1,751 Patentes de febrero de 2013 (pag. 43)

  1. 1345.-

    Dispositivo de control para turbinas hidráulicas configurado para adaptar el par resistente que ofrece el generador de movimiento del rodete de una turbina hidráulica de manera que se establezca una presión estable a la entrada (Pi) y a la salida (Po) independientemente del caudal circulante (Q) y adaptar la energía eléctrica producida por la turbina para lograr el comportamiento hidráulico deseado, que se caracteriza porque comprende unos primeros medios de control y unos segundos medios de potencia ;...

  2. 1346.-

    Dispositivo de acerrojamiento/desacerrojamiento para hoja corrediza y hoja equipada con un dispositivo de este tipo. La invención se refiere a un dispositivo de acerrojamiento/desacerrojamiento para hoja corrediza de ventana o de puerta, comprendiendo dicho dispositivo un mecanismo de acerrojamiento, que comprende al menos un pestillo y al menos un órgano de mando de cada pestillo, adaptado para poder ser desplazado entre una posición de acerrojamiento y una posición de desacerrojamiento, un tirador ...

  3. 1347.-

    Un sistema de imagen de enfoque automático que incluye un sensor de imagen acoplado a un controlador. El sensor de imagen capta una imagen que tiene al menos un borde con una anchura. El controlador genera una señal de enfoque que es una función de la anchura de borde. Una lente recibe la señal de enfoque y ajusta un enfoque. La anchura de borde se puede determinar mediante diversas técnicas como el uso de gradientes. Un histograma de las anchuras de borde se puede utilizar para determinar si una determinada...

  4. 1348.-

    Procedimiento de difusión de programas audiovisuales (PG) a un terminal (T) a través de una red de tipo IP, apartir de una fuente audiovisual (FAV) asociada a una fuente de señalización (FS), caracterizado porque consiste,con respecto a dicho terminal (T): a) en adquirir (A) un archivo descriptivo de la fuente de señalización (FS), que comprende al menos datos deinformación relativa a un canal de señalización de difusión (SC); b) tras la adquisición de dicho archivo descriptivo, en adquirir (B) de dicha fuente de señalización (FS) a partir de losdatos de dicho archivo...

  5. 1349.-

    Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 8 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 8 y la secuencia complementariade éste: acagccgccuagcauuucaucac (SEC ID Nº: 8); donde dicho(s) fragmento (s) de SEC.ID Nº:8 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº: 8; un fragmento de 19 nt de...

  6. 1350.-

    Dispositivo de producción de energía, que comprende una pila de combustible a alta temperatura que admitecomo combustible una mezcla de metano y vapor de agua a una temperatura y una presión predeterminadas, así como una unidad detransformación de una mezcla gaseosa de etanol y de agua en una mezcla de metano y vapor de agua paraalimentar la pila, caracterizado porque la presión de la mezcla gaseosa de metano y vapor de agua resultante de launidad de transformación es superior a la presión de la mezcla de metano y vapor de agua admitida por la pila,explotada...

  7. 1351.-

    Procedimiento para la fabricación de una máquina de tratamiento para el tratamiento de piezas de trabajohechas preferiblemente, al menos parcialmente, de madera, materiales derivados de la madera, plástico, metal osimilares con, al menos, una parte de soporte de la máquina y, al menos, una unidad de tratamiento unida a la parte de soporte de la máquina, estando hecha la parte de soporte de la máquina , al menos porsecciones, de hormigón, con las siguientes etapas: fabricar la parte de soporte de la máquina de hormigónque presenta un valor medio de...

  8. 1352.-

    Un procedimiento para proteger una de una fruta, una hortaliza o una planta decorativa contra el deterioromicrobiano tras la recolección aplicando a la misma una mezcla que comprende: una fuente de ácido sórbico seleccionado del grupo de ácido sórbico,una sal de metal alcalino de ácido sórbicoy combinaciones de los mismos; y una fuente de ácido fosforoso seleccionada del grupo de una sal de metal alcalino de ácido fosforoso, una salamoniacal de ácido fosforoso y combinaciones de las mismas.

  9. 1353.-

    Procedimiento para realizar el acabado de una placa de madera o de compuesto de madera, en particular placaMDF (de fibras de densidad media) o HDF (de fibras de alta densidad), con una cara superior y una cara inferior,con las siguientes etapas: a) aplicación de una capa de sellado de resina de melamina o de resina úrica sobre la cara superior de laplaca, b) estampado de un motivo decorativo, que presenta colores resistentes al calor, compuesto preferiblementepor tintas resistentes al calor, sobre la capa de sellado, c) aplicación de una capa de protección...

  10. 1354.-

    Recipiente de líquido que puede montarse de forma desacoplable en un conjunto principal de un aparato deimpresión, en el que el conjunto principal incluye (A) un carro en el que pueden montarse de forma desacoplable una serie de recipientes delíquido (1K, 1C, 1M, 1Y) correspondientes a líquidos de diferentes colores, respectivamente, (B) unos contactos eléctricos del aparato correspondientes a los recipientes de líquido,respectivamente, (C) una línea eléctrica común conectada eléctricamente en común con los contactos eléctricos delaparato...

  11. 1355.-

    Un medio de cultivo celular exento de proteínas animales, que comprende putrescina e hidrolizado de soja,en el que la putrescina está presente en el medio de cultivo en una concentración que varía entre 0,5 y 10 mg/L y elhidrolizado de soja está presente en una concentración que varía desde el 0,05 % (p/v) hasta el 1 % (p/v).

  12. 1356.-

    Dispositivo de radiofrecuencia (30; 30'; 30''; 30''') que controla unos medios para alimentar al menos una cargaeléctrica (14, 14') y que comprende una unidad de radiofrecuencia del tipo emisor y/o receptor de señales deradiofrecuencia y conectada mediante un primer conductor (9b) a la red alterna , caracterizado por que la unidadde radiofrecuencia comprende una salida y/o una entrada de señal de radiofrecuencia conectada mediante unenlace de HF a un primer terminal del circuito de sintonía (17; 17') del dispositivo de radiofrecuencia,estando este...

  13. 1357.-

    Método para la producción de un compuesto de interés que incluye el cultivo de una cepa de Bacillus moderadamentetermofílica en una fuente de carbono que contiene sacarosa, caracterizado por que la cepa de Bacillus moderadamentetermofìlica se deriva de una cepa progenitora de Bacillus moderadamente termofílica que no es capaz de utilizar lasacarosa como una fuente de carbono por transformación de dicha cepa progenitora con un polinucleótido que incluyeuna secuencia de ADN que codifica un polipéptido con actividad de fosfotransferasa específica de...

  14. 1358.-

    Disposición de cojinete para un soporte de los dientes en un carrete de una máquina cosechadora, quecomprende un primer elemento de cojinete en forma de un casquillo de cojinete con un taladro de cojinete para el alojamiento giratorio de un soporte de los dientes alrededor de un eje de giro (D) y con medios de fijación para la fijación del casquillo de cojinete en un elemento de soporte de un carrete , así como unsegundo elemento de cojinete en forma de un anillo de cojinete , que se puede fijar sobre el soporte de losdientes , en la...

  15. 1359.-

    Método para producir una composición seca de los compuestos de reacción almacenable, y dicho método incluyelos pasos de a) proporcionar una mezcla líquida de compuestos de reacción, y dicha mezcla líquida incluye cebadores,nucleótidos, una Taq DNA polimerasa y una primera molécula estabilizante, donde dicha primera moléculaestabilizante es una proteína, y b) secar dicha mezcla líquida mediante la reducción de la presión que envuelve a dicha mezcla líquida,en el que dicha composición seca de los compuestos de reacción es soluble en solución...

  16. 1360.-

    Composición de factor VIII formulada sin añadir albúmina a dicha composición, que comprende la siguienteformulación de excipientes además del factor VIII: 300mM a 500 mM de NaCl; del 1% al 4% (peso por volumen) de un agente estabilizante seleccionado de entre el grupoconsistente en sacarosa, trehalosa, rafinosa y arginina; 1 mM a 5 mM de sal de calcio; y un agente tampón para mantener un pH de aproximadamente entre 6 y 8.

  17. 1361.-

    Un transmisor para transmitir datos de difusión a un receptor, el transmisor que comprende: unos medios de procesamiento de entrada configurados para recibir flujos de entrada, para añadir almenos una cabecera en banda base a los flujos de entrada recibidos, y componer al menos una trama en banda base; y unos primeros medios de BICM, Codificación y Modulación Intercalada de Bits, (102; 301 a 308)configurados para codificar datos BCH de la trama en banda base, para codificar LDPC los datoscodificados BCH, y para el intercalado de bits de los...

  18. 1362.-

    Procedimiento para producir una construcción de calzada , que comprende los pasos de (i) aplicar un imprimador sobre una estructura portante , especialmente aplicar un imprimador de hormigón sobre una estructura de hormigón ; (ii) aplicar una película de plástico sobre la estructura portante imprimada según el paso 5 (i); así como acontinuación (iii) aplicar una composición adherente que contiene a) al menos una resina epoxídica sólida b) al menos un polímero termoplástico sólido a temperatura ambiente; y (iv)...

  19. 1363.-

    Una composición de agente antiadhesión para asfalto, comprendiendo la composición de agenteantiadhesión : (A) un copolímero que tiene un peso molecular medio de 5.000 a 100.000 y que incluye unidades constitucionalesrepresentadas por las Fórmulas y que se indican a continuación, en las que una proporción de la unidadconstitucional representada por la Fórmula con respecto a la unidad constitucional representada por la Fórmula es de 3 : 7 a 7 : 3; (B) un tensioactivo que es al menos uno seleccionado entre un tensioactivo de betaína...

  20. 1364.-

    Procedimiento de gestión del control de acceso a al menos un contenido digital en función de al menos un criteriode acceso (A', B'), siendo transmitido dicho contenido digital a al menos un terminal en la forma de un flujode datos; en el que dicho criterio de acceso se almacena en memoria en asociación con un identificador (id) en relación con elterminal, siendo dicho identificador un puntero hacia dicho criterio de acceso; comprendiendo dicho procedimiento las etapas siguientes, en el ámbito de dicho terminal: /a/ recibir el flujo...

  21. 1365.-

    Método para decodificar por reconstrucción de alta frecuencia [HFR] mediante un receptor de audio, comprendiendo el método: recibir un primer flujo de bits, incluyendo el primer flujo de bits una primera señal de banda baja y una pluralidad de parámetros de nivel, en el que los parámetros de nivel de la pluralidad de parámetros de nivel están asociados con diferentes bandas de frecuencia de una pluralidad de bandas de frecuencia, representando un parámetro de nivel de la pluralidad de parámetros de nivel la suma de una potencia de señal...

  22. 1366.-

    Sistema de estantes con armazones para el alojamiento de travesaños (120, 120', 122, 122') longitudinales,y con segmentos de inserción para insertar entre dos travesaños (120, 120', 122, 122') longitudinales opuestos,formándose un segmento de inserción mediante varias regletas de rodillos dispuestas paralelasunas a otras, que están fijadas en sus primeros extremos, a un primer perfil portante, y en sus segundos extremos, a un segundo perfil portante, estando configurada en el extremo superior del primer perfil portante,una primera...

  23. 1367.-

    Un compuesto de la fórmula general Ia: en la que R2 R4, y R5 se seleccionan cada uno independientemente de H, C(≥O)R', C(≥O)OR', P≥O(OR')2, alquilo C1-C18 sustituido o no sustituido, alquenilo C2-C18 sustituido o no sustituido, alquinilo C2-C18 sustituido o no sustituido, arilo sustituido o no sustituido; en la que R1 es C(≥O)R'' o C(≥O)OR'', y R'' es un alquilo con al menos 4 átomos de carbono opcionalmente sustituido o un alquenilo opcionalmente sustituido, donde los sustituyentes opcionales se seleccionan de arilo o grupo...

  24. 1368.-

    Un transmisor para transmitir datos de difusión a un receptor, el transmisor que comprende: unos medios de procesamiento de entrada configurados para recibir flujos de entrada, para añadir al menos una cabecera en banda base a los flujos de entrada recibidos, y componer al menos una trama en banda base; y unos primeros medios de BICM, Codificación y Modulación Intercalada de Bits, (301 a 308) configurados para codificar datos BCH de la trama en banda base, para codificar LDPC los datos codificados BCH, y para el intercalado de bits de...

  25. 1369.-

    Pieza receptora destinada a recibir una barra para su acoplamiento con un elemento de anclaje para hueso,incluyendo la pieza receptora un cuerpo receptor con un extremo superior (9a) y un extremo inferior (17b); una parte receptora de barra con un canal para alojar la barra , y una parte receptora de la cabeza para alojar una cabeza del elemento de anclaje para hueso,teniendo dicha parte receptora de la cabeza un extremo abierto (19, 17b) y siendo flexible para permitir laintroducción y fijación de dicha cabeza; y un anillo...

  26. 1370.-

    Un eje de accionamiento de turbina eólica que comprende: hierro dúctil templado de molde que contiene del 3,0 al 3,8 por ciento en peso de carbono, del 1,9 al 2,8 por ciento enpeso de silicio, hasta el 0,3 por ciento en peso de manganeso, hasta el 0,8 por ciento en peso de cobre, hasta el 2,0 porciento en peso de níquel, hasta el 0,3 por ciento en peso de molibdeno, del 0,03 al 0,06 por 5 ciento en peso demagnesio, menos del 0,05 por ciento en peso de cromo, menos del 0,02 por ciento en peso de vanadio y menos del0,01 por ciento de azufre,...

  27. 1371.-

    Composición cosmética que comprende, en un medio fisiológicamente aceptable, una fase oleosa que tiene un índice de refracción comprendido entre 1,47 y 1,51, por lo menos un agente de coloración goniocromático apropiado para crear un fondo coloreado goniocromático y unas partículas reflectantes apropiadas para crear, cuando se aplica la composición para formar una capa sobre un soporte y se ilumina, unos puntos de sobrebrillo visibles a simple vista, siendo dicho agente de coloración goniocromático seleccionado de tal manera que se...

  28. 1372.-

    Un procedimiento para estimar el tipo de la estructura del Grupo de Imágenes, GoP, de una pluralidad defotogramas de vídeo en una secuencia de vídeo estimando sus tipos de fotogramas, que comprende las etapas de: a) capturar los tamaños de los fotogramas en bytes de cada fotograma de vídeo posterior a un fotograma-Interno inicial, fotograma-I, para obtener una serie de tamaños de fotograma aprovechando las característicasde la capa de transporte que lleva el fotograma de vídeo; b) convertir, después de un número de fotogramas,...

  29. 1373.-

    Un vehículo anfibio que comprende: un asiento para sentarse a horcajadas, un casco de planeo, al menos cuatro ruedas , cada unas de las cuales es móvil entre una localización extendida demodo tierra y una localización retraída de modo agua, en el cual dos de las ruedas son ruedas delanteras dirigibles, que están, al menos en el modo tierra del vehículo, conectadas con un manillar que elconductor puede operar para dirigir el vehículo, un motor que en el modo tierra del vehículo está conectado con al menos una...

  30. 1374.-

    Un tubo absorbente compuesto por una lámina de soporte que consiste en una banda de fibra y un componentede polímero absorbente soportado por y unido a la superficie de dicha lámina de soporte, estando formada dichalámina de soporte en un tubo, soportando la superficie dicho componente de polímero absorbente situado en suinterior.

  31. 1375.-

    Una composición farmacéutica que comprende a) un compuesto que contiene estroncio y b) una vitamina D juntocon uno o más excipientes fisiológicamente aceptables, en la que el compuesto que contiene estroncio seselecciona del grupo que comprende succinato de estroncio, L-aspartato de estroncio, L-glutamato de estroncio,piruvato de estroncio, α-cetoglutarato de estroncio, maleato de estroncio y mezclas de los mismos.

  32. 1376.-

    Cesta para cubiertos para un lavavajillas, que consta de un armazón de la cesta , que consta de un fondo y paredes exteriores , estando configurada la cesta para cubiertos con al menos un apoyo para los cubiertos , para alojar en suspensión piezas de cubertería grandes y estando troquelados los apoyos para los cubiertos como soportes longitudinales y estando unidos pudiendo soltarse y tal que pueden ajustarse en altura y/o en posición mediante soportes de apoyo con el armazón de la cesta y pudiendo disponerse en una...

<< · 22 · 32 · 37 · 40 · 41 · < · 43 · > · 46 · 49 · >>