Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.

Un método para aumentar los títulos de espinosinas de una célula hospedante de S. spinosa

, comprendiendo dicho método transformar la célula hospedante de S. spinosa con un gen heterólogo que codifica una proteína que se une al oxígeno.

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E12166535.

Solicitante: DOW AGROSCIENCES LLC.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 9330 ZIONSVILLE ROAD INDIANAPOLIS, IN 46268 ESTADOS UNIDOS DE AMERICA.

Inventor/es: MOUNCEY,NIGEL, HAN,LEI.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/90 (Introducción estable de ADN extraño en el cromosoma)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/19 (modificados por la introducción de material genético extraño)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/52 (Genes que codifican enzimas o proenzimas)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/62 (teniendo el heterociclo al menos ocho miembros y sólo oxígeno como heteroátomo del ciclo, p. ej. eritromicina, espiramicina, nistatina)
google+ twitter facebookPin it
Ilustración 1 de Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.
Ilustración 2 de Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.
Ilustración 3 de Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.
Ilustración 4 de Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.
Mejora de la producción de espinosinas con proteínas que se unen al oxígeno.

Texto extraído del PDF original:

DESCRIPCIÓN

Mejora de la producción de espinosinas con proteínas que se unen al oxígeno

Campo técnico

La invención se aplica al campo técnico de la genética molecular en la que los genes pueden estar integrados en el cromosoma de Saccharopolyspora spinosa. Un método de ingeniería metabólica incluye la expresión recombinante de una proteína que se une al oxígeno, tal como un gen de hemoglobina, dentro de una región del DNA cromosómi- co que da como resultado el aumento de la producción de espinosinas en Saccharopolyspora spinosa, preferible- mente no teniendo al mismo tiempo un efecto negativo sobre el crecimiento u otras características metabólicas deseadas de Saccharopolyspora spinosa.

La invención se refiere al aumento de los títulos de espinosinas de una célula hospedante de S. spinosa transfor- mando la célula hospedante de S. spinosa con un gen heterólogo que codifica una proteína que se une al oxígeno, como se define en las reivindicaciones que se acompañan.

Antecedentes

Como se describe en la Patente de EE.UU. Nº 5.362.634, el producto de fermentación A83543 es una familia de compuestos relacionados producida por Saccharopolyspora spinosa. Los miembros conocidos de esta familia se han denominado factores o componentes y a cada uno se le ha dado una letra de identificación. Estos compuestos se denominan en adelante espinosina A, B, etc. Los compuestos espinosinas son útiles para el control de arácnidos, nemátodos e insectos, en particular las especies de lepidópteros y dípteros. Los compuestos se consideran compa- tibles con el medio ambiente con un perfil toxicológico atractivo.

Los compuestos espinosinas producidos de forma natural son macrólidos que consisten en una lactona tetracíclica de 21 carbonos que incluye la unión de dos desoxiazúcares: un azúcar neutro (ramnosa) y un aminoazúcar (foro- samina). (Véase Kirst et al., (1991)). Si el aminoazúcar no está presente, los compuestos se han denominado pseu- doagliconas de A, D, etc., y si el azúcar neutro no está presente, entonces los compuestos se han denominado pseudoagliconas inversas de A, D, etc. Una nomenclatura más preferida es referirse a las pseudoagliconas como espinosina A 17-Psa, espinosina D 17-Psa, etc., y a las pseudoagliconas inversas como espinosina A 9-Psa, espi- nosina D 9-Psa, etc.

Los compuestos espinosinas producidos de forma natural se pueden obtener por fermentación de las cepas de S. spinosa NRRL 18395, 18537, 18538, 18539, 18719, 18720, 18743 y 18823 y sus derivadas. Estos cultivos se han depositado y forman parte de la colección de cultivos madre del Midwest Area Northern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, 1815 North University Street, Peoria, 111, 61604.

La Patente de EE.UU. Nº 5.362.634 y la Patente Europea correspondiente Nº 0375316 B1 se refieren a las espinosi- nas A, B, C, D, E, F, G, H y J. Se dice que estos compuestos son producidos cultivando una cepa del nuevo micro- organismo Saccharopolyspora spinosa seleccionado de NRRL 18395, NRRL 18537, NRRL 18538 y NRRL 18539.

El documento WO 93/09126 se refiere a las espinosinas L, M, N, Q, R, S y T. En él también se describen dos cepas productoras de la espinosina J: NRRL 18719 y NRRL 18720, y una cepa que produce las espinosinas Q, R, S y T: NRRL 18823.

El documento WO 94/20518 y la Patente de EE.UU. Nº 5.670.486 se refieren a las espinosinas K, O, P, U, V, W e Y, y sus derivados. En ellos también se describen la cepa NRRL 18743 productora de la espinosina K.

El documento WO 99/46387 se refiere a un método de transformación de cepas de S. spinosa con un vector de DNA recombinante, o una de sus porciones, que incluye una secuencia de DNA que codifica la expresión de una actividad que es limitante de la velocidad en la vía biosintética de las espinosinas.

Feng Liang et al. (Applied Microbiology and Biotechnology, 74(2), 7 November 2006, pp. 390-397) describen la ex- presión de la hemoglobina de Vitreoscilla en Bacillus thuringiensis y varios hospedantes bacterianos heterólogos para mejorar la densidad celular, el metabolismo oxidante y la producción de proteínas.

Sería ventajoso mejorar la producción de los compuestos espinosinas.

Sumario de la invención

La presente invención proporciona un método para aumentar los títulos de espinosinas de una célula hospedante de S. spinosa, comprendiendo dicho método transformar la célula hospedante de S. spinosa con un gen heterólogo que codifica una proteína que se une al oxígeno.

La presente invención proporciona también un método para mejorar la producción de espinosinas en una célula hospedante de S. spinosa, comprendiendo dicho método integrar un gen que codifica una proteína que se une al oxígeno en el DNA cromosómico de la cepa de especies de S. spinosa, en donde la integración del gen que codifica una proteína que se une al oxígeno en el DNA cromosómico comprende: a) crear una fagoteca para identificar un locus genómico; b) clonar dos fragmentos de DNA genómico a partir del locus genómico, en donde un fragmento genómico se clona aguas arriba de un polinucleótido que comprende un gen que codifica una proteína que se une al oxígeno y el se- gundo fragmento genómico se clona aguas abajo de dicho polinucleótido; c) introducir los fragmentos genómicos en una cepa de S. spinosa por transformación; d) obtener transconjugantes; y e) cribar dichos transconjugantes para detectar la presencia de dicho polinucleótido.

La presente invención proporciona también una célula de S. spinosa modificada genéticamente, que comprende un gen heterólogo que codifica una proteína que se une al oxígeno, en la que cuando se expresa el gen heterólogo que codifica una proteína que se une al oxígeno, la célula de S. spinosa modificada genéticamente es capaz de aumen- tar la producción de espinosinas. La presente invención proporciona también una cepa que comprende una pobla- ción de las células de S. spinosa modificadas genéticamente como se ha definido anteriormente.

En realizaciones, la invención proporciona la integración de dos o más genes mejoradores de las espinosinas y/o genes que codifican enzimas biosintéticas de espinosinas. En una realización, se proporciona al menos uno en un sitio neutro en el genoma de la célula hospedante. Se pueden proporcionar cualesquiera polinucleótidos heterólogos adicionales ya sea en el mismo sitio neutro, en una localización genómica diferente o como una construcción de expresión no integrada.

La presente invención incluye dentro de su alcance la transformación de células hospedantes por métodos distintos de la integración genómica de un polinucleótido y también las células hospedantes transformadas y sus usos. Por ejemplo, la invención incluye dentro de su alcance un método para transformar una célula hospedante de S. spinosa con un gen heterólogo de una proteína que se une al oxígeno. En una realización, el gen de la proteína que se une al oxígeno puede ser proporcionado como un casete de expresión. En una realización, el casete de expresión no llega a integrarse en el genoma de la célula hospedante. Por lo tanto, en dichas realizaciones, la secuencia de poli- nucleótido no se expresa en el genoma de la célula hospedante.

Breve descripción de los dibujos

Las realizaciones preferidas de la invención se describen con referencia a los dibujos, en los cuales: La FIG. 1 representa el plásmido pDAB109000 que contiene el fragmento de DNA sintético de 977 pb con pJ201.

La FIG. 2 representa el plásmido pDAB 109001 que resultó de la clonación del casete de expresión del gene de la hemoglobina en pIJ773.

La FIG. 3 representa el mapa de la secuencia final de los clones de cósmidos en la agrupación de genes de obscuri- na. Se muestran los clones de cósmidos solapantes. Las barras rellenas indican el tamaño real de los insertos en el clon del cósmido 1E3 y el clon del cósmido 2N14 con relación a la agrupación de genes de obscurina. Las líneas de puntos indican que sólo un extremo del cósmido se encuentra dentro de la agrupación de genes de obscurina.

La FIG. 4 representa el plásmido pIJ773, que contiene el casete de expresión de resistencia a apramicina (marcado como aac(3) IV).

Descripción detallada

Existen muchos usos para los genes integrados dentro del cromosoma de Saccharopolyspora spinosa. Los genes clonados, bien naturales o heterólogos, se pueden usar para mejorar los rendimientos de las espinosinas naturales y para producir nuevas espinosinas. Se pueden obtener mejores rendimientos, por ejemplo, proporcionando (por ejemplo, integrando en el genoma de una cepa) una copia duplicada del gen para que cualquier enzima sea limitante de la velocidad en dicha cepa. En casos en los que está bloqueada la vía biosintética en una cepa mutante particu- lar, debido a la falta de una enzima requerida, se puede restaurar la producción de las espinosinas deseadas pro- porcionando el gen requerido (por ejemplo, integrando una copia del gen). Cuando se interrumpe una vía biosintéti- ca, se puede crear una cepa precursora diferente.

La presente invención ilustra que la expresión de una proteína que se une al oxígeno en S. spinosa mejora la pro- ducción de una espinosina por la célula de S. spinosa. Más específicamente, se ha demostrado que la expresión de la secuencia del gen de la hemoglobina de Vitreoscilla, en lo sucesivo "VHb", en S. spinosa da como resultado el aumento de la producción de espinosinas. Preferiblemente, para la mejora de cepas de S. spinosa, la transformación estable de un polinucleótido se realizó integrando un casete de expresión génica en el genoma de S. spinosa. Un método de integración es por recombinación homóloga, preferiblemente usando una parte del DNA cromosómico y un elemento de inserción. El DNA cromosómico se puede insertar en el genoma de S. spinosa. Basándose en esta recombinación y como resultado de su aplicación, en una realización de la invención, los casetes de expresión géni- ca aac(3) IV y VHb se integraron por separado en el cromosoma de S. spinosa en el locus de las policétido-sintasas (PKS) de obscurina dando como resultado la inactivación de un gen natural, obsA.

Las siguientes definiciones se utilizan en la presente memoria y deben ser remitidas a la interpretación de las reivin- dicaciones y la parte descriptiva de la memoria.

Como se usa en la presente memoria, se entiende que los artículos indefinidos "un" y "una" precediendo a un ele- mento o componente de la invención no son restrictivos respecto al número de casos (es decir, incidencias) del elemento o componente. Por tanto, "un" o "una" se debe leer como que incluye uno o al menos uno, y la forma en singular del elemento o componente incluye también el plural salvo que el número se entienda claramente que es el singular.

Como se usan en la presente memoria, los términos "que comprende" y "que incluye" significan la presencia de las características, números enteros, etapas o componentes establecidos como se citan en las reivindicaciones, pero que no excluyen la presencia o adición de una o más de otras de sus características, números enteros, etapas, componentes o grupos. Esto significa que una composición, una mezcla, un proceso, un método, un artículo o un aparato que "comprende" o "incluye" una lista de elementos no está limitado sólo a aquellos elementos sino que puede incluir otros no expresamente incluidos en la lista o inherentes a ella. Como se usa en la presente memoria, "o" se refiere a un "o" inclusivo y exclusivo. Por ejemplo, una condición A o B es satisfecha por una cualquiera de las siguientes: A es verdadera (o está presente) y B es falsa (o no está presente), A es falsa (o no está presente) y B es verdadera (o está presente) y tanto A como B son verdaderas (o están presentes).

Como se usa en la presente memoria, el término "aproximadamente" se refiere a la modificación de la cantidad de un ingrediente o reaccionante de la invención o cuando se emplea se refiere a la variación en la cantidad numérica que puede ocurrir, por ejemplo, en los procedimientos típicos de medición y manipulación de líquidos utilizados para la preparación de concentrados o el uso de soluciones en la práctica; en un error involuntario en estos procedimien- tos; en diferencias en la fabricación, fuente o pureza de los ingredientes empleados para preparar las composiciones o llevar a cabo los métodos; y similares. El término "aproximadamente" abarca también cantidades que difieren de- bido a las diferentes condiciones de equilibrio para una composición que resulta de una mezcla inicial particular. Sean o no modificadas por el término "aproximadamente", las reivindicaciones incluyen equivalentes a las cantida- des.

Como se utiliza en la presente memoria, los términos "polipéptido" y "péptido" y "proteína" se usarán indistintamente para referirse a un polímero de dos o más aminoácidos unidos entre sí por un enlace peptídico. En un aspecto, este término también incluye modificaciones del polipéptido posteriores a la expresión, por ejemplo, glicosilaciones, aceti- laciones, fosforilaciones y similares. Incluidos en la definición están, por ejemplo, péptidos que contienen uno o más análogos de un aminoácido o aminoácidos marcados y peptidomiméticos. Los péptidos pueden comprender L- aminoácidos. La referencia en la presente memoria a "polipéptido", "péptido" y "proteína" incluye sus fragmentos, derivados y variantes.

Como se usa en la presente memoria, los términos "péptido de interés", "POI", "producto génico", "producto génico diana" y "producto génico con la región codificadora diana" se refieren al producto peptídico/proteínico deseado codificado por el gen expresado. El péptido de interés puede incluir cualquier producto peptídico/proteínico, inclu- yendo, aunque sin limitación, proteínas, proteínas de fusión, enzimas, péptidos, polipéptidos y oligopéptidos. El pép- tido de interés tiene una longitud que varía desde 2 a 398 aminoácidos. El producto peptídico/proteínico deseado puede ser un péptido/proteína heterólogo, expresado por un gen extraño (es decir, no natural).

Como se utiliza en la presente memoria, el término "construcción genética" se refiere a una serie de ácidos nucleicos contiguos útiles para modular el genotipo o fenotipo de un organismo. Ejemplos no limitantes de construcciones genéticas incluyen, aunque sin limitación, una molécula de ácido nucleico y un marco de lectura abierto, un gen, un casete de expresión, un vector, un plásmido y similares.

Como se utiliza en la presente memoria, el término "gen endógeno" se refiere a un gen natural en su localización natural en el genoma de un organismo.

Como se utiliza en la presente memoria, un "gen extraño" se refiere a un gen que no se encuentra normalmente en el organismo hospedante, pero que es introducido en el organismo hospedante por transferencia de genes. Los genes extraños pueden comprender genes naturales insertados en un organismo no natural o genes quiméricos. Un gen extraño también puede ser denominado un gen no natural. Un gen extraño está preferiblemente optimizado en sus codones para su expresión en una célula hospedante, preferiblemente cuando la célula hospedante es S. spino- sa. La optimización adecuada para la expresión en S. spinosa se incluye en la Tabla 1.

La referencia en la presente memoria a un "gen" incluye, para los fines de la invención, cualquier secuencia codifica- dora o secuencia de control, o sus fragmentos. Un gen puede incluir cualquier combinación de secuencia codificado- ra y secuencia de control, o sus fragmentos. Por lo tanto, un "gen" como se cita en la presente memoria puede ser todo o parte de un gen natural. Una secuencia de polinucleótido como se cita en la presente memoria se puede usar indistintamente con el término "gen", o puede incluir cualquier secuencia codificadora, secuencia no codificadora o secuencia de control, sus fragmentos y sus combinaciones.

Como se usa en la presente memoria, el término "heterólogo" con respecto a una secuencia dentro de un organis- mo/genoma particular indica que la secuencia se origina a partir de una especie extraña, o, si procede de la misma especie, está sustancialmente modificada a partir de su forma natural en composición y/o locus genómico y/o núme- ro de copias por intervención humana deliberada. Por tanto, cuando el gen es un gen natural, puede ser heterólogo si ha sido mutado, replicado (es decir, aumentado el número de copias) o movido (es decir, su localización dentro de la célula). Así, por ejemplo, la expresión génica heteróloga se refiere al proceso de expresar un gen a partir de un organismo/genoma colocándolo en el genoma de un organismo/genoma diferente.

Como se usa en la presente memoria, el término "recombinante" se refiere a una combinación artificial de dos seg- mentos de secuencia que estarían de otro modo separados, por ejemplo, por síntesis química o por la manipulación de segmentos aislados de ácidos nucleicos por técnicas de ingeniería genética. "Recombinante" incluye también la referencia a una célula o vector, que ha sido modificado por la introducción de un ácido nucleico heterólogo o una célula procedente de una célula así modificada, pero no abarca la alteración de la célula o vector por episodios que ocurren de forma natural (por ejemplo, mutación espontánea, transformación natural, transducción natural, transpo- sición natural), tales como los que se producen sin intervención humana deliberada. Una célula hospedante recom- binante de la presente invención será distinguible de una célula de origen natural de la misma especie en virtud de la presencia en ella de DNA extraño (por ejemplo, marcadores de selección, vectores, genes no naturales), o en virtud de una estructura genética alterada (por ejemplo, eliminación o interrupción de secuencias naturales, cambios en la orientación de las secuencias naturales, promotores alterados u otras secuencias de control, números de copia alte- rados, localización alterada de secuencias naturales). Además de lo anterior, una célula hospedante recombinante de la invención mostrará mejor producción de espinosinas en comparación con una célula no modificada del mismo tipo. Con referencia a la célula, recombinante puede ser utilizado indistintamente con el término "modificada genéti- camente".

Una "cepa" como se denomina en la presente memoria es una población de células que desciende de un solo orga- nismo o que es un material aislado de un cultivo sustancialmente puro. En una realización, una cepa puede com- prender al menos 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% de células hospedantes modificadas genéticamente, tal como se define en la presente memoria.

El término "modificado genéticamente" o "alterado genéticamente" significa la alteración científica de la estructura del material genético de un organismo vivo. Implica la producción y uso del DNA recombinante. En particular, se usa para definir el organismo genéticamente diseñado o modificado a partir del organismo de origen natural. La modifi- cación por ingeniería genética se puede realizar por varios métodos conocidos en la técnica, tales como por ejemplo, sustitución de genes, amplificación de genes, interrupción de genes, transfección, transformación utilizando plásmi- dos, virus u otros vectores. Un organismo modificado genéticamente, por ejemplo, un microorganismo modificado genéticamente, se denomina también a menudo un organismo recombinante, por ejemplo, un microorganismo re- combinante.

Como se utiliza en la presente memoria, el término "interrumpido" o "interrupción" se refiere a un gen que ha sido manipulado o modificado por ingeniería genética o por causas naturales que cambian la actividad de un gen. Dicha actividad génica se puede aumentar o disminuir, en comparación con la actividad génica no interrumpida. Además, dicha interrupción puede alterar o suprimir la expresión y/o función de las proteínas. La interrupción que causa una disminución en la actividad de los genes puede ser una reducción del número de copias de un gen, provocando así la subexpresión del gen. Se dice que un gen está "subexpresado" si está reducido el nivel de transcripción de dicho gen en comparación con un gen no interrumpido (por ejemplo, el gen de tipo natural). Esto se puede medir, por ejemplo, por análisis de transferencia de Northern cuantificando la cantidad de mRNA como indicación de la expre- sión génica. Como se usa en la presente memoria, un gen se subexpresa si disminuye la cantidad de mRNA gene- rado en al menos 1%, 2%, 5% 10%, 25%, 50%, 75%, 100%, 200% o incluso más de 500% , en comparación con la cantidad de mRNA generado a partir de un gen no interrumpido (por ejemplo, gen de tipo natural). Alternativamente, la interrupción puede incluir la expresión del gen a partir de una secuencia de control débil, tal como un promotor, en comparación con el promotor natural. En otra realización, se pueden alterar el promotor, la región reguladora y/o el sitio de unión al ribosoma aguas arriba del gen para lograr la expresión reducida. En otra realización, también se puede reducir la expresión disminuyendo la semivida relativa del RNA mensajero. En otra realización, se puede disminuir la actividad de un polipéptido propiamente dicho, por ejemplo empleando una o más mutaciones en la secuencia de aminoácidos del polipéptido, que disminuyen la actividad. Por ejemplo, la alteración de la afinidad del polipéptido para su sustrato correspondiente puede dar lugar a una actividad reducida. Igualmente, se puede dismi- nuir la semivida relativa del polipéptido. En cualquier caso, sea la expresión del gen reducida o la actividad reducida, la reducción se puede conseguir alterando la composición de los medios de cultivos celulares y/o los métodos utili- zados para el cultivo. "Expresión reducida" como se utiliza en la presente memoria significa una disminución de al menos 5%, 10%, 25%, 50%, 75%, 100%, 200% o incluso más de 500%, en comparación con la cantidad de mRNA o proteína generados en comparación con el gen no interrumpido (por ejemplo, un gen de tipo natural). "Actividad reducida" como se usa en la presente memoria significa una disminución de al menos 5%, 10%, 25%, 50%, 75%,100%, 200% o incluso más de 500%, en comparación con la actividad o concentración de la proteína, polinucleótidoo gen antes de la interrupción. La actividad de una proteína también se puede reducir poniendo en contacto la pro- teína con un inhibidor específico o general de su actividad. Los términos "actividad reducida", "actividad disminuida o suprimida" se usan indistintamente en la presente memoria.

En otra realización, la interrupción puede aumentar la actividad o expresión de un gen. Una secuencia de control, tal como el promotor, la región reguladora y/o el sitio de unión al ribosoma aguas arriba del gen se puede alterar para lograr el aumento de la expresión. En otra realización, el aumento de la expresión se puede lograr aumentando el número de copias del gen. En una realización, la sobreexpresión también se puede lograr aumentando la semivida relativa del RNA mensajero. En otra realización, la actividad del polipéptido propiamente dicho se puede aumentar realizando una o más mutaciones en la secuencia de aminoácidos del polipéptido, lo que aumentaría la actividad. Por ejemplo, la alteración de la afinidad del polipéptido para su sustrato correspondiente puede dar como resultado mayor actividad. Igualmente, se puede aumentar la semivida relativa del polipéptido. En cualquiera caso, sea la sobreexpresión del gen o la actividad aumentada, el aumento puede conseguirse alterando la composición de los medios de cultivos celulares y/o los métodos utilizados para el cultivo. "Sobreexpresión" o "actividad aumentada" como se usa en la presente memoria significa un aumento de al menos 5%, 10%, 25%, 50%, 75%, 100%, 200% o incluso más de 500%, en comparación con una proteína, polinucleótido o gen de tipo natural; o la actividad y/o la concentración de la proteína presente antes de la interrupción para aumentar la expresión y/o la actividad. La activi- dad de una proteína también se puede aumentar poniendo en contacto la proteína con un inhibidor específico o general de su actividad. Los términos "sobreexpresión" y "actividad aumentada" se pueden utilizar indistintamente.

"Alterar" con referencia a los cambios en la expresión o actividad puede incluir mutación, sustitución, deleción o adición de una secuencia génica de control o secuencia de polinucleótido o sus fragmentos.

En la presente memoria, mejora o aumento de la producción de espinosinas significa un aumento en la cantidad de una o más espinosinas naturales o la producción de una o más nuevas espinosinas, en comparación con la produc- ción de espinosinas por una célula hospedante del mismo tipo cuando se desarrolla en las mismas condiciones (por ejemplo, fermentación en un matraz con agitación) durante el mismo período de tiempo. Preferiblemente, los méto- dos y las células hospedantes de la presente invención proporcionan un aumento en el título de las espinosinas naturales de al menos 4%, 4,6%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20 %, 30%, 40%, 50%, 60%, 70%, 80%, 90% o al menos 100%.

La expresión "secuencias de control" se refiere colectivamente a secuencias promotoras, sitios de unión al ribosoma, secuencias de terminación de la transcripción, dominios reguladores aguas arriba, potenciadores y similares, que proporcionan colectivamente la transcripción y traducción de una secuencia codificadora en una célula hospedante.

Una cualquiera o más de las "secuencias de control" antes mencionadas seleccionadas del grupo antes mencionado se puede proporcionar en un casete de expresión. No todas estas secuencias de control necesitan siempre estar presentes en un vector recombinante, siempre que el gen deseado sea capaz de ser transcrito y traducido.

En la presente memoria, la referencia a DNA cromosómico o al genoma de la célula hospedante se puede usar indistintamente.

"Recombinación" se refiere a la redistribución de secciones de secuencias de DNA o RNA entre dos moléculas de DNA o RNA. La "recombinación homóloga" se produce entre dos moléculas de DNA que se hibridan en virtud de las secuencias de nucleótidos homólogas o complementarias presentes en cada molécula de DNA.

La referencia en la presente memoria a un "gen mejorador de espinosinas" incluye cualquier secuencia de polinu- cleótido que, cuando se proporciona en una célula hospedante de S. spinosa, tiene el efecto de aumentar la expre- sión o actividad de una espinosina natural, o permitir la expresión de una nueva espinosina o un derivado de una espinosina natural. Un gen mejorador de espinosinas puede ser una secuencia de control o una secuencia codifica- dora, o ambas, o sus fragmentos. También están incluidos sus derivados y variantes. En una realización, un gen mejorador de espinosinas puede codificar una proteína que se une al oxígeno. Además, la proteína que se une al oxígeno puede ser cualquier proteína que se una al oxígeno, en particular las que se unen al oxígeno de forma re- versible, tales como las globinas. Un gen mejorador de espinosinas puede ser un gen que codifica una enzima bio- sintética de espinosinas.

Las "proteínas que se unen al oxígeno" que se pueden utilizar en la invención incluyen, aunque sin limitación, hemo- globina de Vitreoscilla (VHb), flavohemoproteína de Alcaligenes eutrophus, mioglobina de corazón de caballo, he- moproteína de E. coli, hemoproteína de B. subtilis, flavohemoglobina de levadura, leghemoglobina de soja, leghe- moglobina de altramuz y mioglobina de esperma de ballena. Como se ha indicado antes, la proteína que se une al oxígeno también puede ser una proteína que sea endógena al organismo productor de espinosinas. Alternativamen- te, la proteína que se une al oxígeno puede ser heteróloga del organismo productor de espinosinas.

Un "sitio neutro" para la integración de un casete de expresión génica es aquel que codifica un producto génico que no está implicado en una vía metabólica primaria y no se requiere preferiblemente para la producción de espinosi- nas. Un sitio neutro puede ser uno que codifica un gen que no es necesario para el desarrollo y/o división de la célu- la. Por tanto, si se interrumpe el gen en el sitio neutro, una célula hospedante modificada genéticamente presentará un metabolismo primario y un desarrollo comparable al de una célula hospedante del mismo tipo que no ha sido modificada genéticamente, cuando se mantiene en las mismas condiciones. Un sitio neutro puede ser un sitio de un gen implicado en una vía metabólica secundaria, por ejemplo el locus de la policétido-sintasa (PKS) de obscurina, dando como resultado preferiblemente la inactivación de un gen natural, obsA. La secuencia de un fragmento del gen obsA se denomina en la presente memoria SEQ ID NO 8. Cuando el sitio neutro es un gen, la interrupción pue- de ser en un elemento de control del gen o en la secuencia codificadora del gen, o en ambos. Alternativamente, un sitio neutro puede ser un sitio que no es un gen.

Una vía metabólica primaria incluye las vías esenciales para la supervivencia celular, por ejemplo la glicolisis, la vía de la pentosa-fosfato, el ciclo de TCA y la biosíntesis de aminoácidos. Una vía metabólica secundaria es una que está implicada en la producción de un metabolito secundario, es decir, que no es necesaria para la supervivencia de la célula individual.

Los términos "condiciones restrictivas" o "hibridación en condiciones restrictivas" se refieren a condiciones bajo las cuales una sonda se hibridará preferiblemente con su subsecuencia diana, y en menor grado, o nada en absoluto, a otras secuencias. La "hibridación restrictiva" y las "condiciones de lavado en la hibridación restrictiva" en el contexto de los experimentos de hibridación de ácidos nucleicos, tales como hibridaciones de Southern y de Northern, son dependientes de las secuencias y son diferentes bajo diferentes parámetros ambientales. Una amplia guía para la hibridación de ácidos nucleicos se encuentra en Tijssen (1993) Laboratory Techniques in Biochemistry and Molecu- lar Biology-Hybridization with Nucleic Acid Probes, part I, chapter 2, Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, New York. En general, se seleccionan condiciones de hibridación y de lavado altamente restrictivas para que sean aproximadamente 5ºC inferiores al punto de fusión térmico (Tm) para la secuencia específica a una fuerza iónica y un pH definidos. El Tm es la temperatura (bajo una fuerza iónica y un pH definidos) a la cual el 50% de la secuencia diana se hibrida con una sonda perfectamente coincidente. Se selec- cionan condiciones muy restrictivas para que sean iguales al Tm para una sonda particular.

Un ejemplo de condiciones de hibridación restrictivas para la hibridación de ácidos nucleicos complementarios que tienen más de 100 residuos complementarios en un filtro en una transferencia de Southern o Northern es 50% de formamida con 1 mg de heparina a 42ºC, realizándose la hibridación durante una noche. Un ejemplo de condiciones de lavado altamente restrictivas es con NaCl 0,15 M a 72ºC durante aproximadamente 15 minutos. Un ejemplo de condiciones de lavado restrictivas es un lavado con 0,2xSSC a 65ºC durante 15 minutos (véase, Sambrook et al., (1989) Molecular Cloning - A Laboratory Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Har- bor Press, NY, para la descripción del tampón SSC). Frecuentemente, un lavado muy restrictivo está precedido de un lavado poco restrictivo para eliminar la señal de la sonda de fondo. Un ejemplo de lavado restrictivo medio para un dúplex de, por ejemplo, más de 100 nucleótidos, es 1xSSC a 45ºC durante 15 minutos. Un ejemplo de lavado poco restrictivo para un dúplex de, por ejemplo, más de 100 nucleótidos, es 4-6xSSC a 40ºC durante 15 minutos. En general, una relación señal a ruido de 2x (o superior) que la observada para una sonda no relacionada en el ensayo de hibridación particular indica la detección de una hibridación específica. Los ácidos nucleicos que no se hibridan entre sí en condiciones restrictivas son todavía sustancialmente idénticos si los polipéptidos que codifican son sus- tancialmente idénticos. Esto ocurre, por ejemplo, cuando se crea una copia de un ácido nucleico usando la máxima degeneración de codones permitida por el código genético.

La descripción se refiere también a un polinucleótido aislado hibridable en condiciones restrictivas, preferiblemente en condiciones muy restrictivas, con un polinucleótido como el de la presente descripción.

Como se utiliza en la presente memoria, se pretende que el término "hibridación" describa condiciones para hibrida- ción y lavado bajo las cuales secuencias de nucleótidos homólogas entre sí, en al menos aproximadamente 50%, al menos aproximadamente 60%, al menos aproximadamente 70%, más preferiblemente al menos aproximadamente 80%, incluso más preferiblemente al menos aproximadamente 85% a 90%, lo más preferiblemente al menos 95%, se mantienen típicamente hibridadas entre sí.

En una realización, un ácido nucleico de la descripción es al menos 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99%, o más homólogo de una secuencia de ácido nucleico mostrada en esta solicitud o de sus complementos.

Otro ejemplo no limitativo de condiciones de hibridación restrictivas es la hibridación en 6x cloruro de sodio/citrato de sodio (SSC) a aproximadamente 45ºC, seguido por uno o más lavados en 1xSSC, 0,1% de SDS a 50ºC, preferible- mente a 55ºC, más preferiblemente a 60ºC e incluso más preferiblemente a 65ºC.

Las condiciones altamente restrictivas pueden incluir incubaciones a 42ºC durante un período de varios días, tal como 2-4 días, utilizando una sonda de DNA marcada, tal como una sonda de DNA marcada con digoxigenina (DIG), seguidas de uno o más lavados con 2xSSC, 0,1% de SDS a temperatura ambiente y uno o más lavados con 0,5xSSC, 0,1% de SDS o con 0,1xSSC, 0,1% de SDS a 65-68ºC. En particular, las condiciones altamente restricti- vas incluyen, por ejemplo, una incubación de 2 horas a 4 días a 42ºC utilizando una sonda de DNA marcada con DIG (preparada, por ejemplo, usando un sistema de marcaje con DIG; Roche Diagnostics GmbH, 68298 Mannheim, Alemania) en una solución, tal como solución DigEasyHyb (Roche Diagnostics GmbH) con o sin 100 µg/mL de DNA de esperma de salmón, o una solución que comprende 50% de formamida, 5xSSC (NaCl 150 mM, citrato trisódico 15 mM), 0,02% de dodecilsulfato de sodio, 0,1% de N-lauroilsarcosina y 2% de reactivo de bloqueo (Roche Diagnos- tics GmbH), seguido de lavado de los filtros dos veces durante 5 a 15 minutos en 2xSSC y 0,1% de SDS a tempera- tura ambiente y después lavado dos veces durante 15-30 minutos con 0,5xSSC y 0,1% de SDS o 0,1xSSC y 0,1% de SDS a 65-68ºC.

En algunas realizaciones, una molécula de ácido nucleico aislada de la descripción que se hibrida en condiciones altamente restrictivas con una secuencia de nucleótidos de la descripción puede corresponder a una molécula de ácido nucleico de origen natural. Como se usa en la presente memoria, una molécula de ácido nucleico "de origen natural" se refiere a una molécula de RNA o DNA que tiene una secuencia de nucleótidos que existe en la naturale- za (por ejemplo, codifica una proteína natural).

Un experto en la técnica sabrá qué condiciones aplicar para condiciones de hibridación restrictivas y altamente res- trictivas. Las directrices adicionales con respecto a estas condiciones están fácilmente disponible en la técnica, por ejemplo, en Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; y Au- subel et al., (eds.), 1995, Current Protocols in Molecular Biology (John Wiley & Sons, N.Y.).

En la presente memoria se usa la notación convencional para describir secuencias de polinucleótidos: el extremo izquierdo de una secuencia de polinucleótido monocatenaria es el extremo 5'; la dirección hacia la izquierda de una secuencia de polinucleótido bicatenaria se refiere a la dirección 5'. La dirección de 5' a 3' de la adición de nucleótidos a los transcritos de RNA nuevos se denomina dirección de transcripción. La cadena de DNA que tiene la misma secuencia que un mRNA se denomina "cadena codificadora"; las secuencias en la cadena de DNA que tienen la misma secuencia que un mRNA transcrito a partir del DNA y que se encuentran en 5’ hasta el extremo 5' del trans- crito de RNA se denominan "secuencias aguas arriba"; las secuencias en la cadena de DNA que tienen la misma secuencia que el RNA y que están en 3’ hasta el extremo 3' del transcrito de RNA codificador se denominan "se- cuencias aguas abajo".

La presente descripción incluye dentro de su alcance un método para mejorar la producción de espinosinas en una célula hospedante de S. spinosa, que comprende integrar un polinucleótido en el DNA cromosómico de una célula de S. spinosa, en el que el polinucleótido comprende un gen que codifica una enzima biosintética de espinosinas. La presente descripción también proporciona una célula hospedante de S. spinosa modificada genéticamente que com- prende un polinucleótido integrado en ella, en el que el polinucleótido comprende un gen que codifica una enzima biosintética de espinosinas. La presente descripción se refiere también al uso de una célula hospedante de S. spino- sa que comprende un polinucleótido integrado en ella en la producción de una espinosina, en donde el polinucleótido comprende un gen que codifica una enzima biosintética de espinosina. En una realización, una célula hospedante de la descripción muestra mejor producción de espinosinas, preferiblemente producción de las espinosinas A/D o pro- ducción de las espinosinas J/L en la fermentación en un matraz con agitación.

Un polinucleótido que contiene un gen para una enzima biosintética de espinosinas permitiría el suministro o la du- plicación de genes que codifican enzimas limitantes de la velocidad en la producción de espinosinas. Este podría ser utilizado para aumentar el rendimiento en cualquier circunstancia cuando una de las actividades codificadas limita la síntesis de la espinosina deseada. Se observó un aumento en el rendimiento de las espinosinas A/D cuando se duplicaron genes unidos a la policétido-sintasa de espinosinas integrando un cósmido que los contienen en S. spi- nosa (Madduri et al., 2001). En otro ejemplo, se logró un aumento del rendimiento de este tipo en fermentaciones de Streptomyces fradiae duplicando el gen que codifica una metiltransferasa limitante de la velocidad que convierte macrocina en tilosina (Baltz et al., 1997).

En una realización, la presente descripción proporciona el suministro en una célula hospedante de un gen que codi- fica una enzima biosintética de espinosina, en combinación con el suministro de un gen mejorador de espinosinas, que en una realización puede codificar una proteína que se une al oxígeno. Por tanto, la descripción proporciona mayor producción de espinosinas por la expresión heteróloga de un gen mejorador de espinosinas y la co-expresión de una enzima biosintética de espinosina heteróloga. Se proporcionan métodos, células hospedantes y usos relacio- nados con esta realización.

La presente descripción incluye también dentro de su alcance un método para producir una nueva espinosina o un compuesto intermedio o derivado de espinosina, en una célula hospedante de S. spinosa, que comprende integrar un polinucleótido en el DNA cromosómico de una célula hospedante de S. spinosa, en el que el polinucleótido es capaz de interrumpir la expresión de un gen natural que codifica una enzima biosintética de espinosinas. En una realización, el polinucleótido comprende un fragmento interno de un gen natural que codifica una enzima biosintética de espinosinas. En una realización, el método puede comprender la introducción de un gen heterólogo mejorador de espinosinas en la célula hospedante. La presente descripción proporciona también una célula hospedante de S. spinosa modificada genéticamente que comprende un polinucleótido integrado en ella, en el que el polinucleótido es capaz de interrumpir la expresión de un gen natural que codifica una enzima biosintética de espinosinas. En una realización, el polinucleótido comprende un fragmento interno de un gen natural que codifica una enzima biosintética de espinosinas. En una realización, se puede proporcionar un gen heterólogo mejorador de espinosinas en la célula hospedante. La presente descripción se refiere también al uso de una célula hospedante de S. spinosa que com- prende un polinucleótido integrado en ella en la producción de una espinosina, en el que el polinucleótido es capaz de interrumpir la expresión de un gen natural que codifica una enzima biosintética de espinosinas. En una realiza- ción, el polinucleótido comprende un fragmento interno de un gen natural que codifica una enzima biosintética de espinosinas. En una realización, se puede proporcionar en la célula hospedante un gen heterólogo mejorador de espinosinas. En una realización, una célula hospedante de S. spinosa de la descripción muestra mejor producción de espinosinas, preferiblemente producción de las espinosinas A/D o producción de las espinosinas J/L en la fer- mentación en un matraz con agitación.

En una realización, se puede proporcionar en la célula hospedante modificada genéticamente un gen heterólogo que codifica una enzima biosintética de espinosinas. Por tanto, el método puede comprender adicionalmente transformar la célula con un gen heterólogo que codifica una enzima biosintética de espinosinas. La célula hospedante genéti- camente modificada como se ha definido antes puede comprender adicionalmente un gen heterólogo que codifica una enzima biosintética de espinosinas. El gen heterólogo puede codificar la misma enzima biosintética de espinosi- nas o una enzima biosintética de espinosinas diferente. El gen heterólogo puede codificar una enzima biosintética de espinosinas natural o uno de sus mutantes, derivados, fragmentos o variantes.

Por tanto, la descripción en una realización proporciona un método para producir una nueva espinosina o un com- puesto intermedio o derivado de espinosina, en una célula hospedante de S. spinosa, que comprende: a) integrar un polinucleótido en el DNA cromosómico de una célula hospedante de S. spinosa, en el que el polinucleótido es capaz de interrumpir la expresión de un gen natural que codifica una enzima biosintética de espinosinas; y b) proporcionar en la célula hospedante un gen heterólogo mejorador de espinosinas; c) opcionalmente, proporcionar en la célula hospedante un gen heterólogo que codifica una enzima biosintética de espinosinas. Se describe también una célula hospedante genéticamente modificada que comprende un polinucleótido integrado en ella, en el que el polinucleóti- do es capaz de interrumpir la expresión de un gen natural que codifica una enzima biosintética de espinosinas y que comprende además un gen heterólogo mejorador de espinosinas y opcionalmente un gen heterólogo que codifica una enzima biosintética de espinosinas. Se describe también el uso de dicha célula hospedante en la producción mejorada de una espinosina.

Compuesto intermedios específicos (o sus derivados naturales) podrían ser sintetizados por cepas mutantes de S. spinosa en las que hubieran sido interrumpidos ciertos genes que codifican enzimas para la biosíntesis de espinosi- nas. Dichas cepas se pueden generar integrando, por ejemplo por recombinación homóloga, una secuencia mu- tagénica que contiene un fragmento interno del gen diana. Por la integración, se forman dos copias incompletas del gen biosintético, eliminando con ello la función enzimática que codifica. El sustrato para esta enzima, o alguno de sus derivados naturales, se debe acumular por fermentación de la cepa mutante. En una realización, se utilizó dicha estrategia para generar eficazmente una cepa de Saccharopolyspora erythraea que producía nuevos derivados de 6-desoxieritromicina (Weber & McAlpine, 1992).

Dichas cepas se podrían generar intercambiando la región diana, por recombinación homóloga con doble cruza- miento, con un plásmido mutagénico que contenga el nuevo fragmento entre las secuencias no mutadas que flan- quean la región diana. El gen híbrido produciría proteínas con funciones alteradas, bien que carecieran de una acti- vidad o que realizaran una nueva transformación enzimática. Se acumularía un nuevo derivado por fermentación de la cepa mutante. Esta estrategia se utilizó para generar una cepa de Saccharopolyspora erythraea que produce un nuevo derivado de anhidroeritromicina (Donadio et al., 1993).

Se clonaron los genes que codifican enzimas biosintéticas de espinosinas y marcos de lectura abiertos “ORF” rela- cionados para uso en la presente descripción y se determinó la secuencia de DNA de cada uno. Los genes clonados y los ORF se denominan de aquí en adelante spnA, spnB, spnC, spnD, spnE, spnF, spnG, spnH, spnI, spnJ, spnK, spnL, spnM, spnN, spnO, spnP, spnQ, spnR, spnS, ORFL15, ORFL16, ORFR1, ORFR2, S. spinosa gtt, S. spinosa

gdh, S. spinosa epi y S. spinosa kre. Las secuencias de los genes biosintéticos de espinosinas son conocidas en la técnica y están definidas en US2004/002343 (solicitud Nº 10/329148) por las bases 21111-28898, 28916-35374, 35419-44931, 44966-59752, 59803-76569, 20168-20995, 18541-19713, 17749-18501, 16556-17743, 14799-16418, 13592-14785, 12696-13547, 11530-12492, 10436-11434, 8967-10427, 7083-8450, 5363-6751, 4168-5325, 3416- 4165, 2024-2791, 1135-1971, 76932-77528 y 77729-79984 de la SEQ ID NO: 1, las bases 334-1119 de la SEQ ID NO: 27, las bases 88-1077 de la SEQ ID NO 24, las bases 226-834 de la SEQ ID NO 31 y las bases 1165-1992 de la SEQ ID NO: 24, respectivamente. La referencia en la presente memoria a un gen que codifica una enzima biosin- tética de espinosinas incluye cualquiera de los genes y de los ORF antes mencionados, así como cualesquiera ge- nes y ORF adicionales conocidos por un experto en la técnica. Por tanto, la presente descripción comprende el uso de uno o más genes seleccionados del grupo antes mencionado, o sus fragmentos, derivados o variantes.

En realizaciones en las que está interrumpido un gen natural que codifica una enzima biosintética de espinosinas, la enzima se puede seleccionar de las anteriormente definidas. Un fragmento interno de un gen puede incluir cualquier parte de una secuencia codificadora o no codificadora de un gen, por ejemplo una secuencia de control, regiones no traducidas, secuencias codificadoras, intrones o exones. Se puede determinar un fragmento dependiendo de la localización cromosómica deseada de la secuencia de polinucleótido que se ha de integrar.

La Saccharapolyspora spinosa produce una mezcla de nueve compuestos muy relacionados denominados colecti- vamente "espinosinas". Dentro de la mezcla, las espinosinas A y D, conocidas como espinosad, son los componen- tes principales y tienen la mayor actividad contra insectos diana claves. Las espinosinas J y L, dos de los componen- tes minoritarios dentro de la mezcla de espinosinas, son los precursores de espinotoram, el insecticida de espinosina de la segunda generación.

Espinosad es un insecticida producido por Dow AgroSciences (Indianapolis, Ind.) que está constituido principalmente por aproximadamente 85% de espinosina A y aproximadamente 15% de espinosina D. Las espinosinas A y D son productos naturales producidos por fermentación de Saccharopolyspora spinosa, como se ha descrito en la Patente de EE.UU. Nº 5.362.634. El espinosad es un ingrediente activo de varias formulaciones insecticidas disponible co- mercialmente de Dow AgroSciences, que incluye los productos para el control de insectos TRACER™, SUCCES™, SPINTOR™ y CONSERVE™. Por ejemplo, el producto TRACER está constituido por aproximadamente 44% a apro- ximadamente 48% de espinosad (p/v) o aproximadamente 479 gramos de espinosad por litro (4 libras por galón). Se ha establecido la utilidad de los compuestos de espinosina en formulaciones granulares y líquidas para el control de arácnidos, nemátodos e insectos, en particular, las especies de lepidópteros, tisánopteros y dípteros. Las espinosi- nas A y D también se denominan en la presente memoria espinosinas A/D.

Espinotoram es una mezcla de 5,6-dihidro-3'-etoxi-espinosina J (componente principal) y 3'-etoxi-espinosina L pro- ducidas por Dow AgroSciences. La mezcla se puede preparar por etoxilación de una mezcla de espinosina J y espi- nosina L, seguido por hidrogenación. El doble enlace en 5,6 de la espinosina J y su derivado 3'-etoxi se hidrogenan mucho más fácilmente que el de la espinosina L y su derivado 3'-etoxi, debido al impedimento estérico por el grupo metilo en C-5 en la espinosina L y su derivado 3'-etoxi. Véase, la Patente de EE.UU. Nº 6.001.981. Las espinosinas J y L también se denominan en la presente memoria espinosinas J/L.

En esta solicitud se ha demostrado que la expresión de VHb en S. spinosa da como resultado un aumento en la producción de espinosinas. La expresión de la proteína portadora de oxígeno, VHb, produce niveles elevados de la hemoglobina homodimérica bajo condiciones de crecimiento hipóxicas (Zhang et al., 2007). Entre las hemoglobinas, la VHb tiene un valor medio de la constante de la velocidad de asociación al oxígeno y una constante bastante alta de la velocidad de disociación del oxígeno (cientos de veces mayor que las de otras hemoglobinas). Esto sugiere que VHb es capaz de liberar el oxígeno unido más fácilmente que las demás hemoglobinas (Zhang et al., 2007).

La expresión de VHb en varias cepas de Actinomyces condujo a un aumento en la producción de antibióticos inclu- yendo clortetraciclina, monensina, eritromicina y actinorrodina (Zhang et al., 2007; Magnolo et al., 1991). La cepa de

Streptomyces coelicolor recombinante que expresa VHb produjo diez veces más actinorrodina que la cepa de tipo natural a bajos niveles de oxígeno disuelto (OD) (OD inferior al 5% de saturación en aire) (Magnolo et al., 1991). Además, la producción de actinorrodina por la cepa recombinante que expresa VHb era menos sensible a las condi- ciones de aireación. Aunque la producción de eritromicina no se considera en general sensible a los niveles de OD, siempre que los niveles de OD estén por encima de los niveles mínimos requeridos para el crecimiento, la expresión de VHb en una cepa productora de eritromicina industrial aumentó significativamente los títulos de eritromicina hasta 7,25 g/L desde 4,25 g/L, mientras que redujo la acumulación de biomasa en condiciones de fermentación en un biorreactor alimentado por lotes a escalas entre 10-15 litros (Brunker et al., 1997; 1998; Minas et al., 1998).

Las realizaciones de la presente descripción proporcionan una célula hospedante genéticamente modificada que alberga un gen mejorador de espinosinas integrado en el genoma de S. spinosa.

Se han clonado genes que codifican un gran número de proteínas que se unen al oxígeno y se han determinado sus secuencias. Por ejemplo, las secuencias de polinucleótido conocidas de proteínas de globina útiles en la presente invención incluyen, aunque sin limitación, las que codifican una mioglobina de cianobacterias (Potts et al., 1992, Science 256:1690-1692), hemoglobina de Scapharca inaequivalvis (Gambacurta et al., 1993, FEBS Lett. 330:90-94), mioglobina de Aplysia limacina (Cutruzzola et al., 1996, Biochem. J. 314:83-90), hemoglobina de Ascaris (Sherman et al., 1992, Proc. Natl. Acad. Sci. USA 89:11696-11700), hemoglobina del nemátodo Pseudoterranova decipiens (Dixon et al., 1991, Natl. Acad. Sci. USA 88:5655-5659 y Dixon et al., 1992, J. Mol. Evol. 35:131-136), hemoglobina de Paramecium caudatum (Yamauchi et al., 1992, Biochem. Biophys. Res. Commun. 182:195-200), hemoproteína de Rhizobium meliloti (David et al., 1988, Cell 54:671-683) y Saccharomyces cerevisiae (Shimada et al., 1989, J. Biochem. 105:417-422). Particularmente adecuadas para su uso en la presente invención son las proteínas que se unen al oxígeno que tienen velocidades koff relativamente altas tal como VHb (koff 5600 s-1; Orii and Webster, 1986, J.

Biol. Chem. 261:3544-3547) o afinidad al oxígeno relativamente baja, tal como la mioglobina de corazón de caballo (KD 0,79 µM; Wittenberg et al., 1985, en Nitrogen Fixation Research Progress. H. J. Evand et al., Eds. Martinus Nijhoff Publishers, Dordrecht, p. 354). Por tanto, las proteínas que se unen al oxígeno preferidas pueden ser las proteínas con una velocidad koff para el oxígeno mayor que 10 s-1, más preferiblemente mayor que 100 s-1, o una KD para el oxígeno mayor que 0,5 µM, aunque se entenderá que también serán útiles las proteínas que se unen al oxí- geno con constantes de velocidad fuera de estos parámetros. Como se indicó anteriormente, las proteínas que se unen al oxígeno preferidas incluyen globinas, tales como hemoglobina, mioglobina y legemoglobinas. Las propieda- des de muchas proteínas que se unen al oxígeno, incluyendo globinas, están descritas en la bibliografía. Adicional- mente, las técnicas para determinar las propiedades de unión al oxígeno de una proteína, tal como una globina, son muy conocidas por los expertos en la técnica y se pueden realizar sin excesiva experimentación.

Como se indicó anteriormente dicha proteína que se une al oxígeno para uso en la presente invención, como se ha descrito en la presente memoria a modo de ejemplo de trabajo, es VHb. La secuencia completa del gen de VHb está descrita en la Patente de EE.UU. Nº 5.049.493. Los fragmentos, mutantes, variantes y derivados de VHb que se unen al oxígeno también están dentro del alcance de la presente descripción.

También están incluidos fragmentos, mutantes, variantes y derivados de la secuencia de polinucleótido que codifica VHb, que codifican una proteína que se une al oxígeno. Preferiblemente, la presente descripción proporciona el uso de la secuencia codificadora de VHb del vector de expresión descrito en la SEQ ID NO 1, o sus fragmentos, varian- tes o derivados.

Los mutantes incluyen, aunque sin limitación, "polimorfismo(s) funcional(es)", que como se utiliza en la presente memoria se refiere a un cambio en la secuencia de pares de bases de un gen que produce un cambio cualitativo o cuantitativo en la actividad de la proteína codificada por dicho gen (por ejemplo, un cambio en la especificidad de la actividad; un cambio en el nivel de actividad). El término "polimorfismo funcional" incluye mutaciones, deleciones e inserciones.

En general, la etapa de detección del polimorfismo de interés se puede realizar recogiendo una muestra biológica que contenga DNA de la fuente y determinando a continuación en la muestra biológica la presencia o ausencia de DNA que contiene el polimorfismo de interés.

La determinación de la presencia o ausencia de DNA que codifica una mutación particular se puede llevar a cabo con una sonda de oligonucleótidos marcada con un grupo detectable adecuado y/o por una reacción de amplifica- ción, tal como una reacción en cadena de polimerasa o una reacción en cadena de ligasa (el producto de la cual se puede detectar entonces con una sonda de oligonucleótidos marcada u otras técnicas). Se sabe que para realizar la presente invención se pueden emplear numerosos formatos de ensayo con diferentes sondas de oligonucleótidos. Véase, por ejemplo, la Patente de EE.UU. Nº 4.302.204 de Wahl et al.; la Patente de EE.UU. Nº 4.358.535 de Falkow et al.; la Patente de EE.UU. Nº 4.563.419 de Ranki et al.; y la Patente de EE.UU. Nº 4.994.373 de Stavrianopoulos et al.

La amplificación de una secuencia de ácidos nucleicos seleccionada, o diana, se puede realizar por cualquier medio adecuado. Véase, en general, Kwoh et al., Am. Biotechnol. Lab. 8, 14-25 (1990). Ejemplos de técnicas de amplifica- ción adecuadas incluyen, aunque sin limitación, reacción en cadena de polimerasa, reacción en cadena de ligasa, amplificación por desplazamiento de cadena (véase en general G. Walker et al., Proc. Natl. Acad. Sci. USA 89, 392- 396 (1992); G. Walker et al., Nucleic Acids Res. 20, 1691-1696 (1992)), amplificación basada en la transcripción (véase D. Kwoh et al., Proc. Natl. Acad Sci. USA 86, 1173-1177 (1989)), replicación de secuencias autosostenida (o "3SR") (véase J. Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874-1878 (1990)), el sistema de Qß replicasa (véase P. Lizardi et al., BioTechnology 6, 1197-1202 (1988)), amplificación basada en secuencias de ácidos nucleicos (o "NASBA") (véase R. Lewis, Genetic Engineering News 12 (9), 1 (1992)), la reacción en cadena de reparación (o "RCR") (véase R. Lewis, supra) y amplificación de DNA bumerán (o "BDA") (véase R. Lewis, supra). Generalmente se prefiere la reacción en cadena de polimerasa.

La reacción en cadena de polimerasa (PCR) se puede llevar a cabo de acuerdo con técnicas conocidas. Véase, por ejemplo, las Patentes de EE.UU. Nos. 4.683.195; 4.683.202; 4.800.159; y 4.965.188. En general, la PCR implica, en primer lugar, tratar una muestra de ácido nucleico (por ejemplo, en presencia de una DNA-polimerasa estable al calor) con un cebador oligonucleotídico para cada cadena de la secuencia específica que se ha de detectar en con- diciones de hibridación, de modo que se sintetice un producto de extensión de cada cebador que sea complementa- rio con cada cadena de ácidos nucleicos, siendo los cebadores suficientemente complementarios con cada cadena de la secuencia específica para hibridarse con ella de modo que el producto de extensión sintetizado a partir de cada cebador, cuando se separa de su complemento, pueda servir como un molde para la síntesis del producto de extensión del otro cebador, y luego tratar la muestra en condiciones de desnaturalización para separar los productos de extensión del cebador de sus moldes, si están presentes la secuencia o secuencias que se han de detectar. Es- tas etapas se repiten cíclicamente hasta que se obtiene el grado deseado de amplificación. La detección de la se- cuencia amplificada se puede realizar añadiendo al producto de reacción una sonda de oligonucleótidos capaz de hibridarse con el producto de reacción (por ejemplo, una sonda de oligonucleótidos de la presente descripción), llevando la sonda un marcador detectable y detectando luego el marcador de acuerdo con técnicas conocidas, o por visualización directa sobre un gel. Dichas sondas pueden tener una longitud de 5 a 500 nucleótidos, preferiblemente de 5 a 250, más preferiblemente de 5 a 100 o de 5 a 50 ácidos nucleicos. Cuando las condiciones de la PCR permi- ten la amplificación de todos los tipos alélicos, dichos tipos se pueden distinguir por hibridación con una sonda espe- cífica alélica, por digestión con endonucleasas de restricción, por electroforesis en geles con gradientes de desnatu- ralización u otras técnicas.

La reacción en cadena de ligasa (LCR) también se realiza de acuerdo con técnicas conocidas. Véase, por ejemplo, R. Weiss, Science 254, 1292 (1991). En general, la reacción se lleva a cabo con dos pares de sondas de oligonu- cleótidos: un par se une a una cadena de la secuencia que se ha de detectar; el otro par se une a la otra cadena de la secuencia que se ha de detectar. Cada par juntos solapan completamente la cadena correspondiente. La reacción se realiza, en primer lugar, desnaturalizando (por ejemplo, separando) las cadenas de la secuencia que se ha de detectar, haciendo reaccionar a continuación las cadenas con los dos pares de sondas de oligonucleótidos en pre- sencia de una ligasa estable al calor, de modo que se liguen entre sí cada par de sondas de oligonucleótidos, sepa- rando luego el producto de reacción y repitiendo luego cíclicamente el proceso hasta que la secuencia ha sido ampli- ficada en el grado deseado. A continuación se puede realizar la detección de la misma manera que se ha descrito anteriormente respecto a la PCR.

Las técnicas de amplificación del DNA, tales como las anteriores, pueden implicar el uso de una sonda, un par de sondas o dos pares de sondas que se unen específicamente al DNA que contiene el polimorfismo funcional, pero no se unen al DNA que no contiene el polimorfismo funcional. Alternativamente, la sonda o el par de sondas podría unirse al DNA que tanto contiene como no contiene el polimorfismo funcional, pero produce o amplifica un producto (por ejemplo, un producto de alargamiento) en el que se puede determinar una diferencia detectable (por ejemplo, un producto más corto, donde el polimorfismo funcional es una mutación por deleción). Dichas sondas se pueden generar de acuerdo con técnicas estándares a partir de las secuencias de DNA conocidas en o asociadas a un gen unido a VHb o a partir de secuencias que se pueden generar a partir de dichos genes de acuerdo con técnicas es- tándares.

Se apreciará que las etapas de detección descritas en la presente memoria se pueden realizar directa o indirecta- mente. Otros medios de determinar indirectamente el tipo alélico incluyen la medición de marcadores polimórficos que están unidos al polimorfismo funcional particular, como se ha demostrado para las VNTR (repeticiones en tán- dem de número variable).

La biología molecular comprende una amplia variedad de técnicas para el análisis de secuencias de ácidos nuclei- cos y proteínas. Muchas de estas técnicas y procedimientos constituyen la base de pruebas y ensayos de diagnósti- co clínico. Estas técnicas incluyen análisis por hibridación de ácidos nucleicos, análisis con enzimas de restricción, análisis de secuencias genéticas y la separación y purificación de ácidos nucleicos y proteínas (véase, por ejemplo, J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2 Ed., Cold Spring Harbor Labo- ratory Press, Cold Spring Harbor, N.Y., 1989).

La mayoría de estas técnicas implican realizar numerosas operaciones (por ejemplo, pipeteado, centrifugación y electroforesis) en un gran número de muestras. Dichas operaciones son a menudo complejas y consumen tiempo, y requieren generalmente un alto grado de precisión. Muchas técnicas están limitadas en su aplicación por una falta de sensibilidad, especificidad o reproducibilidad.

El análisis por hibridación de ácidos nucleicos implica generalmente la detección de un número muy pequeño de ácidos nucleicos diana específicos (DNA o RNA) con un exceso de DNA sonda, entre una cantidad relativamente grande de ácidos nucleicos no diana complejos. Una reducción en la complejidad del ácido nucleico en una muestra es útil para la detección de bajo número de copias (es decir, 10.000 a 100.000) de ácidos nucleicos diana. La reduc- ción de la complejidad del DNA se logra en cierto grado por la amplificación de secuencias de ácidos nucleicos dia- na. (Véase, M.A. Innis et al., PCR Protocols: A guide to Methods and Applications, Academic Press, 1990, Spargo et al., 1996, Molecular & Cellular Probes, respecto a la amplificación por desplazamiento de cadena (SDA)). Esto es debido a que la amplificación de ácidos nucleicos diana da como resultado un enorme número de secuencias de ácidos nucleicos diana con relación a las secuencias no diana, mejorando así la etapa de hibridación de dianas subsiguiente.

La etapa de hibridación implica colocar la muestra de DNA preparada en contacto con una sonda indicadora especí- fica en las condiciones óptimas ajustadas para que tenga lugar la hibridación entre la secuencia de DNA diana y la sonda. La hibridación se puede realizar en uno cualquiera entre varios formatos. Por ejemplo, el análisis por hibrida- ción de ácidos nucleicos en múltiples muestras se ha realizado en una variedad de formatos de filtros y de soportes sólidos, (véase Beltz et al., Methods in Enzymology, Vol. 100, Part et al., Eds., Academic Press, New York, Chapter 19, pp. 266-308, 1985). Un formato, la llamada hibridación por "transferencia de mancha", implica la unión no cova- lente de los DNA diana a un filtro seguido por la posterior hibridación con una o varias sondas marcadas con radio- isótopos. La hibridación por "transferencia de mancha" alcanzó un uso generalizado en las dos últimas décadas durante las cuales se desarrollaron muchas versiones (véase Anderson and Young, en Nucleic Acid Hybridization – A Practical Approach, Hames and Higgins, Eds, IRL Press, Washington, D.C., Chapter 4, pp.73-111, 1985). Por ejemplo, el método de transferencia de mancha se ha desarrollado para múltiples análisis de mutaciones genómicas (EP-A 0228075 de Nanibhushan et al.) y para la detección de clones solapantes y la construcción de mapas genó- micos (Patente de EE.UU. Nº 5.219.726 de Evans).

Técnicas adicionales para realizar análisis de hibridación de ácidos nucleicos de múltiples muestras incluyen disposi- tivos múltiplex micro-formateados o de matriz (por ejemplo, chips de DNA) (véase M. Barinaga, 253 Science, pp.1489, 1991; W. Bains, 10 Bio/Technology, pp. 757-758, 1992). Estos métodos unen generalmente secuencias de DNA específicas a áreas específicas muy pequeñas de un soporte sólido, tales como micro-pocillos de un chip de DNA. Estos formatos de hibridación son versiones a microescala de los sistemas de hibridación convencionales por "transferencia de mancha" y en "sándwich".

La hibridación micro-formateada se puede utilizar para realizar "secuenciación por hibridación" (SBH) (véase M. Barinaga, 253 Science, pp. 1489, 1991; W. Bains, 10 Bio/Technology, pp. 757-758, 1992). La SBH hace uso de todos los oligómeros de n-nucleótidos (n-meros) posibles para identificar n-meros en una muestra de DNA descono- cida, que se alinean subsiguientemente por análisis de algoritmos produciendo la secuencia de DNA (véase, Drma- nac, Patente de EE.UU. Nº 5.202.231).

Existen dos formatos para la realización de la SBH. El primer formato implica crear una matriz de todos los n-meros posibles sobre un soporte, que se hibrida luego con la secuencia diana. El segundo formato implica unir la secuencia diana a un soporte, que se sonda secuencialmente con todos los n-meros posibles. Southern (Solicitud de Patente del Reino Unido GB 8810400, 1988; E. M. Southern et al., 13 Genomics 1008, 1992), propuso utilizar el primer for- mato para analizar o secuenciar DNA. Southern identificó una única mutación puntual conocida utilizando DNA ge- nómico amplificado por PCR. Southern describió también un método para sintetizar una matriz de oligonucleótidos sobre un soporte sólido para la SBH. Drmanac et al., (260 Science 1649-1652, 1993) utilizaron un segundo formato para secuenciar varias secuencias cortas de DNA (116 pb). Los DNA diana se unieron a soportes de membrana (formato de "transferencia de mancha"). Cada filtro se hibridó secuencialmente con 272 oligonucleótidos de 10- meros y 1-mero marcados. Se utilizaron amplios intervalos de condiciones restrictivas para lograr una hibridación específica para cada sonda de n-meros. Los tiempos de lavado variaron desde 5 minutos hasta una noche utilizando temperaturas de 0ºC a 16ºC. La mayoría de las sondas requirieron 3 horas de lavado a 16ºC. Los filtros tuvieron que ser expuestos de 2 a 18 horas con el fin de detectar las señales de hibridación.

En general, están disponibles una variedad de métodos para la detección y el análisis de los episodios de hibrida- ción. Dependiendo del grupo indicador (fluoróforo, enzima, radioisótopo, etc.) utilizado para marcar la sonda de DNA, la detección y el análisis se realizan fluorimétricamente, calorimétricamente o por autorradiografía. Observando y midiendo la radiación emitida, tal como la radiación fluorescente o la emisión de partículas, se puede obtener in- formación acerca de los episodios de hibridación. Incluso cuando los métodos de detección tienen muy alta sensibi- lidad intrínseca, la detección de los episodios de hibridación es difícil debido a la presencia de fondo de materiales unidos no específicamente. Por tanto, la detección de episodios de hibridación depende de cómo se pueda realizar la hibridación específica y sensible. En cuanto a los análisis genéticos, se han desarrollado varios métodos que han intentado aumentar la especificidad y sensibilidad.

Una forma de análisis genético es el análisis centrado en la elucidación de polimorfismos en un solo nucleótido ("SNP"). Factores que favorecen el uso de los SNP son su gran abundancia en el genoma humano (especialmente en comparación con repeticiones cortas en tándem (STR)), su localización frecuente dentro de regiones de genes codificadoras o reguladoras (que pueden afectar a la estructura proteica o a los niveles de expresión) y su estabili- dad cuando pasan de una generación a la siguiente (Landegren et al., Genome Research, Vol. 8, pp.769-776, 1998).

Un SNP se define como cualquier posición en el genoma que existe en dos variantes y la variante más común se produce menos del 99% de las veces. Con el fin de utilizar los SNP como marcadores genéticos generalizados, es crucial que puedan ser genotipificados fácil, rápida, precisa y rentablemente. Numerosas técnicas están actualmente disponibles para tipificar los SNP (para revisión, véase Landegren et al., Genome Research, Vol. 8, pp. 769-776, (1998)), las cuales requieren amplificación de la diana. Dichas técnicas incluyen secuenciación directa (Carothers et al., BioTechniques, Vol. 7, pp. 494-499, 1989), polimorfismo de conformación monocatenaria (Orita et al., Proc. Natl. Acad. Sci. USA, Vol. 86, pp. 2766-2770, 1989), amplificación específica de alelos (Newton et al., Nucleic Acids Re- search, Vol. 17, pp. 2503-2516, (1989)), digestión por restricción (Day and Humphries, Analytical Biochemistry, Vol. 222, pp. 389-395, 1994) y ensayos de hibridación. En su forma más básica, los ensayos de hibridación funcionan discriminando indicadores de oligonucleótidos cortos contra dianas apareadas y desapareadas. Se han desarrollado muchas adaptaciones al protocolo básico. Estas incluyen reacción en cadena con ligación (Wu and Wallace, Gene, Vol. 76, pp. 245-254, 1989) y minisecuenciación (Syvanen et al., Genomics, Vol. 8, pp. 684-692, 1990). Otras mejo- ras incluyen el uso de la actividad 5'-nucleasa de la DNA-polimerasa Taq (Holland et al., Proc. Natl. Acad. Sci. USA, Vol. 88, pp. 7276-7280, 1991), balizas moleculares (Tyagi and Kramer, Nature Biotechnology, vol. 14, pp. 303-308, 1996), curvas de desnaturalización por calor (Howell et al., Nature Biotechnology, Vol. 17, pp. 87-88, 1999) y "chips" de DNA (Wang et al., Science, Vol. 280, pp.1077-1082, 1998).

Un fenómeno adicional que se puede utilizar para distinguir los SNP es las energías de interacción de los ácidos nucleicos o energías de apilamiento de bases resultantes de la hibridación de múltiples sondas específicas diana con una sola diana. (Véase, R. Ornstein et al., "An Optimized Potential Function for the Calculation of Nucleic Acid Interaction Energies", Biopolymers, Vol. 17, 2341-2360 (1978); J. Norberg and L. Nilsson, Biophysical Journal, Vol.

74, pp. 394-402, (1998); y J. Pieters et al., Nucleic Acids Research, Vol. 17, nº 12, pp. 4551-4565 (1989)). Este fe- nómeno de apilamiento de bases se usa en un formato único en la presente invención para proporcionar diferencia- les de Tm altamente sensibles que permiten la detección directa de los SNP en una muestra de ácidos nucleicos.

Se han utilizado métodos adicionales para distinguir secuencias de ácidos nucleicos en organismos relacionados o para secuenciar DNA. Por ejemplo, la Patente de EE.UU. Nº 5.030.557 de Hogan et al., describió que la estructura secundaria y terciaria de un ácido nucleico diana monocatenario puede verse afectada por la unión de oligonucleóti- dos "auxiliares" además de los oligonucleótidos "sonda" haciendo que se presenta un mayor Tm entre la sonda y el ácido nucleico diana. Sin embargo, dicha patente se limitaba en su procedimiento a la utilización de energías de hibridación sólo para alterar las estructuras secundaria y terciaria de cadenas de RNA de auto-asociación, que si se dejaban inalteradas tenderían a evitar que la sonda se hibridara con la diana.

Respecto a la secuenciación del DNA, K. Khrapko et al., Federation of European Biochemical Societies Letters, Vol. 256, nº 1,2, pp. 118-122 (1989), por ejemplo, describieron que la hibridación por apilamiento continuo dio como re- sultado una estabilización del dúplex. Adicionalmente, J. Kieleczawa et al., Science, Vol. 258, pp. 1787-1791 (1992), describieron el uso de tramos contiguos de hexámeros para cebar la síntesis de DNA en donde parecía que los tramos contiguos estabilizaban el cebado. Igualmente, L. Kotler et al., Proc. Natl. Acad. Sci. USA, Vol. 90, pp. 4241- 4245, (1993) describieron la especificidad de secuencias en el cebado de las reacciones de secuenciación de DNA por el uso de módulos de oligonucleótidos hexámeros y pentámeros. Además, S. Parinov et al., Nucleic Acids Re-

search, Vol. 24, nº 15, pp. 2998-3004, (1996), describieron el uso de oligómeros de apilamiento de bases para la secuenciación del DNA en asociación con microchips de secuenciación de DNA pasiva. Por otra parte, G. Yershov et al., Proc. Natl. Acad. Sci. USA, Vol. 93, pp. 4913-4918 (1996), describieron la aplicación de las energías del apila- miento de bases en SBH sobre un microchip pasivo. En el ejemplo de Yershov, se anclaron sondas de DNA de 10- meros a la superficie del microchip y se hibridaron con secuencias diana en conjunción con sondas cortas adiciona- les, pareciendo que dicha combinación estabilizaba la unión de las sondas. En dicho formato, podrían ser elucidados segmentos cortos de una secuencia de ácidos nucleicos para la secuenciación de DNA. Yershov señaló además que en su sistema se incrementó el efecto desestabilizador de los desapareamientos utilizando sondas más cortas (por ejemplo, 5-meros). El uso de dichas sondas cortas en la secuenciación de DNA proporcionó la capacidad de discernir la presencia de desapareamientos a lo largo de la secuencia que se estaba sondando en lugar de un único desapareamiento en una localización específica del complejo de hibridación sonda/diana. El uso de sondas más largas (por ejemplo, oligos de 8-meros, 10-meros y 13-meros) fue menos funcional para dichos fines.

Un ejemplo adicional de metodologías que han utilizado el apilamiento de bases en el análisis de ácidos nucleicos incluye la Patente de EE.UU. Nº 5.770.365 de Lane et al., en donde se describe un método para capturar dianas de ácidos nucleicos utilizando una sonda de captura unimolecular que tiene un bucle monocatenario y una región bica- tenaria que actúa junto con una diana de unión para estabilizar la formación de dúplex por las energías de apila- miento.

La secuencia de nucleótidos puede ser modificada convenientemente por mutagénesis dirigida al sitio de acuerdo con métodos convencionales. Alternativamente, la secuencia de nucleótidos se puede preparar por síntesis química, incluyendo, aunque sin limitación, el uso de un sintetizador de oligonucleótidos, en donde los oligonucleótidos se diseñan basándose en la secuencia de aminoácidos del polipéptido deseado, y preferiblemente seleccionando los codones que son favorecidos en la célula hospedante en la que se producirá el polipéptido recombinante.

Las nuevas espinosinas también se pueden producir por mutagénesis de los genes clonados y sustitución en un organismo productor de espinosinas de los homólogos no mutados por los genes mutados. Preferiblemente, la susti- tución comprende un método de introducción de polinucleótidos como se describe en la presente memoria. Se pue- de usar cualquier método de mutagénesis adecuado, incluyendo, por ejemplo mutagénesis de cualquier enzima biosintética de espinosinas bien directamente o por mutagénesis de un gen que codifica una enzima biosintética de espinosinas. La descripción proporciona mutagénesis de cualquier espinosina de S. spinosa. Preferiblemente, la mutagénesis puede implicar, por ejemplo: 1) deleción o inactivación de un dominio de cetorreductasa, deshidratasa o enoil-reductasa (KR, DH o ER) de modo que se bloquee una o más de estas funciones y la cepa produzca una espinosina que tenga un núcleo de lactona con un doble enlace, un grupo hidroxilo o un grupo ceto que no está presente en el núcleo de espinosina A (véase Donadio et al., 1993); 2) sustitución de un dominio de AT de modo que se incorpore en el núcleo de lactona un ácido carboxílico diferente (véase Ruan et al, 1997); 3) adición de un domi- nio de KR, DH o ER a un módulo de PKS existente, de modo que la cepa produzca una espinosina que tenga un núcleo de lactona con un enlace saturado, un grupo hidroxilo o un doble enlace que no está presente en el núcleo de espinosina A; o 4) adición o sustracción de un módulo de PKS completo de modo que el núcleo de lactona cíclica tenga un número mayor o menor de átomos de carbono. Se puede crear una PKS híbrida sustituyendo el dominio de carga de la PKS de espinosina con carga de PKS heteróloga. Véase, por ejemplo, la Patente de EE.UU. Nº 7.626.010. Se ha observado además que las espinosinas por la modificación de los azúcares que están unidos a la cadena principal de la lactona de la espinosina pueden incluir modificaciones del resto de ramnosa y/o forosamina o unión de diferentes desoxiazúcares. El grupo de Salas en España demostró que se pueden producir nuevos com- puestos de policétidos sustituyendo la molécula de azúcar existente por diferentes moléculas de azúcar. Rodríguez et al., J. Mol. Microbiol Biotechnol. 2000 Jul; 2(3): 271-6. Los ejemplos que siguen en la solicitud ayudan a ilustrar el uso de mutagénesis para producir una espinosina con funcionalidad modificada.

El DNA de la región de agrupación de genes de espinosinas se puede utilizar como sonda de hibridación para identi- ficar secuencias homólogas. Por tanto, el DNA clonado de la presente memoria se podría utilizar para localizar otros plásmidos de las genotecas de Saccharopolyspora spinosa que solapen la región descrita en la presente memoria, pero que también contuvieran anteriormente el DNA no clonado de las regiones adyacentes en el genoma de Sac- charopolyspora spinosa. Además, el DNA de la región clonada de la presente memoria se puede utilizar para identi- ficar en otros organismos secuencias no idénticas pero similares. Las sondas de hibridación tienen normalmente una longitud de al menos aproximadamente 20 bases y están marcadas para permitir su detección.

En la invención se pueden utilizar varios tipos de mutagénesis con una variedad de fines. Incluyen, aunque sin limi- tación, mutagénesis puntual aleatoria dirigida al sitio, recombinación homóloga, barajadura del DNA u otros métodos de mutagénesis recursivos, construcción quimérica, mutagénesis que usa moldes que contienen uracilo, mutagéne- sis dirigida por oligonucleótidos, mutagénesis del DNA modificado con fosforotioato, mutagénesis que usa DNA dúplex con huecos o similares, o cualquiera de sus combinaciones. Métodos adecuados adicionales incluyen repa- ración de desapareamiento puntual, mutagénesis que usa cepas hospedantes deficientes en reparación, selección por restricción y purificación por restricción, mutagénesis por deleción, mutagénesis por síntesis génica total, repara- ción por rotura de la doble cadena y similares. Las mutagénesis, que incluyen, aunque sin limitación, la participación de construcciones quiméricas, también están incluidas en la presente descripción. En una realización, la mutagéne- sis puede ser guiada por información conocida de la molécula de origen natural o de la molécula de origen natural alterada o mutada, incluyendo, aunque sin limitación, de la secuencia, comparaciones de secuencias, propiedades físicas, estructura cristalina o similares.

Los genes responsables de las vías metabólicas secundarias en S. spinosa, no esenciales para las actividades me- tabólicas primarias del organismo, representan una fuente atractiva para los sitios neutros. De estos, son de particu- lar interés las agrupaciones de genes de policétido-sintasa que no son de espinosinas puesto que la interrupción de las agrupaciones de genes pueden dar como resultado la eliminación de las vías competidoras potenciales para los precursores comunes de acil-CoA y los cofactores esenciales para la biosíntesis y producción de espinosinas. Esto puede producir una sinergia entre los beneficios de los genes diana y la mayor disponibilidad de los precursores. En una realización, la presente invención proporciona la integración de un polinucleótido como se define en la presente memoria en un sitio neutro en el genoma de la célula hospedante, por ejemplo en el locus de la policétido-sintasa de la obscurina, por ejemplo el gen obsA.

Los textos y ejemplos encontrados en la presente memoria describen estos procedimientos. Se encuentra informa- ción adicional en las siguientes publicaciones y referencias citadas en: Ling et al, Approaches to DNA mutagenesis: an overview, Anal. Biochem. 254(2): 157-178 (1997); Dale et al., Oligonucleotide-directed random mutagenesis using the phosphorothioate method, Methods Mol. Biol. 57:369-374 (1996); Smith, In vitro mutagenesis, Ann. Rev. Genet.

19:423-462 (1985); Botstein & Shortle, Strategies and applications of in vitro mutagenesis, Science 229:1193-1201 (1985); Carter, Site-directed mutagenesis, Biochem. J. 237:1-7 (1986); Kunkel, The efficiency of oligonucleotide directed mutagenesis, en Nucleic Acids & Molecular Biology (Eckstein, F. and Lilley, D.M.J. eds., Springer Verlag, Berlin) (1987); Kunkel, Rapid and efficient site-specific mutagenesis without phenotypic selection, Proc. Natl. Acad. Sci. USA 82:488-492 (1985); Kunkel et al., Rapid and efficient site-specific mutagenesis without phenotypic selection,

Methods in Enzymol. 154, 367-382 (1987); Bass et al., Mutant Trp repressors with new DNA-binding specificities, Science 242:240-245 (1988); Methods in Enzymol. 100:468-500 (1983); Methods in Enzymol. 154:329-350 (1987); Zoller & Smith, Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment, Nucleic Acids Res. 10:6487-6500 (1982); Zoller & Smith, Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors, Methods in Enzymol. 100:468-500 (1983); Zoller & Smith, Oligonucleotide-directed mutagenesis: a simple method using two oligonucleotide primers and a single-stranded DNA template, Methods in Enzymol. 154:329-350 (1987); Taylor et al., The use of phosphorothio- ate-modified DNA in restriction enzyme reactions to prepare nicked DNA, Nucl. Acids Res. 13:8749-8764 (1985); Taylor et al., The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate- modified DNA, Nucl. Acids Res. 13:8765-8787 (1985); Nakamaye & Eckstein, Inhibition of restriction endonuclease

Nci I cleavage by phosphorothioate groups and its application to oligonucleotide-directed mutagenesis, Nucl. Acids Res. 14:9679-9698 (1986); Sayers et al., Y-T Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis, Nucl. Acids Res. 16:791-802 (1988); Sayers et al., Strand specific cleavage of phosphorothioate- containing DNA by reaction with restriction endonucleases in the presence of ethidium bromide, (1988) Nucl. Acids Res. 16:803-814; Kramer et al., The gapped duplex DNA approach to oligonucleotide-directed mutation construction,

Nucl. Acids Res. 12:9441-9456 (1984); Kramer & Fritz, Oligonucleotide-directed construction of mutations via gapped duplex DNA, Methods in Enzymol. 154:350-367 (1987); Kramer et al., Improved enzymatic in vitro reactions in the gapped duplex DNA approach to oligonucleotide-directed construction of mutations, Nucl. Acids Res. 16:7207 (1988); Fritz et al., Oligonucleotide-directed construction of mutations: a gapped duplex DNA procedure without en- zymatic reactions in vitro, Nucl. Acids Res. 16:6987-6999 (1988); Kramer et al., Point Mismatch Repair, Cell 38:879- 887 (1984); Carter et al., Improved oligonucleotide site-directed mutagenesis using M13 vectors, Nucl. Acids Res. 13:4431-4443 (1985); Carter, Improved oligonucleotide-directed mutagenesis using M13 vectors, Methods in Enzy- mol. 154:382-403 (1987); Eghtedarzadeh & Henikoff, Use of oligonucleotides to generate large deletions, Nucl. Acids Res. 14:5115 (1986); Wells et al., Importance of hydrogen-bond formation in stabilizing the transition state of subtil- isin, Phil. Trans. R. Soc. Lond. A 317:415-423 (1986); Nambiar et al., Total synthesis and cloning of a gene coding

for the ribonuclease S protein, Science 223:1299-1301 (1984); Sakamar and Khorana, Total synthesis and expres- sion of a gene for the a-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin), Nucl. Acids Res. 14:6361-6372 (1988); Wells et al., Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites, Gene 34:315-323 (1985); Grundstrom et al., Oligonucleotide-directed mutagenesis by microscale 'shot gun' gene synthesis, Nucl. Acids Res. 13:3305-3316 (1985); Mandecki, Oligonucleotide-directed

double-strand break repair in plasmids of Escherichia coli: a method for site-specific mutagenesis, Proc. Natl. Acad. Sci. USA, 83:7177-7181 (1986); Arnold, Protein engineering for unusual environments, Current Opinion in Biotech- nology 4:450-455 (1993); Sieber, et al., Nature Biotechnology, 19:456-460 (2001). W. P. C. Stemmer, Nature 370, 389-91 (1994); y, 1. A. Lorimer, I. Pastan, Nucleic Acids Res. 23, 3067-8 (1995). Detalles adicionales sobre muchos de los métodos anteriores se pueden encontrar en Methods in Enzymology, Volumen 154, que describe también controles útiles para la localización y resolución de problemas con varios métodos de mutagénesis.

También se pueden utilizar fragmentos de péptidos, polipéptidos, proteínas, polinucleótidos y genes descritos en la presente memoria. Los fragmentos pueden comprender al menos 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o al menos 99% de la longitud de la secuencia de referen- cia (por ejemplo, secuencia de tipo natural o de origen natural). En una realización, los fragmentos pueden ser los que son funcionalmente equivalentes en al menos un aspecto a la secuencia de referencia.

Los términos "homología" o "porcentaje de identidad" se usan indistintamente en la presente memoria. Para los finesde esta invención, se define en la presente memoria que con el fin de determinar el porcentaje de identidad de dossecuencias de aminoácidos o de dos secuencias de ácidos nucleicos, las secuencias se alinean para fines de com- paración óptimos (por ejemplo, se pueden introducir huecos en la secuencia de una primera secuencia de aminoáci- dos o ácidos nucleicos para alineación óptima con una segunda secuencia de aminoácidos o ácidos nucleicos). Se comparan a continuación los residuos de aminoácidos o nucleótidos en las posiciones de aminoácidos o posiciones de nucleótidos correspondientes. Cuando una posición en la primera secuencia está ocupada por el mismo residuo de aminoácidos o nucleótidos que la posición correspondiente en la segunda secuencia, entonces las moléculas son idénticas en dicha posición. El porcentaje de identidad entre las dos secuencias es una función del número de posi- ciones idénticas compartidas por las secuencias (es decir, % de identidad = número de posiciones idénticas/número total de posiciones (es decir, posiciones solapantesx100). Preferiblemente, las dos secuencias tienen la misma longi- tud. En la presente invención, una variante o derivado de péptido, polipéptido, proteína o polinucleótido o secuencia de genes es uno que comprende una o más deleciones, adiciones o sustituciones, y puede tener al menos 20%, 30%, 40%, 50%, 60 %, 70%, 75%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, o al menos 99% de identidad de secuencias con la secuencia de referencia (por ejemplo, de tipo natural o de origen natural). En una variante o derivado, las sustituciones pueden ser sustituciones conservadoras, en las que los aminoácidos o ácidos nucleicos están sustituidos por aminoácidos o ácidos nucleicos que tienen propiedades similares, de tal manera que no se cambie la naturaleza y actividad de la secuencia. Alternativamente, las sustituciones pueden no ser conserva- doras, de tal manera que estén sustituidas por unas que tengan propiedades diferentes que a su vez afecten a la naturaleza y propiedades de la secuencia.

Los expertos en la técnica serán conscientes del hecho de que están disponibles varios programas informáticos diferentes para determinar la homología entre dos secuencias. Por ejemplo, se pueden realizar una comparación de secuencias y la determinación del porcentaje de identidad entre dos secuencias utilizando un algoritmo matemático. En una realización preferida, el porcentaje de identidad entre dos secuencias de aminoácidos se determina utilizan- do el algoritmo de Needleman y Wunsch (J. Mol. Biol. (48):444-453 (1970)) que se ha incorporado al programa GAP en el paquete de programas informáticos GCG (disponible en Internet en la página web de Accelrys, más específi- camente en http://www.accelrys.com), usando bien una matriz Blossom 62 o una matriz PAM250, y un peso de hue- cos de 16, 14, 12, 10, 8, 6 o 4 y un peso de longitudes de 1, 2, 3, 4, 5 o 6. Los expertos en la técnica apreciarán que todos estos parámetros diferentes proporcionarán resultados ligeramente diferentes, pero que el porcentaje de iden- tidad global de dos secuencias no se altera significativamente cuando se utilizan diferentes algoritmos.

Incluso en otra realización, el porcentaje de identidad entre dos secuencias de nucleótidos se determina usando el programa GAP en el paquete de programas informáticos GCG (disponible en Internet en la página web de Accelrys, más específicamente en http://www.accelrys.com), utilizando una matriz NWSgapdna.CMP y un peso de huecos de 40, 50, 60, 70 u 80 y un peso de longitudes de 1, 2, 3, 4, 5 o 6. En otra realización, el porcentaje de identidad entre dos secuencias de aminoácidos o de nucleótidos se determina usando el algoritmo de E. Meyers y W. Miller (CA- BIOS, 4:11-17 (1989) que se ha incorporado en el programa ALIGN (versión 2.0) (disponible en Internet en la página web de Vega, más específicamente ALIGN - IGH Montpellier, o más específicamente en http://vega.igh.cnrs.fr/bin/align-guess.cgi) usando una tabla de residuos de peso PAM120, una penalización por longitud de hueco de 12 y una penalización por hueco de 4.

Las secuencias de ácidos nucleicos y proteínas de la presente descripción se pueden usar además como una "se- cuencia de consulta" para realizar una búsqueda en las bases de datos públicas para, por ejemplo, identificar otros miembros de la familia o secuencias relacionadas. Dichas búsquedas se pueden realizar usando los programas BLASTN y BLASTX (versión 2.0) de Altschul, et al., (1990) J. Mol. Biol. 215:403-10. Las búsquedas de nucleótidos por BLAST se pueden realizar con el programa BLASTN, puntuación = 100, longitud de palabra = 12, para obtener secuencias de nucleótidos homólogas a las moléculas de ácidos nucleicos de la presente descripción.

Las búsquedas de proteínas por BLAST se pueden realizar con el programa BLASTX, puntuación = 50, longitud de palabra = 3, para obtener secuencias de aminoácidos homólogas a las moléculas de proteínas de la presente des- cripción.

Para obtener alineamientos con huecos con fines comparativos, se puede utilizar Gapped BLAST como ha sido descrito por Altschul et al., (1997) Nucleic Acids Res. 25 (17): 3389-3402. Cuando se utilizan los programas BLAST y Gapped BLAST, se pueden usar los parámetros por defecto de los programas respectivos (por ejemplo, BLASTX y BLASTN). (Disponible en Internet en la página web de NCBI, más específicamente en www.ncbi.nlm.nih.gov).

Un casete de expresión para uso en la presente descripción puede comprender una secuencia de polinucleótido, preferiblemente un gen que codifica un gen mejorador de espinosinas y/o un gen que codifica una enzima biosintéti- ca de espinosinas. En una realización, el gen mejorador de espinosinas y un gen que codifica una enzima biosintéti- ca de espinosinas son como se han definido en la presente memoria. Un casete de expresión puede comprender opcionalmente un marcador seleccionable. Un casete de expresión puede comprender opcionalmente una o más secuencias de control, incluyendo un origen de replicación. Un casete de expresión puede comprender opcionalmen- te una o más secuencias para permitir la integración (por ejemplo, por recombinación) en un genoma de una célula hospedante. El término "casete de expresión" se puede usar indistintamente con términos tales como vector de expresión y construcción genética.

Vectores de expresión adecuados para su uso en la presente invención incluyen vectores procariotas y eucariotas (por ejemplo, plásmido, fagémido o bacteriófago), vectores de mamíferos y vectores de plantas. Los vectores proca- riotas adecuados incluyen plásmidos tales como, aunque sin limitación, los comúnmente utilizados para la manipula- ción del DNA en Actinomyces (por ejemplo pSET152, pOJ260, pIJ101, pJV1, pSG5, pHJL302, pSAM2, pKC1250). Dichos plásmidos han sido descritos por Kieser et al., ("Practical Streptomyces Genetics", 2000). Otros vectores adecuados pueden incluir plásmidos tales como los capaces de replicación en E. coli (por ejemplo, pBR322, ColE1, pSC101, PACYC 184, itVX, pRSET, pBAD (Invitrogen, Carlsbad, Calif.) y similares). Dichos plásmidos han sido descritos por Sambrook (véase "Molecular Cloning: A Laboratory Manual", segunda edición, editado por Sambrook, Fritsch & Maniatis, Cold Spring Harbor Laboratory, (1989)) y muchos de dichos vectores están disponibles comer- cialmente. Los plásmidos de Bacillus incluyen pC194, pC221, pT127 y similares, y han sido descritos por Gryczan (en: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329). Los plásmidos de Streptomyces

adecuados incluyen pli101 (Kendall et al., J. Bacteriol. 169:4177-4183, 1987) y los bacteriófagos de Streptomyces incluyen, aunque sin limitación, tales como ψC31 (Chater et al., en: Sixth International Symposium on Actinomyceta- les Biology, Akademiai Kiado, Budapest, Hungría (1986), pp. 45-54). Los plásmidos de Pseudomonas han sido revi- sados por John et al., (Rev. Infect. Dis. 8:693-704, 1986) e Izaki (Jpn. J. Bacteriol. 33:729-742, 1978). En una reali- zación, un casete de expresión para uso en la presente descripción puede comprender una secuencia de polinucleó- tido que codifica un gen mejorador de espinosinas, como se define en la presente memoria, un terminador de la transcripción y un marcador seleccionable. Preferiblemente, el gen mejorador de espinosinas es una secuencia de polinucleótidos que codifica VHb o uno de sus fragmentos, derivados o variantes. Independientemente, el terminador de la transcripción puede ser la secuencia terminadora de la transcripción aph. Independientemente, el marcador seleccionable puede ser un gen de resistencia a la apramicina. Preferiblemente, el casete de expresión es como se muestra en la SEQ ID NO. 1.

La supresión de la expresión de genes particulares es una herramienta importante tanto para la investigación como para el desarrollo de organismos modificados genéticamente más ajustados para un fin particular. El silenciamiento génico se puede conseguir por la introducción de un transgén que corresponde al gen de interés en la orientación antisentido con relación a su promotor (véase, por ejemplo, Sheehy et al., Proc. Natl. Acad. Sci. USA 85:8805-8808 (1988); Smith et al., Nature 334:724-726 (1988)), o en la orientación con sentido con relación a su promotor (Napoli et al., Plant Cell 2:279-289 (1990); van der Krol et al., Plant Cell 2:291-299 (1990); Patente de EE.UU. Nº 5.034.323; Patente de EE.UU. Nº 5.231.020; y Patente de EE.UU. No. 5.283.184), ambas de las cuales conducen a la expre- sión reducida del transgén así como al gen endógeno.

Se ha documentado que el silenciamiento génico postranscripcional va acompañado por la acumulación de peque- ños fragmentos (20 a 25 nucleótidos) de RNA antisentido, que pueden ser sintetizados a partir de un molde de RNA y representan los determinantes de especificidad y movilidad del proceso (Hamilton & Baulcombe, Science 286:950- 952 (1999)). Ha quedado claro que en una gama de organismos la introducción de dsRNA (RNA bicatenario) es un componente importante que conduce al silenciamiento génico (Fire et al., Nature 391:806-811 (1998); Timmons & Fire, Nature 395:854 (1998); el documento WO99/32619; Kennerdell & Carthew, Cell 95:1017-1026 (1998); Ngo et al., Proc. Natl. Acad. Sci. USA 95:14687-14692 (1998); Waterhouse et al., Proc. Natl. Acad. Sci. USA 95:13959- 13964 (1998); el documento WO99/53050; Cogoni & Macino, Nature 399:166-169 (1999); Lohmann et al., Dev. Biol. 214:211-214 (1999); Sánchez-Alvarado & Newmark, Proc. Natl. Acad. Sci. USA 96:5049-5054 (1999)). En las bacte- rias, el gen suprimido no necesita ser un gen bacteriano endógeno, ya que tanto los transgenes informadores como los genes víricos son sometidos a silenciamiento génico postranscripcional por transgenes introducidos (English et al., Plant Cell 8:179-188 (1996); Waterhouse et al., supra). Sin embargo, en todos los casos anteriores, se puede preferir alguna similitud de secuencias entre el transgén introducido y el gen que es suprimido. En la presente me- moria los términos "célula hospedante" y "célula hospedante recombinante" se usan indistintamente. Dichos térmi- nos se refieren no sólo a la célula objeto particular, sino también a la progenie o progenie potencial de dicha célula. Debido a que pueden producirse ciertas modificaciones en generaciones sucesivas debido a mutación o influencias ambientales, dicha progenie puede en efecto no ser idéntica a la célula parental, pero aún así está incluida dentro del alcance del término tal como se usa en la presente memoria.

Los métodos de la invención pueden incluir las etapas adicionales de: a) cultivar una célula modificada genéticamente de la invención, en condiciones apropiadas para la producción de espinosinas; y b) recoger las espinosinas de un cultivo de la célula.

Se incluyen los ejemplos siguientes para ilustrar la presente invención y no se deben interpretar como limitativos de la misma.

Ejemplos

Construcción de un casete de expresión del gen de hemoglobina Se diseñó un casete de expresión del gen de hemoglobina para que contuviera las siguientes características claves: i) el promotor ( promotor aac3 (IV)) del gen de resistencia a apramicina (originalmente de Klebsiella pneumoniae bajo el número de acceso en GenBank X99313; Kieser et al., 2001) que es funcional en S. spinosa; ii) el gen VHb de la hemoglobina de Vitreoscilla con codones optimizados (Tabla 1) diseñado utilizando una tabla de preferencia de codones de S. spinosa y el programa informático GeneDesigner (DNA 2.0, Menlo Park, California); y iii) la secuencia terminadora de la transcripción aph (Pulido y Jiménez, 1987). La selección y disposición de estos elementos génicos garantiza la transcripción estable de VHb y la expresión óptima de proteínas, proporcionando de esta manera una expresión fuerte de la proteína hemoglobina. El casete de expresión con el gen de la hemoglobina (SEQ ID NO: 1) se sintetizó por el programa DNA 2.0 (Menlo Park, CA). El fragmento sintético resultante de 977 pb flanqueado por HindIII se clonó en el vector pJ201 (Figura 1) y se secuenció por el programa DNA 2.0 para confirmar la exactitud de secuencia antes del envío. El plásmido resultante se denominó pDAB109000. SEQ ID NO. 1 Tabla 1. Comparación de los codones del gen de la hemoglobina de Vitreoscilla (VHb) y los codones preferidos del gen sintético de la hemoglobina para la expresión óptima en S. spinosa. Se prefieren los codones de VHb sintéticos en S. spinosa y se seleccionaron para sustituir los codones preferidos del gen de hemoglobina de Vitreoscilla usan- do el programa informático GeneDesigner.

Aminoácido

Leu

Arg

Thr

Ile

Lys

Ala

Val

Pro

His

TTA CGT ACC ATT AAA GCC GTT CCT CAT Codón de VHb deVitreoscilla

TTG CGC ACT GCT GTA CCA GCA GTC Codón sintético de VHb

CTG CGG ACG ATC AAG GCG GTG CCG CAC Aminoácido

Asp

Gly

Ser

Asn

Cys

Phe

Gln

Glu

Tyr

Codón de VHb deVitreoscilla

GAT GGT TCT AAT TGT TTT CAA GAA TAT Codón sintético de VHb

GAC GGC TCG AAC TGC TTC CAG GAG TAC Introducción del casete de expresión génica de la hemoglobina en el clon del cósmido 1E3 Se eligió la agrupación de genes de la obscurina como sitio para la integración del casete de expresión del gen de la hemoglobina debido a que la interrupción de la agrupación de genes de la obscurina no reduce la producción de espinosinas. El casete de expresión del gen de la hemoglobina fue clonado en el cósmido 1E3 (que contiene una agrupación parcial de genes de la obscurina con DNA genómico). Este cósmido se manipuló genéticamente para facilitar la integración estable del casete de expresión del gen de la hemoglobina dentro de la agrupación de genes de la obscurina del genoma de S. spinosa.

El casete de expresión del gen de la hemoglobina se clonó primeramente en el vector pIJ773 (John Innes Centre, Norwich, Reino Unido) por un método de clonación convencional. Este casete, además del gen de resistencia a apramicina y oriT flanqueado por secuencias de recombinación de FRT fue clonado luego en el cósmido 1E3 dirigido por PCR (Gust et al., 2002). Brevemente, el casete de expresión del gen de la hemoglobina se amplificó primera- mente usando pDAB109000 como molde y los siguientes cebadores, aac3-VHb directo (SEQ ID NO: 2 5'- CGCTGAAAAGCTTCTGACGCCG-3') y aac3-VHb inverso (SEQ ID NO: 3 5'-CAACCCGTACCACGGCCTCT-3'). El fragmento de PCR amplificado se digirió con HindIIIIKpnI para generar dos fragmentos; un fragmento HindIII/KpnI de 864 pb y un fragmento HindIII/KpnI de 83 pb. El fragmento HindIII/KpnI de 864 pb, que lleva el casete de expresión de gen de la hemoglobina incluyendo el terminador de la transcripción, se purificó en gel y se clonó en el vector pIJ773 que había sido digerido con HindIII/KpnI. Se seleccionaron un total de 38 transformantes cultivados en me- dios de Luria-Bertani (LB) que contenían 50 µg/mL de apramicina para su posterior análisis y confirmación. Después de crecimiento durante la noche en LB líquido que contenía apramicina a 50 µg/mL, se recogieron las células por centrifugación a 13000 rpm en una microcentrífuga durante 2 minutos.

Los sedimentos celulares que llevan el plásmido de control pDAB109000 produjeron un color rojizo que indicaba la presencia de la proteína hemoglobina. Sin embargo, sólo siete de los clones recombinantes produjeron sedimentos celulares rojizos visibles que iban desde el rojo claro a un color rojo más intenso. Se seleccionaron estos siete clo- nes y se pasó a la siguiente etapa que incluía el aislamiento de DNA plasmídico y digestiones con enzimas de res- tricción. Dos de los siete clones, el clon 22 y el clon 30, produjeron los patrones de restricción deseados basados en el análisis de restricción usando las siguientes enzimas NdeI, HindIII/KpnI y NdeI/KpnI. Se secuenciaron la región del gen de la hemoglobina de ambos clones y el fragmento de PCR que llevaba el casete de expresión de gen de la hemoglobina. Se secuenciaron completamente la región del gen de la hemoglobina del clon 22 y el fragmento de PCR y los datos de las secuencias confirmaron que el gen sintético de la hemoglobina deseado se amplificó sin ningún error y fue clonado en pIJ773 (Figura 2). El plásmido resultante fue etiquetado como pDAB109001.

La integración del casete de expresión génica FRT :: aac3(IV) y el casete de expresión del gen sintético de la hemo- globina :: oriT:: FRT :: en el clon del cósmido 1E3 se llevó a cabo como se describe por un protocolo modificado dirigido por PCR (Gust et al., 2002). Se incorporaron al protocolo las siguientes modificaciones: i) el E. coli hospe- dante para introducir el clon del cósmido recombinante que llevaba el casete de expresión del gen de la hemoglobi- na era E. coli BW25141/pKD78 adquirido a The Coli Genetic Stock Center (CGSC) de la Universidad de Yale; ii) el plásmido de expresión de recombinasa rojo lambda pKD78, derivado de pKD46 (Datsenko and Wanner, 2000); y iii) se diseñaron y utilizaron los siguientes cebadores de PCR, tallo-bucle Strep interno ObsA (SEQ ID NO: 4 5'- GAAGAAGGCGGCGTCGAACTGGTCGACCTCGGTGAGGAAGGTACCTCCGACCGCACGGC-3') y ObsA 5' FRT aac3 (SEQ ID NO: 5 5'-GGCAATGCGCAGAGTTCGTAGTGCGGGAGCCATTTGATGTGTAGGCTGGAGCTGCTTC- 3'). La amplificación resultante produjo un fragmento de 2216 pb que consistía en (FRT ::aac3(IV) :: oriT:: FRT :: VHb) dentro del clon del cósmido 1E3.

La integración dentro del clon del cósmido 1E3 se diseñó para que ocurriera en el extremo 5' de ObsA, lo que da como resultado la eliminación de 600 pb de la secuencia codificadora de ObsA. Esto asegura la interrupción comple- ta de la primera enzima policétido-sintasa dentro de la agrupación de genes de la obscurina. Una vez integrado, el casete de expresión del gen de la hemoglobina fue orientado de tal manera que su secuencia codificadora estaba en la orientación opuesta a la secuencia codificadora de ObsA. Esta direccionalidad impide la lectura en la transcripción a partir del supuesto promotor de ObsA que potencialmente podría dar como resultado una transcripción no desea- da. Los supuestos clones recombinantes que llevaban el fragmento (FRT :: aac3(IV):: oriT:: FRT :: VHb) se aislaron y se confirmaron por análisis de restricción. La digestión por restricción usando BamHI indicó que los clones de cósmi- dos recombinantes que llevaban el casete del gen de la hemoglobina tenían diferentes patrones de restricción, en comparación con el clon del cósmido parental, 1E3. Por otra parte, la digestión por restricción usando NdeI y ClaI,

destinada a regenerar la secuencia codificadora del gen sintético de hemoglobina, reveló que sólo los tres clones recombinantes producían un fragmento de 444 pb que llevaba la región codificadora completa del gen sintético de hemoglobina.

Conjugación del casete de expresión génica (FRT :: aac3(IV) :: oriT :: FRT :: VHb) en cepas de S. spinosa

Se completó la conjugación micelial entre la cepa donante, Escherichia coli S17, que contenía el casete de expre- sión génica FRT :: aac3(IV) y el casete de expresión del gen sintético de hemoglobina :: oriT :: FRT :: dentro de cósmido 1E3 y la cepa productora de espinosinas, DAS-2. La conjugación micelial entre la cepa donante y la cepa receptora de S. spinosa se llevó a cabo de acuerdo con el método descrito por Matsushima et al., (1994). Las colo- nias identificadas inicialmente como resistentes a apramicina y ácido nalidíxico en los medios de conjugación se parchearon sobre en medios de agar-agar con infusión de cerebro-corazón (BHI) que contenían 50 µg/mL de apra- micina y 25 µg/mL de ácido nalidíxico para confirmar el fenotipo de resistencia a antibióticos de las colonias. Se supuso que las colonias que tenían el fenotipo de resistencia a antibióticos deseada contenían el casete FRT :: aac3 (IV):: oriT :: FRT :: VHb integrado dentro del locus ObsA de la agrupación de genes de la obscurina. Para confirmar la presencia del gen de resistencia a apramicina, aac3(IV), se aisló el DNA genómico de los supuestos transconju- gantes utilizando el kit genómico bacteriano PURELUTE™ (Edge BioSystems, Gaithersburg, MD) de acuerdo con las instrucciones del fabricante. Este DNA genómico (gDNA) se utilizó como molde para la confirmación del tamaño por amplificación con PCR de un fragmento de DNA de aac3(IV) de 785 pb utilizando el sistema de PCR FAILSA- FE™ (Epicentre Biotecnologies, Madison, WI).

Confirmación de la presencia de un gen de hemoglobina en transconjugantes Para confirmar que el gen sintético de hemoglobina estaba presente en los transconjugantes, se aisló el DNA genó- mico de un número seleccionado de transconjugantes (por el kit genómico bacteriano PURELUTE™) y se utilizó como molde para la amplificación por PCR del gen de la hemoglobina (por el sistema de PCR FAILSAFETM). Las cepas recombinantes produjeron un producto de PCR de 395 pb, correspondiente al tamaño de la región codificado- ra del gen de la hemoglobina destinada a la amplificación. Se purificaron los fragmentos de PCR y se completó la secuenciación del DNA de ambas cadenas para confirmar aún más la presencia del gen VHb. El alineamiento de la secuencia derivada de los fragmentos de PCR con la secuencia del gen sintético de hemoglobina sintetizado por el programa DNA 2.0 indicó que estas cepas recombinantes llevaban el gen de la hemoglobina con una secuencia idéntica a la secuencia de DNA diseñada.

Expresión del gen de hemoglobina en condiciones de fermentación Se determinó en condiciones de fermentación la expresión del gen sintético de hemoglobina en la cepa recombinan- te que llevaba el casete de expresión del gen de la hemoglobina. Las cepas recombinantes que contenían el casete de expresión de VHb se cultivaron en condiciones de fermentación en matraces con agitación, y se aislaron las co- rrespondientes muestras de RNA total por el kit bacteriano RIBOPURE™ (Ambion, Austin, TX) y se prepararon para su uso como molde en el ensayo de RT-PCR. La fermentación del mutante de doble cruzamiento se realizó bajo las condiciones descritas por Bums et al., (WO 2003/070908). El análisis del caldo de fermentación para detectar la presencia de factores de espinosinas se puede llevar a cabo bajo las condiciones descritas por Baltz et al., (Patente de EE.UU. Nº 6.143.526). Para confirmar la presencia de los factores de espinosinas en el líquido sobrenadante, extractos del caldo de fermentación se secaron en un aparato SpeedVac durante una noche seguido por reparto del residuo entre agua y éter. La capa etérea se secó por evaporación bajo corriente de N2. La muestra se disolvió luego en acetona-d6 y se transfirió a un tubo de RMN para la adquisición de la RMN protónica 1D. Los perfiles de RMN se compararon con los de los patrones de espinosinas.

La preparación de RNA total se trató con DNAsa I (Ambion, Austin, TX) inmediatamente después de la purificacióndel RNA de acuerdo con las instrucciones del fabricante. La RT-PCR del gen sintético de hemoglobina utilizando elRNA total aislado se llevó a cabo usando el kit de RT-PCR OneStep (Qiagen, Valencia, CA) de acuerdo con lasinstrucciones del fabricante. Los cebadores para la amplificación de la región codificadora del gen sintético de he- moglobina fueron SynHemo directo (SEQ ID NO: 6 5'-CAGACGATCAACATCATCAAGGCG-3') y SynHemo inverso (SEQ ID NO: 7 5'-ACCTGGATGAACACGTCCGC-3'). Las cepas recombinantes que contenían el casete de expre- sión de VHb produjeron un fragmento específico de 395 pb correspondiente a la región codificadora del gen de he- moglobina destinada a la amplificación. En el mismo ensayo, el RNA total aislado de cepas de control no recombi- nantes no produjo un fragmento de PCR correspondiente en tamaño al gen sintético de hemoglobina. Estos resulta- dos confirmaron que un gen sintético de hemoglobina, activado por el promotor del gen de resistencia a apramicina, se transcribió y expresó en S. spinosa bajo condiciones de fermentación.

Efecto de la expresión del gen de la hemoglobina sobre la producción de espinosad Se evaluó el impacto de la expresión del gen de hemoglobina sobre la producción de espinosad (A/D) cultivando las cepas recombinantes bajo condiciones de fermentación en matraces con agitación, tal como se ha descrito ante- riormente. Los resultados de la fermentación se compararon con los niveles de la espinosina A/D producidos en la respectiva cepa parental, que no llevaba el gen de la hemoglobina. El número de cepas recombinantes selecciona- das para la evaluación en matraces con agitación se basó en el número de transconjugantes disponibles para el análisis y el deseo de obtener datos que determinarían si la expresión del gen sintético de hemoglobina produciría mayores niveles de espinosad A/D.

Se analizaron siete cepas recombinantes derivadas de DAS-2. Todas ellas superaron a la cepa parental DAS-2, en la producción de espinosad. La cepa parental acumuló espinosad dentro del intervalo esperado. El aumento estadís- ticamente significativo de la producción de espinosad A/D varió de 4,6% a 12,9% para las cepas que contenían el gem VHb (Tabla 2). La consistencia entre las cepas recombinantes en superar a la cepa de control en la producción de espinosad en condiciones de fermentación en matraces con agitación dio como resultado un aumento significati- vo porcentual de títulos de espinosad A/D. Este aumento en los títulos de espinosad indicó que las cepas recombi- nantes como un todo habían adquirido una mayor capacidad de producción de espinosad debido a la presencia en el genoma del gen sintético de hemoglobina. La expresión del gen sintético de hemoglobina en condiciones de fermen- tación en matraces con agitación indica que la expresión del gen de la hemoglobina aumenta la producción de espi- nosad.

Tabla 2: Comparación de las cepas DAS-2 y las cepas recombinantes DAS-2 VHb que contienen un gen de VHb integrado cromosómicamente en la producción de espinosad.

Identificación de la Factores principales de espino- Títulos de espinosinas en relación con el control en por- cepa sinas centajes el día 10 de la fermentación DAS-2 A/D 100,0 DAS-2 VHb1 A/D 107,4 DAS-2 VHb4 A/D 104,6 DAS-2 VHb5 A/D 108,0 DAS-2 VHb6 A/D 110,5 DAS-2 VHb7 A/D 112,9 DAS-2 VHb8 A/D 110,4 DAS-2 VHB9 A/D 105,6 Basándose en los resultados de fermentación descritos anteriormente, las cepas recombinantes siguientes, DAS-2 VHb7 y DAS-2 VHb8, se conservaron criogénicamente en glicerol al 20% usando cultivos vegetativos que crecen activamente. Se llevó a cabo un estudio de la fermentación en matraces con agitación dedicado a: i) evaluar las cepas crioconservadas; ii) asegurar la reproducibilidad de los resultados de fermentación; y iii) proporcionar pruebas del avance de las cepas seleccionadas para un trabajo futuro. En este estudio las cepas de control produjeron espi- nosad en los niveles esperados, y todo el estudio se llevó a cabo sin ningún tipo de desviaciones inesperadas del protocolo de operación. Cada cepa recombinante superó a las cepas de control tanto durante como al final del ciclo de fermentación lo que confirmó las observaciones iniciales de los estudios de fermentación en matraces con agita- ción. El aumento en los niveles de espinosad en las cepas recombinantes en relación con las cepas de control fue estadísticamente significativo.

Se utilizó el grupo de genes de policétido-sintasa de obscurina para la integración y expresión de un gen de hemo- globina con codones optimizados en la cepa de S. spinosa , DAS-2. La integración y expresión del gen de hemoglo- bina dieron como resultado una mejora de la producción de A/D en la fermentación en matraces con agitación de S. spinosa, DAS-2.

Identificación de clones de cósmidos que llevan el gen ObsA con policétido-sintasa (PKS) de obscurina Se completó el cribado de una genoteca de cósmidos usando una sonda de 806 pb procedente del locus genómico ObsA de S. spinosa (SEQ ID NO: 8). Se construyó una genoteca de cósmidos a partir de una cepa de S. spinosa por BIOS&T (Montreal, Canadá) usando el vector cósmido Supercos I (Stratagene, La Jolla, CA) y el DNA genómico de la cepa de S. spinosa que se preparó de acuerdo con el protocolo de aislamiento de DNA genómico descrito por Kieser et al., (2000). SEQ ID NO 8.

El cribado de la genoteca con la sonda ObsA permitió la identificación de clones de cósmidos que llevaban el extre- mo 5' de ObsA en condiciones estrictas. El marcaje de la sonda, la hibridación y la detección se llevaron a cabo utilizando el kit DIG de marcaje de DNA y el kit DIG de detección de ácidos nucleicos (Roche, Basilea, Suiza) de acuerdo las instrucciones del fabricante. Específicamente, se marcó el fragmento de PCR de 806 pb derivado del extremo 5' de ObsA usando el kit de marcaje con cebador aleatorio (Roche). La hibridación se realizó durante una noche a 58ºC en el horno de hibridación seguida por lavado dos veces de ambos filtros a 65ºC durante un total de 30 minutos utilizando el tampón de lavado que contenía 0,1xSSC y 0,1% de SDS. La sonda hibridada se detectó usando el kit DIG de detección de ácidos nucleicos de Roche basado en el inmunoensayo ligado a enzimas (ELISA) con un conjugado de anticuerpos anti-DIG-AP altamente específico y los sustratos de color NBT (azul de nitro- tetrazolio) y BCIP (fosfato de 5-bromo-4-cloro-3-indolilo). Se identificaron varios conjuntos de cósmidos con señales de hibridación fuertes. Se seleccionaron cuatro de los clones, 1E3, 2N14, 3M23 y 4E16, para el aislamiento de DNA de cósmidos y confirmación por secuenciación.

La amplificación por PCR de los clones de cósmidos utilizando el cebador directo de ObsA (SEQ ID NO: 9 5'- CAAGATCGTTGGGACCTGGCC-3') y el cebador inverso de ObsA (SEQ ID NO: 10 5'-TCGACGTACTGG AC- CTCGGC-3') dio como resultado un solo fragmento de PCR equivalente a la sonda de tamaño 806 pb. Las reaccio- nes de PCR se realizaron de acuerdo con las instrucciones del fabricante utilizando el sistema de PCR FAILSAFE™ (Epicentre Biotecnologies, Madison, WI).

Los insertos de DNA llevados por los cuatro clones de cósmidos se secuenciaron también en ambos extremos con el fin de cartografiar los clones de cósmidos en la agrupación de genes de obscurina y estimar el tamaño de los inser- tos de los clones de cósmidos (Figura 3). Se determinó que el clon del cósmido 1E3 tenía un tamaño de 42900 pb y contenía el extremo 5' de ObsA en el centro del inserto de DNA. Se determinó que el clon del cósmido 2N14 tenía un tamaño de 40.153 pb y no llevaba la región codificadora completa de ObsA. Los insertos en los clones de cósmidos 3M23 y 4E16 contenían el extremo 5' de ObsA en un extremo y en el otro extremo las secuencias de DNA más allá de la agrupación de genes de obscurina. No se estimaron los tamaños reales de los clones de cósmidos 3M23 y 4E16. Se eligió el clon del cósmido 1E3 para completar la interrupción de ObsA para determinar el impacto de la abolición de la función de los genes de policétido-sintasa sobre las características de S. Spinosa y la producción de espinosinas.

Modificación por ingeniería genética del clon de cósmidos para la interrupción de ObsA dirigida por PCR Para interrumpir ObsA dentro de la agrupación de genes de obscurina, el casete de interrupción de resistencia a apramicina (FRT-aac3(IV)-oriT-FRT) del plásmido pIJ773 (proporcionado por The John Innes Center Plant Bioscien- ces Limited, Norwich, Inglaterra; Figura 4) se integró en el clon del cósmido 1E3 dirigido por PCR.

La integración del casete de interrupción de ObsA (FRT-aac3(IV)-oriT-FRT) en el clon del cósmido 1E3 se llevó a cabo de acuerdo con Gust et al., (2002) con las siguientes modificaciones. Se usó E. coli BW25141/pKD78 adquirida a The Coli Genetic Stock Center (CGSC) de la Universidad de Yale, que contenía el plásmido de expresión de re- combinasa rojo lambda, pKD78, derivado de pKD46 (Datsenko and Wanner, 2000). Se utilizaron los siguientes ce- badores largos de PCR, ObsA 5' FRT aac3 (SEQ ID NO: 11 5'-GGCAATGCGCAGAGTTCGTAGTGCGG GAGC- CATTTGATGTGTAGGCTGGAGCTGCTTC-3') y ObsA interno oriT FRT (SEQ ID NO: 12 5'-GAAGAA GGCGGCGTCGAACTGGTCGACCTCGGTGAGGAAATTCCGGGGATCCGTCGACC-3'), para amplificación del fragmento de 1322 pb que llevaba FRT-aac3(IV)-oriT-FRT usando pIJ773 como molde (Figura 4). El fragmento am- plificado de 1322 pb se purificó y se integró en el cósmido 1E3 de acuerdo con Guts et al., (2002).

Diez de los clones de E. coli recombinantes que se obtuvieron dirigidos por PCR eran resistentes a apramicina y tenían el mismo patrón de digestión con la enzima de restricción BamHI (este patrón de digestión es diferente del que tiene el clon del cósmido 1E3 que no contiene el casete de interrupción). La confirmación adicional de los clones recombinantes se llevó a cabo por amplificación usando un par de cebadores que se asocian a las regiones de DNA de 95 pb aguas arriba del codón de iniciación de ObsA y 334 pb aguas abajo de la codón de inicio de ObsA, respec- tivamente. Los cebadores son ObsA 5' aguas arriba directo (SEQ ID NO: 13 5'-CGACCGGTGTGTCGA TGT- TAGGGT-3') y ObsA interno inverso (SEQ ID NO: 14 5'-CTTCCAACGCTTCCCAGCCC-3'). Las reacciones de PCR se completaron de acuerdo con las instrucciones del fabricante utilizando el sistema de PCR FAILSAFE™ (Epicentre Biotecnologies, Madison, WI).

La amplificación utilizando el DNA genómico de la cepa de espinosad utilizada para crear los cósmidos o el DNA del clon del cósmido 1E3 produjo el fragmento esperado de 429 pb. La amplificación utilizando el DNA de cósmido ais- lado de nueve (no se incluyo el clon 10 debido a redundancia) de los diez clones de cósmidos recombinantes produ- jo un único fragmento correspondiente al tamaño esperado de 1538 pb. El fragmento de PCR esperado de 1538 pb se debe a la inserción de 1322 pb del casete de interrupción (FRT-aac3(IV)-oriT-FRT) en el extremo 5' de ObsA con la deleción simultánea de 213 pb del gen ObsA. Todos los clones de cósmidos recombinantes produjeron un único fragmento de PCR de 1538 pb y no produjeron el fragmento de 429 pb que observado en el clon del cósmido de control 1E3 lo que indica que cada uno de los clones de cósmidos recombinantes contenía el casete de interrupción (FRT-aac3(IV)-oriT-FRT) en el extremo 5' de ObsA.

Interrupción de ObsA dentro de la agrupación de genes de la obscurina por integración del casete de interrupción (FRT-aac3(IV)-oriT-FRT) en S. spinosa

Se usaron métodos de de conjugación para introducir el clon del cósmido recombinante que llevaba el casete de interrupción de ObsA (FRT-aac3(IV)-oriT-FRT) en cepas de S. spinosa con el fin de lograr transconjugantes de todas las cepas dianas para el análisis concluyente del impacto de la interrupción de ObsA sobre el crecimiento y la pro- ducción de espinosinas.

La conjugación micelial entre la cepa donante que lleva el cósmido 1E3 recombinante y una cepa de S. spinosa receptora, NRRL 18538, se llevó a cabo de acuerdo con el método descrito por Matsushima et al., (1994).

Se produjeron transconjugantes. Casi todos los transconjugantes primarios confirmaron el fenotipo resistente a apramicina deseado lo que indica que los transconjugantes llevaban el gen de resistencia a apramicina, aac3(IV),

integrado en la agrupación de genes de policétido-sintasa de obscurina por recombinación homóloga. Se analizaron varios transconjugantes seleccionados para determinar la presencia del fragmento de DNA correspondiente al tama- ño de un fragmento de aac3(IV) de 785 pb por amplificación por PCR. Los controles negativos que no contenían el casete de interrupción (FRT-aac3(IV)-oriT-FRT) no produjeron un amplicón por PCR.

El impacto de la interrupción de ObsA sobre el crecimiento y producción de espinosinas en S. spinosa

El impacto de la interrupción de ObsA sobre la producción de espinosina se evaluó usando un protocolo de matraces con agitación. La fermentación de los transconjugantes se realizó bajo las condiciones descritas por Bums et al., (WO 2003/070908). El análisis del caldo de fermentación para detectar la presencia de factores de espinosinas se llevó a cabo bajo las condiciones descritas por Baltz et al., (Patente de EE.UU. Nº 6.143.526).

Para los aislados de S. spinosa se realizó una comparación directa del rendimiento de los transconjugantes en rela- ción con sus respectivas cepas parentales. Se evaluaron en matraces con agitación cuatro de los mutantes desacti- vados de ObsA derivados de la cepa NRRL 18538. El título medio de cada mutante desactivado fue mayor que el de la cepa parental. Sin embargo, basándose en el análisis estadístico no parecía que las diferencias fueran significati- vas (Tabla 2).

Tabla 2. Producción de espinosinas el día 10 por los mutantes desactivados de ObsA derivados de NRRL 18538.

Cepa Factores de espinosinas princi- Títulos de espinosinas en relación con el con- pales trol en porcentajes el día 10 de la fermentación NRRL 18538 parental A/D 100 NRRL 18538 ΔObsA-1 A/D 108 NRRL 18538 ΔObsA-2 A/D 114 NRRL 18538 ΔObsA-3 A/D 108 NRRL 18538 ΔObsA-6 A/D 107 La interrupción de OsbA en el gen PKS de la obscurina en la cepa A/D, NRRL 18538, no tuvo impacto negativo sobre la producción de espinosinas en comparación con las cepas de control parentales respectivas en las condicio- nes usuales de fermentación en matraces con agitación. La falta de impacto negativo sobre la producción de espino- sinas por la interrupción de ObsA califica a la agrupación de genes de policétido-sintasa de obscurina como un sitio neutro para la integración y expresión de genes diana de interés para la mejora de los procesos de producción y fermentación de espinosinas. Este locus genómico sirve como ejemplo de un sitio de integración para la integración de genes dentro del genoma de S. spinosa.

Lo anterior es ilustrativo de la presente invención, y no debe interpretarse como limitativo de la misma. La invención se define por las siguientes reivindicaciones.

Lista de secuencias

<110> Dow AgroSciences LLC <120> Mejora de la producción de espinosinas con proteínas que se unen al oxígeno <130> P202858EP <150> US 13/100,220 <151> 2011-05-03 <150> US 13/100,202 <151> 2011-05-03 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 977 <212> DNA <213> Secuencia Artificial <220> <223> Casete de expresión génica de hemoglobina <400> 1 <210> 2 <211> 22 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo aac3-vhb <400> 2 cgctgaaaag cttctgacgc cg 22 <210> 3 <211> 20 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso aac3-vhb <400> 3 caacccgtac cacggcctct <210> 4 <211> 59 <212> DNA <213> Secuencia Artificial <220> <223> Cebador tallo-bucle Strep interno obsA <400> 4 gaagaaggcg gcgtcgaact ggtcgacctc ggtgaggaag gtacctccga ccgcacggc 59 <210> 5 <211> 58 <212> DNA <213> Secuencia Artificial <220> <223> Cebador aac3 5' FRT obsA <400> 5 ggcaatgcgc agagttcgta gtgcgggagc catttgatgt gtaggctgga gctgcttc 58 <210> 6 <211> 24 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo SynHemo <400> 6 cagacgatca acatcatcaa ggcg 24 <210> 7 <211> 20 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso SynHemo <400> 7 acctggatga acacgtccgc <210> 8 <211> 806 <212> DNA <213> Saccharopolyspora spinosa <400> 8 <210> 9 <211> 21 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo obsA <400> 9 caagatcgtt gggacctggc c 21 <210> 10 <211> 20 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso obsA <400> 10 tcgacgtact ggacctcggc <210> 11 <211> 58 <212> DNA <213> Secuencia Artificial <220> <223> Cebador aac3 5' FRT ObsA <400> 11 ggcaatgcgc agagttcgta gtgcgggagc catttgatgt gtaggctgga gctgcttc 58 <210> 12 <211> 59 <212> DNA <213> Secuencia Artificial <220> <223> Cebador FRT oriT interno ObsA <400> 12 gaagaaggcg gcgtcgaact ggtcgacctc ggtgaggaaa ttccggggat ccgtcgacc 59 <210> 13 <211> 24 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo 5' curso arriba obsA <400> 13 cgaccggtgt gtcgatgtta gggt 24 <210> 14 <211> 20 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso interno obsA <400> 14 cttccaacgc ttcccagccc

REIVINDICACIONES

1. Un método para aumentar los títulos de espinosinas de una célula hospedante de S. spinosa, comprendiendo dicho método transformar la célula hospedante de S. spinosa con un gen heterólogo que codifica una proteína que se une al oxígeno.

2. El método de acuerdo con la reivindicación 1, en el que la proteína que se une al oxígeno es hemoglobina de Vitreoscilla.

3. El método de acuerdo con la reivindicación 1, en el que la proteína que se une al oxígeno es una proteína globina, preferiblemente seleccionada del grupo que consiste en hemoglobina de Vitreoscilla, flavohemoproteína de Alcalige- nes eutrophus, mioglobina de corazón de caballo, hemoproteína de E. coli, hemoproteína de B. subtilis, flavohemo- globina de levadura, leghemoglobina de soja, leghemoglobina de altramuz y mioglobina de esperma de ballena.

4. Un método de acuerdo con una cualquiera de las reivindicaciones 1 a 3, en el que el título de espinosinas es au- mentado en al menos 4,6%.

5. Un método de aumentar la producción de espinosinas de acuerdo con una cualquiera de las reivindicaciones 1 a 4, comprendiendo además el método: a) cultivar la célula de S. spinosa que expresa un gen heterólogo que codifica una proteína que se une al oxígeno, en condiciones apropiadas para la producción de espinosinas; y b) recoger espinosinas del cultivo.

6. Un método de acuerdo con una cualquiera de las reivindicaciones precedentes, en donde el gen heterólogo que codifica una proteína que se une al oxígeno está integrado en un cromosoma de la célula de S. spinosa.

7. Un método para mejorar la producción de espinosinas en una célula hospedante de S. spinosa, comprendiendo dicho método integrar un gen que codifica una proteína que se une al oxígeno en el DNA cromosómico de la cepa de la especie S. spinosa, en donde la integración del gen que codifica una proteína que se une al oxígeno en el DNA cromosómico comprende: a) crear una fagoteca para identificar un locus genómico; b) clonar dos fragmentos de DNA genómico del locus genómico, en donde un fragmento genómico se clona aguas arriba de un polinucleótido que comprende un gen que codifica una proteína que se une al oxígeno, y el segundo fragmento genómico se clona aguas abajo de dicho polinucleótido; c) introducir los fragmentos genómicos en una cepa de S. spinosa por transformación; d) obtener transconjugantes; y, e) cribar dichos transconjugantes para detectar la presencia de dicho polinucleótido.

8. El método de acuerdo con la reivindicación 7, en el que el polinucleótido contiene un casete de expresión génica que comprende la proteína que se une al oxígeno.

9. El método de acuerdo con la reivindicación 8, en el que el casete de expresión génica contiene un marcador se- leccionable de antibióticos.

10. Un método de acuerdo con una cualquiera de las reivindicaciones 7 a 9, en el que el gen que codifica la proteína que se une al oxígeno está integrado en el DNA cromosómico en el locus de la policétido-sintasa de obscurina.

11. Una célula de S. spinosa modificada genéticamente, que comprende un gen heterólogo que codifica una proteí- na que se une al oxígeno, en la que cuando se expresa el gen heterólogo que codifica una proteína que se une al oxígeno, la célula de S. spinosa modificada genéticamente es capaz de aumentar la producción de espinosinas.

12. La célula de S. spinosa modificada genéticamente de acuerdo con la reivindicación 11, en la que la célula de S. spinosa modificada genéticamente es capaz de producir un título de espinosinas que está aumentado en al menos 4,6% en comparación con el título de espinosinas de una célula de S. spinosa no modificada.

13. Una célula de S. spinosa modificada genéticamente de acuerdo con la reivindicación 11 o la reivindicación 12, en la que la proteína que se une al oxígeno es una proteína globina, preferiblemente seleccionada del grupo que con- siste en hemoglobina de Vitreoscilla, flavohemoproteína de Alcaligenes eutrophus, mioglobina de corazón de caba- llo, hemoproteína de E. coli, hemoproteína de B. subtilis, flavohemoglobina de levadura, leghemoglobina de soja, leghemoglobina de altramuz y mioglobina de esperma de ballena.

14. Una célula de S. spinosa modificada genéticamente de acuerdo con una cualquiera de las reivindicaciones 11 a 13, en la que el gen heterólogo que codifica una proteína que se une al oxígeno está integrado en el genoma de la célula de S. spinosa modificada genéticamente, preferentemente en el DNA cromosómico en el locus de la policéti- do-sintasa de obscurina.

15. Una cepa que comprende una población de células de S. spinosa modificadas genéticamente como se define en una cualquiera de las reivindicaciones 11 a 14.

16. El método o la célula de S. spinosa de una cualquiera de las reivindicaciones precedentes, en donde las espino-sinas se seleccionan del grupo que consiste en espinosinas A + D, espinosinas J + L, espinosina A y espinosina J.