Método para clasificar una enfermedad inflamatoria del intestino como una enfermedad de Crohn o como una colitis ulcerosa.

Un método para clasificar una enfermedad inflamatoria del intestino en un paciente como enfermedad de Crohn o como colitis ulcerosa

, comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR30c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b-5p, miR150, miR-181d, miR-182, miR185, miR196a, miR199a- 3p, miR199a-5p, miR199b-5p, miR-203, miR223, miR-299-5p, miR320a, miR324-3p y miR-328 y

ii) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o una colitis ulcerosa.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2011/063949.

Solicitante: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE).

Nacionalidad solicitante: Francia.

Dirección: 101, RUE DE TOLBIAC 75013 PARIS FRANCIA.

Inventor/es: OGIER-DENIS,ERIC, TRETON,XAVIER.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2534920_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Método para clasificar una enfermedad inflamatoria del intestino como una enfermedad de Crohn o como una colitis ulcerosa

Sector de la técnica

La presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una enfermedad de Crohn o como una colitis ulcerosa.

Estado de la técnica

Las enfermedades inflamatorias del intestino (Eli), tales como enfermedad de Crohn (EC) y colitis ulcerosa (CU) son trastornos crónicos graves y recidivantes mediados por el sistema inmunológico del tracto gastrointestinal. Las Eli son enfermedades heterogéneas caracterizadas por diversas anomalías genéticas que conducen a respuestas inflamatorias excesivamente agresivas a un subconjunto de bacterias entéricas comensales.

La enfermedad de Crohn puede afectar a todas las partes del tracto digestivo y especialmente al íleon y/o al colon y conduce a ulceraciones de la mucosa, fístula, e infiltración profunda de células inflamatorias en la pared intestinal.

La colitis ulcerosa con frecuencia implica a la parte inferior del colon y el recto y la inflamación de la mucosa puede extenderse al ciego en un patrón contiguo.

En la práctica clínica, del 2 al 3 % de los pacientes con colitis de Eli no pueden clasificarse como EC o CU basándose en criterios endoscópicos, radiológicos e histopatológicos habituales, aunque esta distinción puede ser crucial para guiar las elecciones terapéuticas, especialmente cuando se analiza la resección colónica.

De forma similar, la sensibilidad de los marcadores serológicos (autoanticuerpos para neutrófilos [ANCA, pANCA] y anticuerpos antimicrobianos [ASCA, anti-OmpC, anti-12, y anti-CBir1 ]) sigue siendo insuficiente para diferenciar entre EC y CU. Por otro lado, la etiología de las Eli y la causa del brote siguen siendo en gran medida desconocidas y también se necesitan marcadores bioespecíficos de EC y CU para evaluar un diagnóstico temprano. Hasta la fecha, sigue siendo difícil elegir biomarcadores estrictamente específicos.

Algunas identificaciones específicas de la expresión de miARN en la mucosa colónica de pacientes con Eli ya se han desvelado en la técnica anterior (X. Treton*, M. Fasseu, E. Pedruzzi, Y. Bouhnik, T. Aparicio, D. Cazals-Hatem, F. Daniel, M. Laburthe, A. Grover, E. Ogierdenis: "P273: Alteration Of Microrna Expression In Inflamed And Inactive Colonic Mucosa Of Patients With Inflammatory Bowel Disease", Gastro 29- Uegw/Wcogh, Londres, 2 de Noviembre de 29 (2-11-29), - 25 de Noviembre de 29 (25-11-29); TRETON ET AL: "P217 SPECIFIC ALTERATION OF MICRO-RNA EXPRESSION IN INFLAMMATORY BOWEL DISEASE", JOURNAL OF CROHNS AND COLITIS, vol. 2, Ni) 21, 1 de Febrero de 28 (1-2-28), página S69; Treton et al.: "Alteration de lexpression des microARN dans la muqueuse colique quiescente de patients atteints de maladies inflammatoires chroniques de lintestin (MICI)", 26 de Marzo de 21 (26-3-21); y el documento WO 29/12877). Sin embargo dichas identificaciones no permiten al mismo tiempo el diagnóstico de Eli (Eli frente a sano) y el diagnóstico diferencial de CU y EC.

Objeto de la invención

La presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una EC o como una CU, comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, m¡R-142-3p, m¡R-142-5p, miR-146a, miR-146b-5p, miR15, miR-181d, miR-182, miR185, miR196a, miR199a-3p, m¡R199a-5p, m¡R199b-5p, miR-23, miR223, miR-299-5p, miR32a, miR324-3p, y miR-328y

ii) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o de una colitis ulcerosa.

Descripción detallada de la invención

El objetivo de los inventores fue localizar alteraciones de la expresión génica de miARN en la mucosa colónica quiescente no inflamada de pacientes con Eli frente a la de individuos sanos. En consecuencia, han estudiado alteraciones de todo el genoma en el patrón de expresión génica de miARN en mucosa quiescente de pacientes con CU y EC activas, en comparación con tejido sano normal. Han identificado subconjuntos de 22 (CU) y 34 (EC) miARN con expresión elevadamente alterada en tejido mucoso quiescente, estando 1 desregulados habitualmente en tejidos con CU y EC no inflamados (Tabla B). Más particularmente, los inventores seleccionaron 15 miARN para

los que la expresión fue estadísticamente diferente en biopsias colónicas no inflamadas de pacientes con CU y EC (véase la Tabla B y la Figura 1). Estos miARN y los 1 que están habitualmente desregulados en tejidos con CU y EC no inflamados se ensayaron después con respecto a su capacidad para diferenciar entre EC y CU. Basándose en la clasificación clínica del panel de pacientes como CU o EC, la selección de los 25 miARN fue capaz de predecir 5 15/16 en su verdadera clase (Tabla V).

En consecuencia, la presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una enfermedad de Crohn o como una colitis ulcerosa, comprendiendo dicho método una etapa de medir un perfil de expresión de miARN en una muestra del paciente, en la que dichos miARN son 1 miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b- 5p, miR15, miR-181 d, miR-182, miR185, miR196a, miR199a-3p, miR199a-5p, miR199b-5p, miR-23, miR223, miR- 299-5p, miR32a, miR324-3p, y miR-328.

El término "miARN" se refiere a moléculas de microARN maduras (ARN pequeños no codificantes) que son 15 generalmente de 21 a 22 nucleótidos de longitud, incluso aunque se han indicado longitudes de 19 y hasta 23 nucleótidos. Los miARN se procesan cada uno a partir de moléculas de ARN precursoras más largas ("miARN precursor": pri-miARN y pre-miARN). Los pri-miARN se transcriben a partir de genes que no codifican proteínas o se incluyen en genes que codifican proteínas (dentro de intrones o exones no codificantes). Los "miARN precursores" se pliegan en estructuras en horquilla que contienen tallos con emparejamiento de bases imperfecto y se procesan 2 en dos etapas, catalizadas en animales por dos endonucleasas de tipo ribonucleasa III denominadas Drosha y Dicer. El miARN procesado es típicamente una parte del tallo. Los miARN procesados (también denominados "miARN maduros") se ensamblan en complejos de ribonucleoproteínas grandes (miRISC) que reprimen de forma post- transcripcional (regulación negativa) a un gen o genes diana específicos.

Todos los miARN pertenecientes a la invención se conocen por sí mismos y sus secuencias están públicamente disponibles de la base de datos http://www.mirbase.org/cgi-bin/mirna_summary.pl?org=hsa . Los miARN de la invención se enumeran en la Tabla A:

TABLA A: miARN pertenecientes a la invención

miARNJd

Número de Referencia

Secuencia

SEC ID Nfi:

hsa-mir-15a

MIMAT68

uagcagcacauaaugguuugug

hsa-mir-26a

MIMAT82

uucaaguaauccaggauaggcu

hsa-mir-29a

MIMAT86

uagcaccaucugaaaucgguua

hsa-mir-29b

MIMAT1

uagcaccauuugaaaucaguguu

hsa-mir-3c

... [Seguir leyendo]

 


Reivindicaciones:

1. Un método para clasificar una enfermedad inflamatoria del intestino en un paciente como enfermedad de Crohn o 5 como colitis ulcerosa, comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b-5p, m¡R15, miR-181d, miR-182, miR185, miR196a, miR199a- 1 3p, miR199a-5p, miR199b-5p, miR-23, miR223, miR-299-5p, miR32a, miR324-3p y miR-328 y

¡i) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o una colitis ulcerosa.

2. El método de acuerdo con la reivindicación 1 en el que la muestra resulta de biopsias endoscópicas realizadas en

el colon del paciente.