Adenovirus de simio con proteínas de la cápside hexónica de SAdV-46 y usos del mismo.

Un adenovirus recombinante que tiene una cápside que comprende una proteína hexónica seleccionada de: una proteína hexónica que comprende los aminoácidos 1 a 959 de la SEC ID N.º: 79

(SAdV-46); una proteína hexónica que comprende un fragmento de la proteína hexónica de SAdV que consiste en la SEC ID N.º: 79 con un truncamiento N-terminal o C-terminal de 50 aminoácidos de longitud; y una proteína hexónica que comprende un fragmento de la SEC ID N.º: 79 que consiste en los residuos de aminoácidos 138 a 163, los residuos de aminoácidos 138 a 441, o los residuos de aminoácidos 125 a 443;

una proteína pentónica; y

una proteína de fibra;

encapsidando dicha cápside una molécula heteróloga portadora de un gen unido operativamente a secuencias de control de la expresión que dirigen la transcripción, traducción y / o expresión del mismo en una célula huésped y elementos cis de adenovirus en 5' y 3' necesarios para la replicación y la encapsidación, comprendiendo dichos elementos cis una repetición terminal invertida de adenovirus en 5' y una repetición terminal invertida de adenovirus en 3'.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2009/062548.

Solicitante: THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 3160 CHESTNUT STREET, SUITE 200 PHILADELPHIA, PA 19104 ESTADOS UNIDOS DE AMERICA.

Inventor/es: WILSON, JAMES M., ROY,SOUMITRA, VANDENBERGHE,LUC H.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > C12N7/00 (Virus, p. ej. bacteriófagos; Composiciones que los contienen; Su preparación o purificación (preparaciones de uso médico que contienen virus A61K 35/76; preparación de composiciones de uso médico que contienen antígenos o anticuerpos virales, p. ej. vacunas virales, A61K 39/00))
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/861 (Vectores adenovirales)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Adenovirus de simio con proteínas de la cápside hexónica de SAdV-46 y usos del mismo Antecedentes de la invención El adenovirus es un virus de ADN bicatenario con un tamaño de genoma de aproximadamente 36 kilobases (kb), que se ha usado ampliamente para aplicaciones de transferencia génica debido a su capacidad para alcanzar una transferencia génica altamente eficiente en diversos tejidos diana y gran capacidad de transgenes.

Convencionalmente, los genes E1 del adenovirus se eliminan y sustituyen con un casete de transgén que consiste en el promotor de elección, la secuencia de ADNc del gen de interés y una señal de poli A, que tiene como resultado un virus recombinante con replicación defectuosa.

Los adenovirus tienen una morfología característica con una cápside icosaédrica que consiste en tres proteínas principales, hexón (II), base pentón (III) y una fibra nudosa (IV), junto con una serie de otras proteínas minoritarias VI, VIII, IX, IIIa y IVa2 [W.C. Russell, J. Gen Virol., 81:2573-2604 (Nov 2000)]. El genoma del virus es un ADN bicatenario lineal con una proteína terminal unida covalentemente al extremo 5’, que tiene repeticiones terminales invertidas (ITR). El ADN del virus está asociado íntimamente con la proteína VIII altamente básica y un pequeño péptido pX (antes denominado mu). Otra proteína, V, está empaquetada con este complejo de ADN-proteína y proporciona un enlace estructural con la cápside a través de la proteína VI. El virus contiene también una proteasa codificada por el virus, que es necesaria para el procesamiento de algunas de las proteínas estructurales para producir virus infecciosos maduros.

Se ha desarrollado un esquema de clasificación para la familia Mastadenovirus, que incluye adenovirus humanos, simios, bovinos, equinos, porcinos, ovinos, caninos y de zarigüeya. Este esquema de clasificación se desarrolló en base a las diferentes capacidades de las secuencias de adenovirus en la familia para aglutinar los glóbulos rojos de la sangre. El resultado fue seis subgrupos, ahora conocidos como subgrupos A, B, C, D, E y F. Véase, T. Shenk et al., Adenoviridae: The Viruses and their Replication", Cap. 67, en FIELD’S VIROLOGY, 6ª Ed., editado por B.N Fields et al., (Lippincott Raven Publishers, Filadelfia, 1996), p. 111-2112.

Se han descrito adenovirus recombinantes para la liberación de moléculas heterólogas a las células huésped. Véase, la patente de Estados Unidos 6.083.716, que describe el genoma de dos adenovirus de chimpancé. Los adenovirus de simio, C5, C6 y C7, se han descrito en la patente de Estados Unidos N.º: 7.247.472 como útiles como vectores de vacuna. Otros adenovirus de chimpancé se describen en el documento WO 2005/1071093 como útiles para la fabricación de vehículos de vacunas de adenovirus.

Lo que se necesita en la técnica son vectores eficaces que eviten el efecto de la inmunidad preexistente a serotipos de adenovirus seleccionados en la población.

En el presente documento se describen secuencias de ácidos nucleicos aisladas y secuencias de aminoácidos aisladas de adenovirus-43 de simio (gorila) (SADV-43), -45 (SADV-45), -46 (SADV-46), -47 (SADV-47), adenovirus- 48 de simio (macaco de Java) (SADV-48), -49 (SADV-49) y -50 (SADV-50) y vectores que contienen estas secuencias. También se describen numerosos procedimientos para usar los vectores y células que contienen las secuencias de SADV-43, -45, -46, -47, -48, -49, o -50 descritas en el presente documento.

Los procedimientos descritos en el presente documento implican la entrega de uno o más gen(es) heterólogo(s) seleccionados a un paciente mamífero mediante la administración de un vector SADV-43, -45, -46, -47, -48, -49 o - 50. El uso de las composiciones descritas en el presente documento para la vacunación permite la presentación de un antígeno seleccionado para el desencadenamiento de respuestas inmunitarias protectoras. Los vectores basados en el adenovirus de simio 45 también se pueden usar para producir productos de genes heterólogos in vitro. Tales productos génicos son ellos mismos útiles para una diversidad de propósitos tal como se describe en el presente documento.

Sumario de la invención La invención proporciona, en un aspecto, un adenovirus recombinante que tiene una cápside que comprende una proteína hexónica seleccionada de: una proteína hexónica de SAdV-46 que comprende los aminoácidos 1 a 959 de la SEC ID N.º: 79; una proteína hexón que comprende un fragmento de la proteína hexón SAdV que consiste en la SEC ID N.º: 79 con un truncamiento N-terminal o C-terminal de 50 aminoácidos de longitud; y una proteína hexón que comprende un fragmento de SEC ID N.º: 79 que consiste en los residuos de aminoácidos 138 a 163, los residuos de aminoácidos 138 a 441, o los residuos de aminoácidos 125 a 443; una proteína pentón; y una proteína de fibra; encapsidando dicha cápside una molécula heteróloga que porta un gen unido operativamente a secuencias control de la expresión que dirigen la transcripción, la traducción y / o la expresión de la misma en una célula huésped y elementos cis de adenovirus en 5’ y 3’ necesarios para la replicación y encapsidación, comprendiendo dichos elementos cis una repetición terminal invertida en 5’ del adenovirus y una repetición terminal invertida en 3’ del adenovirus. La invención también se extiende a composiciones que comprenden los adenovirus de la invención, en vehículos farmacéuticos.

En otro aspecto, la invención proporciona un vector que comprende un ácido nucleico de adenovirus de simio (SADV) seleccionado del grupo que consiste en: los nucleótidos de SAdV-46 1 a 35608 de SEC ID N.º: 69 y su complementaria.

Estas y otras realizaciones y ventajas de la invención se describen en más detalle más adelante.

Descripción detallada de la invención Se proporcionan secuencias de ácidos nucleicos y de aminoácidos novedosas de los adenovirus de simio 43, 45, 46 y 47, que se aislaron de las heces gorila y de los adenovirus de simio 48, 49 y 50, que se aislaron de heces de macaco de Java. Con respecto al listado de secuencias, cualquier "texto libre" con el identificador numérico <223> se proporciona en una sección que precede a las reivindicaciones denominado TEXTO LIBRE DEL LISTADO DE SECUENCIAS.

También se proporcionan vectores de adenovirus y líneas celulares de empaquetamiento novedosos para producir esos vectores para su uso en la producción in vitro de las proteínas o fragmentos recombinantes u otros reactivos.

Además se proporcionan composiciones para uso en la entrega de una molécula heteróloga para fines terapéuticos o vacunales. Tales composiciones terapéuticas o vacunales contienen los vectores adenovíricos que llevan una molécula heteróloga insertada. Además, las nuevas secuencias de SADV-43, -45, -46, -47, -48, -49 y -50 son útiles para proporcionar las funciones auxiliares esenciales requeridas para la producción de vectores víricos adenoasociados (AAV) recombinantes. Por lo tanto, se proporcionan construcciones auxiliares, procedimientos y líneas celulares que utilizan estas secuencias en tales procedimientos de producción.

La expresión "homología sustancial" o "similitud sustancial", cuando se refiere a un ácido nucleico o fragmento del mismo, indica que, cuando está óptimamente alineado con inserciones o deleciones de nucleótidos adecuadas con otro ácido nucleico (o su cadena complementaria), existe identidad de secuencia de nucleótidos en al menos aproximadamente 95 al 99 % de las secuencias alineadas.

La expresión "homología sustancial" o "similitud sustancial", cuando se refiere a aminoácidos o fragmentos de los mismos, indica que, cuando están óptimamente alineados con inserciones o deleciones adecuadas de aminoácidos con otro aminoácido (o su cadena complementaria), existe identidad de secuencia de aminoácidos en al menos aproximadamente 95 al 99 % de las secuencias alineadas. Preferiblemente, la homología es sobre la secuencia de longitud completa, o una proteína de la misma, o un fragmento de la misma que tiene una longitud de al menos 8 aminoácidos, o, más deseablemente, de al menos 15 aminoácidos. Ejemplos de fragmentos adecuados se describen en el presente documento.

La expresión “porcentaje de identidad de secuencia” o “idéntica” en el contexto de secuencias de ácido nucleico se refiere a los residuos en las dos secuencias que son iguales cuando se alinean para una correspondencia máxima. Cuando se requieren huecos para alinear una secuencia con otra, el grado de puntuación se calcula con respecto a la secuencia más larga sin penalización por huecos. Las secuencias que conservan la funcionalidad del polinucleótido o un polipéptido codificado de ese modo son más estrechamente idénticas. La longitud de la comparación de identidad de secuencia puede ser sobre la longitud completa del genoma (por ejemplo, aproximadamente 36 kpb), se desea la longitud completa de un marco de lectura abierto de un gen, proteína, subunidad, o enzima [véanse, por ejemplo, las tablas que proporcionan las regiones codificantes adenovíricas], o un fragmento de al menos aproximadamente 500 a 5000 nucleótidos. Sin embargo, también puede desearse la identidad entre fragmentos más pequeños, por ejemplo de al menos aproximadamente nueve nucleótidos, habitualmente al menos aproximadamente 20 a 24 nucleótidos, al menos aproximadamente 28 a 32 nucleótidos, al menos aproximadamente 36 o más nucleótidos. Del mismo modo, la "identidad de secuencia en porcentaje" puede determinarse fácilmente para las secuencias de aminoácidos, a lo largo de la longitud completa de una proteína, o un fragmento de la misma. Adecuadamente, un fragmento tiene una longitud de al menos aproximadamente 8 aminoácidos y puede ser de hasta aproximadamente 700 aminoácidos. Ejemplos de fragmentos adecuados se describen en el presente documento.

La identidad se determina fácilmente utilizando este tipo de algoritmos y programas informáticos según se definen en el presente documento con los ajustes predeterminados. Preferiblemente, tal identidad es sobre la longitud completa de la proteína, enzima, subunidad, o sobre un fragmento de al menos aproximadamente 8 aminoácidos de longitud.

Sin embargo, la identidad puede basarse en regiones más cortas, cuando sea adecuado para el uso al que se está poniendo el producto génico idéntico.

Como se describe en el presente documento, las alineaciones se realizan utilizando cualquiera de una diversidad de programas de alineación de múltiples secuencias disponibles pública o comercialmente disponibles, tales como "Clustal W", accesible a través de servidores Web en Internet. Como alternativa, también se utilizan los servicios públicos de Vector NTI® [InVitrogen]. También hay una serie de algoritmos conocidos en la técnica que se pueden utilizar para medir la identidad de secuencia de nucleótidos, incluyendo los contenidos en los programas descritos anteriormente. Como otro ejemplo, las secuencias de polinucleótidos pueden compararse utilizando Fasta, un programa en GCG Versión 6.1. Fasta proporciona alineaciones y el porcentaje de identidad de secuencia de las regiones de la mejor superposición entre las secuencias de consulta y de búsqueda. Por ejemplo, se puede determinar el porcentaje de identidad de secuencia entre secuencias de ácido nucleico usando Fasta con sus parámetros por defecto (un tamaño de letra de 6 y el factor NOPAM para la matriz de puntuación) tal como se proporciona en GCG Versión 6.1. Del mismo modo están disponibles programas para realizar alineaciones de aminoácidos. En general, estos programas se utilizan en los parámetros por defecto, aunque un experto en la técnica puede modificar estos valores según sea necesario. Como alternativa, un experto en la materia puede utilizar otro algoritmo o programa de ordenador que proporcione al menos el nivel de identidad o alineación como el proporcionado por los algoritmos y programas a los que se hace referencia.

"Recombinante", tal como se aplica a un polinucleótido, significa que el polinucleótido es el producto de diversas combinaciones de etapas de clonación, restricción o ligación y otros procedimientos que dan como resultado una construcción que es distinta de un polinucleótido encontrado en la naturaleza. Un virus recombinante es una partícula vírica que comprende un polinucleótido recombinante. Los términos incluyen, respectivamente, réplicas de la construcción polinucleotídica original y la progenie de la construcción del virus original.

"Heterólogo" significa derivado de una entidad genotípicamente distinta de la del resto de la entidad con la que se está comparando. Por ejemplo, un polinucleótido introducido mediante técnicas de ingeniería genética en un plásmido o vector derivado de una especie diferente es un polinucleótido heterólogo. Un promotor eliminado de su secuencia codificante nativa y unido operativamente a una secuencia codificante con la que no se encuentra unido de forma natural es un promotor heterólogo. Un sitio de recombinación específico de sitio que se ha clonado en un genoma de un virus o vector vírico, en el que el genoma del virus no lo contiene naturalmente, es un sitio de recombinación heteróloga. Cuando un polinucleótido con una secuencia de codificación para una recombinasa se utiliza para modificar genéticamente una célula que normalmente no expresa la recombinasa, tanto el polinucleótido como la recombinasa son heterólogos para la célula.

Como se usa a lo largo de esta memoria descriptiva y las reivindicaciones, el término "comprenden" y sus variantes incluyendo "comprende", "que comprende", entre otras variantes, incluye componentes, elementos, números enteros, etapas y similares. El término "consiste en" o "que consiste en" son exclusivos de otros componentes, elementos, números enteros, etapas y similares.

I. Las secuencias de adenovirus de simio Las secuencias de ácidos nucleicos y aminoácidos de adenovirus de simio -43 (SADV-43), -45, - 46, -47, -48, -49 o - 50 se proporcionan en el Listado de Secuencias. Estos adenovirus y sus secuencias se aíslan del otro material al que están asociados en la naturaleza. SAdV-48, -49 y -50 se aislaron de macaco de Java.

SAdV-43 y SAdV-45 se aislaron de gorila y se ha determinado que están en el mismo subgrupo que el subgrupo humano C. SAdV-46 y SAdV-47 se aislaron de gorila y se ha determinado que están en el mismo subgrupo que el subgrupo humano B. Por tanto, SAdV-43, -45, -46 y -47 y las construcciones basadas en sus secuencias pueden ser útiles para inducir o expresar citocinas/quimiocinas, incluyendo IFNα, IL-6, RANTES y MIP1α.

SAdV-48, -49 y -50 no encajan fácilmente en ninguna de las familias de adenovirus existentes A, B, C, D o E. SAdV- 48, -49 y -50 son más serológicamente e inmunológicamente distintas de los adenovirus dentro de estas familias y vectores derivados de estos adenovirus y por tanto se prevé que sea menos probable que se enfrenten a inmunidad preexistente en las poblaciones humanas. Además, se prevé que SAdV-48, -49 y -50 son de utilidad para la evaluación de antígenos en las especies de primates no humanos y no chimpancés, incluyendo, por ejemplo, monos rhesus y de Java. Esto es particularmente útil cuando no están disponibles modelos humanos y de chimpancés por cualquier diversidad de razones.

A. Secuencias de ácidos nucleicos. Las secuencias de ácidos nucleicos SAdV-43 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 37189 de la SEC ID N.º: 1. Las secuencias de ácidos nucleicos SAdV-45 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 37152 de la SEC ID N.º: 38. Las secuencias de ácidos nucleicos SAdV-45 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 35608 de la SEC ID N.º: 69. Las secuencias de ácidos nucleicos SAdV-47 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 35563 de la SEC ID N.º: 99. Las secuencias de ácidos nucleicos SAdV-48 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 34201 de la SEC ID N.º: 129. Las secuencias de ácidos nucleicos SAdV-49 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 35499 de la SEC ID N.º: 157. Las secuencias de ácidos nucleicos SAdV-50 proporcionadas en el presente documento incluyen los nucleótidos de 1 a 35512 de la SEC ID N.º: 183. Véase el listado de secuencias. Las secuencias de ácidos nucleicos de SADV-43, -45, -46, -47, -48, -49 y -50 pueden abarcar adicionalmente la hebra que es complementaria a las secuencias de SEC ID N.ºs: 1, 38, 69, 99, 129, 157 Y 183, respectivamente, así como las secuencias de ARN y ADNc correspondientes a las secuencias de las siguientes secuencias y sus cadenas complementarias. Las secuencias de ácidos nucleicos pueden abarcar además secuencias que son más del 98,5 % idénticas y preferiblemente, más de aproximadamente el 99 % idénticas, al Listado de Secuencias. También se incluyen en una alternativa las variantes naturales y las modificaciones de ingeniería de las secuencias proporcionadas en las SEC ID N.ºs: 1, 38, 69, 99, 129, 157 y 183 y sus cadenas complementarias. Tales modificaciones incluyen, por ejemplo, marcadores que se conocen en la técnica, metilación y sustitución de uno o más de los nucleótidos de origen natural con un nucleótido degenerado.

En ciertas alternativas tales como en los vectores adenovíricos derivados de estas secuencias, la función de una o ambas de estas regiones se puede eliminar, por ejemplo, mediante deleción de la región, destrucción del promotor para el gen, u otra deleción funcional. Sin embargo, en otras alternativas, puede desearse la retención de estas regiones.

En una alternativa, se proporcionan fragmentos de las secuencias de SAdV-43, -45, -46, -47, – 48, -49 y -50 y sus cadenas complementarias, ADNc y ARN complementarios a los mismos. Los fragmentos adecuados tienen una longitud de al menos 15 nucleótidos y abarcan fragmentos funcionales, es decir, fragmentos que son de interés biológico. Por ejemplo, un fragmento funcional puede expresar un producto adenovírico deseado o puede ser útil en la producción de vectores víricos recombinantes. Tales fragmentos incluyen las secuencias de genes y fragmentos listados en las tablas en el presente documento. Las tablas proporcionan las regiones de transcripción y los marcos de lectura abierta en las secuencias de SAdV-43, -45, -46, -47, -48, -49 y -50. Para ciertos genes, los transcritos y los marcos de lectura abierta (ORF) se encuentran en la cadena complementaria a la presentada en la SEC ID N.º: 1. Véanse, por ejemplo, E2b, E4 y E2a. También se muestran los pesos moleculares calculados de las proteínas codificadas. Téngase en cuenta que los marcos de lectura abierta de E1a y los marcos de lectura abierta E2b de SADV-43, -45, -46, -47, -48, -49 y -50 contienen sitios de corte y empalme internos. Estos sitios de corte y empalme se indican en la tabla anterior.

La secuencias de ácidos nucleicos adenovíricos de SAdV-43, -45, -46, -47, -48, -49 y -50 son útiles como agentes terapéuticos y en la construcción de una diversidad de sistemas de vectores y células huésped. Tal como se usa en el presente documento, un vector incluye cualquier molécula de ácido nucleico adecuada incluyendo ADN desnudo, un plásmido, un virus, un cósmido, o un episoma. Estas secuencias y productos pueden usarse solos o en combinación con otras secuencias adenovíricas o fragmentos, o en combinación con elementos de otras secuencias adenovíricas o no adenovíricas. Las secuencias de SADV-43, -45, -46, -47, -48, -49 y -50 también son útiles como vectores de liberación antisentido, vectores de terapia génica o vectores de vacunas. Por lo tanto, además se proporcionan moléculas de ácidos nucleicos, vectores liberación de genes y células huésped que contienen las secuencias de SAdV-43, -45, -46, -47, – 48, -49 y -50.

Un ejemplo es una molécula de ácido nucleico que contiene las secuencias ITR de AdV de simio (SAdV) -43, -45, - 46, -47, -48, -49 y -50. Otro ejemplo es una molécula de ácido nucleico que contiene las secuencias de SAdV-43, - 45, -46, -47, -48, -49 y -50 que codifican un producto génico de Ad deseado. Todavía otra molécula de ácido nucleico más construida usando las secuencias de SAdV-43, -45, -46, -47, -48, -49 y -50 será fácilmente evidente para un experto en la técnica, en vista de la información proporcionada en el presente documento.

En una realización, las regiones de gen de Ad de simio identificadas en el presente documento se pueden usar en una diversidad de vectores para la entrega de una molécula heteróloga a una célula. Por ejemplo, se generan vectores para la expresión de una proteína de la cápside adenovírica (o fragmento de la misma) para los fines de generar un vector vírico en una célula huésped de empaquetamiento. Tales vectores pueden diseñarse para la expresión en trans. Como alternativa, dichos vectores están diseñados para proporcionar células que contengan de manera estable secuencias que expresen las funciones adenovíricas deseadas, por ejemplo, uno o más de E1a, E1b, las secuencias de repetición terminales, región E2a, E2b, E4, E4ORF6.

Además, las secuencias de genes adenovíricos y fragmentos de los mismos son útiles para proporcionar las funciones auxiliares necesarias para la producción de virus auxiliares dependientes (por ejemplo, vectores adenovíricos que carecen de las funciones esenciales, o virus adenoasociados (AAV)). Para tales procedimientos de producción, las secuencias de SADV-43, -45, -46, -47, -48, -49 y -50 pueden usarse en un procedimiento de este tipo de una manera similar a las descritas para el Ad humano. Sin embargo, debido a las diferencias en las secuencias entre las secuencias de SAdV-43, -45, -46, -47, -48, -49 y -50 y las de Ad humano, el uso de las secuencias de SAdV-43, -45, -46, -47, -48, -49 y -50 minimiza considerablemente o elimina la posibilidad de recombinación homóloga con funcionas auxiliares en una célula huésped que porta las funciones de Ad E1, por ejemplo células 293, lo que puede producir contaminantes adenovíricos infecciosos durante la producción de rAAV.

Los procedimientos para producir rAAV utilizando funciones auxiliares adenovíricas se han descrito ampliamente en la literatura con los serotipos de adenovirus humanos. Véanse, por ejemplo, la patente de Estados Unidos 6.258.595 y las referencias citadas en la misma. Véanse, también, la patente de Estados Unidos 5.871.982; el documento WO 99/14354; el documento WO 99/15685; el documento WO 99/47691. Estos procedimientos también se pueden utilizar en la producción de AAV de serotipo no humano, incluidos los serotipos de AAV de primates no humanos. Las secuencias de SAdV-43, -45, -46, -47, – 48, -49 y -50 que proporcionan las funciones auxiliares necesarias (por ejemplo, ORF6 de E1a, E1b, E2a y / o E4) pueden ser particularmente útiles para proporcionar la función adenovírica necesaria al tiempo que se reduce al mínimo o se elimina la posibilidad de recombinación con cualesquiera otros adenovirus presentes en la célula de empaquetamiento de rAAV que son típicamente de origen humano. Por tanto, los genes seleccionados o marcos de lectura abiertos de las secuencias de SAdV-43, -45, -46, -47, -48, -49 y -50 pueden usarse en estos procedimientos de producción de rAAV.

Como alternativa, los vectores recombinantes de SAdV-43, -45, -46, -47, -48, -49 y -50 pueden usarse en estos procedimientos Tales vectores de simio adenovíricos recombinantes pueden incluir, por ejemplo, un Ad/AAV híbrido de simio en el que las secuencias de Ad de simio flanquean un casete de expresión de rAAV compuesto de, por ejemplo, AAV 3 ' y / o ITR en 5' y un transgén sometido al control de secuencias reguladoras que controlan su expresión. Un experto en la técnica reconocerá que todavía otros vectores adenovíricos de simio y / o las secuencias génicas de SAdV-43, -45, -46, -47, -48, -49 y -50 serán útiles para la producción de rAAV y otros virus dependientes del auxiliar adenovírico.

En todavía otra alternativa, las moléculas de ácidos nucleicos están diseñadas para la liberación y la expresión de productos génicos adenovíricos seleccionados en una célula huésped para lograr un efecto fisiológico deseado. Por ejemplo, una molécula de ácido nucleico que contiene secuencias que codifican una proteína SAdV-43, -45, -46, -47, -48, -49 o -50 E1a se puede administrar a un sujeto para su uso como una terapéutica para el cáncer. Opcionalmente, dicha molécula se formula en un vehículo a base de lípidos y preferentemente se dirige a las células cancerosas. Tal formulación se puede combinar con otras terapias contra el cáncer (por ejemplo, cisplatino, taxol, o similares). Todavía otros usos para las secuencias adenovíricas proporcionadas en el presente documento serán fácilmente evidentes para un experto en la técnica.

Además, un experto en la técnica entenderá fácilmente que las secuencias de SAdV-43, – 45, -46, -47, -48, -49 y -50 pueden adaptarse fácilmente para su uso para una diversidad de sistemas de vectores víricos y no víricos para la entrega in vitro, ex vivo o in vivo de moléculas terapéuticas e inmunógenas. Por ejemplo, las secuencias de Ad de simio SAdV-43, -45, -46, -47, -48, -49 y -50 pueden usarse en una diversidad de sistemas de vectores rAd y no-rAd. Dichos sistemas de vectores pueden incluir, por ejemplo, plásmidos, lentivirus, retrovirus, poxvirus, virus de la vacuna y sistemas víricos adenoasociados, entre otros. La selección de estos sistemas de vectores no es una limitación de la presente invención.

También se proporcionan moléculas útiles para la producción de las proteínas de simios y las proteínas derivadas de simios de la invención. Tales moléculas que portan polinucleótidos incluidas las secuencias de ADN de SAdV-43, - 45, -46, -47, -48, -49 o -50 pueden estar en forma de ADN desnudo, de un plásmido, de un virus o de cualquier otro elemento genético.

B. Proteínas adenovíricas Se describen los adenovirus SAdV-43, -45, -46, -47, -48, -49 y -50, tales como proteínas, enzimas y fragmentos de los mismos, que están codificadas por los ácidos nucleicos adenovíricos descritos en el presente documento.

También son de interés las proteínas de SAdV-43, -45, -46, -47, -48, -49 y -50, enzimas y fragmentos de las mismas, que tienen las secuencias de aminoácidos codificadas por estas secuencias de ácidos nucleicos que se generan por otros procedimientos. Tales proteínas incluyen las codificadas por los marcos de lectura abiertos identificados en la tabla anterior, las proteínas en la siguiente tabla (también mostradas en el listado de secuencias) y los fragmentos de las mismas de las proteínas y polipéptidos.

Así, en una alternativa, se proporcionan proteínas de adenovirus de simio únicas 43, -45, -46, -47, -48, -49 y -50 que son sustancialmente puras, es decir, están libres de otras proteínas víricas y proteináceas. Preferiblemente, estas proteínas son al menos homogéneas al 10 %, más preferiblemente homogéneas al 60 % y lo más preferiblemente homogéneas al 95 %.

En una alternativa, se proporcionan proteínas de la cápside derivada de simio únicas. Como se usa en el presente documento, una proteína de la cápside derivada de simio incluye cualquier proteína de la cápside adenovírica que contiene una proteína de la cápside SAdV-43, -45, -46, -47, -48, -49 o -50 o un fragmento de la misma, incluyendo, sin limitación, proteínas quiméricas de la cápside, proteínas de fusión, proteínas artificiales de la cápside, proteínas sintéticas de la cápside y proteínas recombinantes de la cápside, sin limitación a los medios de generar estas proteínas.

Adecuadamente, estas proteínas de la cápside derivadas de simio contienen una o más regiones de SAdV-43, -45, - 46, -47, -48, -49 o -50 o fragmentos de las mismas (por ejemplo, un hexón, pentón, fibra, o fragmento de los mismos) en combinación con las regiones de la cápside o fragmentos de las mismas de diferentes serotipos adenovíricos, o proteínas o fragmentos de la cápside de simio modificados, como se describe en el presente documento. Una "modificación de una proteína de la cápside asociada con tropismo alterado" tal como se utiliza en el presente documento incluye una proteína alterada de la cápside, es decir, una región de pentón, hexón o proteína de fibra, o fragmento de las mismas, tal como el dominio de nudo de la región de la fibra, o un polinucleótido que codifica los mismos, de forma que se altera la especificidad. La cápside derivada de simio puede construirse con uno o más de los serotipos de simio SAdV-43, -45, -46, -47, -48, -49 o -50 u otro setotipo de Ad que puede ser de origen humano o no humano. Dicho Ad puede obtenerse a partir de una diversidad de fuentes, incluyendo la ATCC, fuentes comerciales y académicas, o las secuencias del Ad pueden obtenerse de GenBank u otras fuentes adecuadas.

Se proporcionan las secuencias de aminoácidos de las proteínas pentónicas de SAdV-43 [SEC ID N.º: 6], SAdV-45 [SEC ID N.º: 43], SAdV-46 [SEC ID N.º: 74], SAdV-47 [SEC ID N.º: 104], SAdV-48 [SEC ID N.º: 134], SAdV-49 [SEC ID N.º: 162] y SAdV-50 [SEC ID N.º: 188]. Adecuadamente, la proteína pentónica, o fragmentos únicos de la misma, puede usarse para una diversidad de fines. Ejemplos de fragmentos adecuados incluyen el pentón que tiene truncamientos en N-terminal y / o en C-terminal de aproximadamente 50, 100, 150, o 200 aminoácidos, en base a la numeración de aminoácidos proporcionada anteriormente y en las SEC ID N.ºs: 6, 43, 74, 104, 134, 162 o 188. Otros fragmentos adecuados incluyen fragmentos más cortos internos, C-terminales o N-terminales. Además, la proteína pentónica puede modificarse para una diversidad de fines conocidos por los expertos en la materia.

Se proporcionan las secuencias de aminoácidos de las proteínas hexónicas SAdV-43 [SEC ID N.º: 11], SAdV-45 [SEC ID N.º: 48], SAdV-46 [SEC ID N.º: 79], SAdV-47 [SEC ID N.º: 109], SAdV-48 [SEC ID N.º: 139], SAdV-49 [SEC ID N.º: 167] y SAdV-50 [SEC ID N.º: 193]. Adecuadamente, la proteína hexónica, o fragmentos únicos de la misma, pueden usarse para una diversidad de fines. Ejemplos de fragmentos adecuados incluyen el hexón que tiene truncamientos N-terminales y / o C-terminales de aproximadamente 50, 100, 150, 200, 300, 400, o 500 aminoácidos, en base a la numeración de aminoácidos proporcionada anteriormente y en las SEC ID N.ºs: 11, 48, 79, 109, 139, 167 y 193. Otros fragmentos adecuados incluyen fragmentos más cortos internos, C-terminales o N-terminales. Por ejemplo, un fragmento adecuado la región del bucle (dominio) de la proteína hexónica, designado DEI y FG1, o una región hipervariable de la misma. Tales fragmentos incluyen las regiones que abarcan los residuos de aminoácidos de aproximadamente 125 a 443; de aproximadamente 138 a 441, o fragmentos más pequeños, tales como los que abarcan aproximadamente del residuo 138 hasta el residuo 163; de aproximadamente 170 a aproximadamente 176; de aproximadamente 195 a aproximadamente 203; de aproximadamente 233 a aproximadamente 246; de aproximadamente 253 a aproximadamente 264; de aproximadamente 287 a aproximadamente 297; y de aproximadamente 404 a aproximadamente 430 de las proteínas hexónicas de simio, con referencia a las SEC ID N.ºs: 11, 48, 79, 109, 139, 167 o 193. Otros fragmentos adecuados pueden identificarse fácilmente por un experto en la técnica. Además, la proteína hexónica puede modificarse paras una diversidad de fines conocidos por los expertos en la técnica. Debido a que la proteína hexónica es el factor determinante para el serotipo de un adenovirus, tales proteínas hexónicas artificiales darían lugar a adenovirus que tienen serotipos artificiales. Otras proteínas artificiales de la cápside también pueden construirse usando las secuencias pentónicas 11, 48, 79, 109, 139, 167 y / o 193 y / o las secuencias pentónicas y/o las secuencias de fibra y / o fragmentos de las mismas.

En una alternativa, se puede generar un adenovirus que tiene una proteína hexónica alterada utilizando las secuencias de una proteína hexónica de SAdV-43, -45, -46, -47, -48, -49 o -50. Un procedimiento adecuado para alterar las proteínas hexónicas se describe en la patente de EE.UU. 5.922.315. En este procedimiento, al menos una región de bucle del hexón del adenovirus se cambia con al menos una región de bucle de otro serotipo de adenovirus. Por lo tanto, al menos una región de bucle de una proteína hexónica de adenovirus alterada tal es una región de bucle hexónica de Ad de simio de SAdV-43, -45, -46, -47, -48, – 49 o -50. En una alternativa, una región de bucle de la proteína hexónica de SAdV-43, -45, -46, -47, -48, -49 o -50 se sustituye por una región de bucle de otro serotipo de adenovirus. En otra alternativa, la región del bucle del hexón de SAdV-43, -45, -46, -47, -48, -49 o - 50 se utiliza para sustituir una región de bucle de otro serotipo de adenovirus. Los serotipos de adenovirus adecuados pueden seleccionarse fácilmente de entre los serotipos humanos y no humanos, como se describe en el presente documento. La selección de un serotipo adecuado no es una limitación de la presente invención. Aún otros usos para las secuencias de la proteína hexónica de SAdV-43, -45, -46, -47, -48, -49 y -50 serán fácilmente evidentes para los expertos en la técnica.

Se proporcionan las secuencias de aminoácidos de las proteínas de fibra de SAdV-43 [SEC ID N.º: 22], SAdV-45 [SEC ID N.º: 59], SAdV-46 [SEC ID N.º: 89], SAdV-47 [SEC ID N.º: 119] y SAdV-48 [SEC ID N.º: 147]. SAdV-49 y SAdV-50 tienen cada una dos proteínas de fibra. Las proteínas de fibra 1 y 2 de SADV-49 tienen la secuencia de aminoácidos de SEC ID N.ºs: 174 y 175, respectivamente. Las proteínas de fibra 1 y 2 de SADV-50 tienen la secuencia de aminoácidos de SEC ID N.ºs: 201 y 200, respectivamente. Adecuadamente, estas proteínas de la fibra, o fragmentos únicos de las mismas, pueden usarse para una diversidad de fines. Un fragmento adecuado es el nudo de la fibra. Ejemplos de otros fragmentos adecuados incluyen la fibra que tiene truncamientos en N-terminal y / o en C-terminal de aproximadamente 50, 100, 150, o 200 aminoácidos, en base a la numeración de aminoácidos proporcionada en las SEC ID N.ºs: 22, 59, 89, 119, 147, 174, 175, 200 y 201. Aún otros fragmentos adecuados incluyen fragmentos internos. Además, la proteína de fibra puede modificarse usando una diversidad de técnicas conocidas por los expertos en la materia.

Los fragmentos únicos de las proteínas de SAdV-43, -45, -46, -47, -48, -49 y -50 son de una longitud de al menos 8, al menos 15, o al menos 20 aminoácidos. Sin embargo, fragmentos de otras longitudes deseadas pueden usarse fácilmente. Además, en el presente documento se proporcionan modificaciones como se pueden introducir para mejorar el rendimiento y / o la expresión de un producto génico de SAdV-43, -45, -46, -47, -48, -49 o -50, por ejemplo, la construcción de una molécula de fusión en la que la totalidad o un fragmento del producto génico de SAdV-43, -45, -46, –47, -48, -49 o -50 se fusiona (ya sea directamente o mediante un enlazador) con una pareja de fusión para potenciar. Otras modificaciones adecuadas incluyen, sin limitación, el truncamiento de una región de codificación (por ejemplo, una proteína o enzima) para eliminar una pre o pro-proteína normalmente escindida y para proporcionar la proteína madura o enzima y / o mutación de una región de codificación para proporcionar un producto génico secretable. Aún otras modificaciones serán fácilmente evidentes para un experto en la técnica. Además se abarcan proteínas que tienen una identidad de al menos aproximadamente el 99 % con las proteínas de SAdV-43, -45, -46, -47, -48, -49 o -50 proporcionadas en el presente documento.

Como se describe en el presente documento, los vectores que contienen las proteínas de la cápside adenovírica de SAdV-43, -45, -46, -47, -48, -49 o -50 son particularmente muy adecuados para su uso en aplicaciones en las que los anticuerpos neutralizantes disminuyen la efectividad de otros vectores basados en el serotipo de Ad, así como otros vectores víricos. Los vectores rAd son particularmente ventajosos en readministración para repetir la terapia génica o para reforzar la respuesta inmunitaria (títulos de vacunas).

En ciertas circunstancias, puede ser deseable utilizar uno o más de los productos génicos de SAdV-43, -45, -46, -47, -48, -49 o -50 (por ejemplo, una proteína de la cápside o un fragmento de la misma) para generar un anticuerpo. El término "un anticuerpo", como se usa en el presente documento, se refiere a una molécula de inmunoglobulina que es capaz de unirse específicamente a un epítopo. Los anticuerpos pueden existir en diversas formas incluyendo, por ejemplo, anticuerpos policlonales de alta afinidad, anticuerpos monoclonales, anticuerpos sintéticos, anticuerpos quiméricos, anticuerpos recombinantes y anticuerpos humanizados. Tales anticuerpos se originan a partir de las clases de inmunoglobulinas IgG, IgM, IgA, IgD e IgE.

Tales anticuerpos pueden generarse usando cualquiera de una serie de procedimientos conocidos en la técnica. Los anticuerpos adecuados se pueden generar mediante técnicas convencionales bien conocidas, por ejemplo, Kohler y Milstein y las muchas modificaciones conocidas de las mismas. Se generan títulos altos de anticuerpos deseables de forma similar mediante la aplicación de técnicas recombinantes conocidas a los anticuerpos monoclonales o policlonales desarrollados para estos antígenos [véanse, por ejemplo, la solicitud de patente PCT N.º: PCT / GB85 / 00392; la publicación de solicitud de patente británica N.º: GB2188638A; Amit et al., 1986 Science, 233: 747-753; Queen et al., 1989 Proc. Nat’l. Acad. Sci. EE.UU., 86:10029-10033; la solicitud de patente PCT N.º: PCT/WO9007861; y Riechmann et al., Nature, 332:323-327 (1988); Huse et al., 1988a Science, 246:1275-1281]. Como alternativa, los anticuerpos pueden producirse mediante la manipulación de las regiones determinantes de la complementariedad de anticuerpos animales o humanos frente a SAdV-43, -45, -46, -47, -48, -49 o -50, o una proteína u otros fragmento de la misma. Véanse, por ejemplo, E. Mark y Padlin, "Humanization of Monoclonal Antibodies", Capítulo 4, The Handbook of Experimental Pharmacology, Vol. 113, The Pharmacology of Monoclonal Antibodies, Springer-Verlag (junio, 1994); Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. EE.UU. 85:5879-5883; y Bird et al., 1988, Science 242:423-426. También se proporcionan anticuerpos anti-idiotipo (Ab2) y anticuerpos anti-anti-idiotipo (Ab3). Véase, por ejemplo, M.

Wettendorff et al., "Modulation of anti-tumor immunity by anti-idiotypic antibodies." En Idiotypic Network and Diseases, ed. de J. Cerny y J. Hiernaux, 1990 J. Am. Soc. Microbiol., Washington DC: páginas 203-229]. Estos anticuerpos anti-idiotipo y anti-anti-idiotipo se producen utilizando técnicas bien conocidas por los expertos en la materia. Estos anticuerpos pueden usarse para una diversidad de fines, incluyendo procedimientos y kits de diagnóstico y clínicos.

En ciertas circunstancias, puede ser deseable introducir un marcador detectable o una etiqueta sobre un producto génico de SAdV-43, -45, -46, -47, -48, -49 o -50, u otra construcción. Tal como se usa en el presente documento, un marcador detectable es una molécula que es capaz, por sí sola o tras la interacción con otra molécula, de proporcionar una señal detectable. Lo más deseablemente, el marcador es detectable visualmente, por ejemplo, mediante fluorescencia, para su fácil uso en los análisis de inmunohistoquímica o microscopia de inmunofluorescencia. Por ejemplo, los marcadores adecuados incluyen isotiocianato de fluoresceína (FITC), ficoeritrina (PE), aloficocianina (APC), colorantes de corifosfina-O (CPO) o en tándem, PE-cianina-5 (PC5) y PE-rojo Texas (ECD). Todos estos colorantes fluorescentes están disponibles comercialmente y sus usos se conocen en la técnica. Otros marcadores útiles incluyen un marcador de oro coloidal. Aún otros marcadores útiles más incluyen compuestos o elementos radiactivos. Además, los marcadores incluyen una diversidad de sistemas enzimáticos que operan para revelar una señal colorimétrica en un ensayo, por ejemplo, glucosa oxidasa (que utiliza glucosa como sustrato) libera peróxido como un producto que en presencia de peroxidasa y un donante de hidrógeno tal como tetrametil bencidina (TMB), produce un TMB oxidado que se ve como un color azul. Otros ejemplos incluyen peroxidasa de rábano picante (HRP), fosfatasa alcalina (AP) y hexocinasa junto con glucosa-6-fosfato deshidrogenasa que reacciona con ATP, glucosa y NAD + para producir, entre otros productos, NADH que se detecta como una absorbancia incrementada a la longitud de onda de 340 nm.

Otros sistemas de marcadores que se utilizan en los procedimientos descritos en el presente documento son detectables por otros medios, por ejemplo, micropartículas de látex coloreadas [Bangs Laboratories, Indiana] en las que un colorante está incluido se usan en lugar de enzimas para formar conjugados con las secuencias diana proporcionan una señal visual indicativa de la presencia del complejo resultante en ensayos aplicables.

Los procedimientos para acoplar o asociar el marcador con una molécula deseada son igualmente convencionales y se conocen por los expertos en la técnica. Se describen los procedimientos conocidos de unión del marcador [véanse, por ejemplo, Handbook of Fluorescent probes and Research Chemicals, 6ª Ed., R. P. M. Haugland, Molecular Probes, Inc., Eugene, OR, 1996; Pierce Catalog and Handbook, Life Science and Analytical Research Products, Pierce Chemical Company, Rockford, IL, 1994/1995]. Por lo tanto, la selección del marcador y los procedimientos de acoplamiento no limitan la presente invención.

Las secuencias, las proteínas y los fragmentos de SAdV-43, -45, -46, -47, -48, -49 y -50 pueden producirse por cualesquiera medios adecuados, incluyendo producción recombinante, síntesis química, u otros medios de síntesis. Las técnicas de producción adecuadas se conocen bien por los expertos en la técnica. Véase, por ejemplo, Sambrook y col., "Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY). Como alternativa, los péptidos también pueden sintetizarse mediante procedimientos de síntesis de péptidos en fase sólida bien conocidos (Merrifield, J. Am. Chem. Soc., 85:2149 (1962); Stewart and Young, Solid Phase Peptide Synthesis (Freeman, San Francisco, 1969) páginas. 27-62). Estos y otros procedimientos de producción adecuados están dentro del conocimiento de los expertos en la técnica y no son una limitación de la presente invención.

Además, un experto en la técnica entenderá fácilmente que las secuencias de SAdV-43, – 45, -46, -47, -48, -49 y -50 pueden adaptarse fácilmente para su uso para una diversidad de sistemas de vectores víricos y no víricos para la entrega in vitro, ex vivo o in vivo de moléculas terapéuticas e inmunógenas. Por ejemplo, en una alternativa, las proteínas de la cápside de Ad de simio y otras proteínas de adenovirus de simio descritas en el presente documento se utilizan para la entrega no vírica a base de proteínas de genes, proteínas y otras moléculas de diagnóstico, terapéuticas e inmunógenas deseables. En una alternativa de este tipo, una proteína de SAdV-43, -45, -46, -47, -48, -49 o -50 se une, directa o indirectamente, a una molécula para dirigir a las células con un receptor de adenovirus. Preferiblemente, para dicha orientación se selecciona una proteína de la cápside tal como un hexón, pentón, fibra o un fragmento de las mismas que tiene un ligando para un receptor de superficie celular. Las moléculas adecuadas para entrega se seleccionan de entre las moléculas terapéuticas descritas en el presente documento y sus productos génicos. Una diversidad de enlazadores, incluyendo, lípidos, PoliLys y similares pueden usarse como enlazadores.

Por ejemplo, la proteína pentónica de simio se puede utilizar fácilmente para tal propósito mediante la producción de una proteína de fusión usando las secuencias pentónicas de simio de una manera análoga a la descrita en Medina- Kauwe LK, et al., Gene Ther. mayo de 2001; 8(10):795-803 y Medina-Kauwe LK, et al., Gene Ther. diciembre de 2001; 8 (23): 1753-1761. Como alternativa, las secuencias de aminoácidos de la proteína IX de Ad de simio se pueden utilizar para dirigir vectores a un receptor de superficie celular, tal como se describe en la solicitud de patente de EE.UU. 20010047081. Los ligandos adecuados incluyen un antígeno CD40, una secuencia que contiene RGD o polilisina y similares. Todavía otras proteínas de Ad de simio, incluyendo, por ejemplo, la proteína hexónica y / o la proteína de fibra, pueden usarse para estos fines y otros similares.

Todavía otras proteínas adenovíricas de SAdV-43, -45, -46, -47, -48, -49 o -50 se pueden usar solas o en combinación con otra proteína adenovírica para una diversidad de fines que serán evidentes para un experto en la materia. Además, todavía otros usos para las proteínas adenovíricas de SAdV-43, -45, -46, -47, -48, -49 y -50 serán fácilmente evidentes para un experto en la materia.

II. Vectores adenovíricos recombinantes Las composiciones descritas en el presente documento incluyen vectores que liberan una molécula heteróloga a las células, bien para fines terapéuticos o bien para fines vacunales. Como se usa en el presente documento, un vector puede incluir cualquier elemento genético, incluyendo, sin limitaciones, ADN desnudo, un fago, transposón, cósmido, episoma, plásmido, o un virus. Tales vectores contienen ADN de adenovirus de simio de SAdV-43, -45, -46, -47, -48, -49 y/o -50 y un minigén. Por "minigén" se entiende la combinación de un gen heterólogo seleccionado y los otros elementos reguladores necesarios para impulsar la traducción, transcripción y / o expresión del producto génico en una célula huésped.

Típicamente, un vector adenovírico derivado de SAdV está diseñado de tal modo que el minigén está situado en una molécula de ácido nucleico que contiene otras secuencias adenovíricas en la región nativa de un gen adenovírico seleccionado. El minigén puede insertarse en una región del gen existente para interrumpir la función de esa región, si se desea. Como alternativa, el minigén puede insertarse en el sitio de un gen adenovírico parcial o totalmente delecionado. Por ejemplo, el minigén puede localizarse en el sitio de la deleción tal como el sitio de una deleción funcional de E 1 o de una deleción funcional de E3, entre otras que pueden seleccionarse. El término "delecionado funcionalmente" o "deleción funcional" significa que una cantidad suficiente de la región del gen se retira o daña de otro modo, por ejemplo, por mutación o modificación, de modo que la región del gen ya no es capaz de producir productos funcionales de la expresión génica. Si se desea, se puede eliminar toda la región del gen. Otros sitios adecuados para la disrupción o deleción génica se tratan en otras partes de la solicitud.

Por ejemplo, para un vector de producción útil para la generación de un virus recombinante, el vector puede contener el minigén y el extremo 5’ del genoma adenovírico o el extremo 3’ del genoma adenovírico, o ambos extremos 5 'y 3' del genoma adenovírico. El extremo 5 'del genoma adenovírico contiene los elementos cis 5’ necesarios para el empaquetamiento y la replicación; es decir, las secuencias de repetición terminal invertidas en 5' (ITR) (que funcionan como orígenes de replicación) y los dominios potenciadores del empaquetamiento nativos en 5’ (que contienen las secuencias necesarias para el empaquetamiento de los genomas de Ad lineales y los elementos potenciadores para el promotor de E1). El extremo 3’ del genoma adenovírico incluye los elementos cis en 3’ (incluyendo las ITR) necesarios para el empaquetamiento y la encapsidación. De manera adecuada, un adenovirus recombinante contiene elementos cis adenovíricos tanto en 5’ como en 3’ y el minigén se localiza entre las secuencias adenovíricas en 5’ y 3’. Un vector adenovírico basado en SAdV-43, -45, -46, -47, -48, -49 o -50 también puede contener secuencias adenovíricas adicionales de estas u otras fuentes.

Adecuadamente, estos vectores adenovíricos basados en SAdV-43, -45, -46, -47, -48, -49 o -50 contienen uno o más elementos adenovíricos derivados del genoma adenovírico de SAdV-43, – 45, -46, -47, -48, -49 o -50, respectivamente. En una alternativa, los vectores contienen ITR adenovíricas de SAdV-43, -45, -46, -47, -48, -49 o - 50 y secuencias adenovíricas adicionales del mismo serotipo adenovírico. En otra alternativa, los vectores contienen secuencias adenovíricas que derivan de un serotipo adenovírico diferente que el que proporciona las ITR.

Según se define en el presente documento, un adenovirus seudotipado se refiere a un adenovirus en el que la proteína de la cápside del adenovirus es de un adenovirus diferente al adenovirus que proporciona las ITR.

Además, los adenovirus quiméricos o híbridos pueden construirse utilizando los adenovirus descritos en el presente documento usando técnicas conocidas por los expertos en la materia. Véase, por ejemplo, el documento US 7.291.498.

La selección de la fuente adenovírica de los ITR y la fuente de cualesquiera otras secuencias adenovíricas presentes en el vector no es una limitación de la presente invención. Hay diversas cepas de adenovirus disponibles en la Colección Americana de Cultivos Tipo, Manassas, Virginia, o disponibles por solicitud de diversas fuentes comerciales e institucionales. Adicionalmente, las secuencias de muchas de estas cepas están disponibles a partir de una diversidad de bases de datos incluyendo, por ejemplo, PubMed y GenBank. Los vectores de adenovirus homólogos preparados a partir de otros adenovirus de simios o de seres humanos se describen en la bibliografía publicada [véase, por ejemplo, la patente de Estados Unidos N.º: 5.240.846]. Las secuencias de ADN de un número de tipos de adenovirus están disponibles en GenBank, incluyendo el tipo Ad5 [N.º de Acceso en GenBank M73260]. Las secuencias de adenovirus se pueden obtener de cualquier serotipo de adenovirus conocido, tales como los serotipos 2, 3, 4, 7, 12 y 40 e incluyen además cualquiera de los tipos humanos identificados actualmente. Del mismo modo, también se pueden usar adenovirus que se sabe que infectan a animales no humanos (por ejemplo, simios) en las construcciones de vectores. Véase, por ejemplo, la patente de EE.UU. N.º: 6.083.716.

Las secuencias víricas, virus auxiliares (si es necesario) y partículas víricas recombinantes y otros componentes del vector y las secuencias usadas en la construcción de los vectores descritos en el presente documento se obtienen como se ha descrito anteriormente. Las secuencias de ADN de SAdV-43, -45, – 46, -47, -48, -49 y/o -50 se usan para construir vectores y líneas celulares útiles en la preparación de tales vectores.

Se pueden generar modificaciones de las secuencias de ácidos nucleicos que forman los vectores de SAdV-43, -45, -46, -47, -48, -49 y/o -50, incluyendo deleciones, inserciones y otras mutaciones en las secuencias utilizando técnicas estándar de biología molecular y también son de interés.

A. El "minigén" Los procedimientos usados para la selección del transgén, la clonación y construcción del "minigén" y su inserción en el vector vírico están dentro de la experiencia en la técnica dadas las enseñanzas proporcionadas en el presente documento.

1. El transgén El transgén es una secuencia de ácido nucleico heteróloga con respecto a las secuencias del vector que flanquean el transgén, que codifica un polipéptido, proteína, u otro producto, de interés. La secuencia codificante de ácido nucleico está unida operativamente a componentes reguladores de una manera que permite la transcripción, traducción, y / o expresión del transgén en una célula huésped.

La composición de la secuencia transgénica dependerá del uso que se dará al vector resultante. Por ejemplo, un tipo de secuencia transgénica incluye una secuencia indicadora, que tras la expresión produce una señal detectable. Dichas secuencias indicadoras incluyen, sin limitación, secuencias de ADN que codifican β-lactamasa, β- Galactosidasa (LacZ), fosfatasa alcalina, timidina cinasa, proteína fluorescente verde (GFP), cloranfenicol acetiltransferasa (CAT), luciferasa, proteínas unidas a la membrana, incluidas, por ejemplo, CD2, CD4, CD8, la proteína hemaglutinina de la gripe y otras bien conocidas en la técnica, contra las que existen anticuerpos de alta afinidad dirigidos a las mismas o se pueden producir por medios convencionales y proteínas de fusión que comprenden una proteína unida a la membrana fusionada apropiadamente a un dominio de etiqueta antigénico a partir de, entre otras, hemaglutinina o Myc. Estas secuencias de codificación, cuando están asociadas a elementos reguladores que dirigen su expresión, proporcionan señales detectables por medios convencionales, incluyendo ensayos enzimáticos, radiográficos, colorimétricos, de fluorescencia u otros ensayos espectrográficos, ensayos de clasificación celular de activación fluorescente y ensayos inmunológicos, incluyendo el ensayo de inmunoabsorción ligado a enzimas (ELISA ), radioinmunoensayo (RIA) e inmunohistoquímica. Por ejemplo, cuando la secuencia marcadora es el gen LacZ, la presencia del vector portador de la señal se detecta mediante ensayos para determinar la actividad beta-galactosidasa. Cuando el transgén es GFP o luciferasa, el vector que lleva la señal puede medirse visualmente mediante la producción de color de luz en un luminómetro.

En una realización, el transgén es una secuencia no marcadora que codifica un producto que es útil en biología y medicina, tal como proteínas, péptidos, ARN, enzimas, o ARN catalíticos. Moléculas de ARN deseables incluyen ARNt, ARNdc, ARN ribosómico, ARN catalítico y ARN antisentido. Un ejemplo de una secuencia de ARN útil es una secuencia que extingue la expresión de una secuencia de ácido nucleico objetivo en el animal tratado.

El transgén se puede usar para el tratamiento de, por ejemplo, deficiencias genéticas, como terapéutico para cáncer o vacuna, para la inducción de una respuesta inmunitaria y / o con fines de vacuna profiláctica. Como se utiliza en el presente documento, la inducción de una respuesta inmunitaria se refiere a la capacidad de una molécula (por ejemplo, un producto génico) para inducir una respuesta inmunitaria de linfocitos T y/o humoral frente a la molécula.

Se contempla el uso de múltiples transgenes, por ejemplo, para corregir o mejorar una afección causada por una proteína de varias subunidades. En ciertas situaciones, puede usarse un transgén diferente para codificar cada subunidad de una proteína o para codificar diferentes péptidos o proteínas. Esto es deseable cuando el tamaño del ADN que codifica la subunidad de la proteína es grande, por ejemplo, para una inmunoglobulina, el factor de crecimiento derivado de plaquetas, o una proteína distrofina. A fin de que la célula produzca la proteína de múltiples subunidades, una célula se infecta con el virus recombinante que contiene cada una de las diferentes subunidades. Como alternativa, el mismo transgén puede codificar diferentes subunidades de una proteína. En este caso, un solo transgén incluye el ADN que codifica cada una de las subunidades, con el ADN para cada subunidad separado por un sitio interno de entrada para la ribozima (IRES). Esto es deseable cuando el tamaño del ADN que codifica cada una de las subunidades es pequeño, por ejemplo, el tamaño total del ADN que codifica las subunidades y el IRES es menor de cinco kilobases. Como una alternativa a un IRES, el ADN puede estar separado por secuencias que codifican un péptido 2A, que se autoescinde en un acontecimiento postraduccional. Véanse, por ejemplo, M.L. Donnelly, et al., J. Gen. Virol., 78(Pt 1):13-21 (enero 1997); Furler, S., et al,. Gene Ther., 8(11):864-873 (junio 2001); Klump H., et al., Gene Ther., 8(10):811-817 (mayo 2001). Este péptido 2A es significativamente más pequeño que un IRES, lo que lo convierte en muy adecuado para utilizar cuando el espacio es un factor limitante. Sin embargo, el transgén seleccionado puede codificar cualquier producto biológicamente activo u otro producto, por ejemplo, un producto deseable para su estudio.

Un experto en la técnica puede seleccionar transgenes adecuados fácilmente. La selección del transgén no se considera que sea una limitación de esta realización.

2. Elementos reguladores Además de los elementos principales identificados anteriormente para el minigén, el vector también incluye elementos de control convencionales necesarios que están unidos operativamente al transgén de una manera que permite su transcripción, traducción y / o expresión en una célula transfectada con el vector plasmídico o infectada con el virus producido por los procedimientos descritos en el presente documento y / o conocidos por los expertos en la técnica. Un "elemento de control" o "secuencia de control" es una secuencia de nucleótidos implicada en una interacción de moléculas que contribuye a la regulación funcional de un polinucleótido, incluyendo replicación, duplicación, transcripción, corte y empalme, traducción o degradación del polinucleótido. La regulación puede afectar a la frecuencia, la velocidad o la especificidad del proceso y puede ser de naturaleza potenciadora o inhibidora. Los elementos de control se conocen en la técnica y ejemplos de algunos se discuten en otra parte en esta memoria descriptiva. Como se usa en el presente documento, secuencias “operativamente unidas” incluyen tanto secuencias de control de la expresión que son contiguas al gen de interés como secuencias de control de la expresión que actúan en trans o a una distancia para controlar el gen de interés.

Las secuencias de control de la expresión incluyen secuencias adecuadas de iniciación, terminación, promotoras y potenciadoras de la transcripción; señales eficientes del procesamiento de ARN, tales como señales de corte y empalme y de poliadenilación (poli A); secuencias que estabilizan el ARNm citoplasmático; secuencias que potencian la eficiencia de la traducción (es decir, secuencia consenso de Kozak); secuencias que potencian la estabilidad proteica; y cuando se desee, secuencias que potencian la secreción del producto codificado.

En la técnica se conoce un gran número de secuencias de control de la expresión, incluyendo promotores que son nativos, constitutivos, inducibles y / o específicos de tejido y pueden usarse. Los ejemplos de promotores constitutivos incluyen, sin limitaciones, el virus retrovírico del sarcoma de Rous (VSR), el promotor LTR (opcionalmente con el potenciador del VSR), el promotor del citomegalovirus (CMV) (opcionalmente con el potenciador del CMV) [véase, por ejemplo, Boshart et al., Cell , 41: 521 a 530 (1985)], el promotor del SV40, el promotor de la dihidrofolato reductasa, el promotor de la β-actina, el promotor de la fosfoglicerol cinasa (PGK) y el promotor de EF1α [Invitrogen].

Los promotores inducibles permiten la regulación de la expresión génica y pueden estar regulados por compuestos suministrados de forma exógena, factores ambientales tales como la temperatura, o la presencia de un estado fisiológico específico, por ejemplo, fase aguda, un estado de diferenciación particular de la célula, o solo en las células en replicación. Los promotores inducibles y los sistemas inducibles están disponibles a partir de diversas fuentes comerciales, incluyendo, sin limitaciones, Invitrogen, Clontech y Ariad. Se han descrito muchos otros sistemas y un experto en la técnica los puede seleccionar fácilmente. Por ejemplo, los promotores inducibles incluyen el promotor de la metalotionina de oveja (MT) inducible con cinc y el promotor del virus del tumor mamario de ratón (MMTV) inducible por dexametasona (Dex). Otros sistemas inducibles incluyen el sistema del promotor de la polimerasa de T7 [documento WO 98/10088]; el promotor de ecdisona de insectos [No et al., Proc. Natl. Acad. Sci. Natl. Acad. Sci. EE.UU., 93: 3346 hasta 3351 (1996)], el sistema reprimible por tetraciclina [Gossen et al., Proc. Natl.

Acad. Sci. Natl. Acad. Sci. EE.UU., 89: 5.547 a 5.551 (1992)], el sistema inducible por tetraciclina [Gossen et al., Science, 268: 1766 hasta 1769 (1995), véase también Harvey et al., Opin. Chem. Biol., 2:512-518 (1998)]. Otros sistemas incluyen el dímero FK506, VP16 o p65 usando castradiol, difenol murislerona, el sistema inducible por RU486 [Wang et al., Nat. Biotech., 15:239-243 (1997) y Wang et al., Gene Ther., 4:432-441 (1997)] y el sistema inducible por rapamicina [Magari et al., J. Clin. Invest., 100:2865-2872 (1997)]. La eficacia de algunos promotores inducibles aumenta a lo largo del tiempo. En tales casos se puede potenciar la eficacia de tales sistemas insertando varios represores en tándem, por ejemplo, TetR unido a un TetR a través de un IRES. Como alternativa, se puede esperar al menos 3 días antes de rastrear la función deseada. Alguien puede potenciar la expresión de las proteínas deseadas por medios conocidos para potenciar eficacia de este sistema. Por ejemplo, utilizando el elemento regulador postranscripcional del virus de la hepatitis de la marmota (WPRE).

En otra realización, se utilizará el promotor nativo para el transgén. Puede preferirse el promotor nativo cuando se desea que la expresión del transgén imite la expresión nativa. El promotor nativo se puede utilizar cuando la expresión del transgén debe regularse temporalmente o en términos de desarrollo, o de una manera específica de tejido, o en respuesta a estímulos transcripcionales específicos. En una realización adicional, también se pueden usar otros elementos de control de la expresión nativos, tales como elementos potenciadores, sitios de poliadenilación o secuencias de consenso Kozak, para imitar la expresión nativa.

Otra realización del transgén incluye un transgén unido operativamente a un promotor específico de tejido. Por ejemplo, si se desea la expresión en el músculo esquelético, debe usarse un promotor activo en el músculo. Estos incluyen los promotores de genes que codifican la β-actina esquelética, la cadena ligera de la miosina 2A, la distrofina, la creatina cinasa muscular, así como promotores musculares sintéticos con actividades superiores a las de los promotores de origen natural (véase Li et al., Nat. Biotech., 17:241-245 (1999)). Se conocen ejemplos de promotores que son específicos de tejido para hígado (albúmina, Miyatake et al., J. Virol., 71:5124-32 (1997); el promotor del núcleo del virus de la hepatitis B, Sandig et al., Gene Ther., 3:1002-9 (1996); alfa-fetoproteína (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), osteocalcina ósea (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); sialoproteína ósea (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), linfocitos (CD2, Hansal et al., J. Immunol., 161:1063-8 (1998); cadena pesada de la inmunoglobulina; cadena del receptor de linfocitos T), neuronales tales como el promotor de la enolasa específica de neuronas (NSE) (Andersen et al., Mol. Neurobiol., 13:503-15 (1993)), gen de la cadena ligera del neurofilamento (Piccioli et al., Proc. Natl. Acad. Sci. EE.UU., 88:5611-5 (1991)) y el gen vgf específico de neuronas (Piccioli et al., Neuron, 15:373-84 (1995)), entre otros.

Opcionalmente, los vectores portadores de transgenes que codifican productos terapéuticamente útiles o inmunógenos también pueden incluir marcadores seleccionables o genes indicadores pueden incluir secuencias que codifican resistencia a geneticina, higromicina o a purimicina, entre otros. Dichos indicadores seleccionables o genes marcadores (situados preferentemente fuera del genoma vírico para empaquetarse en una partícula vírica) se pueden usar para señalar la presencia de los plásmidos en las células bacterianas, tales como resistencia a la ampicilina. Otros componentes del vector pueden incluir un origen de replicación. La selección de estos y otros promotores y elementos vectoriales son convencionales y muchas de tales secuencias están disponibles [véanse, por ejemplo, Sambrook et al. y las referencias citadas en el mismo].

Estos vectores se generan utilizando las técnicas y secuencias proporcionadas en el presente documento en conjunción con técnicas conocidas por los expertos en la técnica. Tales técnicas incluyen técnicas de clonación convencionales de ADNc tales como las descritas en textos [Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY], el uso de secuencias de oligonucleótidos solapantes de los genomas de adenovirus, reacción en cadena de la polimerasa y cualquier procedimiento adecuado que proporcione la secuencia de nucleótidos deseada.

III. Producción del vector vírico En una realización, los plásmidos adenovíricos de simio (u otros vectores) se utilizan para producir vectores adenovíricos. En una realización, los vectores adenovíricos son partículas adenovíricas que son defectivos en replicación. En una realización, las partículas adenovíricas se convierten en defectivas para la replicación mediante deleciones en los genes E1a y / o E1b. Como alternativa, los adenovirus se convierten en defectivos para la replicación por otros medios, opcionalmente al tiempo que conservan los genes E1a y / o E1b. Los vectores adenoviíricos pueden contener también otras mutaciones en el genoma adenovírico, por ejemplo, mutaciones sensibles a la temperatura o deleciones en otros genes. En otras realizaciones, es deseable retener una región intacta de E1a y / o de E1b en los vectores adenovíricos. Tal región de E1 intacta puede estar situada en su localización nativa en el genoma adenovírico o estar en el sitio de una deleción en el genoma adenovírico natural (por ejemplo, en la región E3).

En la construcción de vectores de adenovirus de simio útiles para la liberación de un gen en la célula humana (o de otro mamífero), se puede usar un intervalo de secuencias de ácidos nucleicos adenovíricos en los vectores. Por ejemplo, la totalidad o una porción del gen E3 temprano retardado de adenovirus se puede eliminar de la secuencia de adenovirus de simio que forma una parte del virus recombinante. Se cree que la función de E3 de simio es irrelevante para la función y la producción de la partícula de virus recombinante. Los vectores de adenovirus de simio se pueden construir también con una deleción de al menos la región ORF6 del gen E4 y más deseablemente, debido a la redundancia en la función de esta región, de toda la región E4. Todavía otro vector de SAdV-43, -45, -46, -47, - 48, -49 o -50 contiene una deleción en el gen E2a temprano retardado. También se pueden realizar deleciones en cualquiera de los genes tardíos L1 a L5 del genoma del adenovirus de simio. De un modo similar, las deleciones en los genes intermedios IX y IVa2 pueden ser útiles para algunos fines. Se pueden efectuar otras deleciones en los otros genes de adenovirus estructurales o no estructurales. Las deleciones tratadas anteriormente pueden usarse individualmente, es decir, una secuencia de adenovirus para su uso como se describe en el presente documento puede contener deleciones en solo una sola región. Como alternativa, las deleciones de genes completos o porciones de los mismos eficaces para destruir su actividad biológica pueden usarse en cualquier combinación. Por ejemplo, en un vector de ejemplo, la secuencia de adenovirus puede tener deleciones de los genes E1 y del gen E4, o de los genes E1, E2a y E3, o de los genes E1 y E3, o de los genes E1, E2a y E4, con o sin deleción de E3 y así sucesivamente. Como se ha tratado anteriormente, dichas deleciones pueden usarse en combinación con otras mutaciones, tales como mutaciones de sensibilidad a la temperatura, para lograr un resultado deseado.

Un vector adenovírico que carece de cualquier secuencia adenovírica esencial (por ejemplo, E1a, E1b, E2a, E2b, E4 ORF6, L1, L2, L3, L4 y L5)) puede cultivarse en presencia de los productos génicos adenovíricos que faltan que se requieren para la infectividad vírica y la propagación de una partícula adenoviírica. Estas funciones auxiliares pueden proporcionarse cultivando el vector adenovírico en presencia de una o más construcciones auxiliares (por ejemplo, un plásmido o virus) o una célula huésped de empaquetamiento. Véanse, por ejemplo, las técnicas descritas para la preparación de un vector Ad humano "mínimo" en la solicitud de patente internacional WO96 / 13597, publicada el 9 de mayo de 1996.

1. Virus auxiliares Por lo tanto, dependiendo del contenido del gen de adenovirus de simio de los vectores víricos utilizados para portar el minigén, puede ser necesario un adenovirus ayudante o un fragmento de virus no replicante para proporcionar suficientes secuencias génicas de adenovirus de simio necesarias para producir una partícula vírica recombinante infecciosa que contenga el minigén. Los virus auxiliares útiles contienen secuencias de genes de adenovirus seleccionadas que no están presentes en la construcción del vector de adenovirus y / o no son expresadas por la línea celular de empaquetamiento en la que se ha transfectado el vector. En una realización, el virus auxiliar es defectivo en la replicación y contiene diversos genes de adenovirus además de las secuencias descritas anteriormente. Tal virus auxiliar se utiliza deseablemente en combinación con una línea celular que expresa E1.

Los virus auxiliares también se pueden formar en los conjugados poli-catiónicos como se describe en Wu et al., J.

Biol. Chem., 264:16985-16987 (1989); K. J. Fisher y J. M. Wilson, Biochem. J., 299:49 (abril 1, 1994). Los virus auxiliares pueden contener opcionalmente un segundo minigén indicador. En la técnica se conoce una serie de tales genes indicadores. La presencia de un gen indicador en el virus auxiliar que es diferente del transgén en el vector de adenovirus permite controlar de forma independiente tanto el vector Ad como el virus auxiliar. Este segundo indicador se utiliza para permitir la separación entre el virus recombinante resultante y el virus auxiliar tras la purificación.

2. Líneas celulares de complementación Para generar adenovirus recombinantes de simio (Ad) con deleción de cualquiera de los genes descritos anteriormente, la función de la región del gen delecionado, si es esencial para la replicación y la infectividad del virus, debe proporcionarse al virus recombinante a través de un virus auxiliar o una línea celular , es decir, una línea celular de complementación o empaquetamiento. En muchas circunstancias, una línea celular que expresa el E1 humano puede usarse para transcomplementar el vector Ad de simio. Esto es particularmente ventajoso porque, debido a la diversidad entre las secuencias de SAdV-43, -45, -46, -47, – 48, -49 y -50 y las secuencias de AdE1 humano que se encuentran en las células de empaquetamiento actualmente disponibles, el uso de células que contienen E1 humanas actuales impide la generación de adenovirus competentes para la replicación durante la replicación y el proceso de producción. Sin embargo, en ciertas circunstancias, será deseable utilizar una línea celular que exprese los productos génicos de E1 para la producción de un adenovirus de simio con deleción de E1. Tales líneas celulares se han descrito. Véase, por ejemplo, la patente de EE.UU. N.º: 6.083.716.

Si se desea, se pueden utilizar las secuencias proporcionadas en el presente documento para generar una línea celular o célula de empaquetamiento que exprese, como mínimo, el gen de adenovirus E1 de SAdV-43, -45, -46, -47, -48, -49 o -50 sometido al control transcripcional de un promotor para la expresión en una línea celular parental seleccionada. Los promotores inducibles o constitutivos se pueden usar para este fin. Ejemplos de tales promotores se describen con detalle en otra parte en esta memoria descriptiva. Se selecciona una célula padre para la generación de una línea celular novedosa que expresa cualquier gen de SAdV-43, -45, -46, -47, -48, -49 o -50 deseado. Sin limitación, tal línea celular parental puede ser células HeLa [N.º de acceso en ATCC: CCL 2], A549 [N.º de acceso en ATCC: CCL 185], HEK 293, KB [CCL 17], Detroit [por ejemplo, Detroit 510, CCL 72] y WI-38 [75] CCL, entre otras. Estas líneas celulares están todas disponibles en la Colección Americana de Cultivos Tipo, 10801 University Boulevard, Manassas, Virginia 20110-2209. Otras líneas celulares parentales adecuadas pueden obtenerse de otras fuentes.

Tales líneas celulares que expresan E1 son útiles en la generación de vectores delecionados de adenovirus de simio recombinantes E1. Adicionalmente, o como alternativa, las líneas celulares que expresan uno o más productos génicos adenovíricos de simio, por ejemplo, E1a, E1b, E2a, y / o E4 ORF6, se pueden construir usando esencialmente los mismos procedimientos que se usan en la generación de vectores víricos de simio recombinantes. Tales líneas celulares pueden usarse para transcomplementar vectores de adenovirus delecionados en los genes esenciales que codifican esos productos, o para proporcionar funciones auxiliares necesarias para el empaquetamiento de un virus dependiente de auxiliar (por ejemplo, virus adenoasociado). La preparación de una célula huésped implica técnicas tales como el ensamblaje de secuencias de ADN seleccionadas. Este ensamblaje puede llevarse a cabo utilizando técnicas convencionales. Tales técnicas incluyen ADNc y clonación genómica, que se conocen bien y se describen en Sambrook et al., citado anteriormente, el uso de secuencias de oligonucleótidos solapantes de los genomas de adenovirus, en combinación con la reacción en cadena de la polimerasa, procedimientos sintéticos y cualesquiera otros procedimientos adecuados que proporcionen la secuencia de nucleótidos deseada.

En todavía otra alternativa, los productos génicos adenovíricos esenciales se proporcionan en trans mediante el vector adenovírico y / o virus auxiliar. En tal caso, se puede seleccionar una célula huésped adecuada de cualquier organismo biológico, incluyendo células procariotas (por ejemplo, bacterianas) y células eucariotas, incluyendo células de insecto, células de levadura y células de mamíferos. Las células huésped particularmente deseables se seleccionan de entre cualquier especie de mamífero, incluyendo, sin limitación, células tales como células A549, WEHI, 3T3, 10T1 / 2, HEK 293 o PERC6 (de las que todas ellas expresan E1 adenovírico funcional) [Fallaux, FJ et al., (1998), Hum Gene Ther, 9:1909-1917], células Saos, C2C12, L , HT1080, HepG2 y fibroblastos primarios, hepatocitos y mioblastos derivados de mamíferos, incluyendo ser humano, mono, ratón, rata, conejo y hámster. La selección de las especies de mamíferos que proporcionan las células no es una limitación de esta invención; ni lo es el tipo de célula de mamífero, es decir, fibroblastos, hepatocitos, células tumorales, etc.

3. Ensamblaje de partículas víricas y transfección de una línea celular Generalmente, cuando se proporciona el vector que comprende el minigén mediante transfección, el vector se libera en una cantidad de aproximadamente 5 g a aproximadamente 100 g de ADN,y preferentemente de aproximadamente 10 a aproximadamente 50 mg de ADN a aproximadamente 1 x 104 células a aproximadamente x 1013 células y preferentemente de aproximadamente 105 células.. Sin embargo, las cantidades relativas de ADN del vector para las células huésped se pueden ajustar teniendo en consideración factores tales como el vector seleccionado, el procedimiento de liberación y las células huésped seleccionadas.

El vector puede ser cualquier vector conocido en la técnica o divulgado anteriormente, incluyendo ADN desnudo, un plásmido, fago, transposón, cósmidos, episomas, virus, etc. La introducción en la célula huésped del vector se puede lograr por cualquier medio conocido en el técnica o como se ha divulgado anteriormente, incluyendo transfección e infección. Uno o más de los genes adenovíricos puede estar integrado de forma estable en el genoma de la célula huésped, expresarse de forma estable como episomas, o expresarse de forma transitoria. Los productos génicos pueden expresarse todos transitoriamente sobre un episoma o integrarse de forma estable, o algunos de los productos génicos pueden expresarse de forma estable mientras que otros se expresan transitoriamente. Además, los promotores para cada uno de los genes adenovíricos pueden seleccionarse independientemente a partir de un promotor constitutivo, un promotor inducible o un promotor adenovírico natural. Los promotores pueden estar regulados por un estado fisiológico específico del organismo o célula (es decir, por el estado de diferenciación o en células en replicación o quiescentes) o por factores añadidos exógenamente, por ejemplo.

La introducción de las moléculas (como plásmidos o virus) en la célula huésped también puede realizarse utilizando técnicas conocidas por el experto en la materia y como se trata a lo largo de la memoria descriptiva. En una realización preferida se usan técnicas de transfección estándar, por ejemplo, transfección en CaPO4 o electroporación.

El ensamblaje de las secuencias de ADN seleccionadas del adenovirus (así como el transgén u otros elementos del vector en diversos plásmidos intermedios) y el uso de los plásmidos y vectores para producir una partícula vírica recombinante se consiguen usando técnicas convencionales. Tales técnicas incluyen técnicas de clonación convencionales de ADNc tales como las descritas en los textos [Sambrook et al., citado anteriormente], el uso de secuencias de oligonucleótidos solapantes de los genomas de adenovirus, reacción en cadena de la polimerasa y cualquier procedimiento adecuado que proporcione la secuencia de nucleótidos deseada. Se usan técnicas de transfección y cotransfección estándar, por ejemplo, técnicas de precipitación en CaPO4. Otros procedimientos convencionales empleados incluyen recombinación homóloga de los genomas víricos, formación de placas de virus en revestimiento de agar, procedimientos de medición de la generación de señal y similares.

Por ejemplo, tras la construcción y ensamblaje del vector vírico que contiene el minigén deseado, el vector se transfecta in vitro en presencia de un virus auxiliar en la línea celular de empaquetamiento. Se produce recombinación homóloga entre las secuencias del auxiliar y del vector, lo que permite que las secuencias del transgén del adenovirus en el vector se repliquen y se empaqueten en cápsides del virión, lo que da como resultado partículas de vectores víricos recombinantes. El procedimiento actual para producir tales partículas de virus se basa en la transfección. No obstante, la invención no se limita a estos procedimientos. Los adenovirus de simio recombinantes resultantes son útiles en la transferencia de un transgén seleccionado a una célula seleccionada.

IV. Uso de los vectores de adenovirus recombinantes Los vectores basados en (SAdV)-43, -45, -46, -47, -48, -49 o -50 de adenovirus de simio recombinantes son útiles para la transferencia génica a un paciente humano o veterinario no simio in vitro, ex vivo e in vivo.

Los vectores de adenovirus recombinantes descritos en el presente documento pueden usarse como vectores de expresión para la producción de los productos codificados por los genes heterólogos in vitro. Por ejemplo, los adenovirus recombinantes que contienen un gen insertado en la ubicación de una deleción de E1 se pueden transfectar en una línea celular que expresa E1 como se ha descrito anteriormente. Como alternativa, los adenovirus competentes para la replicación se pueden utilizar en otra línea celular seleccionada. Después, las células transfectados se cultivan de la manera convencional, lo que permite que el adenovirus recombinante exprese el producto génico a partir del promotor. Después el producto génico puede recuperarse del medio de cultivo por procedimientos convencionales conocidos de aislamiento y recuperación de proteínas a partir del cultivo.

Un vector adenovírico de simio recombinante derivado de SAdV-43, -45, -46, -47, -48, -49 o -50 proporciona un vehículo de transferencia génica eficaz que puede entregar un transgén seleccionado a una célula huésped seleccionada in vivo o ex vivo incluso cuando el organismo tenga anticuerpos neutralizantes frente a uno o más serotipos de AAV. En una realización, el rAAV y las células se mezclan ex vivo; las células infectadas se cultivan usando metodologías convencionales; y las células transducidos se vuelven a infundir en el paciente. Estas composiciones son particularmente muy adecuadas para la administración de genes para fines terapéuticos y para la inmunización, incluyendo la inducción de inmunidad protectora.

Más habitualmente, los vectores adenovíricos recombinantes de SAdV-43, -45, -46, -47, -48, -49 o -50 se utilizarán para la liberación de moléculas terapéuticas o inmunógenas, como se describe a continuación. Se entenderá fácilmente para ambas aplicaciones que los vectores adenovíricos recombinantes son particularmente muy adecuados para su uso en regímenes que implican la liberación repetida de vectores adenovíricos recombinantes. Tales regímenes implican típicamente la entrega de una serie de vectores víricos en los que se alternan las cápsides víricas. Las cápsides víricas pueden cambiarse para cada administración posterior o después de un número preseleccionado de administraciones de una cápside de un serotipo particular (por ejemplo, uno, dos, tres, cuatro o más). Por lo tanto, un régimen puede implicar la entrega de un rAd con una primera cápside de simio, la entrega con un rAd con una segunda cápside de simio y la entrega con una tercera cápside de simio. Una diversidad de otros diversos regímenes que utilizan las cápsides de SAdV-43, -45, -46, -47, -48, -49 o -50 solas, en combinación unas con otras, o en combinación con otros adenovirus (que preferiblemente no producen reacciones cruzadas inmunológicamente) serán evidentes para los expertos en la técnica. Opcionalmente, un régimen tal puede implicar la administración de rAd con cápsides de otros adenovirus de primate no humano, adenovirus humanos o secuencias artificiales como las que se describen en el presente documento.. Cada fase del régimen puede implicar la administración de una serie de inyecciones (u otras vías de administración) con una única cápside de Ad seguida de una serie con otra cápside de una fuente de Ad diferente. Como alternativa, los vectores de SAdV-43, -45, -46, - 47, -48, -49 o -50 pueden usarse en regímenes que implican otros sistemas de entrega no mediada por adenovirus, incluyendo otros sistemas vírico, sistemas de liberación no víricos, proteínas, péptidos y otras moléculas biológicamente activas.

Las secciones siguientes se centrarán en moléculas de ejemplo que se pueden suministrar a través de vectores de SAdV-43, -45, -46, -47, -48, -49 y -50.

A. Entrega mediada por Ad de moléculas terapéuticas En una alternativa, los vectores recombinantes descritos anteriormente se administran a los seres humanos de acuerdo con los procedimientos publicados para la terapia génica. Un vector vírico de simio portador del transgén seleccionado puede administrarse a un paciente, preferiblemente suspendido en una solución biológicamente compatible o vehículo portador farmacéuticamente aceptable. Un vehículo adecuado incluye solución salina estéril. Para este fin se pueden usar otras soluciones de inyección estériles isotónicas acuosas y no acuosas y suspensiones estériles acuosas y no acuosas que se sabe que son vehículos farmacéuticamente aceptables y bien conocidos por los expertos en la técnica.

Los vectores adenovíricos de simio se administran en cantidades suficientes para transducir las células diana y proporcionar niveles suficientes de transferencia y expresión génica para proporcionar un beneficio terapéutico sin efectos fisiológicos adversos indebidos o con efectos fisiológicos médicamente aceptables, que los expertos en las técnicas médicas pueden determinar. Las vías de administración convencionales y farmacéuticamente aceptables incluyen, pero no se limitan a, la liberación directa en la retina y otros procedimientos de liberación intraocular, liberación directa en el hígado, vías de inhalación, intranasal, intravenosa, intramuscular, intratraqueal, subcutánea, intradérmica, rectal, oral y otras vías parenterales de administración. Las vías de administración pueden combinarse, si se desea, o ajustarse dependiendo del transgén o de la afección. La vía de administración dependerá principalmente de la naturaleza de la afección a tratar.

Las dosificaciones del vector vírico dependerán principalmente de factores tales como la afección que se está tratando, la edad, el peso y la salud del paciente y por lo tanto pueden variar entre pacientes. Por ejemplo, una dosificación para ser humano adulto o veterinaria terapéuticamente eficaz del vector vírico está generalmente en el intervalo de aproximadamente 100 ml a aproximadamente 100 ml de un vehículo que contiene concentraciones de virus de aproximadamente 1 x 106 a aproximadamente 1 x 1015 partículas, de aproximadamente 1 x 1011 a 1 x 1013 partículas o de aproximadamente 1 x 109 a 1x 1012 partículas. Las dosificaciones variarán dependiendo del tamaño del animal y de la vía de administración. Por ejemplo, una dosificación veterinaria o humana adecuada (para un animal de aproximadamente 80 kg) para la inyección intramuscular se encuentra en el intervalo de aproximadamente 1 x 109 a aproximadamente 5 x 1012 partículas por ml, para un único sitio. Opcionalmente, se pueden entregar en múltiples sitios de administración. En otro ejemplo, una dosificación humana o veterinaria adecuada puede estar en el intervalo de aproximadamente 1 x 1011 a aproximadamente 1 x 1015 partículas para una formulación oral. Un experto en la técnica puede ajustar estas dosis, dependiendo de la vía de administración y la aplicación terapéutica o de vacuna para la que se emplea el vector recombinante. Los niveles de expresión del transgén, o para un inmunógeno, el nivel de anticuerpos circulantes, pueden controlarse para determinar la frecuencia de administración de la dosificación. Sin embargo, otros procedimientos para determinar la cronología de la frecuencia de administración serán fácilmente evidentes para un experto en la técnica.

Una etapa del procedimiento opcional implica la coadministración al paciente, bien simultáneamente con, o bien antes o después de la administración del vector vírico, de una cantidad adecuada de un modulador inmunitario de acción corta. El modulador inmunitario seleccionado se define en el presente documento como un agente capaz de inhibir la formación de anticuerpos neutralizantes dirigidos contra un vector recombinante de SAdV-43, -45, -46, -47, -48, -49 o -50 o capaz de inhibir la eliminación de los linfocitos T citolíticos (CTL) del vector. El modulador inmunitario puede interferir con las interacciones entre las subpoblaciones de linfocitos T colaboradores (TH1 o TH2) y linfocitos B para inhibir la formación de anticuerpos neutralizantes. Como alternativa, el modulador inmunitario puede inhibir la interacción entre los linfocitos TH1 y los CTL para reducir la aparición de eliminación de CTL del vector. Se divulga una diversidad de moduladores inmunitarios útiles y dosificaciones para el uso de los mismos, por ejemplo en Yang et al., J. Virol, 70 (9) (sept., 1996); solicitud de patente Internacional N.º: WO96 / 12406, publicada el 2 de mayo de 1996; y solicitud de patente internacional N.º: PCT / US96 / 03035.

1. Transgenes terapéuticos Productos terapéuticos útiles codificados por el transgén incluyen hormonas y factores de crecimiento y diferenciación, incluyendo, sin limitaciones, insulina, glucagón, hormona de crecimiento (GH), hormona paratiroidea (PTH), factor de liberación de la hormona de crecimiento (GRF), hormona estimulante del folículo (FSH), hormona luteinizante (LH), gonadotropina coriónica humana (hCG), factor de crecimiento endotelial vascular (VEGF), angiopoyetinas, angiostatina, factor estimulante de colonias de granulocitos (GCSF), eritropoyetina (EPO), factor de crecimiento del tejido conjuntivo (CTGF), factor de crecimiento de fibroblastos básico (bFGF), factor de crecimiento de fibroblastos ácido (aFGF), factor de crecimiento epidérmico (EGF), factor transformante de crecimiento (TGF), factor de crecimiento derivado de plaquetas (PDGF), factores de crecimiento de insulina I y II (IGF-I e IGF-II), uno cualquiera de la superfamilia del factor de crecimiento transformante, incluyendo TGF, activinas, inhibinas, o cualquiera de las proteínas morfogenéticas óseas (BMP) BMP 1-15, una cualquiera de la familia de diferenciación de heregluina/neu-regulina/ARIA/ neu (NDF) de factores de crecimiento, factor de crecimiento neural (NGF), factor neurotrófico derivado del cerebro (BDNF), neurotrofinas NT-3 y NT-4/5, factor neurotrófico ciliar (CNTF), factor neurotrófico derivado de la línea de células gliales (GDNF), neurturina, agrina, una cualquiera de la familia de semaforinas/colapsinas, netrina-1 y netrina-2, factor de crecimiento de hepatocitos (HGF), efrinas, noggin, erizo sonic y tirosina hidroxilasa.

Otros productos transgénicos útiles incluyen proteínas que regulan el sistema inmunitario, incluyendo, sin limitación, citocinas y linfocinas tales como trombopoyetina (TPO), interleucinas (IL) IL-1 a IL-25 (incluyendo, por ejemplo, IL-2, IL-4, factor de células IL-12 e IL-18), proteína quimiotáctica de monocitos, factor inhibidor de leucemia, factor estimulante de las colonias de granulocitos y macrófagos, ligando Fas, factores de necrosis tumoral e interferones y factor de células madres, ligando flk-2 / flt3. Los productos génicos producidos por el sistema inmunitario también son útiles. Estos incluyen, sin limitación, inmunoglobulinas IgG, IgM, IgA, IgD e IgE, inmunoglobulinas quiméricas, anticuerpos humanizados, anticuerpos de cadena única, receptores de linfocitos T, receptores de linfocitos T quiméricos, receptores de linfocitos T de cadena única, moléculas del MHC de clase I y clase II, así como inmunoglobulinas y moléculas MHC modificadas por ingeniería. Los productos génicos útiles incluyen también proteínas reguladoras del complemento, tales como proteínas reguladoras del complemento, proteína cofactor de membrana (MCP), factor acelerador del deterioro (DAF), CR1, CF2 y CD59.

Todavía otros productos génicos útiles incluyen uno cualquiera de los receptores para las hormonas, factores de crecimiento, citocinas, linfocinas, proteínas reguladoras y proteínas del sistema inmunitario. En el presente documento también se abarcan receptores para la regulación del colesterol, incluyendo el receptor de las lipoproteínas de baja densidad (LDL), el receptor de las lipoproteínas de alta densidad (HDL), el receptor de las lipoproteínas de muy baja densidad (VLDL) y el receptor de secuestrantes. También se contemplan los productos génicos tales como los miembros de la superfamilia de receptores de hormonas esteroideas, incluyendo los receptores de glucocorticoides y los receptores de estrógenos, los receptores de vitamina D y otros receptores nucleares. Además, los productos génicos útiles incluyen factores de transcripción tales como jun, fos, max, mad, factor de respuesta sérica (SRF), AP-1, AP2, myb, MyoD y miogenina, proteínas que contienen la caja ETS, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, proteínas que contienen la caja CCAAT, factor de regulación de interferón (IRF-1), proteína del tumor de Wilms, proteína de unión a ETS, STAT, proteínas de unión a la caja GATA, por ejemplo, GATA-3 y la familia forkhead de las proteínas de hélice alada.

Otros productos génicos útiles incluyen, carbamoil sintetasa I, ornitina transcarbamilasa, arginosuccinato sintetasa, argininosuccinato liasa, arginasa, fumarilacetacetato hidrolasa, fenilalanina hidroxilasa, alfa-1 antitripsina, glucosa-6- fosfatasa, porfobilinógeno desaminasa, factor VIII, factor IX, cistationina beta-sintasa, cetoácido descarboxilasa de cadena ramificada, albúmina, isovaleril-CoA deshidrogenasa, CoA carboxilasa propionilo, metilmalonil CoA mutasa, glutaril CoA deshidrogenasa, insulina, beta-glucosidasa, carboxilato piruvato, fosforilasa hepática, fosforilasa cinasa, glicina descarboxilasa, proteína H, proteína T, una secuencia reguladora transmembrana de la fibrosis quística (CFTR) y una secuencia de ADNc de la distrofina.

Otros productos génicos útiles incluyen polipéptidos de origen no natural, tales como polipéptidos quiméricos o híbridos que tienen una secuencia de aminoácidos de origen no natural que contiene inserciones, deleciones o sustituciones de aminoácidos. Por ejemplo, las inmunoglobulinas de cadena única modificadas por ingeniería podrían ser útiles en ciertos pacientes inmunocomprometidos. Otros tipos de secuencias génicas de origen no natural incluyen moléculas antisentido y ácidos nucleicos catalíticos, tales como ribozimas, que podrían usarse para reducir la sobreexpresión de un objetivo.

La reducción y / o modulación de la expresión de un gen son particularmente deseables para el tratamiento de afecciones hiperproliferativas caracterizadas por células hiperproliferantes, como son los cánceres y la psoriasis. Los polipéptidos diana incluyen aquellos polipéptidos que se producen exclusivamente o a niveles más altos en las células hiperproliferativas en comparación con las células normales. Los antígenos objetivo incluyen polipéptidos codificados por oncogenes tales como myb, myc, fyn y el gen de translocación bcr / abl, ras, src, P53, neu, trk y EGRF. Además de los productos de oncogenes como antígenos diana, los polipéptidos objetivo para tratamientos anticancerosos y regímenes protectores incluyen regiones variables de anticuerpos producidos por linfomas de células B y regiones variables de receptores de linfocitos T de linfomas de linfocitos T que, en algunas realizaciones, también se utilizan como antígenos diana para la enfermedad autoinmune. Otros polipéptidos asociados a tumores pueden usarse como polipéptidos objetivo, tales como polipéptidos que se encuentran a niveles más altos en los linfocitos Tumorales, incluyendo el polipéptido reconocido por el anticuerpo monoclonal 17-1A y los polipéptidos de unión a folato.

Otros polipéptidos y proteínas terapéuticos adecuados incluyen aquellos que pueden ser útiles para el tratamiento de individuos que sufren enfermedades y trastornos autoinmunes al conferir una respuesta inmunitaria protectora amplia contra objetivos que están asociados con la autoinmunidad, incluyendo receptores celulares y células que producen anticuerpos autodirigidos. Las enfermedades autoinmunes mediadas por linfocitos T incluyen artritis reumatoide (AR), esclerosis múltiple (EM), síndrome de Sjögren, sarcoidosis, diabetes mellitus dependiente de insulina (DMDI), tiroiditis autoinmune, artritis reactiva, espondilitis anquilosante, esclerodermia, polimiositis, dermatomiositis, psoriasis, vasculitis, granulomatosis de Wegener, enfermedad de Crohn y colitis ulcerosa. Cada una de estas enfermedades se caracteriza por receptores de linfocitos T (TCR) que se unen a antígenos endógenos e inician la cascada inflamatoria asociada con las enfermedades autoinmunes.

Los vectores adenovíricos de simio basados en las secuencias de SAdV-43, -45, -46, -47, -48, -49 o -50 del presente documento son particularmente adecuados para regímenes terapéuticos en los que se desean múltiples liberaciones de transgenes mediadas por adenovirus, por ejemplo, en los regímenes que implican la liberación repetida del mismo transgén o en regímenes de combinación que implican la liberación de otros transgenes. Tales regímenes pueden implicar la administración de un vector de adenovirus de simio SAdV-43, -45, -46, -47, -48, -49 o -50 , seguida de la readministración con un vector del adenovirus del mismo serotipo. Regímenes particularmente deseables implican la administración de un vector adenovírico de simio de SAdV-43, – 45, -46, -47, -48, -49 o -50 en el que la fuente de las secuencias de la cápside adenovírica del vector liberado en la primera administración se diferencia de la fuente de las secuencias de la cápside adenovírica del vector vírico utilizado en una o más de las administraciones posteriores. Por ejemplo, un régimen terapéutico implica la administración de un vector de SAdV- 43, -45, -46, -47, -48, -49 o -50 y repetir la administración con uno o más vectores adenovíricos de los mismos o diferentes serotipos. En otro ejemplo, un régimen terapéutico implica la administración de un vector adenovírico seguido por la administración repetida con vector de SAdV-43, -45, -46, -47, -48, -49 o -50 que tiene una cápside que difiere de la fuente de la cápside en el primer vector adenovírico liberado y opcionalmente, además la administración con otro vector que es el mismo o, preferiblemente, difiere de la fuente de la cápside adenovírica del vector en las etapas de administración anteriores. Estos regímenes no están limitados a la liberación de vectores adenovíricos construidos utilizando las secuencias de SAdV-43, -45, -46, -47, -48, – 49 o -50. Por el contrario, estos regímenes pueden utilizar fácilmente vectores de otras secuencias adenovíricas, incluyendo, sin limitación, otras secuencias adenovíricas de simio, (por ejemplo, Pan9 o C68, C1, etc), otras secuencias adenovíricas de primates no humanos, o secuencias adenovíricas humanas, en combinación con uno o más de los vectores de SAdV-43, -45, - 46, -47, -48, -49 o -50. Ejemplos de tales serotipos adenovíricos de simio, humanos o de otros primates no humanos se tratan en otra parte del presente documento. Además, estos regímenes terapéuticos pueden implicar la liberación bien simultánea o bien secuencial de vectores adenovíricos de SAdV-43, -45, -46, -47, -48, -49 o -50 en combinación con vectores no adenovíricos, vectores no víricos, y / o una diversidad de otros compuestos o moléculas terapéuticamente útiles. El uso de los vectores de SAdV-43, – 45, -46, -47, -48, -49 y -50 vectores no se limita a estos regímenes terapéuticos, cuya diversidad será fácilmente evidente para un experto en la técnica.

B. Liberación de transgenes inmunógenos mediados por Ad Los vectores recombinantes de SAdV-43, -45, -46, -47, -48, -49 y -50 pueden usarse también como composiciones inmunógenas Como se usa en el presente documento, una composición inmunógena es una composición frente a la que se monta una respuesta humoral (por ejemplo, de anticuerpos) o celular (por ejemplo, de linfocitos T citotóxicos) frente a un producto transgénico liberado por la composición inmunógena después de la administración a un mamífero y preferiblemente a un primate. Un Ad de simio recombinante puede contener en cualquiera de sus deleciones de secuencias de adenovirus un gen que codifica un inmunógeno deseado. Es probable que el adenovirus de simio sea más adecuado para su uso como una vacuna de virus recombinante vivo en diferentes especies animales en comparación con un adenovirus de origen humano, pero no está limitado a tal uso. Se han identificado los adenovirus recombinantes que pueden usarse como vacunas profilácticas o terapéuticas contra cualquier patógeno para el que se ha(n) identificado el o los antígeno(s) cruciales para la inducción de una respuesta inmunitaria y capaces de limitar la propagación del patógeno y para los que está disponible el ADNc. Dichas composiciones de vacuna (u otras inmunógenas) se formulan en un vehículo de administración adecuado, como se describe anteriormente. Generalmente, las dosis para las composiciones inmunógenas están en el intervalo definido anteriormente para composiciones terapéuticas. Los niveles de inmunidad del gen seleccionado pueden controlarse para determinar la necesidad, si la hay, de refuerzos. Tras una evaluación de los títulos de anticuerpos en el suero, pueden desearse inmunizaciones de refuerzo opcionales.

Opcionalmente, una composición de vacuna de un vector de SAdV-43, -45, -46, -47, -48, -49 o – 50 se puede formular de modo que contenga otros componentes, incluyendo, por ejemplo, adyuvantes, estabilizadores, ajustadores de pH, conservantes y similares. Tales componentes se conocen bien por los expertos en la técnica de las vacunas. Los ejemplos de adyuvantes adecuados incluyen, sin limitación, liposomas, alumbre, monofosforilo lípido A y cualquier factor biológicamente activo, tal como citocina, una interleucina, una quimiocina, un ligando y óptimamente combinaciones de los mismos. Algunos de estos factores biológicamente activos pueden expresarse in vivo, por ejemplo, a través de un plásmido o vector vírico. Por ejemplo, dicho adyuvante puede administrarse con una vacuna de ADN de sensibilización que codifica un antígeno para potenciar la respuesta inmune específica de antígeno en comparación con la respuesta inmune generada tras la sensibilización con una vacuna de ADN que codifica solo el antígeno.

Los adenovirus recombinantes se administran en una "una cantidad inmunógena", es decir, una cantidad de adenovirus recombinantes que es eficaz en una vía de administración para transfectar las células deseadas y proporcionar niveles suficientes de expresión del gen seleccionado para inducir una respuesta inmunitaria. Cuando se proporciona inmunidad protectora, los adenovirus recombinantes se considera que son composiciones de vacuna útiles en la prevención de la infección y / o enfermedad recurrente.

Como alternativa, o adicionalmente, los vectores pueden contener un transgén que codifica un péptido, polipéptido o proteína que induce una respuesta inmune a un inmunógeno seleccionado. Cabe esperar que los vectores recombinantes de SAdV-43, -45, -46, -47, -48, -49 y -50 sean altamente eficaces en la inducción de linfocitos T citolíticos y anticuerpos frente a la proteína antigénica heteróloga insertada expresada por el vector.

Por ejemplo, los inmunógenos se pueden seleccionar de una variedad de familias víricas. Ejemplo de familias víricas contra las que una respuesta inmune sería deseable incluyen, la familia de los picornavirus, que incluye los géneros de rinovirus, que son responsables de aproximadamente el 50 % de los casos de resfriado común; los géneros de enterovirus, que incluyen poliovirus, virus coxsackie, echovirus y enterovirus humanos tales como el virus de la hepatitis A; y los géneros de aptovirus, que son responsables de enfermedades de los pies y la boca, principalmente en animales no humanos. Dentro de la familia de virus de picornavirus, los antígenos objetivo incluyen VP1, VP2, VP3, VP4 y VPG. Otra familia vírica incluye la familia de calcivirus, que abarca el grupo de virus Norwalk, que son un importante agente causal de gastroenteritis epidémica. Todavía otra familia vírica deseable para su uso en la selección de antígenos para inducir respuestas inmunitarias en seres humanos y animales no humanos es la familia de los togavirus, que incluye los géneros de alfavirus géneros, que incluyen los virus Sindbis, el virus RossRiver y los virus de la encefalitis equina oriental y occidental de Venezuela y rubivirus, incluido el virus de la rubeola. La familia Flaviviridae incluye los virus del dengue, la fiebre amarilla, la encefalitis japonesa, la encefalitis de San Luis y de la encefalitis transmitida por garrapatas. Otros antígenos objetivo pueden generarse a partir de la familia del virus de la hepatitis C o de la familia de los coronavirus, que incluye un número de virus no humanos tales como el virus de la bronquitis infecciosa (aves de corral), el virus de la gastroenteritis porcina transmisible (cerdos), el virus de la encefalomielitis hemaglutinante porcina (cerdos), el virus de la peritonitis infecciosa felina (gatos), el coronavirus entérico felino (gatos), el coronavirus canino (perro) y los coronavirus respiratorios humanos, que pueden causar el resfriado común y / o la hepatitis no-A, B o C. Dentro de la familia de coronavirus, los antígenos objetivo incluyen la glucoproteína E1 (también llamada proteína M o de la matriz), E2 (también llamada proteína S o Spike), E3 (también llamada HE o hemaglutinina-elterosa) (no presente en todos los coronavirus), o N (nucleocápside). Aún otros antígenos pueden dirigirse contra la familia de rabdovirus, que incluye los géneros vesiculovirus (por ejemplo, virus de la estomatitis vesicular) y el lisavirus general (por ejemplo, la rabia).

Dentro de la familia de rabdovirus, los antígenos adecuados pueden derivar de la proteína G o la proteína N. La familia filoviridae, que incluye los virus de la fiebre hemorrágica, tal como el virus de Marburg y de Ébola, puede ser una fuente adecuada de antígenos. La familia de paramixovirus incluye los virus de parainfluenza de tipo 1, de parainfluenza de tipo 3, de parainfluenza bovina de tipo 3, rubulavirus (virus de las paperas, de parainfluenza de tipo 2, de parainfluenza de tipo 4, el virus de la enfermedad de Newcastle (pollos), la peste bovina, el morbilivirus, que incluye los virus del sarampión y el moquillo canino y neumovirus, que incluye el virus sincitial respiratorio. El virus de la gripe se clasifica dentro de la familia de los ortomixovirus y es una fuente adecuada de antígeno (por ejemplo, la proteína HA, la proteína N1). La familia bunyavirus incluye los géneros bunyavirus (encefalitis de California, La Crosse), flebovirus (fiebre del Valle del Rift), hantavirus (puremala es un virus de la fiebre hemahagina), Nairovirus (enfermedad ovina de Nairobi) y varios bungavirus sin asignar. La familia de arenavirus proporciona una fuente de antígenos contra LCM y el virus de la fiebre de Lassa. La familia reovirus incluye los géneros de el reovirus, rotavirus (que causa la gastroenteritis aguda en niños), orbivirus y cultivirus (fiebre de la garrapata de Colorado, Lebombo (seres humanos), encefalosis equina, lengua azul).

La familia de retrovirus incluye la subfamilia oncorivirinal que abarca enfermedades humanas y veterinarias tales como el virus de la leucemia felina, HTLVI y HTLVII, lentivirinal (que incluye el virus de la inmunodeficiencia humana (VIH), el virus de la inmunodeficiencia simia (VIS), el virus de la inmunodeficiencia felina (VIF), el virus de la anemia infecciosa equina y spuma-virinal). Entre los lentivirus, se han descrito muchos antígenos adecuados y pueden seleccionarse fácilmente. Ejemplos de antígenos adecuados contra el VIH y el VIS incluyen, sin limitación, las proteínas gag, pol, Vif, Vpx, VPR, Env, Tat, Nef y Rev, así como diversos fragmentos de las mismas. Por ejemplo, los fragmentos adecuados de la proteína Env pueden incluir cualquiera de sus subunidades tales como gp120, gp160, gp41o fragmentos más pequeños de las mismas, por ejemplo, de al menos aproximadamente 8 aminoácidos de longitud. Del mismo modo, se pueden seleccionar fragmentos de la proteína tat. [Véanse, la patente de EE.UU.

5.891.994 y la patente de EE.UU. 6.193.981.] Véanse, también, las proteínas del VIH y el VIS descritas en D.H. Barouch et al., J. Virol., 75(5):2462-2467 (marzo 2001) y R.R. Amara, et al., Science, 292:69-74 (6 de abril 2001). En otro ejemplo, las proteínas o péptidos inmunógenos del VIH y / o VIS pueden usarse para formar proteínas de fusión u otras moléculas inmunógenas. Véanse, por ejemplo, las proteínas de fusión del VIH-1 Tat y/o Nef y los regímenes de inmunización descritos en el documento WO 01/54719, publicado el 2 de agosto de 2001 y el documento WO 99/16884, publicado el 8 de abril de 1999. Las proteínas y péptidos inmunógenos del VIH y/o el VIS descritos en el presente documento son solo un ejemplo. Además, se ha descrito una diversidad de modificaciones de estas proteínas o podrían fabricarse fácilmente por un experto en la técnica. Véase, por ejemplo, la proteína gag modificada que se describe en la patente US 5.972.596. Además, cualquier inmunógeno del VIH y / o VIS deseado se puede liberar solo o en combinación. Tales combinaciones pueden incluir expresión a partir de un único vector o de múltiples vectores. Opcionalmente, otra combinación puede implicar la liberación de uno o más inmunógenos expresados con la liberación de uno o más de los inmunógenos en forma de proteína. Dichas combinaciones se tratarán más detalladamente más adelante.

La familia de papovavirus incluye la subfamilia de poliomavirus (virus BKU y JCU) y la subfamilia de papilomavirus (asociados con cánceres o la progresión maligna del papiloma). La familia de adenovirus incluye virus (EX, AD7, ARD, OB) que causan enfermedades respiratorias y / o enteritis. La familia de parvovirus, el parvovirus felino (enteritis felina), el panleucopeniavirus felino, el parvovirus canino y el parvovirus porcino. La familia de los herpesvirus incluye la subfamilia de los alfaherpesvirus, que abarca los géneros del virus simple (HSVI, HSVII), varicelovirus (seudorrabia, varicela zóster) y la subfamilia de los betaherpesvirus, que incluye los géneros citomegalovirus (HCMV, muromegalovirus) y la subfamilia de los gammaherpesvirrus, que incluye los géneros linfocriptovirus, EBV (linfoma de Burkitt), rinotraqueitis infecciosa, virus de la enfermedad de Marek y rhadinovirus. La familia de poxvirus incluye la subfamilia de los cordopoxvirus, que abarca los géneros de ortopoxvirus (viruela (viruela) y virus vacunal (viruela bovina)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus y la subfamilia de los entomopoxvirus. La familia de hepadnavirus incluye el virus de la hepatitis B. Un virus sin clasificar que puede ser fuente adecuada de antígenos es el virus de la hepatitis delta. Sin embargo otras fuentes víricas pueden incluir virus de enfermedad de bursitis infecciosa aviar y el virus del síndrome respiratorio y reproductivo porcino. La familia de alfavirus incluye el virus de la arteritis equina y varios virus de encefalitis.

Los inmunógenos que son útiles para inmunizar a un ser humano o animal no humano frente a otros patógenos incluyen, por ejemplo, bacterias, hongos, microorganismos parásitos o parásitos multicelulares que infectan a vertebrados humanos y no humanos, o inmunógenos de una célula cancerosa o célula tumoral. Ejemplos de patógenos bacterianos incluyen cocos patógenos grampositivos, incluidos neumococos; estafilococos; y estreptococos. Los cocos patógenos gramnegativos incluyen meningococos; gonococos. Los bacilos gramnegativos entéricos patógenos incluyen enterobacterias; pseudomonas, acinetobacterias y eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H. ducreyi (que causa el chancroide); Brucella; Franisella tularensis (que causa la tularemia); yersinia (pasteurella); Streptobacillus moniliformis y spirillum; los bacilos grampositivos incluyen Listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diftheria); cólera; B. anthracis (ántrax); donovanosis (granuloma inguinal); y bartonelosis. Las enfermedades causadas por bacterias anaerobias patógenas incluyen tétanos; botulismo; otros clostridios; tuberculosis; lepra; y otras micobacterias. Enfermedades por espiroquetas patógenas incluyen sífilis; treponematosis: frambesía, pinta y sífilis endémica; y leptoespirosis. Otras infecciones causadas por bacterias patógenas superiores y hongos patógenos incluyen actinomicosis; nocardiosis; criptococosis, blastomicosis, histoplasmosis y coccidioidomicosis; candidiasis, aspergilosis y mucormicosis; esporotricosis; paracoccidiodomicosis, petriellidiosis, torulopsosis, micetoma y cromomicosis; y dermatofitosis. Las infecciones por rickettsias incluyen la fiebre del tifus, la fiebre manchada de las Montañas Rocosas, la fiebre Q y la rickettsiosis. Los ejemplos de infecciones por micoplasmas y clamidias incluyen: mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; e infecciones por clamidias perinatales. Eucariotas patógenas abarcan protozoos y helmintos patógenos y las infecciones producidas de esta manera incluyen: amebiasis; malaria; leishmaniasis; tripanosomiasis; toxoplasmosis; Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis; giardiasis; triquinosis; filariasis; esquistosomiasis; nematodos; trematodos o flukes; e infecciones producidas por cestodos (tenia).

Muchos de estos organismos y / o toxinas producidas, por tanto, han sido identificados por los Centros para el Control de Enfermedades [(CDC), Departamento de Salud y Servicios Humanos, EE.UU.], como agentes que tienen potencial para su uso en ataques biológicos. Por ejemplo, algunos de estos agentes biológicos, incluyen, Bacillus anthracis (ántrax), Clostridium botulinum y su toxina (botulismo),Yersinia pestis (peste), variola major (viruela), Francisella tularensis (tularemia) y fiebres hemorrágicas víricas [filoviruses (por ejemplo, Ébola, Marburg] y arenavirus [por ejemplo, Lassa, Machupo]), todos los cuales están clasificados actualmente como agentes de la categoría A; Coxiella burnetti (fiebre Q); especies de Brucella (brucelosis), Burkholderia mallei (muermo), Burkholderia pseudomallei (meloidosis), Ricinus communis y su toxina (la toxina ricina), Clostridium perfringens y su toxina (toxina epsilon), especies de Staphylococcus y sus toxinas (enterotoxina B), Chlamydia psittaci (psitacosis), amenazas a la seguridad del agua (por ejemplo, Vibrio cholerae, Crytosporidium parvum), fiebre del tifus (Richettsia powazekii) y encefalitis vírica (alfavirus, por ejemplo, encefalitis equina venezolana; encefalitis equina oriental; encefalitis equina occidental); todos los cuales están clasificados actualmente como agentes de categoría B; y el virus Nipan y los hantavirus, que se clasifican actualmente como agentes de categoría C. Además, otros organismos, que se clasifican así o de manera diferente, se pueden identificar y / o utilizar para tal fin en el futuro. Se comprenderá fácilmente que los vectores víricos y otras construcciones descritas en el presente documento son útiles para liberar antígenos de estos organismos, virus, sus toxinas u otros subproductos, que prevendrán y/o tratarán la infección u otras reacciones adversas con estos agentes biológicos.

Se prevé que la administración de los vectores de SAdV-43, -45, -46, -47, -48, -49 y -50 para entregar inmunógenos contra la región variable de los linfocitos T provoque una respuesta inmune que incluye CTL para eliminar dichos linfocitos T. En la AR, se han caracterizado varias regiones variables específicas de los TCR que están implicados en la enfermedad. Estos TCR incluyen V-3, V-14, V-17 y Vα-17. Por lo tanto, la liberación de una secuencia de ácido nucleico que codifica al menos uno de estos polipéptidos provocará una respuesta inmunitaria que tendrá como objetivo los linfocitos T involucrados en la AR. En la EM, se han caracterizado varias regiones variables específicas de los TCR que están implicadas en la enfermedad. Estos TCR incluyen V-7 y Vα-10. Por lo tanto, la liberación de una secuencia de ácido nucleico que codifica al menos uno de estos polipéptidos provocará una respuesta inmunitaria que tendrá como objetivo los linfocitos T involucrados en la AR. En la esclerodermia se han caracterizado varias regiones variables específicas de los TCR que están implicadas en la enfermedad. Estos TCR incluyen V-6, V-8, V-14 y Vα-16, Vα-3C, Vα-7, Vα-14, Vα-15, Vα-16, Vα-28 y Vα-12. Por lo tanto, la liberación de adenovirus recombinante de simio que codifica al menos uno de estos polipéptidos provocará una respuesta inmunitaria que tendrá como objetivo los linfocitos T involucrados en la esclerodermia.

C. Procedimientos de liberación mediados por Ad Los niveles terapéuticos, o niveles de inmunidad, del gen seleccionado pueden controlarse para determinar la necesidad, si la hay, de refuerzos. Tras una evaluación de la respuesta de linfocitos T CD8 +, u opcionalmente, los títulos de anticuerpo, en el suero, puede ser deseable realizar inmunizaciones de refuerzo opcionales. Opcionalmente, los vectores recombinantes de SAdV-43, -45, -46, -47, -48, -49 y -50 pueden liberarse una única administración o en varios regímenes de combinación, por ejemplo, en combinación con un régimen o curso de tratamiento que implique a otros ingredientes activos o en un régimen de sensibilización-refuerzo. Varios de tales regímenes se han descrito en la técnica y puede seleccionarse fácilmente.

Por ejemplo, los regímenes de sensibilización-refuerzo pueden implicar la administración de un vector basado en ADN (por ejemplo, plásmido) para sensibilizar el sistema inmunitario frente a la segunda administración de refuerzo con un antígeno tradicional, tal como una proteína o un virus recombinante portador de las secuencias que codifican un antígeno tal. Véase, por ejemplo, el documento WO 00/11140, publicado el 2 de marzo de 2000. Como alternativa, un régimen de inmunización puede implicar la administración de un vector recombinante de SAdV-43, - 45, -46, -47, -48, -49 o -50 para reforzar la respuesta inmune a un vector (ya sea vírico o basado en ADN) portador de un antígeno, o una proteína. En aún otra alternativa, un régimen de inmunización implica la administración de una proteína seguida de refuerzo con un vector que codifica el antígeno.

En una alternativa, se describe un procedimiento de sensibilización y refuerzo de una respuesta inmune frente a un antígeno seleccionado mediante la liberación de un vector plasmídico de ADN portador de dicho antígeno, seguido de refuerzo con un vector recombinante de SAdV-43, -45, -46, -47, -48, -49 o -50. En una alternativa, el régimen de sensibilización-refuerzo implica la expresión de multiproteínas desde el vehículo de sensibilización y / o refuerzo. Véase, por ejemplo, R.R. Amara, Science, 292:69-74 (6 de abril 2001) que describe un régimen de multiproteínas para la expresión de subunidades de proteína útiles para generar una respuesta inmune contra el VIH y el VIS. Por ejemplo, una sensibilización de ADN puede liberar Gag, Pol, Vif, VPX y Vpr y Env, Tat y Rev a partir de un único transcrito. Como alternativa, las proteínas Gag, Pol del VIS y Env del VIH-1 se liberan en una construcción de adenovirus de SAdV-43, -45, -46, -47, -48, -49 o -50. Otros regímenes más se describen en los documentos WO 99/16884 y WO 01/54719.

Sin embargo, los regímenes de sensibilización-refuerzo no se limitan a la inmunización para el VIH o para la entrega de estos antígenos. Por ejemplo, la sensibilización puede implicar entregar con un primer vector de SAdV-43, -45, - 46, -47, -48, -49 o -50 seguido de refuerzo con un segundo vector Ad, o con una composición que contiene el propio antígeno en forma de proteína. En un ejemplo, el régimen de sensibilización-refuerzo no puede proporcionar una respuesta inmune protectora a los virus, bacterias u otro organismo del que deriva el antígeno. En otro ejemplo, el régimen de sensibilización-refuerzo proporciona un efecto terapéutico que puede medirse utilizando ensayos consenso para la detección de la presencia de la afección para la que se está administrando la terapia.

La composición de sensibilización puede administrarse en diversos sitios en el cuerpo de una manera dependiente de la dosis, que depende del antígeno al que se está dirigiendo la respuesta inmune deseada. La cantidad o el sitio de la inyección o de las inyecciones o el vehículo farmacéutico no es una limitación. Por el contrario, el régimen puede implicar una etapa de sensibilización y/o refuerzo, cada una de las que puede incluir una dosis única o dosis que se administran cada hora, diariamente, semanalmente o mensualmente o anualmente. Como un ejemplo, los mamíferos pueden recibir una o dos dosis que contengan entre aproximadamente 10 g a aproximadamente 50 g de plásmido en el vehículo. Una cantidad deseable de un composición de ADN varía entre aproximadamente 1 mg a aproximadamente 10.000 g del vector de ADN Las dosis pueden variar de aproximadamente 1 g A 1000 g por kg de peso corporal del sujeto. La cantidad o el sitio de liberación se selecciona deseablemente basándose en la identidad y la afección del mamífero.

La unidad de dosificación del vector adecuada para la liberación del antígeno al mamífero se describe en el presente documento. El vector se prepara para su administración mediante suspensión o disolución en un vehículo farmacéutica o fisiológicamente aceptable tal como solución salina isotónica; solución de sales isotónicas u otras formulaciones que serán evidentes para los expertos en tal administración. El vehículo adecuado será evidente para los expertos en la técnica y dependerá en gran parte de la vía de administración. Las composiciones descritas en el presente documento se pueden administrar a un mamífero de acuerdo con las vías descritas anteriormente, en una formulación de liberación sostenida usando un polímero biocompatible biodegradable, o mediante liberación en el sitio utilizando micelas, geles y liposomas. Opcionalmente, la etapa de sensibilización también incluye la administración con la composición de sensibilización, de una cantidad adecuada de un adyuvante,según se define en el presente documento.

Preferiblemente, una composición de refuerzo se administra de aproximadamente 2 a aproximadamente 27 semanas después de administrar la composición de sensibilización al sujeto mamífero. La administración de la composición de refuerzo se realiza utilizando una cantidad efectiva de una composición de refuerzo que contiene o es capaz de liberar el mismo antígeno que se administra mediante la vacuna de ADN de sensibilización. La composición de refuerzo puede estar compuesta por un vector vírico recombinante derivado de la misma fuente vírica (por ejemplo, secuencias adenovíricos de SAdV-43, -45, -46, -47, -48, -49 o -50, respectivamente) o de otra fuente. Como alternativa, la "composición de refuerzo" puede ser una composición que contiene el mismo antígeno que el codificado en la vacuna de ADN de sensibilización, pero en la forma de una proteína o péptido, cuya composición induce una respuesta inmune en el huésped. En otra alternativa, la composición de refuerzo contiene una secuencia de ADN que codifica el antígeno sometido al control de una secuencia reguladora que dirige su expresión en una célula de mamífero, por ejemplo, vectores tales como vectores bacterianos o víricos bien conocidos. Los requisitos principales de la composición de refuerzo son que el antígeno de la composición sea el mismo antígeno que, o un antígeno de reacción cruzada con, el codificado por la composición de sensibilización.

Los vectores de SAdV-43, -45, -46, -47, -48, -49 y -50 también son muy adecuados para su uso en una variedad de otros regímenes de inmunización y terapéuticos. Tales regímenes pueden implicar la liberación de vectores de SAdV-43, -45, -46, -47, -48, -49 o -50 de forma simultánea o secuencial con vectores de Ad de cápsides de serotipos diferentes, regímenes en los que los vectores de SAdV-43, -45, - 46, -47, -48, -49 o -50 se liberan de forma simultánea o secuencialmente con vectores no Ad, regímenes en los que los vectores de SAdV-43, -45, -46, -47, - 48, -49 o -50 se liberan de simultáneamente o secuencialmente con proteínas, péptidos, y / u otros compuestos terapéuticos o inmunógenos biológicamente útiles. Dichos usos serán fácilmente evidentes paraun experto en la técnica.

Los siguientes ejemplos ilustran la clonación de SAdV-43, -45, -46, -47, -48, -49 y -50 y la construcción de vectores recombinantes de ejemplo. Los ejemplos son solo ilustrativos y no limitan el alcance de la presente invención.

Ejemplo 1 - Aislamiento de adenovirus de simio (SAdV-43, -45, -46, -47, -48, -49 y -50)) y análisis por PCR Las muestras de heces se recogieron en las instalaciones que albergan a los animales y se suspendieron en solución salina equilibrada de Hanks y se enviaron a la Universidad de Pennsylvania en hielo. Las partículas se separaron por centrifugación y se esterilizaron por filtración a través de filtros de jeringa de 0,2 m. 100 l de cada muestra filtrada se inocularon en células A549 cultivadas en MEDIO F12 de Ham con 10 % de FBS, 1 % de Penn- Strep y 50 mg / ml de gentamicina. Después de aproximadamente 1 a 2 semanas en cultivo, el CPE visual era evidente en cultivos de células con varios de los inóculos. La presencia de adenovirus en los cultivos se confirmó mediante amplificación por PCR de una región interna de 1,9 kb del hexón - la región que abarca las regiones hipervariables y que es predominantemente responsable de conferir especificidad de serotipo.

El par de cebadores que se utilizó para la PCR fue la SEC ID N.º: 32: CAGGATGCTTCGGAGTACCTGAG y la SEC ID N.º: 33.

TTGGCNGGDATDGGGTAVAGCATGTT. La secuencia obtenida de esta región se utilizó para hacer una determinación inicial de las especies de adenovirus y la novedad del serotipo. Los aislados adenovíricos se purificaron en placa en células A549, se propagaron a título elevado y se purificaron en gradientes de cloruro de cesio utilizando procedimientos estándar.

Los ADN víricos obtenidos a partir de preparaciones de virus purificados se secuenciaron completamente (Qiagen Genómica Services, Hilden, Alemania). Además, una PCR anidada sensible específica para la ADN polimerasa con cebadores externos, SEC ID N.º: 34.

TGATGCGYTTCTTACCTYTGGTYTCCATGAG y SEC ID N.º: 35.

AGTTYTACATGCTGGGCTCTTACCG y cebadores internos, SEC ID N.º: 36.

GTGACAAAGAGGCTGTCCGTGTCCCCGTA y SEC ID N.º: 37.

TCACGTGGCCTACACTTACAAGCCAATCAC, se utilizó como un diagnóstico específico para la eliminación adenovírica.

Ejemplo 2 - Análisis filogenético Ocho (8) genes a utilizar para el subsiguiente análisis filogenético: fibra, hexón, pentón, proteasa, E1A, proteína de unión al ADN (DBP), polimerasa, proteína precursora terminal (pTP). El genoma del adenovirus de simio citado SAdV-25.2 se utilizó como referencia para encontrar las secuencias de codificación de estos genes en genomas no citados (diana). Para detectar un gen en un genoma diana, se realizó el siguiente procedimiento: 1) el gen focal se extrajo a partir del genoma de referencia y se alineó con el genoma diana. Esto proporcionó una ubicación aproximada del gen focal en el genoma diana; 2) se identificaron todos los ORF en el genoma diana que se superponen con la región alineada; 3) si se sabía que el gen tiene un intrón (E1A, la polimerasa y los genes de pTP), se identificaron todos los pares de señal inicio-final GT-AG que conservan la longitud del primer exón hasta el 30 % y la longitud del intrón hasta el 60 % con respecto al gen de referencia; todos los potenciales intrones se cortaron, generando un conjunto de secuencias de codificación potenciales; 4) para cada secuencia de codificación de este grupo, la secuencia de aminoácidos correspondiente se alineó con la secuencia de aminoácidos de referencia; 5) las secuencias de codificación se ordenaron de acuerdo con su puntuación de alineamiento. La secuencia de codificación con la puntuación más alta se consideró la secuencia de codificación para el gen focal en el genoma diana. Todas las alineaciones se realizaron con el software ClustalW v 2.0.9 [Thompson et al., Nucleic Acids Res, 22..: 4673-4680 (1994)].

A partir de los alineamientos de secuencias de nucleótidos resultantes para cada gen, se reconstruyeron los árboles filogenéticos utilizando el software PhyML [Guindon and Gascuel, Syst Biol, 52: 696-704 (2003)] con el modelo HKY85 [Hasegawa et al., J Mol Evol, 22: 160-174 (1985)] con una relación de transición / transversión, fracción de sitios invariables y la distribución gamma discreta de las tasas a través de los sitios [Yang, J Mol Evol., 39: 306-314 (1994)]. Para evaluar la fiabilidad de las filogenias reconstruidas, se realizaron 100 reconstrucciones de arranque para cada gen.

Con el fin de estimar con precisión las tasas de evolución dentro de los clados B, C, E y D, se retiraron todos los adenovirus aislados de monos del Viejo Mundo, así como los aislados HAdV-40 y HAdV-12. Las secuencias de proteínas que quedans se alinearon y retrotradujeron a ADN utilizando el software PAL2NAL [Suyama et al., Nucl Acids Res, 34: W609-612 (2006)]. Las filogenias para esto se generaron con este subconjunto de datos con el mismo modelo que antes. Finalmente, se usó el software PAML [Yang, Mol Biol Evol, 24: 1586-1591 (2007)] con el modelo específico de rama para estimar las relaciones dn / ds en diferentes ramas manteniendo las longitudes de las ramas fijas. El análisis interno de homología se realizó mediante análisis de ventana deslizante SIMPLOT (ventana: 1000 pb, etapa: 20bp) [Lole et al., J Virol, 73: 152-160 (1999)].

A la conclusión de este análisis, las secuencias ahora designadas adenovirus de simio 43 y 45 y divulgadas en el presente documento se determinó que estaban en la subfamilia C. Las secuencias ahora designadas adenovirus de simio 46 y 47 y divulgadas en el presente documento determinó que estaban en la subfamilia B.

La secuencia ahora designada adenovirus de simio 48, 49 y 50 y divulgada en el presente documento se determinó que estaba fuera de cada una de las subfamilias A, B, C, D y E. SAdV-48, -49 y -50 se colocan, por tanto, en un clado sin caracterizar anteriormente. SAdV-48 está tal vez relacionado con SAdV-3 y SAdV-6, ambos previamente aislados de macaco Rhesus y también fuera de las subfamilias A, B, C, D y E. Ciertos genes de SAdV-49 y SAdV-50 demostraron homología con los adenovirus de las especies A y F.

Ejemplo 3 - Análisis de la liberación de citocinas mediante el ensayo de liberación de citocinas de células dendríticas plasmacitoides La PBMC se aislaron de sangre entera recogida en tubos de tipo Vacutainer que contienen EDTA o heparina después de centrifugación de gradiente de densidad con Ficoll (Amersham Bioscience) a 1000 g durante 25 minutos. Las células se recogieron de la interfase y se lavaron con PBS. Las PBMC se incubaron con tampón de lisis ACK para lisar los glóbulos tojos, se lavaron y se resuspendieron en medio RPMI completo (Mediatech) que contiene 10 % de FBS, glutamina 2 mM, HEPES 10 mM, 50 g/ ml de sulfato de gentamicina y Penn / strep.

Las células dendríticas plasmocitoides se aislaron de PBMC humanas obtenidas del núcleo de inmunología, Centro para la Investigación del SIDA (CFAR), Universidad de Pennsylvania, usando un kit de aislamiento de células dendríticas plasmocitoides (Miltenyi Biotec).

Las células se infectaron con diferentes adenovirus a una MDI de 10.000 como se indica. 48 horas más tarde se recogieron los sobrenadantes y se analizaron para determinar la inducción de diversas citocinas y quimiocinas usando una combinación de ELISA (IFN-alfa, Pierce) y el análisis multiplex de citocinas (interleucina-g [IL-6] y la proteína inflamatoria 1α de macrófagos [MIP-1α] (Millipore / Luminex). Debido a los números extremadamente bajos de PDC en la sangre periférica, los datos presentados representan células aisladas a partir de múltiples donantes.

La significación estadística de conjuntos de datos apropiados se estableció mediante una prueba t de student apareada de dos colas cuando p < 0,01.

Tinción de citocinas intracelular (TICC).

La medición de la producción de citocinas por los linfocitos aislados se realizó mediante la tinción combinada de la superficie e intracelular con anticuerpos monoclonales y el posterior análisis de citometría de flujo con cinco colores. 106 linfocitos se incubaron con 1010 partículas de SAdV-48 inactivado por calor o 1g de la biblioteca de péptido hexónico HAdV-5 en presencia de anticuerpos purificados frente a CD49d y CD28 (BD Biosciences) y GolgiPlug (BD Pharmigen) durante 6 horas. Las células se lavaron y se tiñeron con ECD-CD8 (Beckman Coulter) y anticuerpos anti-humanos APC-CD4 (BD Pharmigen). Se lavaron las células, se permeabilizaron con 250 l de la solución de Cytofix / Cytoperm a 4 ºC durante 20 min, se lavaron con solución de Perm / Wash y se tiñeron con anticuerpos anti- citocinas incluyendo FITC-TNF-α (BD Pharmigen), PE-IL2 (Beckman Coulter) y PE-Cy7-IFN-γ (BD Pharmigen) a 4 ºC durante 30 min. Las células se lavaron, se examinaron por citometría de flujo y los datos se analizaron utilizando el software FlowJo (TreeStar, OR).

Había notables similitudes en el perfil de expresión de citocinas / quimiocinas con los adenovirus que pertenecen al mismo grupo de especies. Los virus de la especie C no pudieron elaborar cantidades significativas de ninguna citocina / quimiocina, mientras que los altos niveles de citocinas / quimiocinas se produjeron después de la exposición a los virus de las especies E. Se encontraron niveles detectables pero más variables de citocinas después de la exposición a los virus de especie B. Dentro de cada grupo de especies no hubo diferencias consistentes entre los adenovirus de primates humanos y no humanos.

ELISPOT DE IFN-γ Las PBMC obtenidas partir de macaco rhesus de Covance (N = 15) y Oregon (N = 15) y de macacos de Java de nuestra instalación (N = 10) se evaluaron para determinar los linfocitos T específicas de adenovirus contra una variedad de antígenos [HAdV-5 (especie C ), SAdV-24 (especie E), SAdV-32 (especie B), tres virus derivados de macacos (SADV-48, SAdV-49 y SAdV-50) y péptidos hexónicos HAdV-5] utilizando un ensayo ELISPOT de IFN-γ.

Las placas de titulación de 96 pocillos multimalla (Millipore) se recubrieron durante la noche con anticuerpo frente a IFN-γ humano (Clon DK-1, Mabtech) o de mono (clon GZ-4, Mabtech) en PBS. Se lavaron las placas y luego se bloquearon durante 1 hora con medio completo (RPMI que contiene 10 % de FBS). Las placas se lavaron con medio RPMI y los linfocitos se sembraron en 100 ml de medio completo a 1 y 2 x 5 células por pocillo. Conjuntos de péptidos estimulantes o virus se añadieron a cada pocillo hasta una concentración final de 2 mg / ml de cada péptido o a las diversas concentraciones de virus como se indica en el texto en 100 ml de medio completo. Las células se incubaron a 37 ºC durante 20 h en 5% de CO2. Las placas se lavaron (PBS con 0,05 % de Tween-20) y después se incubaron con el anticuerpo biotinilado frente a IFN-γ humano y de mono (clon B6-1; Mabtech) diluido en tampón de lavado que contiene 2 % de FBS. Las placas se incubaron durante 2 horas y después se lavaron. A cada pocillo se añadió peroxidasa de rábano picante con avidina (Vector Laboratories) y las placas se incubaron durante 1 hora. Las placas se lavaron y las manchas se desarrollaron con sustrato AEC (BD Biosciences). Las manchas se contaron con un lector de ELISPOT automatizado (AID). Se incluyeron PHA (Sigma) y péptido CEF (Mabtech) como controles positivos en cada análisis. Solo recuentos en ELISPOT superiores a 55 unidades formadoras de manchas (UFM) / 106 linfocitos y con valores tres veces el inicial se consideraron positivos.

Los datos ELISPOT de las células estimuladas con SAdV-48 mostraron que las células de la mayoría de los animales no pudieron responder a ningún antígeno de adenovirus evaluado aunque hubo algunos animales con respuestas de bajo nivel.

Se realizó la necropsia de los Macacos rhesus y macacos de Java seleccionados y las células mononucleares se recogieron de sangre periférica y de diversos sitios en el intestino (íleon, colon y recto) se evaluaron para determinar la presencia de linfocitos T específicos de adenovirus utilizando HAdV-5 y SAdV-48 como antígenos. Las consideraciones sobre el bienestar animal impidieron estudios similares en grandes simios. Se detectaron linfocitos T específicos de adenovirus a lo largo del intestino cuando se utilizó SAdV-48 para estimular las células; mostraron una mezcla de células con memoria central y fenotipos de efector-memoria. Es interesante destacar que la presencia de linfocitos T específicos de adenovirus en el intestino no se predijo en base a los análisis de las PBMC correspondientes que eran consistentemente negativos o tenían respuestas muy bajas. Los linfocitos T generados frente a las infecciones por adenovirus endógenos en macacos no se estimularon eficazmente con HAdV-5 usando células de la sangre o de la mucosa. La tinción intracelular de citocinas (ICCS) de muestras de intestino de varios macacos para adenovirus utilizando SAdV-48 como un antígeno reveló un predominio de células T CD4 aunque las frecuencias fueron bajas, pero positivas para la expresión de IFN-γ, TNF-α e IL-2. Los extractos de heces también se analizaron para determinar la presencia de anticuerpos neutralizantes frente a SAdV-35 (especie B) y SAdV-40 (especie C). Tanto la prevalencia como el título se encontró que eran consistentemente más bajos que los del suero.

Ejemplo 4 – Los loci de E3 de adenovirus humanos contienen menos y más pequeños marcos de lectura abierta de CR1 en comparación con los correspondientes adenovirus de simio.

Los estudios anteriores de adenovirus humanos han demostrado que el locus E3 codifica proteínas importantes en la modulación de las respuestas del huésped pero no esenciales para la replicación. Las variaciones en la estructura y la función de los marcos de lectura abierta de E3 pueden contribuir a las marcadas diferencias en las respuestas del huésped que se observaron entre los grandes simios y los seres humanos.

La región E3 de adenovirus puede codificar hasta 9 marcos de lectura abierta. El adenovirus SAdV-48 contiene solo 6 marcos de lectura abierta, la proteína de 12,4K, CR1-alfa, CR1-alfa, RID-α, RID-β y la proteína de 14,7. Los adenovirus SAdV-49 y SAdV-50 contienen solo 5 marcos de lectura abierta, la proteína de 12,4K, CR1 (que tiene la más alta homología con los genes de CR1-beta de otros adenovirus), RID- α, RID-β y la proteína de 14,7.

Los hasta 9 marcos de lectura abierta hallados en muchos adenovirus están altamente conservados a través de los adenovirus de seres humanos y de grandes simios, incluyendo los últimos tres marcos de lectura abierta que codifican las proteínas anti-apoptosis α RID-, RID- β humana y y la proteína 14,7K [Tollefson et al., Nature, 392: 726- 730 (1998)], el producto del primer marco de lectura abierta de E3 que codifica una proteína de 12,5K de función desconocida y la proteína gp19k que se sabe que regula por disminución la expresión de MHC de clase I [Andersson et al., Cell, 43: 215-222 (1985)].

Las marcos de lectura abierta de E3 que quedan numerados de dos a cuatro en diferentes aislados codifican proteínas trans-membrana de función desconocida que contienen un dominio conservado - CR1 (Pfam PF02440) y se designan CR1-α, CR1-β, CR1-γ y CR1-δ respectivamente. Cada grupo de virus de la especie demostró una estructura característica de los marcos de lectura abierta CR1 que variaba entre los diferentes grupos de especies.

Sin embargo, dentro de un grupo de especies se observaron diferencias consistentes entre los aislados de seres humanos y de grandes simios.

Los virus de grandes simios de especie C contenían todos tres ORF de CR1: CR1-α, CR1-β y CR1-γ; los representantes humanos de la familia de la especie C consistentemente carecían del ORF CR1-γ. Los virus de grandes simios de especie b contenían el espectro completo de los 4 CR1; los representantes humanos de la familia de la especie B carecían de CR1-δ (B2 humano) o contenían una versión sustancialmente truncada de CR1-δ (B1 humano). Los virus de grandes simios de especie E contenían los 4 ORF de CR1; el único representante humano de esta familia, HAdV-4, contenía una versión sustancialmente truncada de CR1-γ.

La aparente degeneración de la estructura de CR1 en los virus humanos en comparación con los virus de grandes simios puede tener un impacto sobre la capacidad de los virus para evadir la detección inmune del huésped y la eliminación. La pérdida relativa de la función E3 en los virus humanos puede explicar la respuesta de células T más eficaz y la disminución de la diseminación observada en los seres humanos.

Este análisis de la familia de CR1 de los marcos de lectura abierta ayuda a perfeccionar los posibles escenarios relacionados con la transmisión de especies cruzada de los adenovirus. La estructura del locus E3 a través del árbol filogenético es probablemente reflejo de acontecimientos de duplicación en un ancestro común de los virus de las especies A, B, C, D, E y F, seguidos de posteriores pérdidas de genes (por ejemplo, en el caso de CR1-δ ) sobre todo en los serotipos que infectan a los seres humanos. Esto es más consistente con la transmisión de adenovirus de simios a seres humanos. La otra explicación menos probable es que se produjeron múltiples duplicaciones independientes dentro de las especies B, C, E posteriores a su divergencia.

Ejemplo 5 - Construcción de vectores adenovíricos con deleción de E1 Los vectores se preparan mediante técnicas convencionales, por ejemplo, como se describe en Roy, et al., Human Gene Therapy 15:519-530 (mayo 2004). Por ejemplo, un vector con deleción de E1 de la subfamilia B se prepara como se describe en la publicación internacional N.º: WO 2009/073103, publicada el 11 de junio de 2009. De forma similar, un vector con deleción de E1 de la subfamilia C se prepara como se describe en la publicación internacional N.º: WO 2009/105084, publicada el 27 de agosto de 2009.

Para construir los vectores adenovíricos con deleción de E1 que expresan la nucleoproteína del virus de la gripe, la secuencia de nucleótidos que codifica el virus de la gripe A H1N1 NP (A/Puerto Rico/8/34/Mount Sinai, N.º de acceso en GenBank: AF389119.1) se optimizó en codones y se sintetizó completamente (Celtek Genes, Nashville, TN). Se construyó un casete de expresión compuesto por el promotor temprano de citomegalovirus humano, un intrón sintético (obtenido a partir del plásmido pCI (Promega, Madison, Wisconsin), la secuencia de codificación de la gripe NP optimizada por codones y la señal de poliadenilación de la hormona de crecimiento bovina. El plásmido pShuttle CMV PI FluA NP alberga el casete de expresión descrito anteriormente donde está flanqueado por los sitios de reconocimiento para las enzimas de restricción de corte raro I-CeuI y PI-SceI (New England Biolabs), respectivamente. Con el fin de crear un clon molecular de un vector adenovírico con deleción de E1, primero se crearon clones moleculares de plásmidos de los adenovirus con deleción de E1 en los que se han insertado sitios de reconocimiento para las enzimas de restricción de corte raro I-CeuI y PI-SceI en lugar de una deleción E1. Después los plásmidos adenovíricos con deleción de E1 se digirieron con I-CeuI y PI-SceI y el casete de expresión (digerido por las mismas enzimas) se ligó. Los clones moleculares del plásmido adenovírico resultante resultantes se transfectaron en células HEK 293 para rescatar el vector adenovírico recombinante. El rescate después de la transfección se facilitaba primero liberando el primer genoma adenovírico lineal a partir del plásmido por digestión con enzimas de restricción. Véase Roy, et al., Vaccine 25:6845-6851 (agosto 2007); publicaciones internacionales N.º: WO 2009/073103, publicada el 11 de junio de 2009; y WO 2009/105084, publicada el 27 de agosto de 2009.

Ejemplo 6 – Vacunas con el tetrámero de la nucleoproteína de la gripe adenovírica Se inyectaron a ratones BALB / c por vía intramuscular 1 x 1011 unidades formadoras de partículas (UFP) de un vector adenovirus de simio (SAdV) que codifica un tetrámero de la nucleoproteína de la gripe A (NP) acuerdo con el protocolo de Roy, et al., Vaccine 25:. 6845- 6851 (agosto de 2007). La entrega mediante SAdV-45 (subfamilia C) y SAdV-46 (subfamilia B) se evaluó frente a adenovirus humano (HAdV) 5 (subfamilia C). La cinética de las respuestas de células T CD8 + Ter + al tetrámero NP y los fenotipos de células T se determinaron los días 10 y 20 después de la inyección. Los perfiles de citocinas se determinaron el día 10 después de la inyección.

Cinética A los 10 días de la inyección, ~ 8 % de los linfocitos T CD8 + + Ter eran específicos de la NP entregada mediante HAdV-5. ~ 5,5 % de los linfocitos T CD8 + Ter + eran específicos de la NP liberada mediante SAdV-46. ~ 0,5 % de los linfocitos T CD8 + Ter + eran específicos de la NP entregada mediante SAdV-45 [Porcentajes ~ +/- 0,5 %]. A los 20 días tras la inyección, los linfocitos T Ter + CD8 + específicos de la NP entregadas mediante HAdV-5 habían disminuido al 5,5 %, los linfocitos T Ter + CD8 + específicas de la NP entregadas mediante SAdV-46 habían aumentado al 7 % y los linfocitos Ter+CD8+ + específicas de la NP entregadas mediante SAdV-45 se mantuvieron constantes.

Fenotipo de memoria Los linfocitos T Ter + CD8+se evaluaron para determinar el fenotipo. A los 10 días de la inyección, ~ 7,5 % de los linfocitos T CD8 + + Ter eran específicos de la NP entregada mediante HAdV-5. ~ 0,5 % eran células T de memoria central (MTC), ~ 3 % eran células T efectoras de memoria (TEM) y ~ 4 % eran células T efectoras (TE). Al día 20, ~ 5,5 % de los linfocitos T eran específicas de la NP entregada mediante HAdV-5. ~ 0,5 % eran TCM, ~ 2,5 % era TEM y ~ 2,5 % eran TE.

A los 10 días de la inyección, ~ 4,5 % de los linfocitos T eran específicas de la NP entregada mediante HAdV-46. ~ 0,5 % eran TCM, ~ 2 % era TEM y ~ 2 % eran TE. El día 20, ~ 7 % de los linfocitos T eran específicos de la NP entregada mediante HAdV-46. ~ 0,5 % eran TCM, ~ 4 % era TEM y ~ 2,5 % eran TE. [Porcentajes ~ +/- 0,5 %] Perfil de citocinas Los linfocitos T CD8 + se evaluaron para determinar el perfil de citocinas secretadas a los 10 días de la inyección en los tejidos de bazo y pulmón. Los datos se resumen en la tabla siguiente: Perfiles de citocinas - bazo % de células T CD8 + secretoras de HAdV-5 SAdV-46 citocinas (~ +/- 0,5) Total 6 IFNγ+ TNFα- IL2- 1 0,5 IFNγ+ TNFα+ IL2- 4,5 4 IFNγ+ TNFα+ IL2+ 0,5 0,5 Perfiles de citocinas - pulmón % de células T CD8 + secretoras de HAdV-5 SAdV-46 citocinas (~ +/- 0,5) Total IFNγ+ TNFα- IL2- 7,5 IFNγ+ TNFα+ IL2- 17 14,5 IFNγ+ TNFα+ IL2+ 0,5 0,5 Los resultados para SAdV-45 no mostraron ninguna respuesta inmune. Sin embargo, se creía que esto estaba asociado con la producción de vectores, que se repite.

Numerosas modificaciones y variaciones están incluidas en el alcance de la memoria descriptiva identificada anteriormente y se espera que sean obvias para un experto en la técnica. Tales modificaciones y alteraciones, tales como selecciones de diferentes minigenes o la selección de los vectores o moduladores inmunes se cree que están dentro del alcance de las reivindicaciones adjuntas a este efecto.

Texto libre de listado de secuencias La siguiente información se proporciona para las secuencias que contienen texto libre con el identificador numérico <223>.

SEC ID N.º: (que contiene texto Texto libre en <223> libre) 1 Adenovirus de simio de tipo 43 2 Construcción sintética 3 Construcción sintética 4 Construcción sintética Construcción sintética 6 Construcción sintética 7 Construcción sintética 8 Construcción sintética 9 Construcción sintética Construcción sintética 11 Construcción sintética 12 Construcción sintética 13 Construcción sintética 14 Construcción sintética Construcción sintética 16 Construcción sintética 17 Construcción sintética 18 Construcción sintética 19 Construcción sintética Construcción sintética 21 Construcción sintética 22 Construcción sintética 23 Construcción sintética 24 Construcción sintética Construcción sintética 26 Construcción sintética 27 Construcción sintética 28 Construcción sintética 29 Construcción sintética Adenovirus de simio de tipo 43 31 Construcción sintética 32 Cebador basado en adenovirus de simio Cebador basado en adenovirus de 33 simio 34 Cebador basado en adenovirus de simio Cebador basado en adenovirus de simio (continuación) SEC ID N.º: (que contiene texto Texto libre en <223> libre) Cebador basado en adenovirus de 36 simio 37 Cebador basado en adenovirus de simio 38 Adenovirus de simio de tipo 45 39 Construcción sintética Construcción sintética 41 Construcción sintética 42 Construcción sintética 43 Construcción sintética 44 Construcción sintética Construcción sintética 46 Construcción sintética 47 Construcción sintética 48 Construcción sintética 49 Construcción sintética Construcción sintética 51 Construcción sintética 52 Construcción sintética 53 Construcción sintética 54 Construcción sintética Construcción sintética 56 Construcción sintética 57 Construcción sintética 58 Construcción sintética 59 Construcción sintética Adenovirus de simio de tipo 45 61 Construcción sintética 62 Construcción sintética 63 Construcción sintética 64 Construcción sintética Adenovirus de simio de tipo 45 66 Construcción sintética 67 Adenovirus de simio de tipo 45 68 Construcción sintética 69 Adenovirus de simio de tipo 46 Construcción sintética 71 Construcción sintética 72 Construcción sintética 73 Construcción sintética 74 Construcción sintética 75 Construcción sintética 76 Construcción sintética 77 Construcción sintética 78 Construcción sintética 79 Construcción sintética 80 Construcción sintética 81 Construcción sintética 82 Construcción sintética 83 Construcción sintética 84 Construcción sintética 85 Construcción sintética 86 Construcción sintética 87 Construcción sintética 88 Construcción sintética 89 Construcción sintética 90 Adenovirus de simio de tipo 46 91 Construcción sintética (continuación) SEC ID N.º: (que contiene texto Texto libre en <223> libre) 92 Construcción sintética 93 Construcción sintética 94 Construcción sintética 95 Adenovirus de simio de tipo 46 96 Construcción sintética 97 Adenovirus de simio de tipo 46 98 Construcción sintética 99 Adenovirus de simio de tipo 47 100 Construcción sintética 101 Construcción sintética 102 Construcción sintética 103 Construcción sintética 104 Construcción sintética 105 Construcción sintética 106 Construcción sintética 107 Construcción sintética 108 Construcción sintética 109 Construcción sintética 110 Construcción sintética 111 Construcción sintética 112 Construcción sintética 113 Construcción sintética 114 Construcción sintética 115 Construcción sintética 116 Construcción sintética 117 Construcción sintética 118 Construcción sintética 119 Construcción sintética 120 Adenovirus de simio de tipo 47 121 Construcción sintética 122 Construcción sintética 123 Construcción sintética 124 Construcción sintética 125 Adenovirus de simio de tipo 47 126 Construcción sintética 127 Adenovirus de simio de tipo 47 128 Construcción sintética 129 Adenovirus de simio de tipo 48 130 Construcción sintética 131 Construcción sintética 132 Construcción sintética 133 Construcción sintética 134 Construcción sintética 135 Construcción sintética 136 Construcción sintética 137 Construcción sintética 138 Construcción sintética 139 Construcción sintética 140 Construcción sintética 141 Construcción sintética 142 Construcción sintética 143 Construcción sintética 144 Construcción sintética 145 Construcción sintética 146 Construcción sintética 147 Construcción sintética 148 Adenovirus de simio de tipo 48 149 Construcción sintética (continuación) SEC ID N.º: (que contiene texto Texto libre en <223> libre) 150 Construcción sintética 151 Construcción sintética 152 Construcción sintética 153 Adenovirus de simio de tipo 48 154 Construcción sintética 155 Adenovirus de simio de tipo 48 156 Construcción sintética 157 Adenovirus de simio de tipo 49 158 Construcción sintética 159 Construcción sintética 160 Construcción sintética 161 Construcción sintética 162 Construcción sintética 163 Construcción sintética 164 Construcción sintética 165 Construcción sintética 166 Construcción sintética 167 Construcción sintética 168 Construcción sintética 169 Construcción sintética 170 Construcción sintética 171 Construcción sintética 172 Construcción sintética 173 Construcción sintética 174 Construcción sintética 175 Construcción sintética 176 Adenovirus de simio de tipo 49 177 Construcción sintética 178 Construcción sintética 179 Construcción sintética 180 Construcción sintética 181 Adenovirus de simio de tipo 49 182 Construcción sintética 183 Adenovirus de simio de tipo 50 184 Construcción sintética 185 Construcción sintética 186 Construcción sintética 187 Construcción sintética 188 Construcción sintética 189 Construcción sintética 190 Construcción sintética 191 Construcción sintética 192 Construcción sintética 193 Construcción sintética 194 Construcción sintética 195 Construcción sintética 196 Construcción sintética 197 Construcción sintética 198 Construcción sintética 199 Construcción sintética 200 Construcción sintética 201 Construcción sintética 202 Adenovirus de simio de tipo 50 203 Construcción sintética 204 Construcción sintética 205 Construcción sintética 206 Construcción sintética 207 Adenovirus de simio de tipo 50 (continuación) SEC ID N.º: (que contiene texto Texto libre en <223> libre) 208 Construcción sintética

REIVINDICACIONES

1.

Un adenovirus recombinante que tiene una cápside que comprende una proteína hexónica seleccionada de: una proteína hexónica que comprende los aminoácidos 1 a 959 de la SEC ID N.º: 79 (SAdV-46); una proteína hexónica que comprende un fragmento de la proteína hexónica de SAdV que consiste en la SEC ID N.º: 79 con un truncamiento N-terminal o C-terminal de 50 aminoácidos de longitud; y una proteína hexónica que comprende un fragmento de la SEC ID N.º: 79 que consiste en los residuos de aminoácidos 138 a 163, los residuos de aminoácidos 138 a 441, o los residuos de aminoácidos 125 a 443; una proteína pentónica; y una proteína de fibra; encapsidando dicha cápside una molécula heteróloga portadora de un gen unido operativamente a secuencias de control de la expresión que dirigen la transcripción, traducción y / o expresión del mismo en una célula huésped y elementos cis de adenovirus en 5’ y 3’ necesarios para la replicación y la encapsidación, comprendiendo dichos elementos cis una repetición terminal invertida de adenovirus en 5' y una repetición terminal invertida de adenovirus en 3’.

2.

Un adenovirus recombinante de acuerdo con la reivindicación 1, caracterizado porque tiene una proteína hexónica que consiste en los aminoácidos 1 a 959 de la SEC ID N.º: 79 (SAdV-46).

3.

Un adenovirus recombinante de acuerdo con la reivindicación 1, caracterizado porque tiene una cápside que comprende una proteína hexónica que comprende un fragmento de la proteína hexónica de SAdV que consiste en la SEC ID N.º: 79 con un truncamiento en N-terminal o en C-terminal de 50 aminoácidos de longitud.

4.

Un adenovirus recombinante de acuerdo con la reivindicación 1, caracterizado porque tiene una cápside que comprende una proteína hexónica que comprende un fragmento de la SEC ID N.º: 79 que consiste en los residuos de aminoácidos 138 a 441 o los residuos de aminoácidos 125 a 443.

5.

El adenovirus de acuerdo con una cualquiera de las reivindicaciones 1 a 4, en el que dicho adenovirus carece de la totalidad o de una parte del gen E1 y es de replicación defectuosa.

6.

El adenovirus de acuerdo con la reivindicación 1, en el que dicho adenovirus tiene una cápside híbrida.

7.

El adenovirus de acuerdo con la reivindicación 1, en el que la proteína pentónica se selecciona del grupo que consiste en: una proteína pentónica de los aminoácidos 1 a 563 de la SEC ID N.º: 74 (SAdV-46); una proteína pentónica de los aminoácidos 1 a 651 de la SEC ID N.º: 6 (SAdV-43); una proteína pentónica de los aminoácidos 1 a 664 de la SEC ID N.º: 43 (SAdV-45); una proteína pentónica de los aminoácidos 1 a 580 de la SEC ID N.º: 104 (SAdV-47); una proteína pentónica de los aminoácidos 1 a 504 de la SEC ID N.º: 134 (SAdV-48); una proteína pentónica de los aminoácidos 1 a 511 de la SEC ID N.º: 162 (SAdV-49); y una proteína pentónica de los aminoácidos 1 a 511 de la SEC ID N.º: 188 (SAdV-50).

8.

El adenovirus de acuerdo con la reivindicación 1, en el que la proteína de fibra se selecciona del grupo que consiste en: una proteína de fibra de los aminoácidos 1 a 353 de la SEC ID N.º: 89 (SAdV-46); una proteína de fibra de los aminoácidos 1 a 599 de la SEC ID N.º: 22 (SAdV-43); una proteína de fibra de los aminoácidos 1 a 601 de la SEC ID N.º: 59 (SAdV-45); una proteína de fibra de los aminoácidos 1 a 322 de la SEC ID N.º: 119 (SAdV-47); una proteína de fibra de los aminoácidos 1 a 570 de la SEC ID N.º: 147 (SAdV-48); una proteína de fibra de los aminoácidos 1 a 521 de la SEC ID N.º: 174 (SAdV-49); una proteína de fibra de los aminoácidos 1 a 418 de la SEC ID N.º: 175 (SAdV-49); una proteína de fibra de los aminoácidos 1 a 521 de la SEC ID N.º: 200 (SAdV-50); y una proteína de fibra de los aminoácidos 1 a 418 de la SEC ID N.º: 201 (SAdV-50).

9.

El adenovirus recombinante de acuerdo con una cualquiera de las reivindicaciones 1 a 8, en el que dicho adenovirus es un adenovirus seudotipado en el que dicha repetición terminal invertida en 5’ de adenovirus y una repetición terminal invertida en 3’ de adenovirus son adenovirus de una fuente diferente que la fuente de la cápside de adenovirus.

10.

Una composición que comprende un virus de acuerdo con cualquiera de las reivindicaciones 1 a 9 y un vehículo farmacéuticamente aceptable.

11.

Un vector que comprende un ácido nucleico de adenovirus de simio (SAdV) seleccionado del grupo que consiste en: los nucleótidos 1 a 35608 de la SEC ID N.º: 69 (SAdV-46) y su complementaria.