38 inventos, patentes y modelos de UHLMANN, EUGEN, DR.

  1. 1.-

    Composiciones y procedimientos para formulaciones de oligonucleótidos

    (12/2015)

    Un oligonucleótido inmunoestimulante que comprende: un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud mediante un espaciador, en donde el oligonucleótido incluye al menos un dinucleótido CpG no metilado, en donde el oligonucleótido tiene la fórmula 5' XP1SP2T 3', en la que X es el dominio de activación de TLR, P1...

  2. 2.-

    Análogos de oligonucleótidos CpG que contienen análogos de T hidrófobos con actividad inmunoestimuladora potenciada

    (06/2015)

    Un oligonucleótido que comprende la secuencia R1YZR2, en la que R1 y R2 son seleccionados del grupo que consiste en un análogo de nucleótido sustituido lipófilo (L), un nucleótido y un enlace, en la que al menos uno de R1 y R2 es un análogo de nucleótido sustituido lipófilo (L), en la que Y es citosina y en la que Z es guanina, en el que (L) es seleccionado de entre 5-cloro-uracilo, 5-bromo-uracilo, 5-yodo-uracilo, 5-etil-uracilo y (E)-5-(2-bromovinil)-uracilo, con la condición de que dicho oligonucleótido no sea d[GCGAA(BrU)(BrU)CGC], en la que BrU es 5-bromo-uracilo.

  3. 3.-

    Análogos de oligonucleótidos modificados con fosfato con actividad inmunoestimulante

    (06/2015)

    Un oligonucleótido inmunoestimulante que tiene al menos un dinucleótido purina-pirimidina modificado, de acuerdo con la Fórmula I**Fórmula** en la que R es hidrógeno (H), C1-C4 alquilo, metoxietil, pivaloil oximetil, pivaloil oxibenzil, o S-pivaloil tioetil o una sal tolerada fisiológicamente de los mismos; X, Y y Z son oxígeno (O) o azufre (S); R1 y R2 son H o C1-C2 alquilo; Py es un nucleósido o un análogo de nucleósido con una base citosina y Pu es un nucleósido o un análogo de nucleósido con una base guanina, por lo que el oligonucleótido...

  4. 4.-

    Análogos de oligorribonucleótidos inmunoestimulantes que contienen restos de oligofosfato modificados

    (11/2014)

    Un oligorribonucleótido (ORN) aislado que comprende un análogo de 5'-trifosfato proporcionado como**Fórmula** en la que X1 está seleccionado de O, S y NH y está ligado a un carbono 5' de un nucleótido del extremo 5' del ORN; X2 está seleccionado de O, S y NH; cada X3, cuando está presente, está seleccionado independientemente de O, S, NH, CH2, CCl2, CHF y CF2; X4 está seleccionado de OH, OR, SH, NHR, R, imidazol y Nu-O-P(Z)(Y)X3, en las que R está seleccionado de un alquilo C1-C12 y un arilo C6-C10, y en la que Nu es un nucleósido; cada Y, independiente de cualquier otro,...

  5. 5.-

    Composiciones y procedimientos para formulaciones de oligonucleótidos

    (09/2014)

    Una composición que comprende una mezcla sustancialmente homogénea de oligonucleótidos formadores de dúplex, en la que la mezcla de oligonucleótidos formadores de dúplex se formula en un tampón de baja salinidad e incluye un soluto, en donde al menos el 50 % de los oligonucleótidos formadores de dúplex están presentes en forma monomérica o dimérica y en donde los oligonucleótidos formadores de dúplex son oligonucleótidos inmunoestimulantes que comprenden: un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud tanto...

  6. 6.-

    Oligonucleótidos que inhiben la expresión de la proteína OB-RGRP y procedimiento de detección de compuestos que modifican la interacción entre las proteínas de la familia de OB-RGRP y el receptor de la leptina

    (04/2012)

    Oligonucleótido opcionalmente modificado que comprende de 8 a 50 nucleótidos que hibrida de manera específica con la secuencia SEQ ID N° 1 e inhibe la expresión de OB-RGRP, caracterizado porque comprende una secuencia que presenta una identidad de al menos 90% con la secuencia SEQ ID NO:2.

  7. 7.-

    OLIGONUCLEÓTIDOS INMUNOESTIMULADORES DE CLASE C SEMIBLANDOS

    (02/2012)

    Un oligonucleótido que comprende: 5' TC GTC GTN1TC GGCGCN1GCCG 3' (SEC IO Nº : 27) , incluyendo el oligonucleótido al menos dos enlaces internucleotídicos estabilizados y representando enlace internucleotídico fosfodiéster o de tipo fosfodiéster y en el que a) N1 es de 0 nucleótidos de longitud, refiriéndose N a cualquier nucleótido; b) N1 es de 3 nucleótidos de longitud, refiriéndose N a cualquier nucleótido; c) el oligonucleótido comprende 5' T*C G*T*C G*T*C G*T*T*C G*G*C*G*C G*C*G*C*C*G 3' (SEC IO Nº :...

  8. 8.-

    OLIGONUCLEÓTIDOS SINTÉTICOS BICATENARIOS PARA LA INHIBICIÓN DIRIGIDA A LA EXPRESIÓN GÉNICA

    (03/2011)

    Oligonucleótido de fórmula I **Fórmula** en donde N y N' son nucleótidos presentes o no en la naturaleza, de los cuales 21 nucleótidos son complementarios entre sí y en donde la hebra del nucleótido (N')y, es la hebra no codificadora o bien la hebra complementaria al gen diana, x e y son iguales cada uno a 21, n es independientemente igual a 4 hasta 6, m es independientemente igual a 0 hasta 20, p es independientemente igual a 0 hasta 10, W y Z son nucleótidos presentes o no en la naturaleza, que están enlazados a través de un enlace 3'5' o 2'5' entre nucleósidos, Li es un enlazador que une las dos...

  9. 9.-

    CONJUGADOS Y PROCEDIMIENTO PARA SU PREPARACION, ASI COMO SU USO PARA EL TRANSPORTE DE MOLECULAS A TRAVES DE MEMBRANAS BIOLOGICAS

    (04/2010)

    Uso de un radical arilo de las fórmulas F1 y F3 a F11, con

  10. 10.-

    OLIGONUCLEOTIDOS INMUNOESTIMULANTES CON MOTIVOS COMBINADOS CON ACTIVIDAD MEJORADA

    (03/2009)
    Ver ilustración. Solicitante/s: COLEY PHARMACEUTICAL GMBH UNIVERSITY OF IOWA RESEARCH FOUNDATION. Clasificación: A61K48/00, C12N15/88, C12N15/00.

    Un ácido nucleico inmunoestimulante de 14-100 nucleótidos de longitud que tiene una secuencia de bases que comprende la fórmula: 5'' PX1DCGHX2 3'' o 5'' X1DCGHX2P 3'' en la que X1 y X2 son independientemente cualquier secuencia de 0 a 10 bases de longitud, D es una base distinta de C, C es citosina, G es guanina, H es una base distinta de G y P es una secuencia que contiene palíndromo rica en CG de al menos 10 bases de longitud, en la que a) H es timina (T) y X2 es CGTTT o CGTTTT, b) P es completamente palindrómico, H es T y X2 se selecciona del grupo consistente en CG, CGT, CGTT, CGTTT y CGTTTT y/o c) P incluye al menos una hipoxantina (I).

  11. 11.-

    ENSAYO HOMOGENEO CON SONDA GENICA CON UN RECEPTOR DIRIGIDO CONTRA EL MARCADOR

    (05/2008)
    Ver ilustración. Solicitante/s: DADE BEHRING MARBURG GMBH. Clasificación: G01N33/58, C07K16/28, C12N15/09, C12Q1/68, G01N33/53, C12P21/08, C07K16/00, C07H21/04, G01N33/532.

    LA INVENCION TRATA DE UN ENSAYO HOMOGENEO DE HIBRIDACION, QUE SE BASA EN QUE LA SEÑAL DE LA SONDA GENICA NO HIBRIDADA VARIA MEDIANTE UN RECEPTOR DIRIGIDO CONTRA EL MARCADOR.

  12. 12.-

    NUEVOS DERIVADOS DE OLIGORRIBONUCLEOTIDOS PARA LA INHIBICION DIRIGIDA DE LA EXPRESION GENICA

    (02/2008)
    Ver ilustración. Solicitante/s: AVENTIS PHARMA DEUTSCHLAND GMBH. Clasificación: A61P35/00, A61K48/00, C12N15/09, C12N15/11, A61P11/06, A61P3/00, A61P31/00, A61P31/12, A61P3/10, A61P29/00, A61P9/10, A61K31/713.

    Oligonucleótido de la fórmula I 5''-(N)x-(Z)n fórmula I en donde N son ribonucleótidos que se presentan o no en la naturaleza, que son complementarios, al menos en parte, a un ARN diana, x, independientemente, es igual a 10 hasta 100, n es igual a 2 hasta 20, Z son nucleótidos que se presentan o no en la naturaleza, que están enlazados con un enlace 2''5''-internucleósido, con la condición de que sus ARN dianas homólogos presenten uno de los siguientes modelos de secuencia 5''-(U)v-(N'')z-(U)w 5''-(U)v-(N'')z-UX 5''-UX-(N'')z-UX y 5''-(U)v-(N'')z, en donde v, independientemente, es igual a 2 hasta 20, en donde w, independientemente, es igual a 2 hasta 20, z, independientemente, es 15 a 25, U es igual a uridina, N es igual a adenosina (A), guanosina (G), citidina (C) o U, y X es igual a A, G o C, de preferencia A. o bien sus sales fisiológicamente tolerables.

  13. 13.-

    DERIVADOS DE ACIDO POLIAMIDONUCLEICO, AGENTES Y PROCEDIMIENTO PARA SU PREPARACION.

    (06/2007)

    Derivado de PNA de la **fórmula**, en donde q es igual a 0 ó 1, D' es igual a hidroxi, mercapto, amino, alquilamino o acilamino, V, de modo independiente entre sí, es igual a oxígeno, azufre, NR1, V', de modo independiente entre sí, es igual a oxígeno, azufre, NR1, un grupo U-(CR3R4)u'-C(O)-NH o un grupo U-(CH2CH2O)u'-CH2-C(O)-NH , U de modo independiente entre sí, es igual a oxígeno, azufre o NH, u' de modo independiente entre sí, es igual a 1 a 10, con preferencia 1 a 4, con preferencia especial 1, W y W' de modo independiente entre sí, son iguales a oxígeno, azufre o NR1, Y e Y' de modo independiente entre sí, son iguales a hidroxi, mercapto, anión oxi, tioato o NR1...

  14. 14.-

    DERIVADOS DE POLIAMIDA-OLIGONUCLEOTIDOS , SU PREPARACION Y USO.

    (04/2007)
    Solicitante/s: AVENTIS PHARMA DEUTSCHLAND GMBH. Clasificación: C07H21/00, A61K31/70, C12Q1/68, C08L77/00, C07K14/00.

    Derivados de poliamida-oligonucleótidos de la **fórmula**, caracterizado porque x es 1 y q = r = 1 y s = t = cero o r = s = 1 y q = t = cero o q = r = s y t = cero; R2 significa hidrógeno, hidroxi, alcoxi C1-C18, halóge- no, azido o amino; B, independientemente uno de otro, representa una ba- se usual en la química de los nucleótidos, y el "cor- chete" indica que R2 y el sustituyente vecino se pue- den encontrar en las posiciones 2' y 3' o, también a la inversa, en las posiciones 3' y 2'; y en donde la estructura de poliamida contiene al menos una nucleo- base que es distinta de timina.

  15. 15.-

    DERIVADOS DE OLIGONUCLEOTIDOS 3'-MODIFICADOS.

    (06/2006)
    Solicitante/s: SANOFI-AVENTIS DEUTSCHLAND GMBH. Clasificación: C07H21/00, A61K31/70, C12Q1/68.

    Compuestos de la fórmula I así como sus sales fisiológicamente tolerables, en donde a es un número de cero a 20; b es un número de cero a 20; R1 es hidrógeno, alquilo C1-C18, alquenilo C2-C18, alquenilo C3-C18, alquilcarbonilo C1-C18, alquenilcarbonilo C2-C19, alquinilcarbonilo C3-C19, arilo C6-C20, aril C6-C14-alquilo C C1-C8, o un radical de la fórmula III R2 es hidrógeno, hidroxi, alcoxi C1-C18, halógeno, azido o NH2; D es hidroxi, O-PO32-; B es una base usual en la química de los nucleótidos, por ejemplo, para bases naturales y bases no naturales; n es un número entero de 7 a 25; n’ es un número entero de cero a 50; m’ es en la fórmula I es un número entero de cero a 5.

  16. 16.-

    OLIGONUCLEOTIDOS ANTISENTIDO CONTRA VHS 1, ASI COMO SU PREPARACION.

    (05/2006)
    Solicitante/s: SANOFI-AVENTIS DEUTSCHLAND GMBH. Clasificación: C07H21/00, A61K31/70, C12N15/11.

    Oligonucleótidos antisentido con las secuencias (Herp099): 5'-G*C*G G G G C T C C A T G G G G G T*C*G-3' (HerpOl 8): 5'-G*C*A G G A G G A T G C T G A G G A*G*G-3' (Herp002):5'-G*G*G G C G G G G C T C C A T G G G*G*G-3' (Herp112):5'-G*G*CGGGGCTCCATGGGGG*T*C-3' (Herp034): 5'-G*G*G G C T C C A T G G G G G T C G*T*A-3' (Herp024): 5'-A*A*G A G G T C C A T T G G G T G G*G*G-3' o (Herp028): 5'-G*G*C C C T G C T G T T C C G T G G*C*G-3', en donde el símbolo * significa que el enlace fosfodiéster está sustituido por un puente fosfotioato.

  17. 17.-

    ANALOGOS DE OLIGONUCLEOTIDOS 3'-DERIVATIZADOS CON AGRUPACIONES NO NUCLEOTIDICAS, SU PREPARACION Y UTILIZACION.

    (04/2006)

    Compuestos análogos a oligonucleótidos de la **fórmula** así como de sus sales fisiológicamente compatibles, caracterizados porque R1 significa hidrógeno, alquilo C1-C18, alquenilo C2- C18, alquinilo C2-C18, alquilcarbonilo C2-C18, alquenilcarbonilo C3-C19, alquinilcarbonilo C3-C19, arilo C6-C20, aril (C6-C14)-alquilo (C1-C8), o un radical de la **fórmula** ; R2 significa hidrógeno, hidroxi, alcoxi C1-C18, halógeno, azido o NH2; B representa una base usual en la química de los oligonucleótidos; a representa oxi o metileno; d, e, independientemente unos de otros, significan un número entero de 0 a 50; i significa un número entero de 1 a 10; W significa oxo, selenoxo o tioxo; V significa oxi, sulfanodiílo o...

  18. 18.-

    DERIVADOS DE ACIDO PEPTIDONUCLEICO CON CARGA NEGATIVA, AGENTES Y PROCEDIMIENTO PARA SU PREPARACION.

    (02/2006)

    Derivado de PNA de **fórmula**, en la que V es igual a oxígeno, azufre, NR1, un grupo U-(CH3R4)u- CH2-C(O)-NH o un grupo U-(CH2CH2O)u’-C(O)-NH , U independientemente uno de otro es igual a oxígeno, azufre o NH, u’ independientemente uno de otro es de 1 a 10, preferiblemente de 1 a 4, con especial preferencia 1, W independientemente uno de otro es igual a oxígeno, azufre, o NR1, Y independientemente uno de otro es igual a hidroxi, mercapto, oxianión, tioato o NR1R2, R1 y R2 independientemente uno de otro es un resto compuesto por hidrógeno, o alquilo C1-C6, preferiblemente hidrógeno, R3 y R4 independientemente uno de otro significan un resto compuesto por hidrógeno o alquilo C1-C6 o un resto de una...

  19. 19.-

    REACTIVO Y METODO PARA INHIBIR LA EXPRESION DE N-RAS.

    (01/2005)
    Ver ilustración. Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C12N9/00.

    ESTA INVENCION SE REFIERE A MOLECULAS DE ARN ENZIMATICO QUE ROMPEN MARN DE N DE RUPTURA NUX (N = CUALQUIER BASE, X = A, C = A, C O U), QUE PREFERIBLEMENTE PRESENTAN LAS SECUENCIAS 5' CCAACACCUGAUGAGCGUUAGCGAAACCUGCU A SUS DERIVADOS MODIFICADOS, A PRODUCTOS FARMACEUTICOS QUE CONTIENEN DICHAS MOLECULAS, PARA PREPARAR PRODUCTOS DESTINADOS AL TRATAMIENTO DE ENFERMEDADES QUE IMPLICAN CRECIMIENTO Y/O DIFERENCIACION CELULAR ANORMAL.

  20. 20.-

    OLIGONUCLEOTIDOS ESTABILIZADOS Y SU USO.

    (11/2004)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00, A61K31/70.

    LA INVENCION SE REFIERE A NUEVO OLIGONUCLEOTIDO ESTABILIZADO, EN DONDE SE MODIFICA AL MENOS UN NUCLEOXIDO PIRIMIDINA NO TERMINAL, ASI COMO A SU UTILIZACION COMO AGENTE DE DIAGNOSTICO O MEDICAMENTO PARA EL TRATAMIENTO DE INFECCIONES DE VIRUS, CANCER O ENFERMEDADES, EN DONDE ACTUAN LA INTEGRINA O CELULA-CELULARECEPTORES DE ADHESION.

  21. 21.-

    DERIVADOS DE POLIAMIDA-OLIGONUCLEOTIDO , SU PREPARACION Y UTILIZACION.

    (01/2003)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00.

    SE DESCRIBE DERIVADO POLIAMIDA - OLIGONUCLEOTIDO DE LA FORMULA DONDE Q, R, S, T DE FORMA INDEPENDIENTE UNO DE OTRO SIGNIFICAN 0 O 1, LA SUMA DE DOS O MAS SIMBOLOS VECINOS Q, R, S Y T SON MAYORES O IGUAL A 2; X ES 1 HASTA 20, DNA ES UN ACIDO NUCLEICO COMO DNA O RNA O UN DERIVADO CONOCIDO DE LOS MISMOS; LI ES UNA LIGADURA COVALENTE ENTRE DNA Y PNA. LA LIGADURA COVALENTE CONTIENE UN ENLACE O UN RESTO ORGANICO CON AL MENOS UN ATOMO DE LA SERIE C, N, O O S; PNA SIGNIFICA UNA ESTRUCTURA POLIAMIDA, QUE CONTIENE AL MENOS UNA NUCLEOBASE, QUE ES DIFERENTE DE IMINA; Y F Y F' SON GRUPOS TERMINALES Y/O ESTAN UNIDOS UNO CON OTRO A TRAVES DE UN ENLACE COVALENTE, ASI COMO SUS SALES TOLERABLES FISIOLOGICAMENTE, PROCESO PARA SU ELABORACION ASI COMO SU UTILIZACION COMO MEDICAMENTO, COMO SONDA DE GENES Y COMO PRIMER.

  22. 22.-

    COMPUESTOS ANALOGOS A OLIGONUCLEOTIDOS, SU PREPARACION Y UTILIZACION.

    (12/2002)

    LA INVENCION CONCIERNE A COMPUESTOS DE FORMULA I, DONDE R1 EQUIVALE A ALQUILO, ACILO, ARILO O A UN RESTO FOSFATO; R2 EQUIVALE A H, OH, ALCOXI, NH2 O HALOGENO; B EQUIVALE A UNA BASE USUAL EN LA QUIMICA DE LOS NUCLEOTIDOS; A EQUIVALE A O O CH2; N EQUIVALE A UNA CIFRA ENTERA DE 1 A 100; W = O, S O EQUIVALE A SE; V = O, S O EQUIVALE A NH; Y = O, S, NH O CH2; Y' = O, S, NH O EQUIVALE A ALQUILENO; X = OH O EQUIVALE A SH; U = OH, SH, SEH O EQUIVALE A ALQUILO, ARILO O AMINO, Y Z = OH, SH, SEH, A UN RESTO DADO EL CASO SUSTITUIDO DE LA SERIE ALQUILO, ARILO, HETEROARILO, ALCOXI O AMINO, O EQUIVALE A UN GRUPO QUE FAVORECE LA ABSORCION INTRACELULAR, O COMO MARCADOR...

  23. 23.-

    COMPUESTOS ANALOGOS A OLIGONUCLEOTIDOS DERIVATIZADOS EN 3', CON AGRUPACIONES NO NUCLEOTIDICAS, SU PREPARACION Y UTILIZACION.

    (12/2002)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00, A61K31/70, C12Q1/68, C07F9/24.

    ANALOGOS A LOS OLIGONUCLEOTIDOS 2' DERIVADOS, CON AGRUPACIONES NO NUCLEOTIDAS, SU OBTENCION Y UTILIZACION. LA PRESENTE INVENCION CONCIERNE A NUEVOS ANALOGOS A LOS OLIGONUCLEOTIDOS, CON PROPIEDADES VALIOSAS FISICAS, BIOLOGICAS Y FARMACOLOGICAS, ASI COMO UN PROCEDIMIENTO PARA SU OBTENCION.

  24. 24.-

    PROCEDIMIENTO PARA LA PREPARACION DE DERIVADOS DE N-ETIL-GLICINA SUSTITUIDOS.

    (10/2002)

    SE DESCRIBEN PROCEDIMIENTOS PARA LA OBTENCION DE DERIVADOS DE N-ETIL-GLICINA DE FORMULA EN DONDE PG ES UN GRUPO LABIL DE PROTECCION DE AMINO CONTRA ACIDOS DEBILES DEL TIPO DE URETANO O DEL TIPO DEL TRITILO, X ES NH O O, Y B{SUP,'} SON BASES USUALES EN LA QUIMICA DE LOS NUCLEOTIDOS, CUYOS GRUPOS AMINO O HIDROXILO EXOCICLICOS ESTAN PROTEGIDOS POR GRUPOS PROTECTORES CONOCIDOS Y APROPIADOS; ASI COMO SUS SALES. EL PROCEDIMIENTO SE CARACTERIZA PORQUE SE HACE REACCIONAR UN COMPUESTO DE FORMULA EN DONDE R ES HIDROGENO, O SI X = NH, ES UN GRUPO LABIL DE PROTECCION DE ACIDOS Y R{SUP,1} ES UN GRUPO DE PROTECCION LABIL CONTRA ACIDOS Y ESTABLE CONTRA AMINAS,...

  25. 25.-

    ESTERES DEL ACIDO METILFOSFONICO, PROCEDIMIENTO PARA SU PREPARACION Y SU EMPLEO.

    (03/2002)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00, A61K31/70.

    A PARTIR DE LOS COMPUESTOS TENIENDO LA FORMULA (I), EN DONDE LOS SUSTITUYENTES R', Y, W Y R TIENEN LOS SIGNIFICADOS CONOCIDOS, SE DISPONE EN VIVO DE ACTIVIDAD DE LOS RESTOS W DE SUSTANCIA ACTIVA CON PROPIEDADES FARMACOCINETICAS MEJORADAS.

  26. 26.-

    OLIGONUCLEOTIDOS ESTABILIZADOS POR RADICALES G-CAP.

    (03/2002)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00, A61K31/70.

    LA INVENCION TRATA DE OLIGONUCLEOTIDOS DE FORMULA 5 '}(CAP)-(OLIGO)-(CAP)-3{SUP ,'}, DONDE (OLIGO) SIGNIFICA UNA SECUENCIA DE NUCLEOTIDOS DE ENTRE 10 A 40 NUCLEOTIDOS Y CAP ES G{SUB,M}, SIENDO M UN NUMERO ENTERO DE CERO A DIEZ, PREFERIBLEMENTE DE DOS A SEIS, ESPECIALMENTE DE DE TRES A CINCO Y MUY ESPECIALMENTE VALE CUATRO, Y DONDE LOS DOS CAPS QUE APARECEN EN LA MOLECULA SE PUEDEN DEFINIR INDEPENDIENTEMENTE UNO DE OTRO, Y EN EL CASO QUE M SEA IGUAL A CERO EN EL EXTREMO 5{SUP,'} O 3{SUP,'}, Y QUE EL EXTREMO DE LA SECUENCIA "OLIGO" NO ACABE EN GUANINA, DEBEN SER OBLIGATORIAMENTE DIFERENTES. SE DESCRIBE TAMBIEN UN PROCEDIMIENTO PARA SU OBTENCION, MEDICAMENTOS CON LOS OLIGONUCLEOTIDOS DE LA INVENCION Y SU UTILIZACION PARA FABRICAR UN MEDICAMENTO PARA EL TRATAMIENTO DE ENFERMEDADES O LA REALIZACION DE UN DIAGNOSTICO.

  27. 27.-

    FOSFONOMONOESTER-ACIDOS NUCLEICOS, PROCEDIMIENTO PARA SU PREPARACION Y SU UTILIZACION.

    (03/2002)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07H21/00, A61K31/70, C12Q1/68, A61K31/66, C07F9/40.

    SE DESCRIBEN NUEVOS ANALOGOS DE OLIGONUCLEOTIDOS DE FORMULA (I), EN DONDE A, B, D, G, L, P, Q, Q{SUP,'}, R{SUP,5}, R{SUP,6}, X, Y, Z Y N SE DEFINEN EN LA DESCRIPCION, CON VALIOSAS PROPIEDADES FISIOLOGICAS, BIOLOGICAS Y FARMACOLOGICAS, Y UN PROCEDIMIENTO PARA SU OBTENCION, SU APLICACION SE RELACIONA CON SU UTILIZACION COMO INHIBIDORES DE LA EXPRESION GENICA (OLIGONUCLEOTIDOS DE SENTIDO CONTRARIO, RIBOZIMAS, OLIGONUCLEOTIDOS CON SENTIDO Y OLIGONUCLEOTIDOS QUE FORMAN TRIPLETES), COMO SONDAS PARA LA DETERMINACION DE ACIDOS NUCLEICOS Y COMO COMPUESTOS AUXILIARES EN LA BIOLOGIA MOLECULAR.

  28. 28.-

    SINTESIS DE ACIDOS NUCLEICOS PEPTIDICOS (PNA) CON UTILIZACION DE UN GRUPO PROTECTOR DE AMINO INESTABLE FRENTE A BASES.

    (12/1999)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C07D239/54, C07D239/46, C07D473/18, C07D473/34, C08G69/06, C08G69/10.

    SE DESCRIBE UN PROCESO PARA LA ELABORACION DE OLIGOMEROS PNA DONDE R0 SIGNIFICA HIDROGENO, ALCANOIL, ALCOXICARBONIL, CICLOALCANOIL, AROIL, HETEROAROIL, O UN GRUPO, QUE ES ADECUADO PARA LA RECEPCION INTRACELULAR DE OLIGOMERO, A Y Q SON RESTOS AMINOACIDOS, K Y L SON 0 HASTA 20, N SIGNIFICA 1 HASTA 50, B ES UNA NUCLEOBASE HABITUAL EN LA QUIMICA DE NUCLEOTIDOS Y Q0 SIGNIFICA OH, NH2 O ALQUILAMINO QUE PUEDE SER SUSTITUIDO POR ON O NH2. CON ELLO SE DESDOBLAN LOS RESTOS AMINOACIDO Y LOS COMPONENTES DONDE PG ES UN GRUPO DE PROTECCION AMINO INESTABLE DE BASE Y B' ES UNA NUCLEOBASE PROTEGIDA EN AMINOFUNCION EXOCICLICA, EN FORMA DE ETAPAS DE ACUERDO CON EL METODO DE FASE SOLIDA SOBRE UN SOPORTE POLIMERO, QUE ESTA PROVISTO CON UN GRUPO DE ANCLAJE. SIENDO ACOPLADO Y, DESPUES DE TERMINADA LA CONSTITUCION, SE DESDOBLAN LOS COMPUESTOS OBJETIVO POR MEDIO DE UNA REACCION DE DESDOBLAMIENTO DE SOPORTE POLIMERO. SE DESCRIBEN ADEMAS PRODUCTOS INTERMEDIOS DE OLIGOMEROS PNA ASI COMO PROCESO PARA SU ELABORACION.

  29. 29.-

    SINTESIS DE ACIDOS NUCLEICOS DE PEPTIDOS O POLIAMIDAS (PNA) UTILIZANDO UN GRUPO PROTECTOR DE AMINO INESTABLE FRENTE A ACIDOS DEBILES.

    (08/1999)

    SE DESCRIBE PROCESO PARA ELABORACION DE OLIGOMEROS PNA DE LA FORMULA DONDE B/X ESTAN DEFINIDOS COMO EN LA DESCRIPCION, R0 SIGNIFICA HIDROGENO, ALCANOIL, ALCOXICARBONIL, CICLOALCANOIL, AROIL, HETEROAROIL O UN GRUPO, QUE ES FAVORABLE PARA LA RECEPCION INTRACELULAR DE OLIGOMEROS, A Y Q REPRESENTAN RESPECTIVAMENTE UN RESTO DE AMINOACIDO; K Y L SON RESPECTIVAMENTE UNA CIFRA COMPLETA DESDE 0 HASTA 10, B ES UNA NUCLEOBASE NATURAL HABITUAL EN LA QUIMICA DE NUCLEOTIDOS O NUCLEOBASE NATURAL O SUS FORMAS DE MEDICAMENTO, O TAMBIEN UN COMPUESTO DE SUSTITUCION DE BASE, Q0 ES HIDROXI O NH2 EVENTUALMENTE SUSTITUIDO Y N ES UNA...

  30. 30.-

    PREPARACION DE PROTEINAS DE FUSION.

    (02/1999)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT THE GENERAL HOSPITAL CORPORATION. Clasificación: C12N15/62.

    SE OBTIENEN PROTEINAS DE FUSION EN ALTOS RENDIMIENTOS SI SE CONSTRUYE UN OLIGONUCLEOTIDO MEZCLADO QUE CODIFICA EL CONSTITUYENTE COMPENSADOR DE LA PROTEINA DE FUSION. LA MEZCLA OLIGONUCLEOTIDA SE INTRODUCE EN UN VECTOR DE TAL MANERA QUE ESTA FUNCIONALMENTE UNIDA A UNA REGION REGULADORA Y AL GEN ESTRUCTURAL PARA LA PROTEINA DESEADA. DE ESTA MANERA SE TRANSFORMAN UNAS CELULAS HUESPED CON LA POBLACION PLASMIDA OBTENIDA Y SE SELECCIONAN LOS CLONES QUE PRODUCEN UNA ALTA PRODUCCION DE PROTEINA DE FUSION CODIFICADA.

  31. 31.-

    PROCEDIMIENTO PARA PRODUCIR UNOS PRODUCTOS INICIADORES DE INSULINA Y ESTREPTOMICINA

    (03/1996)
    Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Clasificación: C12N15/17, C12N15/62.

    DICHO PROCEDIMIENTO CONSISTE EN (A) ACOPLAR UN GEN PARA PROINSULINA REDUCIDA SEGUN AFINIDADES Y TENDENCIAS DE LOS GENES: (B) COMBINAR LA INSULINA (B) CON LA CADENA (A) POR LYS O ASOCIACION LYS-LYS; (C) INSTALAR LA CONSTRUCCION DE GEN EN UN VECTOR DE EXPRESION; (D) TRANSFORMAR LA CONSTRUCCION DE GEN EN CELULAS ANFITRIONAS DE ESTREPTOMICINA; (E) EXPRESAR LA TRANSFORMACION EN FUSION DE PROTEINAS Y (F) SECRECIONAR LA FUSION DE PROTEINAS. LA FUSION DE PROTEINAS SE PUEDE DISOCIAR LIGERAMENTE EN PRECURSORES DE INSULINA.

  32. 32.-

    RNA CON ACTIVIDAD DE ENDONUCLEASA Y ANTISENE, SU FABRICACION Y SU APLICACION.

    (11/1995)
    Solicitante/s: HOECHST SCHERING AGREVO GMBH. Clasificación: C12N5/10, A01H5/00, C12N15/11, C12N9/00, A01N57/16.

    LAS CELULAS RECEPTORAS PUEDEN SER TRANSFORMADAS DE MODO QUE EXPRIMAN RNA-RIBOZIMASA Y RNA "ANTISENE", QUE ESTAN ENLAZADOS ENTRE SI EN EL LOOP DE LA RIBOZIMASA. LAS MOLECULAS RNA PUEDEN SER COMPLEMENTARIAS A UN DETERMINADO VIRUS RNA. LAS PLANTAS QUE HAYAN SIDO TRANSFORMADAS CON GENES CODIFICANTES PARA TALES RNA MUESTRAN UNA DEFENSA ANTIVIRICA SIGNIFICATIVAMENTE MEJORADA.

1 · >>