9 patentes, modelos y diseños de YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD

  1. 1.-

    Novedosos moduladores de la señalización de proteínas cinasas

    (02/2015)

    Un compuesto representado por la estructura de fórmula 1: **Fórmula** en la que R1, R2, R5 y R6 están seleccionados cada uno independientemente de H, alquilo C1-C4, alquenilo C2-C6, alquinilo C2-C6, alquil C1-C4-alquenilo C2-C6, alquil C1-C4-alquinilo C2-C6, (CH2CH2O)nH, cicloalquilo C3-C7, arilo, heterociclilo, heteroarilo, alquil (C1-C4)-arilo, alquil (C1-C4)-heterociclilo, alquil (C1-C4)-heteroarilo, haloalquilo, acilo y un grupo funcional que da lugar a hidroxilo tras la hidrólisis; R3, R4, R7, R8, R9, R10, R11, R12, R13 y R14 están seleccionados cada uno independientemente de H, alquilo C1- C4, alquenilo C2-C6, alquinilo C2-C6, alquil C1-C4-alquenilo...

  2. 2.-

    RNasa T2 humana recombinante y usos de la misma

    (09/2014)

    Una proteína de ribonucleasa aislada de la familia T2 como se expone en SEC ID Nº: 4, en la que la actividad ribonucleasa se inactiva por calor mediante autoclave y tiene actividad de unión a actina.

  3. 3.-

    Uso de incensol y de derivados del mismo para neuroprotección y para el tratamiento de la depresión y la ansiedad

    (07/2014)

    Un compuesto que tiene la fórmula estructural I, incluyendo enantiómeros, diastereómeros, solvatos, y sales farmacéuticamente aceptables de los mismos: [I] **Fórmula** en la que, R es seleccionado de entre H, -C(≥O)R' y -C(≥O)OR", en las que R' es alquilo C1-2 y R" es H o alquilo C1-25; R1, R2, R5 y R6 son seleccionados independientemente de entre H, OH y CH3; R3, R4, R7 y R8 son seleccionados independientemente H y OH; R9 es H o CH3; o uno de R1 y R2 y uno de R3 y R4 tomados conjuntamente forman (i) un segundo enlace entre C12 y C13 o (ii) un anillo epóxido, junto con el carbono al que están unidos; y/o uno de R5 y R6 y uno de R7 y R8 tomados conjuntamente...

  4. 4.-

    Uso de NKp46 para prevenir la diabetes tipo I

    (04/2014)

    Una composicion que comprende, al menos, una proteina y un portador farmaceuticamente aceptable, en la que la proteina se selecciona del grupo formado por: una proteina que comprende un fragmento aislado de la region extracelular de NKp46; un anticuerpo especifico para la region extracelular de NKp46,y una combinacion de los mismos, para su uso en la prevencion o el tratamiento de la diabetes tipo 1.

  5. 5.-

    Oligonucleótido antisentido contra la isoforma R de la acetilcolinesterasa humana (ACHE-R) y sus usos

    (03/2013)

    Un oligonucleótido sintético antisentido dirigido contra el ARNm de AChE humano que tiene la secuencia denucleótidos: 5'CTGCCACGTTCTCCTGCACC 3' (SEQ ID NO: 1), en la que dicho oligonucleótido antisentido suprime de formaselectiva la producción de la isoforma AChE-R.

  6. 6.-

    Uso de una ribonucleasa de la familia T2 que tiene actividad de unión a actina para inhibir angiogénesis tumoral

    (03/2013)

    Una ribonucleasa de la familia T2 para uso en la inhibición de la angiogénesis tumoral en un sujeto, en donde laribonucleasa de la familia T2 se une a actina en su forma ribonucleolítica activa o no activa, en donde dicharibonucleasa se caracteriza por un peso molecular de la proteína T2 de 24 a 36 kDa y un pH óptimo para actividadRNasa.

  7. 7.-

    Uso de una ribonucleasa de la familia T2 que tiene actividad de unión a actina para inhibir y/o invertir la proliferación

    (03/2013)

    Una ribonucleasa de la familia T2 para uso en la prevención, la inhibición y/o la inversión de la proliferación, lacolonización, la diferenciación y/o el desarrollo de células tumorales en un sujeto en donde dicha ribonucleasa de lafamilia T2 es RNasa B1 y estando dicha ribonucleasa desprovista de actividad ribonucleolítica.

  8. 8.-

    Construcciones que contienen múltiples casetes de expresión para terapia de cáncer

    (01/2013)

    Una construcción de ácido nucleico, que comprende: un primer marco abierto de lectura que codifica una toxina diftérica, estando el primer marco abierto de lecturaunido operativamente a una secuencia reguladora de la transcripción específica de H19; y un segundo marco abierto de lectura que codifica una toxina diftérica, estando el segundo marco abierto delectura unido operativamente a una secuencia reguladora de la transcripción de IGF-II seleccionada de lassecuencias P4 de IGF-II y P3 de IGF-II, o que comprende: un primer marco abierto...

  9. 9.-

    PRODUCTOS PARA PREVENIR LA PENETRACIÓN EN LA PIEL

    (02/2011)

    Un compuesto representado por la fórmula general (I): CH3(CH2)mCH(OX)(CH2)nCOO(CH2)iCH(OX)(CH2)kCH3 en la que X es un grupo orgánico que absorbe luz en la región ultravioleta y (CH2)i, (CH2)k, (CH2)m y (CH2)n son cadenas alifáticas que contienen de 5 a 30 grupos metileno