1,534 Patentes de septiembre de 2010 (pag. 12)

  1. 353.-

    Procedimiento para incorporar olores a tiradas cortas de material grafico, en primer lugar, se confecciona una silueta con material opaco correspondiente al área donde ha de aplicarse una tinta olorosa. Seguidamente se solapa dicha silueta sobre una placa de un polímero fotosensible a la luz ultravioleta . Seguidamente la placa del fotopolímero es insolada con luz ultravioleta , y una vez insolada la placa se retira la silueta quedando al descubierto una zona porosa . A continuación, la placa insolada es colocada sobre un soporte paralelo a un plano manteniendo con la superficie de ésta una distancia de separación de entre 0,5 y 5 mm, habiéndose colocado previamente en el plano el material gráfico a tratar . A continuación,...

  2. 354.-

    Un conjunto de salpicadero para un vehículo de motor incluyendo: - un salpicadero que tiene un agujero pasante ; y - un conector que engancha dicho agujero y define un asiento , que es accesible abriendo una escotilla y aloja: * un contacto para suministro eléctrico de 12 V o 24 V y * al menos un contacto eléctrico para transmisión de datos; - medios de retención para sujetar un soporte de dicho dispositivo electrónico portátil que engancha en dicho asiento ; y - medios de refuerzo dispuestos alrededor de al menos parte de dicho asiento ; caracterizado porque dichos medios de refuerzo están fijados con respecto a dicho salpicadero e incluyen...

  3. 357.-

    Procedimiento de recarga de una pieza metálica monocristalina o de solidificación dirigida, de espesor (Ws) inferior a 2 mm, en el cual se aplica sobre la pieza un haz láser y un flujo de polvo metálico , cuya naturaleza es la misma que la de la pieza metálica, para fabricar al menos una capa de metal, monocristalina o de solidificación dirigida, a partir de la pieza , siendo emitido el haz láser a una potencia "P" y desplazándose a lo largo de la pieza a una velocidad "v", caracterizado por el hecho de que el haz láser y el flujo de polvo son aplicados de modo coaxial sobre la pieza , y la relación P/v está comprendida: - para un espesor Ws...

  4. 358.-

    Una máquina expendedora , que comprende un marco de contención , que tiene al menos una pared posterior o torso y dos paredes laterales (4a, 4b) y soporta una pared frontal dispuesta con medios para acceder a la región para la extracción de productos dispensados, dicho marco de contención soportando una pluralidad de bandejas superpuestas asociadas con medios para dispensar los productos que sean dispensados, que están dispuestos en dichas bandejas, dichos medios de acceso constando de una puerta de extracción y un flap protector , que se puede mover de forma angular sobre un eje de oscilación respectivo que es substancialmente horizontal durante...

  5. 359.-

    Dispositivo de dispersión con un espacio de mezcla cerrado herméticamente, con una herramienta de dispersión , que puede ser accionada en este espacio de mezcla alrededor de un eje central, con un elemento en forma de barra para la transmisión de fuerza de un accionamiento sobre esta herramienta y con un accionamiento de este tipo que se encuentra fuera del espacio de mezcla , en el que el elemento en forma de barra está conectado en la entrada al espacio de mezcla con una membrana , que es parte de una pared del espacio de mezcla , y el elemento en forma de barra es desplazable a través del accionamiento...

  6. 360.-

    Nuevos derivados de 4,8-difenilpoliazanaftaleno inhibidores de proteína quinasa activada por mitógeno p38 que tienen la fórmula general (I) **(Figura)** procedimientos para su preparación, composiciones farmacéuticas que los comprenden y su uso en terapia

  7. 361.-

    Una composición que comprende 1,4 a 2,1% de lisina, en la que la composición tiene una relación de leucina a lisina de 1,7 a 2,7, una relación de metionina + cisteína a lisina de 0,5 a 1,5, una relación de fenilalanina + tirosina a lisina de 1,3 a 2,1, y 4 a 8 gramos de lisina por comida

  8. 362.-

    Bastidor de puerta o ventana que comprende: • un marco fijo y por lo menos un batiente montado de forma deslizante en dicho marco , * comprendiendo dicho marco , por lo menos, un larguero del marco definido según una dirección paralela a la dirección de deslizamiento del batiente , comprendiendo dicho larguero del marco una primera cavidad longitudinal prácticamente en forma de "U", * comprendiendo dicho batiente un acristalamiento y en uno de sus lados con respecto al larguero del marco en forma de travesaño elevado, un larguero del batiente definido según una dirección paralela a la dirección...

  9. 363.-

    Dispositivo de apuntalamiento para una hoja -basculable contra un marco - de una ventana, una puerta ventana o similar que comprende un cojinete de giro para mover la hoja desde una posición de cierre, en la que la hoja está situada en el marco , hasta una posición de giro en la que la hoja ha girado alrededor de un eje vertical alejándose del marco , y un dispositivo de apuntalamiento montado en la dirección axial del cojinete de giro y destinado a soportar fuerzas de la hoja situada en el marco que actúan perpendicularmente al plano de dicha hoja , en donde el dispositivo de apuntalamiento ...

  10. 364.-

    Tornillo de rueda para la fijación de una rueda de vehículo en un portarruedas dotado de alojamiento para los tornillos de rueda a lo largo de su perímetro, consistente en una cabeza ensanchada radialmente seguida de un vástago que atraviesa al mismo tiempo un cuerpo del frenado , el portarruedas y la rueda del vehículo , que comprende un tramo roscado y un tramo de centraje (Z) dotado por lo menos de una ranura helicoidal , caracterizado porque el vástago presenta entre la cabeza y el tramo roscado un tramo de seguridad (A) con una estructura superficial que mediante la introducción del tornillo...

  11. 365.-

    Un procedimiento de empalme de al menos un par de cables (2a, 2b), incluyendo cada cable (2a, 2b) al menos un conductor (3a, 3b), comprendiendo dicho procedimiento las etapas de: - provisión de una camisa tubular elástica soportada en una condición radialmente expandida sobre al menos un elemento de soporte ; - disposición de la camisa , en acoplamiento con dicho elemento de soporte , en una posición sustancialmente coaxial alrededor de uno de dichos cables (2a, 2b); - conexión de cada conductor (3a, 3b) de dicho al menos un par de cables (2a, 2b) para obtener una región de empalme entre dichos cables; -...

  12. 367.-

    Una película polimérica retráctil con el calor orientada biaxialmente que comprende una capa de control de retracción formada por una mezcla de 60% en peso a 90% en peso de un componente polimérico principal y de 10% en peso a 40% en peso de un componente de modificación, en la que el componente de modificación se escoge en el grupo formado por un plastómero de etileno, un plastómero de propileno, un copolímero de etileno/propileno catalizado por metaloceno y sus mezclas, y en la que la película presenta una retracción en la dirección de la máquina de 30% a 50% a 135ºC y una...

  13. 369.-

    Ligando de ácido nucleico que se une específicamente y con afinidad elevada a la proteína C5 del Sistema de Complemento y que es un inhibidor de la división de la proteína C5 en C5a y c5b, en el que dicho ligando comprende la secuencia: CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG o una secuencia que tiene un grado de homología primaria de secuencia superior a un 80%

  14. 370.-

    1. Un dispositivo absorbente de luz para calentar mediante una capa de superficie transparente al menos un medio líquido (L, L'') mediante energía solar, que comprende un espacio dentro de dicho capa de superficie transparente en la que dicho medio líquido (L, L'') está dispuesto para circular para dicho calentamiento, y medios dispuestos para proporcionar dicha circulación, en el que los medios absorbentes de luz (14a; 14d; L2) están configurados como una parte integrada en una construcción de tejado o de...

  15. 371.-

    1. Relleno nórdico, para vestir camas y proporcionar abrigo a los usuarios mediante su colocación directa sobre la cama o a través de un elemento de funda; comprendiendo el relleno nórdico al menos un cuerpo de gran extensión superficial; estando formada la constitución de dicho cuerpo en los rellenos nórdicos convencionales por una tapa y un reverso acolchados entre los que se inserta un relleno de plumón de ave, plumas, algodón o fibras sintéticas con un gramaje predeterminado que es función de las temperaturas...

  16. 372.-

    Una cabina para alojar una serie vertical de unidades productoras de calor, comprendiendo la cabina una cámara de equipo y una cámara de unidad refrigerante de equipo separada por una partición vertical , comprendiendo dicha cámara de unidad refrigerante de equipo un intercambiador de calor para eliminar calor de un flujo de aire, y estando adaptada dicha cámara de equipo para soportar la serie de tal manera que la serie coopera con la cabina para definir una primera cámara impelente y una segunda cámara impelente , teniendo la primera cámara impelente una entrada para recibir un flujo de aire refrigerante desde la...

  17. 373.-

    Prensa para iniciar el curvado de cantos de chapas, especialmente de cantos longitudinales de chapas en el transcurso de la fabricación de tubos o similares, que comprende al menos - un armazón de prensa constituido por uno o varios bastidores de prensa cerrados , - una bancada de prensa superior y una bancada de prensa inferior , trabajando en las bancadas de prensa superior y/o inferior una o varias disposiciones de cilindro-pistón de conformación que están apoyadas en los bastidores de la prensa, - uno o varios portaútiles superiores (7a, 7b) para uno o varios útiles superiores y uno o varios portaútiles inferiores...

  18. 374.-

    Un método para proporcionar un producto detergente para lavado de ropa que comprende (a) proporcionar un envase que comprende un recipiente; y un cierre; (b) proporcionar un detergente para lavado de ropa fluido vertible a temperatura ambiente de almacenamiento que tiene de 1 a 80% en peso de tensioactivos detersivos y que comprende al menos un material vertible desde el envase junto con el detergente para lavado de ropa fluido, en donde el material se selecciona de: una composición de perfume detergente vertible conjuntamente; un aditivo para el cuidado de tejidos; un aditivo detersivo específico para el lavado...

  19. 375.-

    Separador magnético con imanes permanentes que comprende un miembro ferromagnético para la conexión del circuito entre, como mínimo, dos polos magnéticos (3C), caracterizado porque cada polo magnético (3C) está compuesto de imanes de ferrita en la parte inferior en contacto con dicho miembro ferromagnético para la conexión del circuito y de imanes de tierras raras en la parte superior que representa la superficie de entrada/salida de las líneas de flujo magnético

  20. 377.-

    Tela prensada con una barrera anti humedecimiento que comprende: una estructura de soporte de base ; una capa de guata unida a la estructura de soporte de base; y teniendo dicha capa de guata una capa fundida que actúa como barrera anti rehumedecimiento, caracterizada por que dicha tela prensada incluye por lo menos una capa adicional de guata unida a la capa fundida

  21. 378.-

    Un dispositivo de limpieza dental eléctrico, de manera específica, un cepillo dental, que tiene un elemento temporizador para producir una señal al final de un periodo de tiempo de cepillado deseado de un cepillado dental, y que tiene un dispositivo de grabación de tiempo para grabar un periodo de tiempo de cepillado real del cepillado dental, caracterizado por que se dispone una unidad de evaluación para determinar una desviación del periodo de tiempo de cepillado real grabado con respecto a un periodo de tiempo de cepillado estándar especificado, y una unidad de control para modificar el periodo de tiempo...

  22. 380.-

    1. Módulo para la conformación de paramentos compartimentadores, tales como los que delimitan distintas zonas de un cuarto de baño o similar, así como cualquier otro tipo de recinto interior o exterior, caracterizado porque está constituido mediante dos placas de alabastro o de otro material similar, traslúcido, rectangulares, dimensionalmente idénticas entre sí, las cuales están fijadas la una a la otra mediante dos tiras de metacrilato u otro material similar, transparente, que relacionan la cara interna de las dos placas de alabastro, a...

  23. 381.-

    1. Zócalo portaleds destinado a permitir la conexión de leds (Lightemitting diode) a circuitos electrónicos sin necesidad de soldarlos, simplemente por un asentamiento e inserción a presión del led sobre el zócalo, caracterizado por el hecho de consistir en una base de material aislante , que alberga unos contactos metálicos , donde se acoplan los leds, teniendo esta base la forma idónea y específica de cada led , para que su conexionado sea fácil e inequívoco. 2. Zócalo portaleds, según la reivindicación 1, caracterizado por el...

  24. 382.-

    1. Dispositivo para la sujeción de piezas sobre palés, que comprende una estructura resistente, aplanada, conformada por un puente vertical reforzado por unos travesaños intermedios y un travesaño inferior que dispone en su parte inferior de unas patas transversales en forma de U invertida, presentando la estructura resistente en su zona inferior una pieza de bloqueo con forma de L abisagrada a la estructura en uno de sus extremos, abatible manualmente, caracterizado porque las patas transversales se prolongan mediante unas alas ...

  25. 383.-

    1. Papelera de cartón, caracterizada porque comprende una base para la sujeción de una bolsa de plástico y una tapa antiolores, acoplable sobre la base , estando conformadas la base y la tapa antiolores mediante unas láminas troqueladas de cartón impreso

  26. 384.-

    1. Funda isotérmica (F) para botellas (B) constituida por un cuerpo laminar recortado y cosido, estando dicho cuerpo laminar constituido por una capa de material aislante térmico (1a) dispuesta entre una primera capa de recubrimiento externa (1b) y una segunda capa de recubrimiento interna (1c), caracterizada por el hecho de que el cuerpo laminar comprende una parte extrema rectangular (R), comprendiendo dicha parte extrema rectangular (R), y a proximidad de uno de los lados mayores (L1), una abertura (A) alargada y paralela...

<< · 6 · 9 · 10 · < · 12 · > · 14 · 16 · 21 · 30 · >>