Cepa de corinebacteria que tiene mejorada la productividad de 5¿-xantosina monofosfato y procedimiento de producción de 5¿-xantosina monofosfato usando la misma.

Uso de una cepa de Corinebacteria para la producción de xantosina 5'-monofosfato

, en el que la cepa de Corinebacteria tiene una actividad malato deshidrogenasa más alta que su actividad endógena de tipo silvestre, mediante el aumento del número de copias del gen mqo que codifican la malato deshidrogenasa, o mediante la sustitución o modificación de un promotor de un gen mqo.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/KR2009/007559.

Solicitante: CJ CHEILJEDANG CORPORATION.

Nacionalidad solicitante: República de Corea.

Dirección: 292, Ssangnim-dong Jung-gu Seoul, 100-400 REPUBLICA DE COREA.

Inventor/es: KIM,Hye-Won, LEE,Ji-Hye, CHO,JINMAN, LEE,JINNAM, OH,YOON SEOK, PARK,JANG HEE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/20 (Bacterias; Sus medios de cultivo)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/02 (Monosacáridos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/34 (Polinucleótidos, p. ej. ácidos nucleicos, oligorribonucleótidos)
google+ twitter facebookPin it
Cepa de corinebacteria que tiene mejorada la productividad de 5¿-xantosina monofosfato y procedimiento de producción de 5¿-xantosina monofosfato usando la misma.

Texto extraído del PDF original:

DESCRIPCIÓN

Cepa de corinebacteria que tiene mejorada la productividad de 5’-xantosina monofosfato y procedimiento de producción de 5’-xantosina monofosfato usando la misma

Campo técnico

La presente invención se refiere a un vector recombinante, que tiene la estructura mostrada en el mapa de escisión de la FIG. 1 que transporta un gen de SEC ID Nº: 7 y una cepa de Corinebacteria, trasformada con el vector recombinante, que tiene una actividad malato deshidrogenasa más alta que la endógena. Además, la presente invención se refiere a un procedimiento de producción de xantosina 5’-monofosfato usando la cepa de Corinebacteria.

Antecedentes de la técnica

La 5’-guanosina monofosfato (en lo sucesivo en el presente documento denominada “GMF”) es un aditivo alimentario ampliamente usado como potenciador del sabor, como la inosina monofosfato (en lo sucesivo en el presente documento denominada “IMF”). La GMF provoca un sabor umami y su uso es dependiente del glutamato monosódico (GMS) que también se usa. A menudo se usa en sinergia con la IMF para aumentar la intensidad del sabor umami del GMS.

Los ejemplos de los procedimientos para la preparación de GMF conocidos hasta ahora incluyen (1) la degradación enzimática del ARN de levadura, (2) la fermentación directa con microorganismos a GMF, (3) la fermentación con microorganismos a guanosina, seguida de una fosforilacion química, (4) la fermentación con microorganismos a guanosina, seguida de una fosforilacion enzimática, (5) la fermentación con microorganismos a xantosina 5’-monofosfato (en lo sucesivo en el presente documento denominado “XMF”), seguida de la conversión en GMF por una cepa de corinebacteria, y (6) la fermentación con microorganismos a XMF, seguida de la conversión de la XMF en GMF por Escherichia coli que tiene actividad aminasa. De estos, el procedimiento (1) tiene dificultades de suministro de material y no es beneficioso económicamente y el procedimiento (2) sufre la desventaja de ser de bajo rendimiento debido a la permeabilidad de la membrana al GMF. Por lo tanto, los otros procedimientos se usan ampliamente en aplicaciones industriales.

Para los procedimientos en los que se produce XMF y se convierte en GMF, es crítico aumentar la productividad de XMF. Por ejemplo, la Solicitud de Patente Coreana Nº: 10-1991-018016 desvela una cepa inactiva en XMF aminasa capaz de producir XMF en un rendimiento alto, que es semi-auxotrófica para la adenina y la guanina, tolerante a los análogos de guanosina y muy susceptible a la lisozima, una enzima que destruye las paredes celulares. La Solicitud de Patente Coreana Nº: 10-2001-000513 desvela una cepa de Corynebacterium ammoniagenes que puede acumular directamente XMF a una concentración alta en un medio de cultivo y un procedimiento de producción de XMF usando la misma. La cepa se prepara mediante la irradiación del microorganismo madre con luz UV tratando con el mutágeno N-metil-N’-nitro-N-nitrosoguanidina (NTG), y seleccionando un mutante tolerante a la norvalina, un análogo de la valina que afecta a la biosíntesis de la XMF. La Solicitud de Patente Coreana Nº: 10-2008-006537 describe un procedimiento de aumento del rendimiento de la XMF en el que se modifican el purN y el purH, genes involucrados en la biosíntesis de la XMF.

Por otro lado, la productividad de ATP conduce a una producción de XMF debido a que el ATP está involucrado en la biosíntesis de XMF. También, la actividad malato deshidrogenasa tiene una gran influencia en la producción de ATP. Sin embargo, en ningún lado se mencionan en los documentos anteriores microorganismos y procedimientos que se diseñen para potenciar la actividad malato deshidrogenasa para aumentar los rendimientos de producción de XMF.

El documento WO 2010/071366 A2 (que tiene la misma fecha de prioridad que la presente solicitud) se refiere a la producción de guanosina 5’-mofosfato mediante el cultivo de células bacterianas del género Corynebacterium.

El documento US 2002/0098552 A1 se refiere a la producción de xantosina 5’-mofosfato mediante el cultivo de células bacterianas del género Corynebacterium. Sin embargo, no se desvela el uso inventivo del gen mqo.

Teniendo en cuenta que es importante aumentar la productividad de ATP de la cepa de producción de XMF, los presentes inventores han llevado a cabo una intensa investigación y han encontrado un gen que es responsable del aumento. También, se ha encontrado que una cepa de Corinebacteria transformada con un vector recombinante que transporta dos copias del gen conjuntamente, podría producir XMF en un alto rendimiento.

Divulgación

Problema técnico

Es por lo tanto un objeto de la presente invención proporcionar una cepa de Corinebacteria que tenga una actividad malato deshidrogenasa más alta que la endógena.

Es otro objeto de la presente invención proporcionar un vector recombinante que tenga la estructura mostrada en el mapa de escisión de la FIG. 1 que transporte el gen de SEC ID Nº: 7.

Es un objeto adicional de la presente invención proporcionar una cepa de Corinebacteria transformada con el vector recombinante.

Es un objeto adicional más de la presente invención proporcionar un procedimiento de producción de XMF mediante el cultivo del microorganismo transformado y de obtención de la XMF del cultivo.

Solución técnica

De acuerdo con un aspecto de la misma, la presente invención se dirige a una cepa de corinebacteria con mejoras sobre la actividad malato deshidrogenasa endógena. La cepa de corinebacteria de la presente invención se modifica para tener una actividad malato deshidrogenasa más alta que su actividad endógena de tipo silvestre, mediante el aumento del número de copias del gen mqo que codifican la malato deshidrogenasa, o mediante la sustitución o modificación de un promotor de un gen mqo, que resulta en una mejora en la productividad de XMF.

La expresión “malato deshidrogenasa”, como se usa en el presente documento, significa una enzima que cataliza la conversión de malato en oxalacetato por deshidrogenación. Esta enzima se encuentra en un espectro muy amplio de organismos vivos con el acompañamiento de lactato deshidrogenasa y requiere DPN y NAD como cofactores para su actividad, generalmente estos acompañan a la lactato deshidrogenasa. En la cepa de corinebacteria de acuerdo con la presente invención, se aumenta la actividad malato deshidrogenasa para producir XMF en un rendimiento más alto.

Como se usa en el presente documento, se pretende que la expresión “actividad endógena” se refiera a la actividad enzimática de interés en un microorganismo de tipo silvestre.

El término “más alta que la actividad endógena” significa una mayor actividad enzimática comparada con la actividad de la variedad endógena, ya sea como resultado de un aumento de la actividad por la propia enzima o por un gen endógeno o un gen extraño. Por ejemplo, un aumento en la actividad enzimática puede conseguirse mediante cualquier procedimiento bien conocido en la técnica para aumentar el número de copias del gen, o para reemplazar o modificar un promotor de un gen mqo.

La enzima objetivo malato deshidrogenasa cuya actividad se busca aumentar de acuerdo con la presente invención se codifica por el gen mqo de Corinebacteria. Puede usarse cualquier derivado o análogo en la presente invención, mientras que sea biológicamente idéntico o corresponda al gen mqo. Es decir, si su actividad es sustancialmente la misma que o similar a la del gen mqo, cualquier gen que queda dentro del intervalo del gen mqo es útil en la presente invención. Ventajosamente, el gen útil en la presente invención comparte una homología con la secuencia del gen mqo de al menos el 70 %, más preferentemente al menos el 80 %, incluso más preferentemente al menos el 90 %, incluso mucho más preferentemente al menos el 95 % y más preferentemente al menos el 98 %. Más ventajosamente, la malato deshidrogenasa está codificada por la secuencia de nucleótidos de SEC ID Nº: 7. El aumento de las copias del gen puede conseguirse mediante la introducción de genes exógenos y/o la amplificación de los genes endógenos. El número de copias del gen puede determinarse fácilmente por los expertos en la materia de acuerdo con las necesidades y el propósito. La amplificación del gen endógeno también puede llevarse a cabo usando un procedimiento conocido en la técnica, por ejemplo, mediante el cultivo en un medio selectivo adecuado a presión. En un ejemplo preferido, un vector que transporta un gen que codifica la malato deshidrogenasa se introduce en una cepa de corinebacteria para generar un microorganismo transformado con una mejora sobre la actividad endógena de tipo silvestre.

Siempre y cuando se conozca en la técnica y pertenezca al género corinebacteria, cualquier cepa puede usarse en la presente invención sin limitación. Preferentemente, los ejemplos de la cepa de corinebacteria útil en la presente invención incluyen Corynebacterium ammoniagenes, Corynebacterium glutamicum, Brevibacterium flavum, y Brevibacterium lactofermentum, pero sin limitación a los mismos. En detalle, entre las cepas de corinebacteria están el Corynebacterium ammoniagenes

ATCC6872, Corynebacterium

thermoaminogenes

FERM BP-1539,

Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum R, Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869 y derivados de los mismos. Se prefiere Corynebacterium ammoniagenes KCJ-1304 transformado de Corynebacterium ammoniagenes KCCM-10530.

De acuerdo con otro aspecto de la misma, la presente invención se dirige a un vector recombinante que tiene la estructura mostrada en el mapa de escisión de la FIG. 1, que transporta el gen de SEC ID Nº: 7.

El gen de SEC ID Nº: 7 tiene una secuencia de nucleótidos de tipo silvestre de un gen mqo de Corinebacteria. Sin embargo, es obvio que un vector recombinante que transporta un derivado o análogo del gen mqo es también útil en la presente invención, mientras el derivado o análogo sea biológicamente idéntico o corresponda al gen mqo, como se ha mencionado anteriormente. Como se usa en el presente documento, el término “gen mqo”, una abreviación del gen “malato: quinona oxidorreductasa”, significa un gen que codifica malato oxalacetato que sirve para oxidar malato a oxalacetato.

En una realización preferida, la presente invención proporciona un vector recombinante que transporta el gen mqo de SEC ID Nº: 7. Mientras transporte un gen mqo, cualquier vector recombinante normal puede emplearse en la presente invención sin limitación. Se prefiere el pDZ-mqo. En un ejemplo preferido de la presente invención, el gen mqo que contiene la SEC ID Nº: 7 se ha empleado para construir un vector recombinante pDZ-mqo (véase la FIG. 1).

De acuerdo con un aspecto adicional de la misma, la presente invención se dirige a una cepa de Corinebacteria transformada con un vector recombinante que transporta el gen mqo.

El gen mqo derivado de corinebacteria puede usarse usando un procedimiento de transformación conocido en la técnica sin limitación. Preferentemente, el gen mqo se clona en un vector para su uso en la transformación en las células.

Puede emplearse cualquier procedimiento para la trasformación si se conoce en la técnica. Como se usa en el presente documento, el término “transformación” es la alteración genética de una célula que resulta de la captación, la incorporación genómica y la expresión de un ADN extraño. Los procedimientos de transformación típicos incluyen la precipitación con CaCl2, un procedimiento Hanahan en el que el efecto de la precipitación con CaCl2 se mejora en combinación con DMSO (dimetilsulfóxido), electroporación, transfección con fosfato de calcio, fusión de protoplastos, transformación mediada por fibra de carburo de silicio, transformación mediada por Agrobacterium, transformación mediada por PEG, sulfato de dextrano, lipofectamina, y transformación mediada por desecación/inhibición. La transformación con pDZ-mqo de acuerdo con la presente invención no se limita a los ejemplos de transformación, sino que puede lograrse usando cualquier procedimiento conocido en la técnica sin limitación.

El término “vector”, como se usa en el presente documento, significa una molécula de ADN usada como vehículo para transferir material genético extraño en una célula huésped adecuada y es una construcción de ADN que contiene elementos reguladores que permiten a un transgen hacer la recombinación con un genoma huésped. Preferentemente, el vector recombinante que transporta el vector mqo de acuerdo con la presente invención puede tener la estructura mostrada en el mapa de escisión de la FIG. 1. El vector representado por el mapa de escisión de la FIG. 1 puede introducirse en corinebacteria secuencial o simultáneamente. De acuerdo con una realización preferida de la presente invención, el vector recombinante se transforma en Corynebacterium ammoniagenes KCCM-10530 que después se cultiva en un medio selectivo para permitir incorporar dos copias del gen mqo en el genoma del huésped a través de una recombinación homóloga, que resulta en la generación de un mutante de Corynebacterium ammoniagenes, llamado Corynebacterium ammoniagenes KCJ-1304. Se ha depositado con el número de referencia KCCM10972P.

Corynebacterium ammoniagenes KCJ-1304 tiene dos copias del gen mqo incorporadas en el genoma del KCCM- 10530 que resultan de la introducción en su interior del pDZ-mqo que tiene la estructura mostrada en el mapa de escisión de la FIG. 1 y la recombinación homóloga de las dos copias del gen mqo con el gen endógeno.

De acuerdo con un aspecto adicional de la misma, la presente invención se dirige a un procedimiento de producción de XMF, que comprende: el cultivo de la cepa de corinebacteria transformada y la obtención de XMF del cultivo. En la presente invención, la XMF se produce en un rendimiento más alto mediante la fermentación directa del microorganismo transformado. El microorganismo transformado es la cepa de corinebacteria que se mejora en la actividad malato deshidrogenasa sobre la actividad endógena de tipo silvestre. El gen mqo del vector recombinante se incorpora preferentemente en el genoma del microorganismo transformado que puede producir así XMF en un alto rendimiento. En una realización preferida, el microorganismo es Corynebacterium ammoniagenes KCCM10972P.

Cualquier medio conocido en la técnica puede usarse sin limitación en el cultivo de la cepa capaz de producir XMF. Preferentemente, el medio contiene glucosa como fuente de carbono y opcionalmente otras fuentes de carbono diversas. Para su uso en el cultivo de un microorganismo de interés, un medio debe cumplir los requisitos para el crecimiento del microorganismo. Los medios de cultivo para las cepas de corinebacteria son conocidos en la técnica (por ejemplo, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., Estados Unidos, 1981). Los ejemplos de las fuentes de carbono útiles para las cepas de corinebacteria incluyen azúcares y carbohidratos tales como glucosa, sacarosa, lactosa, fructosa, maltosa, almidón, celulosa, etc., aceites y lípidos tales como aceite de soja, aceite de girasol, aceite de ricino, aceite de coco, etc., ácidos grasos tales como ácido palmítico, ácido esteárico, ácido linolénico, etc., alcoholes tales como glicerol, etanol, etc., y ácidos orgánicos tales como ácido acético. Estas fuentes de carbono pueden usarse individualmente o en combinación. Los materiales orgánicos tales como peptona, extracto de levadura, extracto de carne, extracto de malta, agua de macerado de maíz, soja, etc., urea, y compuestos inorgánicos tales como cloruro de amonio, fosfato de amonio, carbonato de amonio y nitrato de amonio pueden usarse individualmente o en combinación como fuentes de nitrógeno en el medio. El dihidrógeno fosfato de potasio o hidrógeno fosfato de dipotasio, o las sales de sodio correspondientes pueden ser útiles como fuentes de fósforo. Además, el medio de cultivo puede contener sales de metal tales como sulfato de magnesio, sulfato de hierro, etc. Además, los aminoácidos y/o vitaminas pueden requerirse como elementos esenciales. El medio de cultivo también puede contener precursores adecuados. Estos materiales pueden añadirse a un medio de manera discontinua o de manera continua.

El pH en el medio de cultivo puede ajustarse mediante compuestos básicos tales como hidróxido de sodio, hidróxido de potasio, amoníaco, etc., o compuestos ácidos tales como ácido fosfórico o ácido sulfúrico. Un agente antiespumante tal como el éster de poliglicol de ácido graso puede usarse para prevenir la formación de burbujas durante el cultivo. El medio puede airearse con oxígeno o gas que contiene oxígeno (por ejemplo, aire) para mantener una condición aeróbica o con gas nitrógeno, hidrógeno o dióxido de carbono para mantener una condición anaeróbica. La temperatura de cultivo se mantiene generalmente a 20 ºC  45 ºC, y preferentemente a 30 ºC  35 ºC. El cultivo se continúa hasta que se obtiene la cantidad máxima de XMF. A este respecto, se requiere un periodo de tiempo de 10 a 160 horas.

La 5XMF así producida puede secretarse en el medio de cultivo o permanecer dentro de la célula. El procedimiento de producción de XMF de acuerdo con la presente invención comprende recuperar XMF de las células o del medio de cultivo. Para la recuperación de XMF de las células o del medio del cultivo, puede utilizarse cualquier procedimiento bien conocido en la técnica. Los ejemplos de dichos procedimientos incluyen filtración, cromatografía de intercambio aniónico, cristalización, y HPLC, pero sin limitación a los mismos.

Como se usa en el presente documento, la expresión “xantosina 5’-monofosfato” es un intermedio en la biosíntesis del ácido nucleico y es de importancia fisiológica en animales y plantas. Por lo tanto, encuentra aplicaciones en una diversidad de campos incluyendo la industria alimentaria, la industria farmacéutica y la industria médica. La xantosina monofosfato es un aditivo alimentario usado como potenciador del sabor basado en ácido nucleico para proporcionar el sabor de las setas particularmente en sinergia con GMS. La XMF es un intermedio en el metabolismo de las purinas, formada a partir de IMF, que forma GMF. Cuando se usa el microorganismo transformado de acuerdo con la presente invención, puede producirse XMF en un alto rendimiento que se sabe que se mejora en aproximadamente un 6 % comparado con los microorganismos convencionales.

Efectos ventajosos de la invención

Gracias a la actividad malato deshidrogenasa mejorada, la cepa de corinebacteria transformada de la presente invención produce XMF en un rendimiento más alto a como lo hacen los microorganismos convencionales.

Breve descripción de los dibujos

La FIG. 1 es un diagrama esquemático que muestra la estructura del vector recombinante pDZ-mqo en la que dos copias de un gen mqo se insertan en un vector pDZ.

Modo para la invención

Puede obtenerse una mejor comprensión de la presente invención a través de los siguientes ejemplos que se exponen para ilustración, pero no deben interpretarse como limitativos de la presente invención.

Ejemplo 1: Clonación del mqo derivado de la cepa de Corynebacterium ammoniagenes KCCM-10530 productora de XMF y construcción del vector recombinante (pDZ-mqo) para la incorporación genómica

La secuencia de nucleótidos del gen mqo (NCBI ID_3345228) se obtuvo de los datos del GenBank del NIH. Basándose en la secuencia, se sintetizaron dos pares de cebadores (SEC ID Nº: 1 a 4).

Mientras el genoma de Corynebacterium KCCM-10530 sirvió como molde, se llevó a cabo la PCR en presencia de ADN polimerasa de alta fidelidad PfuUltraTM (Stratagene) usando los cebadores de SEC ID Nº: 1 a 4, con 25 ciclos de desnaturalización a 95 ºC durante 30 s, hibridación a 55 ºC durante 30 s y extensión a 68 ºC durante 2 min. Los productos de la PCR así obtenidos fueron dos copias del gen mqo, cada una de 2,1 kb de longitud (mqo-A, mqo-B), que se amplificaron usando dos conjuntos de SEC ID Nº: 1 y 2, y SEC ID Nº: 3 y 4, respectivamente.

SEC ID Nº: 1; gctctagaATCGGTCATTCCATGAACCC SEC ID Nº: 2; cgcggatccCATCGATATCGCCAACTCCA SEC ID Nº: 3; cgcggatccATCGGTCATTCCATGAACCC SEC ID Nº: 4; gctctagaCATCGATATCGCCAACTCCA Tras tratarse con las enzimas de restricción adecuadas (mqo-A: XbaI + BamHI, mqo-B: BamHI + XbaI), los productos de la PCR mqo-A y mqo-B se insertaron en el vector pDZ que se trató previamente con Xbal y fosfatasa alcalina de gamba, a través de la unión de los tres fragmentos (véase la Solicitud de Patente Coreana Nº: 10-2007- 94433). Finalmente, se obtuvo un vector recombinante pDZ-mqo en el que se clonaron conjuntamente dos copias del gen mqo. La FIG. 1 es un diagrama esquemático que muestra la estructura del vector recombinante pDZ-mqo para incorporarlo en el genoma de Corynebacterium.

Ejemplo 2: Generación de una cepa con el mqo insertado

La construcción del vector pDZ-mqo se transformó en la cepa KCCM-10530 y se sometió a recombinación homóloga con el genoma para insertar una copia del gen mqo en una posición adyacente al gen mqo en el genoma. De este modo, se obtuvo una novedosa cepa productora de XMF, llamada Corynebacterium ammoniagenes KCJ-1304, que tenía dos copias del gen mqo en el genoma de la misma. La inserción de las dos copias del gen mqo conjuntamente se identificó usando la PCR usando un conjunto de cebadores (SEC ID Nº: 5 y 6) que se dirigieron a secuencias de nucleótidos cadena arriba y cadena abajo de las dos copias del gen mqo.

SEC ID Nº: 5; CTTTTCGATGACGCCCAA SEC ID Nº: 6; CCACTTTATCGGGTGAGACCA

Ejemplo 3: Actividad malato deshidrogenasa de la cepa con el mqo insertado

La Corynebacterium ammoniagenes KCJ-1304 productora de XMF preparada en el ejemplo 2 se ensayó para la actividad malato deshidrogenasa de la siguiente forma. La cepa se inoculó en un medio que contenía 10 g/l de bactopeptona, 5 g/l de bactoextracto de carne, 5 g/l de bactoextracto de levaduras, 2,5 g/l de NaCl, 50 mg/l de adenina, y 50 mg/l de guanina y se incubó a 30 ºC durante 12 h hasta que se obtuvo una DO de 10. Se recuperaron 10 ml del cultivo celular, se lavó dos veces con un tampón que comprendía HEPES 50 mM, acetato de potasio 10 mM, CaCl2 10 mM y MgCl2 10 mM, y se suspendió en 1 ml del mismo tampón. Tras la interrupción usando un equipo de ultrasonidos, se centrifugó el lisado celular. El sobrenadante se recentrifugó para proporcionar unos gránulos que después se suspendieron en 100 l de tampón. Se usaron 10 l de esta suspensión como solución enzimática. Se preparó un tampón de reacción mediante el mezclado de HEPES 50 mM, acetato de potasio 10 mM y 2,6- dicloroindolfenol (Cl2Ind) 50 M. El Cl2Ind se descongeló y mezcló justo antes de la reacción. Se añadieron a 980 l de la mezcla de reacción 10 l de malato 100 mM como sustrato y 10 l de la solución enzimática, seguido de una incubación a 30 ºC durante 15 min con agitación. La actividad enzimática se determinó mediante la medida de la concentración del Cl2Ind reducido. El Cl2Ind tenía un coeficiente de absorción de 22 cm-1mM-1 a 600 nm.

Tabla 1 [Tabla 1] [Tabla] Cepa KCCM-10530 KCJ-1304 Cl2Ind reducido (µM) 15,45 20,17 Como se muestra en la Tabla 1, se observó que la KCJ-1304 aumenta en actividad malato deshidrogenasa un 30,6 % comparado con la cepa madre KCCM-10530.

Ejemplo 4: Producción de XMF de la cepa con el mqo insertado

La cepa de Corynebacterium ammoniagenes KCJ-1304 productora de XMF preparada en el Ejemplo 2 se cultivó para producir XMF de la siguiente forma. La cepa madre de Corynebacterium ammoniagenes KCCM-10530 y la mutante KCJ-1304 se inocularon en los respectivos tubos de 14 ml, que contenían cada uno 3 ml del medio de siembra siguiente, y se incubó a 30 ºC durante 20 h con agitación a 200 rpm. Después, se añadieron los cultivos de siembra en una cantidad de 0,4 ml a 32 ml del medio de producción siguiente (24 ml del medio principal + 8 ml del medio A) en respectivos matraces de 250 ml con deflectores en las esquinas, seguido de la agitación del cultivo a 30 ºC y 230 rpm durante 96 h. A partir de ahí, la producción de 5’-XMF se midió cuantitativamente usando HPLC. Las cantidades de XMF producidas por Corynebacterium ammoniagenes KCCM-10530 y KCJ-1304 se proporcionan en la Tabla 2, a continuación.

Tabla 2 [Tabla 2] Cepa KCCM-10530 KCJ-1304 KCCM-10530 28,6 30,3 Medio de siembra: 34 g/l de glucosa, 15 g/l de peptona, 15 g/l de extracto de levadura, 2,6 g/l de NaCl, 3 g/l de urea, 150 mg/l de adenina, 150 mg/l de guanina, pH 7,2 Medio de producción (principal): 80 g/l de glucosa, 10 g/l de sulfato de magnesio, 20 mg/l de sulfato de hierro, 10 mg/l de sulfato de cinc, 10 mg/l de sulfato de manganeso, 30 mg/l de adenina, 30 mg/l de guanina, 100 g/l de biotina, 1 mg/l de sulfato de cobre, 5 mg/l de cloruro de tiamina, 10 mg/l de cloruro de calcio, pH 7,2 Medio de producción (medio A): 10 g/l de fosfato monopotásico, 10 g/l de fosfato dipotásico, 7 g/l de urea, 5 g/l de sulfato de amonio Como se desprende de los datos de la Tabla 2, se encontró que la KCJ-1304 aumenta en la producción de XMF en 1,7 g/l, que corresponde a un aumento del 5,9 %, comparado con la cepa madre KCCM-10530.

<110> CJ CHEILJEDANG CORPORATION <120> UNA CEPA DE CORINEBACTERIA QUE TIENE MEJORADA LA PRODUCTIVIDAD DE 5’-XANTOSINA MONOFOSFATO Y UN PROCEDIMIENTO DE PRODUCCIÓN DE 5’-XANTOSINA MONOFOSFATO USANDO LA MISMA <130> OPA09120/PCT <150> KR10-2008-0128847 <151> 17-12-2008 <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> cebador directo para mqo-A <400> 1 gctctagaat cggtcattcc atgaaccc 28 <210> 2 <211> 29 <212> ADN <213> Secuencia artificial <220> <223> cebador inverso para mqo-A <400> 2 cgcggatccc atcgatatcg ccaactcca 29 <210> 3 <211> 29 <212> ADN <213> Secuencia artificial <220> <223> cebador directo para mqo-B <400> 3 cgcggatcca tcggtcattc catgaaccc 29 <210> 4 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> cebador inverso para mqo-B <400> 4 gctctagaca tcgatatcg caactcca <210> 5 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> cebador directo para la detección de mqo <400> 5 cttttcgatg acgcccaa 18 <210> 6 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> cebador inverso para la detección de mqo <400> 6 ccactttatc gggtgagacc a 21 <210> 7 <211> 1503 <212> ADN <213> Corynebacterium ammoniagenes

<400> 7

REIVINDICACIONES

1. Uso de una cepa de Corinebacteria para la producción de xantosina 5’-monofosfato, en el que la cepa de Corinebacteria tiene una actividad malato deshidrogenasa más alta que su actividad endógena de tipo silvestre, mediante el aumento del número de copias del gen mqo que codifican la malato deshidrogenasa, o mediante la sustitución o modificación de un promotor de un gen mqo.

2. Uso de acuerdo con la reivindicación 1, en el que la actividad malato deshidrogenasa se mejora como resultado de un aumento en la expresión del gen mqo.

3. Uso de acuerdo con la reivindicación 2, en el que el gen mqo es de SEC ID Nº: 7.

4. Uso de acuerdo con la reivindicación 1, en el que la cepa se trasforma con un vector recombinante que comprende un gen mqo.

5. Uso de acuerdo con la reivindicación 4, en el que el gen mqo es de SEC ID Nº: 7.

6. Uso de acuerdo con la reivindicación 1, en el que la cepa de Corinebacteria es Corynebacterium ammoniagenes.

7. Un procedimiento de producción de xantosina 5’-monofosfato, que comprende el cultivo de una cepa de Corinebacteria que tiene una actividad malato deshidrogenasa más alta que su actividad endógena de tipo silvestre, mediante el incremento del número de copias del gen mqo que codifica la malato deshidrogenasa, o mediante la sustitución o modificación de un promotor de un gen mqo; y la obtención de xantosina 5’-monofosfato del cultivo.

8. Una cepa de Corynebacterium ammoniagenes con la productividad de xantosina 5’-monofosfato aumentada, que tiene una actividad malato deshidrogenasa más alta que su actividad endógena de tipo silvestre, mediante el incremento del número de copias del gen mqo que codifica la malato deshidrogenasa, o mediante la sustitución o modificación de un promotor de un gen mqo.