FACTOR NEUROTROFICO DEPENDIENTE DE ACTIVIDAD III (ADNF III).

Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales

, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica humana, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº:

Tipo: Resumen de patente/invención. Número de Solicitud: W9802485US.

Solicitante: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTME
RAMOT UNIVERSITY, AUTHORITY FOR APPLIED RESEARCH & INDUSTRIAL DEVELOPMENT LTD
.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: OFFICE OF THE DIRECTOR, OFFICE OF TECHNOLOGY TRANSFER, BOX OTT,ROCKVILLE, MD 20892-9902.

Inventor/es: .

Fecha de Publicación: .

Fecha Concesión Europea: 16 de Septiembre de 2009.

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/475 (Factores de crecimiento; Reguladores de crecimiento)

Clasificación PCT:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen péptidos... > A61K38/22 (Hormonas (derivados de pro-opiomelanocortina, pro-encefalina o pro-dinorfina A61K 38/33, p. ej. corticotropina A61K 38/35))
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/475 (Factores de crecimiento; Reguladores de crecimiento)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/22 (contra factores de crecimiento)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/18 (Hormonas de crecimiento)

Clasificación antigua:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen péptidos... > A61K38/22 (Hormonas (derivados de pro-opiomelanocortina, pro-encefalina o pro-dinorfina A61K 38/33, p. ej. corticotropina A61K 38/35))
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/475 (Factores de crecimiento; Reguladores de crecimiento)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/22 (contra factores de crecimiento)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/18 (Hormonas de crecimiento)
google+ twitter facebookPin it
FACTOR NEUROTROFICO DEPENDIENTE DE ACTIVIDAD III (ADNF III).

Fragmento de la descripción:

Factor Neurotrófico Dependiente de Actividad III (ADNF III).

Campo de la invención

La presente invención se refiere en general al Factor Neurotrófico Dependiente de Actividad III (ADNF III), también conocido como Proteína Neuroprotectora Dependiente de Actividad (ADNP). Más particularmente, la presente invención se refiere a secuencias de ácido nucleico que codifican polipéptidos de ADNF III; los polipéptidos de ADNF III codificados por tales secuencias de ácidos nucleico; anticuerpos para polipéptidos de ADNF III y el uso de tales polipéptidos de ADNF III para el tratamiento de deficiencias neurológicas y para la prevención de muerte celular asociada con (1) gp120, la proteína de envuelta de VIH; (2) ácido N-metil-D-aspártico (excito-toxicidad); (3) tetrodotoxina (bloqueo de actividad eléctrica) y (4) péptido ß-amiloide, una sustancia relacionada con degeneración neuronal en enfermedad de Alzheimer.

Antecedentes de la invención

La división, supervivencia y diferenciación neuronal dependen durante el desarrollo de un diverso grupo de proteínas y factores de crecimiento peptídico. En este grupo de moléculas reguladoras se incluyen factores tróficos reconocidos, tales como factor de crecimiento nervioso (NGF) (Levi-Montalcini, Differentiation, 13: 51-53 (1979)), factor neurotrófico ciliar (CNTF) (Lin y col., Science 24: 1023-1025 (1989)), factor de crecimiento de fibroblastos (FGF) (Wallicke y col., J. Neurosci. 11: 2249-2258 (1991)), factores de crecimiento similares a insulina 1 y 2 (IGF 1 y 2) (Ishii y col., Pharmacol. & Ther. 62: 125-144 (1994)), factor neurotrófico derivado del cerebro (BDNF) (Laibrock y col., Nature 341: 149-152 (1989)), factor neurotrófico derivado de la glía (GDNF) (Lin y col., Science 260: 1130-1132 (1993)) y neutrofina-3 y neutrofina-4/5 (Henderson y col., Nature 363: 266-269 (1993)). Además, las citoquinas también tienen propiedades neurotróficas (Brenneman y col., J. Neurochem. 58: 454-460 (1992); Patterson, Curr. Opin. Neurobiol. 2: 91-97 (1992)). Aunque muchos de los factores de crecimiento clásicos en primer lugar se reconoció que jugaban papeles tróficos importantes en las interacciones neurona/célula diana, actualmente está claro que las células gliales en el sistema nervioso central (SNC) expresan la mayoría de estos factores de crecimiento/citoquinas y que estas células de soporte juegan papeles significativos durante el desarrollo y la reparación/regeneración nerviosa.

Con respecto a esto, se han realizado esfuerzos para apreciar el papel de neuropéptidos en la regulación de la liberación/expresión de sustancias tróficas derivadas de la glía y para identificar nuevas moléculas gliales que contribuyen a la supervivencia de neuronas del SNC en desarrollo. En particular, se han realizado esfuerzos para apreciar el papel del soporte trófico para neuronas dependientes de actividad en el SNC. Las neuronas dependientes de actividad son una clase de neuronas que mueren durante el bloqueo eléctrico debido a una reducción de materiales tróficos solubles en su entorno (Brenneman y col., Dev. Brain Res. 9: 13-27 (1993); Brenneman y col., Dev. Brain Res. 15: 211-217 (1984)). Se ha demostrado que el bloqueo eléctrico inhibe la síntesis y liberación de materiales tróficos en el medio extracelular de cultivos de SNC (Agostan y col., Mol. Brain. Res. 10: 235-240 (1991); Brenneman y col., Peptides 6(2): 35-39 (1985)). En esta mezcla trófica se incluye péptido intestinal vasoactivo (VIP) (Brenneman y col., Peptides, mencionado anteriormente (1985); Brenneman y col., Proc. Natl. Acad. Sci. EE.UU. 83: 1159-1162 (1986)).

El péptido de 28 aminoácidos VIP, aislado originalmente por Said (Said y col. Ann. NY Acad. Sci. 527: 1-691 (1988)), se ha asociado con protección celular en neuronas sensoriales, neuronas simpáticas axotomizadas y pulmones y vías respiratorias con lesión aguda (véase, por ejemplo, Gressens y col., J. Clin. Invest. 100: 390-397 (1997)). De hecho, la carencia de regulación de expresión de VIP observada en estos sistemas lesionados o inflamados probablemente representa una respuesta adaptativa que limita el daño y promueve la recuperación.

Se ha demostrado que VIP interacciona con receptores de alta afinidad presentes en las células gliales (Gozes y col., J. Pharmacol. Exp. Therap. 257: 959-966 (1991)), dando como resultado la liberación de sustancias promotoras de la supervivencia (Brenneman y col., J. Cell. Biol. 104: 1603-1610 (1987); Brenneman y col., J. Neurosci. Res. 25: 386-394 (1990), entre las cuales se encuentra una citoquina derivada de la glía IL-1-a (Brenneman y col., J. Neurochem. 58: 454-460 (1992); Brenneman y col., Int. J. Dev. Neurosci. 13: 137-200 (1995)) y proteasa nexina I, un inhibidor de serina proteasa (Festoff y col., J. Neurobiol. 30: 255-26 (1995)). Sin embargo, los efectos promotores de la supervivencia neuronal del medio acondicionado con VIP se observaron en concentraciones muy bajas que podrían no atribuirse a IL-1 o proteasa nexina I liberada de la astroglia. Por lo tanto, se han realizado esfuerzos para identificar otras proteínas promotoras de la supervivencia liberadas a partir de células gliales estimuladas mediante VIP.

Al hacer esto, se ha descubierto una proteína neuroprotectora novedosa secretada por la astroglía en presencia de VIP (Brenneman & Gozes, J. Clin. Invest. 97: 2299-2307 (1996); Gozes y Brenneman, J. Molec. Meurosci. 7: 235-244 (1996)). La proteína neurotrófica se aisló mediante procedimientos cromatográficos secuenciales que combinan intercambio de iones, separación por tamaño e integración hidrófoba. Esta proteína neuroprotectora (masa molar, 14 kD y pl, 8,3 ± 0,25) se denominó factor neurotrófico dependiente de actividad (ADNF o ADNF I) por dos razones: (1) era necesario un bloqueo de actividad eléctrica espontánea para detectar la acción neuroprotectora de esta sustancia en cultivos de médula espinal disociados; y (2) VIP, un secretagogo para ADNF, se liberaba durante la actividad eléctrica, haciendo que la presencia de ADNF en el medio extracelular dependiera indirectamente de actividad espontánea. Se observó que ADNF mostraba neuroprotección en concentraciones sin precedentes. Más particularmente, se observó que concentraciones femtomolares de ADNF protegían a las neuronas de muerte asociada con una amplia variedad de toxinas, incluyendo las relacionadas con enfermedad de Alzheimer, el virus de inmunodeficiencia humana (VIH), excitotoxicidad y bloqueo eléctrico (véase, por ejemplo, Gozes y col., Dev. Brain Res. 99: 167-175 (1997)).

A lo largo de estudios dirigidos a las características estructurales de ADNF, se descubrió un fragmento peptídico activo de ADNF. Este péptido activo, 9 aminoácidos obtenidos de ADNF (ADNF-9), se observó que tenían homología marcada, pero no identidad, con una proteína de estrés intracelular: proteína de choque térmico 60 (hsp60). Además, se demostró que ADNF-14 imitaba la potencia de la proteína precursora, mientras que mostraba un intervalo más amplio de concentraciones eficaces en comparación con la proteína precursora. Además, ADNF-14, similar a ADNF, ha demostrado evitar la muerte de células neuronales asociada con la proteína de envuelta (gp120) de VIH (véase Dibbern y col., J. Clin. Invest. 99: 2837-2841 (1997)), con excitotoxicidad (N-metil-D-aspartato), con el péptido ß-amiloide (citotoxina putativa en enfermedad de Alzheimer) y con tetrodotoxina (bloqueo eléctrico) (véase Brenneman & Gozes, J. Clin. Invest. 97: 2299-2307 (1996)).

El descubrimiento de ADNF ha proporcionado conocimiento adicional con respecto a la acción neuroprotectora de VIP (Gozes & Brenneman, Mol. Neurobiol. 3: 201-236 (1989), Said,...

 


Reivindicaciones:

1. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica humana, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº: 2.

2. El ácido nucleico aislado de acuerdo con la reivindicación 1, en el que dicho ácido nucleico aislado tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 2 o su complemento.

3. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica murina, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº: 4.

4. El ácido nucleico aislado de acuerdo con la reivindicación 3, en el que dicho ácido nucleico aislado tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 4 o su complemento.

5. El ácido nucleico aislado de acuerdo con la reivindicación 1 ó 3, en el que dicho ácido nucleico comprende además un vector recombinante.

6. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que el ácido nucleico se amplifica mediante cebadores que hibridan específicamente en condiciones de hibridación rigurosas a la misma secuencia que un conjunto de cebadores que comprende cebadores seleccionados entre el grupo constituido por:

sentido 5'TCCAATGTTCACCTGCAG 3' (SEC ID Nº: 7)
sentido 5' ACCTGCAGCAAAACAACTAT 3' (SEC ID Nº: 9) hskip0.3cm y
antisentido 5' GCTCGTTACAGATTGTAC 3' (SEC ID Nº: 8)

7. Un polipéptido de ADNF III aislado que evita la muerte de células neuronales, estando dicho ADNF III codificado por un ácido nucleico de la reivindicación 1 ó 3.

8. El polipéptido de ADNF III aislado de acuerdo con la reivindicación 7, en el que dicho polipéptido de ADNF III, tiene una secuencia de aminoácidos que comprende la SEC ID Nº: 1.

9. El polipéptido de ADNF III aislado de acuerdo con la reivindicación 7, en el que dicho polipéptido de ADNF III, tiene una secuencia de aminoácidos que comprende la SEC ID Nº: 3.

10. El polipéptido de ADNF III aislado de la reivindicación 7, en el que dicho polipéptido de ADNF III está codificado por un ácido nucleico que tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 2.

11. El polipéptido de ADNF III aislado de la reivindicación 7, en el que dicho polipéptido de ADNF III se reproduce de forma recombinante.

12. Un polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III, comprendiendo dicho polipéptido la siguiente secuencia de aminoácidos:

(R1)x-Asn-Ala-Pro-Val-Ser-Ile-Pro-Gln-(R2)y hskip1cm (SEC ID Nº: 10),

en el que:

R1 es una secuencia de aminoácidos que comprende de 1 a aproximadamente 40 aminoácidos en la que cada aminoácido se selecciona independientemente;

R2 es una secuencia de aminoácidos que comprende de 1 a aproximadamente 40 aminoácidos en la que cada aminoácido se selecciona independientemente; y

x e y se seleccionan independientemente y son iguales a cero o uno.

13. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x e y son ambos cero.

14. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Gly-Gly-; e

y es cero.

15. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Leu-Gly-Gly-;

y es uno; y

R2 es -Gln-Ser.

16. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Leu-Gly-Leu-Gly-Gly- (SEC ID Nº: 17);

y es uno; y

R2 es -Gln-Ser.

17. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Ser-Val-Arg-Leu-Gly-Leu-Gly-Gly- (SEC ID Nº: 18);

y es uno; y

R2 es -Gln-Ser.

18. El polipéptido de ADNF III de acuerdo con la reivindicación 12, en el que dichos polipéptidos de ADNF III tienen una secuencia de aminoácidos seleccionada entre el grupo constituido por las SEC ID Nº: 1 y SEC ID Nº: 3.

19. El polipéptido de ADNF III de una cualquiera de las reivindicaciones 12 a 18, para uso en terapia.

20. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF III) de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para el tratamiento de enfermedad de Alzheimer.

21. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF III) de una cualquiera de las reivindicaciones 12 a 18 para uso en el tratamiento de enfermedad de Alzheimer.

22. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para la prevención de muerte de células neuronales inducida por el péptido ß-amiloide en un paciente aquejado con enfermedad de Alzheimer.

23. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en la prevención de muerte de células neuronales inducida por el péptido ß-amiloide en un paciente aquejado con enfermedad de Alzheimer.

24. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para la prevención de muerte neuronal en un paciente infectado con virus de inmunodeficiencia humana.

25. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en la prevención de muerte neuronal en un paciente infectado con virus de inmunodeficiencia humana.

26. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para aliviar el deterioro del aprendizaje producido por bloqueo colinérgico en un paciente aquejado con enfermedad de Alzheimer.

27. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en el alivio del deterioro del aprendizaje producido por bloqueo colinérgico en un paciente aquejado con enfermedad de Alzheimer.

28. Una composición farmacéutica que comprende un excipiente farmacéuticamente aceptable y el polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 7 a 18.