CIP 2015 : C12N 15/88 : utilizando la micro-encapsulación, p. ej. utilizando vesículas liposómicas.

CIP2015CC12C12NC12N 15/00C12N 15/88[3] › utilizando la micro-encapsulación, p. ej. utilizando vesículas liposómicas.

Notas[t] desde C01 hasta C14: QUIMICA

C SECCION C — QUIMICA; METALURGIA.

C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.

C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00).

C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K).

C12N 15/88 · · · utilizando la micro-encapsulación, p. ej. utilizando vesículas liposómicas.

CIP2015: Invenciones publicadas en esta sección.

Método de transfección de células.

(14/03/2019). Solicitante/s: COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION. Inventor/es: TYACK,SCOTT GEOFFREY.

Un método para producir un ave que comprende células germinales modificadas genéticamente, método que comprende: (i) inyectar una mezcla de transfección que comprende un polinucleótido mezclado con un reactivo de transfección en un vaso sanguíneo de 5 un embrión aviar, en donde (a) el polinucleótido comprende un transposón y la mezcla de transfección comprende una transposasa o un polinucleótido que codifica una transposasa; o (b) la mezcla de transfección comprende una nucleasa dirigida, o un polinucleótido que codifica una nucleasa dirigida; y mediante lo cual el polinucleótido se inserta en el genoma de una o más células germinales primordiales en el ave, e (ii) incubar el embrión a una temperatura suficiente para que el embrión se desarrolle en un polluelo.

PDF original: ES-2704155_T3.pdf

Complejos de ácidos nucleicos.

(06/03/2019) Un complejo antibacteriano que comprende una secuencia de ácido nucleico y al menos un resto de administración, en donde: a) la secuencia de ácido nucleico comprende la secuencia de un sitio de unión celular nativo para un factor de transcripción bacteriano; y b) el resto de administración está representado por la Fórmula (V):**Fórmula** en donde: r es un número entero de 2 a 24; R8, R9 y R10 son iguales o diferentes y se selecciona cada uno entre hidrógeno; alquilo C1-4 opcionalmente sustituido con uno o más átomos de flúor: alcoxi C1-4 opcionalmente sustituido con uno o más átomos de flúor; nitro; amino; mono- y di-alquilamino C1-4; halógeno, fenil-alquilo C1-2 en donde el resto fenilo está opcionalmente sustituido con uno o dos sustituyentes metoxi, metilo o halógeno;…

Administración directa de proteínas con microvesículas modificadas por ingeniería.

(07/12/2018). Solicitante/s: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE). Inventor/es: LOTTEAU, VINCENT, MANGEOT,PHILIPPE.

Una microvesícula secretada por una célula eucariota, en la que dicha microvesícula comprende una proteína de fusión de la membrana viral VSV-G y una proteína de interés, en la que dicha microvesícula no contiene ninguna proteína estructural viral, y en la que dicha proteína de interés no se une con enlace covalente a dicha proteína de fusión de la membrana viral VSV-G.

PDF original: ES-2693167_T3.pdf

Composiciones terapéuticas de ARNm y su uso para tratar enfermedades y trastornos.

(03/12/2018) Una composición para su uso en un método para tratar a un sujeto que tiene una enfermedad que es el resultado de una deficiencia en una proteína, en donde la composición comprende (a) por lo menos una molécula de ARNm, por lo menos una porción de la cual codifica una proteína de fusión que comprende una proteína terapéutica y un polipéptido capaz de unirse a un receptor Fc; y (b) un vehículo de administración, en donde el vehículo de administración es polietilenimina (PEI) o una nanopartícula lipídica, en donde la composición se administra al sujeto mediante suministro pulmonar, y la enfermedad: (a) se selecciona de un trastorno de almacenamiento lisosomal, un trastorno metabólico del ciclo de la urea, enfermedad de Pompe, enfermedad de Gaucher, beta-talasemia, enfermedad de Huntington;…

Conjugado con iloprost o treprostinil como ligando de hallazgo de diana y su uso.

(25/10/2018). Solicitante/s: ethris GmbH. Inventor/es: Rudolph,Carsten , GEIGER,JOHANNES-PETER.

Conjugado a partir de un complejo de agente y al menos un ligando de hallazgo de diana, comprendiendo el complejo de agente un agente envuelto por un material de envoltura, siendo el ligando de hallazgo de diana iloprost o treprostinil, siendo el material de envoltura un polímero catiónico y siendo el agente un ácido nucleico.

PDF original: ES-2687442_T3.pdf

Partículas de HPV y usos de las mismas.

(26/09/2018). Solicitante/s: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE). Inventor/es: COURSAGET, PIERRE L, TOUZE,ANTOINE A, FLEURY,MAXIME J. J, COMBELAS,NICOLAS, DE LOS PINOS,ELISABET.

1.Una composición para el uso en el aporte de uno o más compuestos heterólogos a un sujeto, comprendiendo la composición una nanopartícula que comprende uno o más compuestos heterólogos y una proteína L1 de papilomavirus humano (HPV) modificada que tiene una inmunogenicidad reducida con relación a HPV16 silvestre, en donde la secuencia de aminoácidos de la proteína L1 de HPV modificada corresponde a la secuencia de aminoácidos de SEQ ID NO: 1 que comprende las sustituciones de aminoácidos D273T, N285T y S288N.

PDF original: ES-2683352_T3.pdf

Composiciones farmcéuticas que comprenden poli(beta-amino-ésteres) biodegradables.

(07/03/2018) Una composición farmacéutica que comprende un polinucleótido y un compuesto de fórmula:**Fórmula** o una sal del mismo, en la que: el conector B se selecciona del grupo que consiste en cadenas de carbono de 1 a 30 átomos de carbono, cadenas de carbono que contienen heteroátomos de 1 a 30 átomos y cadenas de carbono y cadenas de carbono que contienen heteroátomos con al menos un sustituyente seleccionado del grupo que consiste en grupos alquilo ramificado y no ramificado, alquenilo ramificado y no ramificado, alquinilo ramificado y no ramificado, amino, alquilamino, dialquilamino, trialquilamino, arilo, ureido, heterocíclico, heterocíclico aromático, cíclico, cíclico aromático, halógeno, hidroxilo, alcoxilo, ciano, amida, carbamaoílo,…

Nanopartículas que comprenden ligandos de ARN.

(18/10/2017). Solicitante/s: MIDATECH LTD. Inventor/es: MARTIN LOMAS, MANUEL, RADEMACHER, THOMAS, WILLIAM, PENADES, SOLEDAD, GUMAA,KHALID, OJEDA,RAFAEL, BARRIENTOS,AFRICA.

Un procedimiento de detección y/u obtención de imágenes de ARNm empleando nanopartículas que comprenden un núcleo que incluye átomos metálicos y/o semiconductores, en donde el núcleo está ligado covalentemente a una pluralidad de ligandos que comprenden: (i) al menos un ligando de ARN que comprende (a) una molécula de ARNip o de miARN de entre 17 y 30 ribonucleótidos de longitud; y (ii) un ligando que comprende un grupo de hidrato de carbono, en donde el procedimiento comprende poner en contacto las nanopartículas con una muestra o células que contienen ARNm diana en condiciones en las que los ligandos de ARN presentes en las nanopartículas sean capaces de interaccionar con ARNm diana y detectar el complejo nanopartícula-ARN-ARNm, y en donde el núcleo de la nanopartícula tiene un diámetro medio entre 0,5 y 10 nm.

PDF original: ES-2655069_T3.pdf

Novedosas formulaciones de lípidos para la administración de ácidos nucleicos.

(05/07/2017). Solicitante/s: PROTIVA BIOTHERAPEUTICS INC. Inventor/es: MACLACHLAN,IAN, PALMER,LORNE,R, YAWORSKI,EDWARD, LAM,KIEU, JEFFS,LLOYD B.

Una partícula de ácido nucleico-lípido que comprende: (a) un ácido nucleico; (b) un lípido catiónico que comprende del 50 % en moles al 65 % en moles del lípido total presente en la partícula; (c) un lípido no catiónico que comprende hasta el 49,5 % en moles del lípido total presente en la partícula y que comprende una mezcla de un fosfolípido y colesterol o un derivado del mismo, en el que el colesterol o derivado del mismo comprende del 30 % en moles al 40 % en moles del lípido total presente en la partícula; y (d) un conjugado de lípido que inhibe la agregación de partículas que comprende del 0,5 % en moles al 2 % en moles del lípido total presente en la partícula.

PDF original: ES-2638448_T3.pdf

Minicélulas intactas de origen bacteriano que encierran ARN regulador.

(01/02/2017). Solicitante/s: ENGENEIC MOLECULAR DELIVERY PTY LTD. Inventor/es: MACDIARMID,JENNIFER, HULF,TOBY, BRAHMBATT,HIMANSHU.

Una composición que comprende: (a) una pluralidad de minicélulas de origen bacteriano, intactas, abarcando cada minicélula de la pluralidad ARN regulador que está empaquetado en la minicélula, y (b) un vehículo farmacéuticamente aceptable para el mismo, en la que (i) el ARN regulador se selecciona del grupo que consiste en ARNss antisentido, ribozima y ARN señuelo, (ii) hay ausencia en las minicélulas de una construcción para la expresión in situ del ARN regulador, y (iii) la pluralidad comprende una cantidad terapéuticamente eficaz del ARN regulador.

PDF original: ES-2626179_T3.pdf

Nuevas formulaciones de lípidos para el suministro de agentes terapéuticos a tumores sólidos.

(30/11/2016). Solicitante/s: PROTIVA BIOTHERAPEUTICS INC. Inventor/es: MACLACHLAN,IAN, JUDGE,ADAM, HEYES,JAMES, YAWORSKI,ED, REID,STEPHEN.

Una partícula de ácido nucleico-lípido que comprende: (a) un ARNpi que silencia la expresión génica de la cinasa 1 similar a polo (PLK-1), que consiste en una secuencia de hebra no codificante 5'-UAUUUAAGGAGGGUGAUCUUC-3' y una secuencia de hebra codificante 5'-AGAUCACCCUCCUUAAAUAUU-3', en la que los nucleótidos en negrita y subrayados son nucleótidos de 2'OMe; (b) un lípido catiónico que comprende de un 50 % en moles a un 65 % en moles del lípido total presente en la partícula; (c) un lípido no catiónico que comprende del 25 % en moles al 45 % en moles del lípido total presente en la partícula; y (d) un lípido conjugado que inhibe la agregación de las partículas que comprende del 5 % en moles al 10 % en moles del lípido total presente en la partícula.

PDF original: ES-2613498_T3.pdf

Uso de liposomas en un vehículo que comprende una fase hidrófoba continua para la entrega de polinucleótidos in vivo.

(01/06/2016). Solicitante/s: IMMUNOVACCINE TECHNOLOGIES INC. Inventor/es: MANSOUR,MARC, KARKADA,MOHAN, WEIR,GENEVIEVE MARY.

Una composición que comprende: un vehículo que comprende una fase continua de una sustancia hidrófoba; liposomas; y un polinucleótido capaz de afectar la expresión de un gen y/o el nivel de un polipéptido.

PDF original: ES-2588705_T3.pdf

Método in vitro para desmontaje/remontaje de partículas análogas al virus del papiloma humano (VLP).

(06/04/2016). Solicitante/s: MEDIMMUNE, INC.. Inventor/es: MCCARTHY, MICHAEL, P., SUZICH, JOANN.

Un método para producir partículas análogas a virus (VLP) del virus del papiloma humano (VPH), que comprende: (i) purificar una proteína L1 del VPH expresada de forma recombinante desmontada en presencia de al menos un agente reductor de sulfhidrilo que mantiene dicha proteína L1 del VPH expresada de forma recombinante en una forma desmontada; y (ii) montar dicha proteína L1 del VPH expresada de forma recombinante en partículas análogas a virus (VLP) del virus del papiloma humano mediante la eliminación u oxidación de dicho al menos un agente reductor.

PDF original: ES-2572628_T3.pdf

ARN de interferencia encapsulado en lípidos.

(16/02/2016). Solicitante/s: PROTIVA BIOTHERAPEUTICS INC. Inventor/es: MACLACHLAN,IAN, AMBEGIA,ELLEN GRACE, HEYES,JAMES.

Partícula de ácido nucleico-lípido para su uso en la administración in vivo de un siARN en un método para el tratamiento de un sujeto mamífero mediante terapia, donde dicho método comprende administrar dicha partícula de ácido nucleico-lípido a dicho sujeto mamífero, donde dicha partícula de ácido nucleico-lípido comprende: un siARN; un lípido catiónico; un lípido no catiónico; y un conjugado de polietilenglicol (PEG)-lípido; en donde dicho siARN se encuentra completamente encapsulado en dicha partícula de ácido nucleico lípido.

PDF original: ES-2559828_T3.pdf

Silenciamiento de expresión de quinasa tipo polo usando ARN interferente.

(11/02/2015) Una molécula modificada de ARNip para silenciar la expresión quinasa 1 tipo polo (PLK-1), en la que la molécula modificada de ARNip comprende una hebra con sentido que consiste en la secuencia de ácido nucleico de la SEC ID Nº 400, una hebra antisentido complementaria, y una región bicatenaria de al menos 15 nucleótidos de longitud, y en la que la hebra antisentido comprende uno o más nucleótidos modificados en la región bicatenaria seleccionados entre el grupo que consiste en nucleótidos de 2'OMe-guanosina, nucleótidos de 2'OMe-uridina, y mezclas de los mismos.

Nanopartículas que comprenden ligandos de ARN.

(14/01/2015) Nanopartículas para su uso en un método de terapia, en donde dichas nanopartículas comprenden un núcleo que incluye átomos metálicos y/o semiconductores, y en donde el núcleo está ligado covalentemente a una pluralidad de ligandos que comprende al menos un ligando de ARN que comprende una molécula de ARNip o de miARN.

Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficicencia adquirida.

(12/02/2013) Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 9 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 9 y la secuencia complementariade éste: (ggauggugcuucaagcuaguaccaguu (SEC.ID Nº:9); donde dicho(s) fragmento (s) de SEC.ID Nº:9 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº: 9; un fragmento de 19 nt de SEC. ID Nº: 9; un fragmento de 20 nt de SEC. ID Nº: 9; un fragmento de…

Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficiencia adquirida.

(05/02/2013) Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 8 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 8 y la secuencia complementariade éste: acagccgccuagcauuucaucac (SEC ID Nº: 8); donde dicho(s) fragmento (s) de SEC.ID Nº:8 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº: 8; un fragmento de 19 nt de SEC. ID Nº: 8; un fragmento de 20 nt de SEC. ID Nº: 8; un fragmento de 21 nt de SEC. ID Nº: 8; un…

Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficiencia adquirida.

(30/01/2013) Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 7 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 7 y la secuencia complementariade éste: accacacacaaggcuacuucccugau (SEC.ID Nº:7); donde dicho(s) fragmento (s) de SEC.ID Nº:7 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº: 7; un fragmento de 19 nt de SEC. ID Nº: 7; un fragmento de 20 nt de SEC. ID Nº: 7; un fragmento de 21 nt de SEC. ID Nº: 7; un fragmento de 22 nt de SEC. ID Nº: 7; un fragmento de 23 nt de SEC.…

Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficiencia adquirida.

(19/09/2012) Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 4 y la secuencia complementaria de ésta, SEC IDNº: 5 y la secuencia complementaria de ésta, o SEC ID Nº: 6 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 4 y la secuencia complementariade éste, un fragmento de SEC ID Nº: 5 y la secuencia complementaria de éste o un fragmento de SEC ID Nº: 6 y lasecuencia complementaria de éste: uaugggguaccugugugga (SEC.ID Nº:4); …

Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficiencia adquirida.

(22/08/2012) Un ARN, donde dicho ARN posee actividad contra la infeccion por el VIH y donde dicho ARN se selecciona del grupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID N°: 1 y la secuencia complementaria de esta, SEC ID N°: 2 y la secuencia complementaria de esta, o SEC ID N°: 3 y la secuencia complementaria de esta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID N°: 1 y la secuencia complementaria de este, un fragmento de SEC ID N°: 2 y la secuencia complementaria de este o un fragmento de SEC ID N°: 3 y la secuencia complementaria de este: donde dicho (s) fragmento (s) de SEC.ID N°:1, SEC.ID N°:2 o SEC.ID N°:3 en b) se seleccionan…

Procedimiento para transfectar células usando un campo magnético.

(08/08/2012) Un procedimiento in vitro para transfectar una célula que comprende la etapa de poner un complejo que comprende (i) uno o más vectores que comprenden una o más moléculas de ácido nucleico; y (ii) una o más partículas magnéticas que se acoplan con uno o más oligo- o policationes u oligo- o polianiones en contacto con una célula aplicando un campo magnético adecuado, en el que dicha(s) partícula(s) magnética(s) y dicho(s) vector(es) se ensamblan en el complejo por agregación inducida por sal.

PARTÍCULAS QUIMÉRICAS VACÍAS SIMILARES A VIRUS DERIVADAS DEL VIRUS DE LA ENFERMEDAD DE LA BURSITIS INFECCIOSA (IBDV), PROCESO PARA SU PRODUCCIÓN Y APLICACIONES.

(10/01/2012) Una proteína de fusión capaz de formar una partícula vacía similar a virus y que consiste en una región A que consiste en un fragmento de la proteína pVP2 del virus de la enfermedad de la bursitis infecciosa (IBDV), que consiste en residuos de aminoácidos 1 a n, en donde "n" es un número entero entre 441 y 501, y una o dos regiones B que consisten en polipéptidos heterólogos, en donde dichos polipéptidos heterólogos no son polipéptidos IBDV nativos y dichos polipéptidos heterólogos contienen uno o más polipéptidos de interés útiles en vacunación, terapia y/o diagnóstico, y en donde dichas regiones B se unen a una región terminal de dicha región A.

COMPLEJO DE ÁCIDO NUCLEICO Y COMPOSICIÓN DE SUMINISTRO DE ÁCIDO NUCLEICO.

(07/12/2011) Complejo de ácido nucleico que comprende un ácido nucleico y una dextrina cíclica altamente ramificada, en el que la dextrina cíclica altamente ramificada es un glucano con un grado de polimerización de 50 a 5000 que presenta una parte de estructura interna cíclica ramificada formada por uniones de α-1,4-glucósido y por lo menos una unión α-1,6-glucósido, y una parte de estructura externa ramificada unida a la parte de estructura interna cíclica ramificada

Ciclooligosacáridos anfifílicos policatiónicos y su uso como transportadores moleculares.

(14/09/2011) Ciclooligosacáridos anfifílicos policatiónicos y su uso como transportadores moleculares.La presente invención se refiere a un grupo de ciclooligosacáridos anfifílicos policatiónicos que, debido a su estructura molecular, pueden ser usados como transportadores de moléculas al interior de las células. Asimismo, la presente invención también se refiere al uso de dichos compuestos en la elaboración de un medicamento, al uso de este medicamento para terapia génica y a una composición farmacéutica que comprenda uno de dichos compuestos

ADMINISTRACIÓN GÉNICA DIRIGIDA A CÉLULAS DE MAMÍFERO NO FAGOCÍTICAS A TRAVÉS DE MINICÉLULAS INTACTAS OBTENIDAS DE BACTERIAS.

(14/07/2011) Una composición que comprende (i) una minicélula derivada de bacterias que contiene una molécula de ácido nucleico terapéutica y (ii) un ligando biespecífico que es capaz de unirse a un componente de superficie de dicha minicélula y a un componente de superficie de una célula de mamífero no fagocítica, en la que dicho ligando biespecífico tiene especificidad por un receptor de superficie de célula de mamífero capaz de activar endocitosis mediada por receptor

COMPOSICIÓN PARA LA TRANSFECCIÓN DE OLIGONUCLEÓTIDOS ACTIVOS PARA LA INACTIVACIÓN DE GENES Y SUS APLICACIONES BIOLÓGICAS Y TERAPÉUTICAS.

(06/06/2011) Composiciones de transfección que comprenden un oligonucleótido activo para la inactivación de genes y una molécula catiónica anfífila de fórmula (I) en la que - X es N-R1, S u O, siendo R1 un radical alquilo C1-C4 o un radical alquilo C3-C6 hidroxilado, - R2 y R3, iguales o diferentes, representan H o un radical alquilo C1-C4, o R2 y R3 están enlazados juntos para formar un anillo saturado o insaturado o un heterociclo que tiene 5 ó 6 elementos, - E es un espaciador alquilo C1-C5, - R4 y R5, iguales o diferentes, representan cadenas hidrocarbonadas o fluorocarbonadas de C10-C36 lineales o ramificadas, saturadas o insaturadas, que comprenden opcionalmente cicloalquilo C3-C6, - A ‾ es un anión biocompatible

MÉTODO PARA MEJORAR LA ESTABILIDAD Y LA DURACIÓN DE CONSERVACIÓN DE COMPLEJOS DE LIPOSOMAS.

(24/01/2011) Un método de preparación de un complejo estable de selección como objetivo de células que comprende un ligando y un liposoma catiónico que encapsula un agente terapéutico, gen indicador o agente diagnóstico que comprende: proporcionar un complejo que comprende un ligando y un liposoma catiónico que encapsula un agente diagnóstico, gen indicador o agente terapéutico; combinar dicho complejo liposómico con una disolución acuosa que consiste esencialmente en una cantidad estabilizante de sacarosa en agua o en un tampón hasta una concentración final de alrededor de un 1% a alrededor de un 80% de sacarosa; liofilizar dicha disolución de complejo…

POLI(BETA-AMINO-ÉSTERES) BIODEGRADABLES Y USOS DE LOS MISMOS.

(17/01/2011) Un poli(beta-amino-éster) preparado a partir de un bis(éster de acrilato) y una amina, en el que la amina se selecciona del grupo que consiste en las fórmulas 6-94: y sus derivados y sales

INMUNIZACIÓN POR INOCULACIÓN DE UNA UNIDAD DE TRANSCRIPCIÓN DE ADN.

(26/11/2010) Una unidad de transcripción de ADN que comprende ADN que codifica ocho antígenos unidos de manera operable a una región promotora, en la que los ocho antígenos son: Gag, Env, Vif, Vpr, Vpu, Tat, Rev y Nef del virus de la inmunodeficiencia humana (HIV); o Gag, Env, Vif, Vpr, Vpx, Tat, Rev y Nef del virus de la inmunodeficiencia simia (SIV); y en la que la unidad de transcripción de ADN no codifica un antígeno Pol de HIV o SIV

ADMINISTRACION GENICA MEDIANTE LIPOSOMA DIRIGIDO.

(20/05/2010) Vector para la administración de un virus a una célula diana dentro de un animal huésped, que comprende un complejo de un ligando de direccionamiento a la célula, un liposoma que comprende uno o más lípidos catiónicos, y el virus, en el que dichos lípidos catiónicos y el virus están presentes en el complejo en una relación de aproximadamente 104 - 107 lípidos catiónicos/partícula viral

PROCEDIMIENTO PARA MODIFICAR GENETICAMENTE PLANTAS LEÑOSAS MEDIANTE LA UTILIZACION DE CELULAS CON CAPACIDAD MERISTEMATICA.

(16/02/2010) Procedimiento para modificar genéticamente plantas leñosas mediante la utilización de células con capacidad meristemática. La presente invención se refiere a un procedimiento de transformación de plantas leñosas que comprende las siguientes etapas: (i) selección de explantos a transformar, (ii) eliminación de yemas presentes en los explantos, (iii) transformación del material, (iv) desarrollo de meristemos, (v) selección de brotes transformados, que se puede utilizar para la introducción de genes específicos que permitan incorporar caracteres interesantes a la planta transformada, tales como genes de resistencia a enfermedades, genes relacionados con la productividad, con la calidad…

1 · · ››

 

Últimas patentes publicadas

 

Clasificación Internacional de Patentes 2015