3,343 Patentes de abril de 2013 (pag. 44)

  1. 1377.-

    Modulación antisentido de la expresión de apolipoproteína B

    (04/2013)

    Un oligonucleótido con la secuencia de bases nucleicas GCCTCAGTCTGCTTCGCACC (SEQ ID NO:2) queinhibe la expresión de la apolipoproteína B, para uso en la reducción de los niveles de partículas pequeñas deLDL en un sujeto humano que muestra un nivel elevado de partículas pequeñas de LDL, en donde el nivel totalde colesterol LDL en dicho sujeto no es elevado.

  2. 1378.-

    Composiciones tensioactivas estructuradas de pH bajo

    (04/2013)

    Composición tensioactiva estructurada acuosa de pH bajo que comprende, con respecto a 100 partes enpeso de composición, entre aproximadamente 3 partes en peso y aproximadamente 40 partes en peso deuno o más agentes tensioactivos aniónicos seleccionados de entre agentes tensioactivos aniónicos fosfatoéster y agentes tensioactivos aniónicos carboxilato, presentando la composición un pH inferior aaproximadamente 5, viscosidad reducible por cizalladura y siendo capaz de mantener en suspensióncomponentes insolubles o parcialmente solubles en agua.

  3. 1379.-

    Procedimiento de operación de enlace y dispositivo de terminal de comunicación

    (04/2013)

    Un procedimiento para la coordinación del funcionamiento de un terminal de comunicación que presenta unasección anfitrión que lleva a cabo el tratamiento asociado con la comunicación exterior, y una sección motor la cual ejecuta una aplicación bajo un control de la sección anfitrión que comprende las etapas de:la valoración de un modo del funcionamiento del terminal de comunicación por parte de la sección anfitrión siempre que se produzca un episodio determinado de antemano el cual tenga lugar de formaperiódica, efectuando la sección anfitrión una primera valoración acerca...

  4. 1380.-

    Bobinadora para una máquina para fabricar bolsas y método para bobinar bolsas

    (04/2013)

    Una bobinadora para una máquina de bolsas comprendiendo; una ranura de entrada definida entre dos rodillos de entrada ; un primer perno , situado a lo largo de una primera trayectoria alternativade película, en la que la película puede, tras abandonar la ranura deentrada, seguir la ranura de la primera trayectoria alternativa de la películahacia el primer perno, con tal de ser bobinada sobre el primer perno ; y un segundo perno , situado a lo largo de una segunda trayectoriaalternativa de película, en el que tras abandonar la ranura de entrada, lapelícula puede seguir la segunda ranura...

  5. 1381.-

    Establecimiento y mantenimiento de llamadas en una red inalámbrica

    (04/2013)

    Un aparato que comprende: al menos un procesador configurado para determinar la calidad de servicio, QoS, para cada una demúltiples aplicaciones, para agregar la QoS para múltiples aplicaciones, y para requerir recursos radio de unared de área local inalámbrica, WLAN, en base a la QoS agregada para las múltiples aplicaciones; y una memoria acoplada a al menos un procesador; caracterizado porque las secuencias de tráfico y las secuencias de señalización se agregan separadamente.

  6. 1382.-

    Grupo mezclador termostático para baño o cocina

    (04/2013)

    Grupo mezclador termostático para baño o cocina que comprende dos válvulas (3, 3a) para regularel flujo de agua caliente y fría, caracterizado por el hecho de que: cada válvula comprende un cilindro (4, 4a) hueco, un cuerpo (5, 5a) tubular que forma un asiento deslizante delcilindro hueco y comprende una entrada (2, 2a) axial y al menos una salida (6, 6a) radial para el agua, un motor(8, 8a) eléctrico para accionar el cilindro hueco, una tapa (7, 7a) para el extremo opuesto a la entrada (2, 2a)del cuerpo tubular, que define una extensión (18, 18a) de dicho asiento deslizante, y una junta...

  7. 1383.-

    Celda eléctrica con dispositivos de prueba dieléctrica de los cables y de puesta a tierra

    (04/2013)

    Dispositivo de prueba dieléctrica de cables para realizar una prueba en unos cables mediante la inyección de unatensión por dichos cables dentro de un equipo eléctrico, como una celda de media tensión, unos medios deinyección de una tensión en dichos cables por medio de dedos de inyección situados en el extremo de dichoscables, un colector de tierra adaptado para conectar eléctricamente dichos dedos a tierra durante la operación de lacelda y que hay que retirar durante la inyección de la tensión, unos medios de puesta a tierra del equipo y a unosmedios de enclavamiento adaptados para impedir...

  8. 1384.-

    Dispositivos de recolección de muestras y métodos que utilizan marcadores y el uso de dichos marcadores como controles en la validación de una muestra, evaluación y/o certificación de laboratorio

    (04/2013)

    Un dispositivo apropiado para marcar una muestra recogida, y dicho dispositivo comprende:un medio de recogida que comprende un tubo o un sistema de recogida de membrana para recoger la muestra, enel que el medio de recogida incluye un revestimiento que comprende al menos un marcador detectable en unasuperficie interior del mismo; y en el que al menos un marcador detectable puede entrar en contacto con la muestraen el momento de recogida de la muestra para marcar la muestra recogida tras el contacto de la muestra con lasuperficie interior del medio de recogida, la cual tiene al menos un marcador detectable...

  9. 1385.-

    Dispositivo y procedimiento de montaje de retenedores y chavetas

    (04/2013)

    Un dispositivo de montaje de retenedor y chaveta para montar entre sí un eje , una chaveta y un retenedor , incluyendo el eje una cavidad (102a) formada en una superficie periférica exterior,incluyendo la chaveta una protuberancia (104b) que está formada en una superficie periférica interna yacoplada con la cavidad (102a) del eje en una dirección axial, teniendo la chaveta una superficieperiférica externa (104b) cuyo diámetro se amplía gradualmente en un lado en dirección axial, estando dividida lachaveta en una pluralidad de piezas en una dirección circunferencial, teniendo...

  10. 1386.-

    Control de diseño por medio de un polígono de diseño

    (04/2013)

    Método asistido por ordenador para obtener o calcular parámetros Dj, j ≥ 1,...,M de un diseño de cristal progresivo para gafa mediante un polígono de diseño dado , donde: - cada punto P dentro del polígono de diseño designa o determina un diseño, y el diseño en el punto P se caracteriza por unos valores de diseño Dj (P); - se dan o se pueden dar unos valores Dj (PEck), j≥1,...M de los parámetros de diseño, que caracterizan el diseño en cada punto de esquina PEck del polígono de diseño ; - se dan o se pueden dar unos valores opcionales Dj (PZusatz) de los parámetros...

  11. 1387.-

    Lector de tarjetas antifraude para máquina bancaria automática

    (04/2013)

    Aparato que comprende: un lector de tarjetas adaptado para su uso en una máquina bancaria automática; al menos un procesador, en el que el al menos un procesador es operativo para determinar al menos un parámetro variable; en el que el lector de tarjetas incluye al menos un sensor magnético en conexión operativa con el al menos un procesador; elemento de transporte de tarjetas que se extiende hacia el lector de tarjetas y en conexión operativa con el al menos un procesador, en el que el elemento de transporte de tarjetas es operativo para mover una tarjeta recibida en el elemento...

  12. 1388.-

    Procedimiento y dispositivo para la dosificación de metal fundido

    (04/2013)

    Procedimiento para la dosificación de metal fundido desde un recipiente a través de un tubo dosificador insertado en el recipiente, en el que el metal fundido asciende en el tubo dosificador hasta un borde de salida y se descarga la cantidad de dosificación desde el tubo dosificador a través del borde de salida ,caracterizado porque al menos partes de la zona del borde de salida se pulverizan con gas comprimido a modode impulsos para el mantenimiento de éstas libre de sedimentos del metal, en el que la pulverización comprende unaeliminación por soplado del metal residual.

  13. 1389.-

    Composición detergente

    (04/2013)

    Una composición detergente para lavavajillas exenta de fosfato que comprende: a) una partícula blanqueadora recubierta que comprende un núcleo que consiste en al menos 95% en pesodel núcleo de blanqueador y una capa de recubrimiento que encierra este núcleo adheriéndose al mismo que consiste en al menos 95% en peso del recubrimiento de sulfato de sodio; y b) una proteasa, amilasa o una mezcla de las mismas.en donde la composición está exenta de tensioactivos catiónicos y aniónicos.

  14. 1390.-

    Sistema y procedimiento para controlar vías ferroviarias

    (04/2013)

    Un sistema de control ferroviario, que comprende: una fibra óptica que tiene una pluralidad de partes separadas a lo largo de la longitud de la fibra óptica,pudiendo cada parte de la pluralidad acoplarse a una porción respectiva de uno de un par de rieles deuna vía; un emisor de señal óptica conectado a la fibra óptica para emitir una señal óptica en la fibra óptica; yun analizador de señal óptica conectado a la fibra óptica para recibir y analizar las señales ópticasalteradas; caracterizado porque la pluralidad de partes comprende una primera pluralidad de...

  15. 1391.-

    Derivados de xantina como agonistas selectivos de HM74A

    (04/2013)

    Un compuesto de fórmula (I) o una de sus sales farmacéuticamente aceptables, en la que R1 representa -(5 alquileno)m-X-(alquileno)n-Y; en la que m y n representan el número de átomos de carbono en la cadena de alquileno; en la que X representa un grupo seleccionado entre heteroarilo y heterociclilo; en la que Y representa un grupo seleccionado entre arilo, heteroarilo y O-arilo; que pueden estar opcionalmente sustituidos con uno o más grupos independientemente seleccionados entre alquiloC1-6, alquenilo C2-6, alquinilo C2-6, halógeno, NH2, -(CH2)q-(O)p-(CH2)q-N(R5)C(O)OR8,-(CH2)q-N(R5)C(O)R8,...

  16. 1392.-

    Derivados de heteroaril-pirrolidinil- y -piperidinil-cetona

    (04/2013)

    Un compuesto de la fórmula I: o una sal farmacéuticamente aceptables de los mismos, en la que: m es 1 n es 1; Ar es: fenilo opcionalmente sustituido, cuyos sustituyentes opcionales pueden comprender uno, dos o tres grupos cada uno elegido independientementeentre: halógeno alquilo C1-6; halo-alquilo C1-6; halo- alcoxi C1-6; alcoxi C1-6; hidroxi; hetero-alquilo C1-6 elegido entre hidroxi-alquilo C1-6 alquilsulfonilo C1-6-alquilo C1-6: y alcoxi C1-6-alquilo C1-6.

  17. 1393.-

    Artículos absorbentes que comprenden indicadores de humedad

    (04/2013)

    Un artículo absorbente que comprende: una lámina de respaldo; una composición indicadora de humedad que comprende un estabilizante, un colorante, y una matriz; un núcleo absorbente que comprende una capa de material no tejido y un complejo de material poliméricoabsorbente y material adhesivo termoplástico; en donde la composición indicadora de humedad está en contacto directo con una superficie interior de lalámina de respaldo y una superficie exterior de la capa de material no tejido; en donde el complejo de material polimérico absorbente y material adhesivo termoplástico...

  18. 1394.-

    Procedimiento para la compensación de fricción en un dispositivo de retroalimentación de fuerza equipado de una transmisión de cable

    (04/2013)

    Procedimiento de compensación de fricción en un dispositivo de retroalimentación de fuerza comprendiendo unórgano de mando manipulado por un usuario y acoplado a un cable tirante accionado por un motorreductor , el cual comprende las etapas de: - detectar una variación de flecha del cable ocasionada por una manipulación del órgano de mando; - en respuesta a esta detección, accionar el motorreductor para que desarrolle un esfuerzo (Fa) compensando almenos parcialmente los rozamientos internos (Rsa) del motorreductor oponiéndose a un movimiento del órgano demando manipulado...

  19. 1395.-

    Dispositivo y procedimiento para la determinación de la orientación de un ojo

    (04/2013)

    Dispositivo para la determinación de la ubicación y/o de la orientación de un ojo con: un sistema de detector para el registro de un rayo de luz irradiado por una parte del ojo, un sistema de proyección, que proyecta informaciones de imagen perceptibles sobre un ojo de un usuario, con un irradiador para la emisión de luz y una disposición conductora de luz de proyección para la desviación y/o el enfoque de los rayos de luz emitidos, que comprende uno o varios elementos holográficos; y una cámara que está configurada para la toma de una imagen del entorno,...

  20. 1396.-

    Cabina de pulverización con calefacción eléctrica híbrida

    (04/2013)

    Una cabina de pulverización que comprende una sala de pintura/secado con unacalefacción radiante eléctrica, caracterizada por que dicha calefacción comprende unacalefacción eléctrica híbrida que incluye la combinación de paneles radiantes eléctricos concalor difuso Y paneles radiantes eléctricos complementarios a alta temperatura ,estando los primeros distribuidos sobre las paredes perimetrales de la sala depintura/secado, estando los segundos situados hacia la parte superior de dichas paredes elevados con respecto al suelo que no pueden ser alcanzados por el operador...

  21. 1397.-

    Materiales de construcción y otros materiales con residuos de bauxita tratados y proceso de fabricación de los mismos

    (04/2013)

    Proceso para la formación de un material de construcción de cemento que contiene residuos de bauxita tratadoscomprendiendo: - preparación de barro rojo estabilizado; - preparación de un componente de cemento Portland modificado añadiendo 5 a 50 por ciento en peso de silicatos a 95a 50 por ciento en peso de cemento Portfand ; y - adición del componente de cemento Portland modificado a una mezcla de agregado estándar junto con hasta 30 % envolumen de barro rojo estabilizado donde se añade el agua y se forma la mezcla. pulverizar desechos de bauxita que contienen compuestos...

  22. 1398.-

    Dispositivo regulador de convertidor de conmutación de tensión de CC-CC, de amplio intevalo de entrada con modos de reducción y elevación

    (04/2013)

    Dispositivo regulador de convertidor de conmutación de tensión CC-CC de bajo coste para suministrarpotencia a diversos componentes en una aplicación de automóvil, que comprende un terminal de entradade excitación que recibe una tensión de excitación y que alimenta a primeros elementos deconmutador en serie, de los que una toma intermedia alimenta a medios de inductor, alimentandodichos medios de inductor a un terminal de salida de potencia, estando conectados dichos medios deinductor a través de una toma intermedia de segundos elementos de conmutador en serie de losque...

  23. 1399.-

    Anticuerpos monoclonales humanos contra CD25

    (04/2013)

    Un anticuerpo monoclonal aislado que se une a CD25 humano e inhibe la unión de IL-2 a CD25, en el que el anticuerpo comprende los dominios CDR1, CDR2 y CDR3 de VH y los dominios CDR1, CDR2 y CDR3 de VL que tienen las secuencias de aminoácidos de: (i) SEC ID Nº: 23, 24, 25, 26, 27 y 28; (ii) SEC ID Nº: 29, 30, 31, 32, 33 y 34; (iii) SEC ID Nº: 35, 36, 37, 38, 39 y 40; o (iv) SEC ID Nº: 17, 18, 19, 20, 21 y 22.

  24. 1400.-

    Usos de BNIPXL-beta en la canicie prematura

    (04/2013)

    Un polipeptido que comprende una secuencia que presenta al menos un 90% de identidad con toda o parte de lasecuencia SEC ID No: 1, para una utilizacion terapeutica en el tratamiento o prevencion de la canicie prematura enseres humanos, comprendiendo dicha parte al menos 30 aminoacidos.

  25. 1401.-

    Inhibidores basados en tiazol de enzimas que usan ATP

    (04/2013)

    Al menos una entidad química elegida de los compuestos de fórmula IV: y sales, solvatos, quelatos, complejos no covalentes farmacéuticamente aceptables y mezclas de los mismos, en los que Ar se elige de heteroarilo y heteroarilo sustituido; Q se elige de cicloalquilo, cicloalquilo sustituido, cicloheteroalquilo, cicloheteroalquilo sustituido, arilo, arilo sustituido, heteroarilo y heteroarilo sustituido; y R1 y R2 se seleccionan independientemente de hidrógeno, alquilo, alquilo sustituido, cicloalquilo, cicloalquilo sustituido, heterocicloalquilo, heterocicloalquilo...

  26. 1402.-

    Dispositivo de cierre rellenable con botón de presión para la activación

    (04/2013)

    Dispositivo de cierre rellenable con botón de presión para la activación, que está constituido por un conector para el enroscamiento o impulsión sobre un cuello de envase , y por una caperuza de cierre que está asociadacon este conector y que se puede presionar encima o articular hacia abajo alrededor de una conexión de bisagra sobre el conector y se puede encajar elásticamente sobre el mismo, en el que en el conector se puedeinsertar un envase rellenable por separado, que está cerrado en la parte inferior con una lámina de sellado que puede ser perforada...

  27. 1403.-

    Instalación de energía eólica

    (04/2013)

    Instalación de energía eólica con un rotor con al menos una pala de rotor ; que está acoplada directa o indirectamente con un generador , para la generación de potencia eléctrica, y con un sistema eléctrico , que está constituido por diferentes unidades eléctricas del sistema , que presentan componentes electrónicos, eléctricos y/o electromecánicos y/o instalaciones de protección electrotécnicas, en la que las unidades eléctricas del sistema comprenden al menos una instalación para el acoplamiento del generador en una red de corriente eléctrica , y todos...

  28. 1404.-

    Dispositivo para la desaceleración de la rotación de una bisagra, en particular, para muebles y una bisagra en particular para muebles que tengan dicho dispositivo de desaceleración

    (04/2013)

    Dispositivo para la desaceleración de la rotación de una bisagra en particular para muebles, del tipo que comprende un primer y un segundo igualador unidos operativamente a un cuerpo en forma de caja y a un brazo , dicho dispositivo comprende un contenedor que alberga al menos un elemento de fricción giratorio adecuado para arrastrarse sobre una superficie de fricción , un deslizador móvil a lo largo de una dirección de traslación durante dicha rotación de dicha bisagra y medios cinemáticos para la transformación de la traslación de dicho deslizador...

  29. 1405.-

    Diseño estructural de matriz de células binarias de memoria de acceso aleatorio magnetoresistiva (MRAM)

    (04/2013)

    Una célula binaria de Memoria de Acceso Aleatorio Magnetoresistiva de Transferencia de Par de Giro (STTMRAM)que comprende: una primera capa de metal que forma una línea de fuente en un primer plano, que incluye una primeraextensión lateral que extiende la línea de fuente en el primer plano y en una dirección perpendicular a uneje longitudinal de la línea de fuente, de manera que una porción de la primera extensión lateral no sesolapa con una segunda capa de metal, que forma una línea de bit; y una segunda capa de metal formada enun segundo plano y que tiene un...

  30. 1406.-

    Procedimiento para la fabricación de recipientes a presión, mediante el prensado de material termo-estable o de materiales termoplásticos reforzados con fibras, su posible combinación con fibras termoplásticas y los productos así obtenidos

    (04/2013)

    Procedimiento para la fabricación de recipientes a presión, mediante el prensado de material termo-estable o de materiales termoplásticos reforzados con fibras, su posible combinación con fibras termoplásticas y los productos así obtenidos. - La invención consiste en el procedimiento y los productos obtenidos mediante la técnica del prensado y calentamiento simultaneo de material termo-estable preimpregnado (SMC) y/o el prensado de materiales termoplásticos reforzados por fibras o no, por ejemplo los GMT, los cuales requieren un calentamiento inicial y posterior prensado....

  31. 1407.-

    Dispositivo para el control óptico de baja intensidad del crecimiento de vello

    (04/2013)

    Dispositivo para reducir el crecimiento de vello en la piel humana, dispositivo que comprende unafuente de pulsos de radiación electromagnética que emite en un intervalo de longitud de onda de entre550 y 1200 nm, caracterizado porque el dispositivo comprende medios de control para limitar unadensidad de energía que puede entregarse de la radiación sobre la piel a un valor máximo de entre 5 y9 J/cm2, en el que durante el funcionamiento dicho valor máximo puede seleccionarse por los medios decontrol según propiedades seleccionadas de la piel que va a tratarse, y...

  32. 1408.-

    Combinaciones de agentes abridores de los canales de potasio y de agentes inhibidores de los canales de sodio o de sustancias activas que influyen sobre los canales de sodio para el tratamiento de algias

    (04/2013)

    Uso de flupirtina en combinación con tolperisona o sus compuestos análogos eperisona o silperisona, o de sussales utilizables farmacéuticamente, para la producción de un medicamento destinado al tratamiento de algias, quevan acompañadas de un tono muscular aumentado

<< · 22 · 33 · 38 · 41 · 42 · < · 44 · > · 47 · 51 · 59 · 74 · >>