CIP 2015 : A01H 1/00 : Procedimientos de modificación de los genotipos (A01H 4/00 tiene prioridad).

CIP2015AA01A01HA01H 1/00[m] › Procedimientos de modificación de los genotipos (A01H 4/00 tiene prioridad).

Notas[g] desde A01H 1/00 hasta A01H 4/00: Procedimientos

A01H 1/02 · Métodos o aparatos de hibridación; Polinización artificial.

A01H 1/04 · Procedimientos de selección.

A01H 1/06 · Procedimientos de mutación, p. ej. tratamientos por productos químicos o irradiaciones (mutaciones específicas preparadas por ingeniería genética sobre celulas o tejidos vegetales C12N 15/00).

A01H 1/08 · · Métodos o aparatos para modificar el número de los cromosomas.

CIP2015: Invenciones publicadas en esta sección.

Resistencia a trastornos fisiológicos en la lechuga.

(13/03/2019). Solicitante/s: RIJK ZWAAN ZAADTEELT EN ZAADHANDEL B.V.. Inventor/es: VAN DUN,CORNELIS,MARIA,PETRUS, DIRKS,ROBERT HELENE GHISLAIN, VELTEROP JOYCE SYLVIA, SCHUT,JOHAN.

Planta que presenta una sensibilidad reducida al etileno y a los trastornos fisiológicos, en particular al punteado pardo y/l el amarilleo, comparada con una planta control, cuya semilla se ha depositado en la NCIMB el 3 de enero de 2007 y a la que se ha dado el número de registro NCIMB 41449, NCIMB 41450, NCIMB 41448, NCIMB 41451, NCIMB 41452 o NCIMB 41453, en donde la susceptibilidad reducida al etileno y a trastornos fisiológicos, en particular punteado pardo y/o amarilleo, está inducida por tratamiento de mutagénesis.

PDF original: ES-2728238_T3.pdf

Uso combinado de Vip3Ab con Cry1Ca para reprimir insectos resistentes.

(15/02/2019). Solicitante/s: DOW AGROSCIENCES LLC. Inventor/es: WOOSLEY, AARON, T., MEADE, THOMAS, NARVA,KENNETH, STORER,NICHOLAS P, SHEETS,JOEL J, BURTON,STEPHANIE L.

Una planta transgénica que comprende y expresa ADN que codifica una proteína insecticida Vip3Ab y ADN que codifica una proteína insecticida Cry1F, comprendiendo y expresando además el ADN que codifica una tercera proteína insecticida, seleccionándose dicha tercera proteína del grupo que consiste en Cry1C, Cry1D y Cry1Be.

PDF original: ES-2700458_T3.pdf

Procedimientos de producción de semillas de plantas.

(23/05/2018). Solicitante/s: SEMINIS VEGETABLE SEEDS, INC. Inventor/es: JUAREZ,BENITO, WALKER,TERRY, MCCUISTION,FRED, TOLLA,GREG.

Un procedimiento de selección de semillas triploides de una población de semillas basándose en el espesor y/o en el peso de las semillas triploides, en el que dicha población de semillas se ha obtenido mediante: (a) la obtención de una planta de sandía tetraploide, en la que la planta se ha injertado en un portainjerto que presenta tolerancia al estrés cuando hay condiciones de estrés; (b) permitir la polinización de la planta de sandía tetraploide por una planta de sandía diploide; y (c) permitir que la semilla triploide se forme en la planta de sandía tetraploide.

PDF original: ES-2676748_T3.pdf

Plantas Cichorium con esterilidad masculina citoplasmática.

(18/04/2018). Solicitante/s: BEJO ZADEN B.V. Inventor/es: GLAS, CORNELIS, VAN CAPPELLEN,WITTE, SCHRIJVER,ALBERTUS JOHANNES MARIA, DE JONG,ELIZABETH ROSALIEN, HAARSMA,ADRIANA DORIEN, ZUTT,NICOLAAS ANTHONIUS.

Una planta Cichorium con esterilidad masculina citoplásmica que comprenden mitocondria de Lactuca, en donde dicha mitocondria de Lactuca comprende al menos una secuencia de ácidos nucleicos mitocondriales seleccionada del grupo que consiste en SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 y SEQ ID NO: 10, y en donde dicha planta de Cichorium comprende un citoplasma maternalmente obtenido a partir de una planta según el depósito NCIMB 42125.

PDF original: ES-2675586_T3.pdf

Métodos para proporcionar plantas Petroselinum crispum estériles masculinas citoplasmáticas, plantas Petroselinum crispum estériles masculinas citoplasmáticas y semillas y partes de estas plantas.

(18/04/2018). Solicitante/s: BEJO ZADEN B.V. Inventor/es: GLAS, CORNELIS, VAN CAPPELLEN,WITTE, SCHRIJVER,ALBERTUS JOHANNES MARIA, DOL,NICOLAAS JOHANNES.

Un método para proporcionar una planta Petroselinum crispum estéril masculina citoplasmática, en donde el método comprende: a) proporcionar primeros protoplastos a partir de una planta Foeniculum vulgare Mill., en donde los primeros protoplastos tienen un genoma nuclear sustancialmente inactivado y un citoplasma sustancialmente no modificado; b) proporcionar segundos protoplastos obtenidos a partir de una planta Petroselinum crispum en donde los segundos protoplastos tienen un citoplasma sustancialmente inactivado y un genoma nuclear sustancialmente no modificado; c) fusionar dichos primeros y segundos protoplastos; d) obtener una planta Petroselinum crispum estéril masculina citoplasmática a partir del producto de fusión de dichos primeros y segundos protoplastos, y en donde dichos primeros protoplastos se obtienen a partir de Foeniculum vulgare Mill. con número de acceso de acceso NCIMB 42055.

PDF original: ES-2675995_T3.pdf

FACTORES DE TRANSCRIPCIÓN AISLADOS DE CARICA PAPAYA Y SU APLICACIÓN PARA OBTENER PLANTAS TOLERANTES A TEMPERATURAS EXTREMAS.

(11/01/2018). Solicitante/s: CENTRO DE INVESTIGACIÓN CIENTÍFICA DE YUCATÁN, A. C. Inventor/es: RODRÍGUEZ ZAPATA,Luis Carlos, FIGUEROA YAÑEZ,Luis Joel, PEREIRA SANTANA,Alejandro, CASTAÑO DE LA SERNA,Enrique.

La presente invención provee cuatro genes CpRap2 aislados a partir de Carica papaya identificados como CpRap2.4a, CpRap2.4b, CpRap2.1, CpRap2.10 y que consisten de las SEQ. ID NO: 1, SEQ. ID NO: 2, SEQ. ID NO: 3 y SEQ. ID NO: 4, así como los métodos de transformación genética para la sobreexpresión de dichos genes y la obtención de plantas no transgénicas tolerantes a través de injertos. La transformación genética de plantas que sobreexpresan los genes CpRap2 y sus injertos mostró que podían sobrevivir a temperaturas extremas, hasta 12 días para calor y más de 30 días para frío.

ADN recombinante para la supresión génica.

(18/10/2017). Solicitante/s: MONSANTO TECHNOLOGY, LLC. Inventor/es: MALVAR, THOMAS, M., LUETHY,MICHAEL,H, HUANG,SHIHSHIEH.

Una construcción de ADN recombinante para la supresión de al menos un gen diana en células vegetales que comprende en un orden de 5' a 3' un elemento promotor activo en células vegetales, unido de forma operativo a un elemento de ADN orientado en antisentido a partir de al menos un gen diana y un elemento de ADN orientado n sentido que comprende de 50 a 5.000 nucleótidos, en el que el elemento de ADN orientado en sentido es más corto que el elemento de ADN orientado en antisentido y el ARN orientado en sentido transcrito por el ADN orientado en sentido es complementario de la mayoría del extremo 5' del ARN orientado en antisentido transcrito por el elemento de ADN orientado en antisentido, en el que dicho ARN transcrito forma un bucle de ARN orientado en antisentido para suprimir dicho al menos un gen diana y en el que dicho elemento de ADN orientado en antisentido comprende, en serie, segmentos de dos o más genes orientados para la supresión.

PDF original: ES-2656149_T3.pdf

Anticuerpos anti-IL-12, composiciones, métodos y usos.

(27/09/2017). Solicitante/s: Ortho Biotech Holding LLC. Inventor/es: KNIGHT, DAVID, M., GILES-KOMAR,JILL, PERITT,DAVID, SHEALY,DAVID, SCALLON,BERNHARD.

Un anticuerpo anti-IL-12 que tiene una región que se une al antígeno que comprende tres CDR de cadena pesada (CDR1, CDR2, CDR3) que tienen las secuencias de aminoácidos de las SEQ ID NO: 1, 2 y 3, y tres CDR de cadena ligera (CDR1, CDR2 y CDR3) que tienen las secuencias de aminoácidos de las SEQ ID NO: 4, 5 y 6, para su uso en el tratamiento de artritis psoriásica.

PDF original: ES-2647220_T3.pdf

Ciertas plantas con niveles reducidos de ácidos grasos saturados o sin ácidos grasos saturados en las semillas, y aceite que se obtiene a partir de las semillas.

(20/09/2017). Solicitante/s: DOW AGROSCIENCES LLC. Inventor/es: THOMPSON, MARK, REDDY,Sam.

Un aceite de colza que puede obtenerse a partir de las semillas de una planta de colza que comprende un polinucleótido, incorporado de modo estable en el genoma de dichas semillas, que codifica una proteína de delta-9 desaturasa, en el que dicho aceite comprende menos del 3,5% de grasas saturadas totales y del 70% a menos del 80% de ácido oleico, y en el que dichas grasas saturadas totales son la suma de los ácidos grasos 16:0, 18;0, 20:0, 22:0 y 24:0.

PDF original: ES-2645787_T3.pdf

Resistencia a trastornos fisiológicos en la lechuga.

(09/08/2017) Una planta de lechuga insensible al etileno que muestra resistencia al punteado pardo, comparada con una planta control, en la que dicha planta posee información genética en su genoma que comprende una mutación inducida que es responsable de la resistencia, y dicha información genética es como la que está presente en el genoma de una planta cuya semilla se ha depositado en NCIMB con el número de registro NCIMB 41449, NCIMB 41450, NCIMB 41448, NCIMB 41451, NCIMB 41452 o NCIMB 41453, y puede obtenerse a partir de una planta cultivada a partir de las semillas depositadas mediante el cruzamiento de una planta con una planta cultivada a partir de las semillas depositadas, y la selección de las plantas resultantes del cruzamiento para la resistencia…

ADN recombinante para supresión génica.

(19/07/2017). Solicitante/s: MONSANTO TECHNOLOGY, LLC. Inventor/es: MALVAR, THOMAS, M., LUETHY,MICHAEL,H, HUANG,SHIHSHIEH.

Una construcción de ADN recombinante para la supresión de al menos un gen diana de planta nativa que comprende en orden 5' a 3' un elemento promotor unido de manera operable a un primer elemento de ADN orientado antisentido en relación con el al menos un gen diana y un segundo elemento de ADN orientado sentido en relación con el al menos un gen diana que comprende 50 a 5.000 nucleótidos, en la que el elemento de ADN orientado sentido no es más de aproximadamente la mitad de la longitud del elemento de ADN orientado antisentido, y el ARN orientado sentido transcrito por el ADN orientado sentido es complementario al extremo más 5' del ARN orientado antisentido transcrito por el elemento de ADN orientado antisentido, en la que dicho ARN transcrito forma un bucle de ARN orientado antisentido para suprimir dicho al menos un gen diana, y en la que dicho elemento de ADN orientado antisentido comprende, en serie, segmentos de dos o más genes dirigidos para supresión.

PDF original: ES-2645298_T3.pdf

Sorgo resistente a herbicidas inhibidores de acetil-CoA-carboxilasa.

(28/06/2017). Solicitante/s: KANSAS STATE UNIVERSITY RESEARCH FOUNDATION. Inventor/es: TUINSTRA,MITCHELL R, AL-KHATIB,KASSIM.

Una molécula de ácido nucleico que comprende una secuencia de ácido nucleico que confiere resistencia a la inhibición de la acetil-CoA carboxilasa por herbicidas, en la que dicha secuencia comprende: (i) una secuencia que comprende la SEQ ID NO: 1 o una secuencia al menos un 95% homóloga a la misma que además comprende la sustitución de nucleótidos de guanina sustituida por citosina en la posición 220 de la SEQ ID NO: 1; o (ii) un gen resistente de la acetil-CoA carboxilasa tal como se encuentra en ATCC. n.º PTA-8033, ATCC. n.º PYA-8034 o una secuencia al menos un 95% homóloga a las mismas, que además comprende la sustitución de nucleótidos de guanina sustituida por citosina en la posición 220 de la SEQ ID NO: 1.

PDF original: ES-2634795_T3.pdf

Plantas de sandía con resistencia al virus de las venas amarillas del pepino (CVYV).

(13/04/2017). Solicitante/s: Nunhems B.V. Inventor/es: DE GROOT,Erik, VAN DE WAL,Marion, BERENTSEN,Richard Bernard, CHIAPPARINO,Elena, OGUNDIWIN,Ebenezer.

La aplicación se refiere al campo de cultivo de plantas, en particular el cultivo de sandía. Se proporcionan plantas de sandía resistentes al CVYV (y semillas a partir de las cuales se pueden cultivar estas plantas). También se proporciona un QTL para resistencia al CVYV (cyv_3.1) y marcadores y métodos para seleccionar plantas para la presencia del QTL.

PDF original: ES-2667441_R1.pdf

PDF original: ES-2667441_A2.pdf

Resistencia a herbicidas que inhiben la acetohidroxiácido sintasa.

(30/11/2016). Solicitante/s: BOARD OF SUPERVISORS OF LOUISIANA STATE UNIVERSITY AND AGRICULTURAL AND MECHANICAL COLLEGE. Inventor/es: CROUGHAN, TIMOTHY, P.

Un ácido nucleico que codifica la secuencia de aminoácidos de una acetohidroxiácido sintasa (AHAS) de arroz funcional, donde: la AHAS codificada exhibe una resistencia a al menos un herbicida de imidazolinona y a al menos un herbicida de sulfonilurea que interfieren normalmente con la AHAS de arroz de tipo natural; la AHAS codificada tiene una sustitución de serina a asparagina en la posición del aminoácido 627 de la SEQ ID NO: 17; y la AHAS codificada es idéntica a la AHAS de tipo natural que comprende la secuencia de aminoácidos tal como la mostrada por la SEQ ID NO: 17, a excepción de la sustitución de serina a asparagina que está presente en dicha AHAS codificada.

PDF original: ES-2608927_T3.pdf

Nuevos genes marcadores seleccionables.

(26/10/2016). Ver ilustración. Solicitante/s: DOW AGROSCIENCES LLC. Inventor/es: WRIGHT, TERRY, R., SMITH, KELLEY, A., MERLO, DONALD J., LIRA,JUSTIN M, ARNOLD,NICOLE L, RUSSELL,SEAN M, WEBB,STEVEN ROBERT, ROBINSON,ANDREW E.

Un método de selección de una célula vegetal, en el que dicho método comprende: proporcionar un vector a una pluralidad de células vegetales, comprendiendo el vector: un promotor operable en una célula vegetal y un polinucleótido unido operablemente a dicho promotor, donde dicho polinucleótido codifica una proteína que tiene actividad de fosfinotricina acetiltransferasa y en donde dicha proteína tiene al menos 90% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO: 2; y cultivar dicha pluralidad de células en una concentración de un herbicida que permite que las células que expresan dicho polinucleótido crezcan mientras se matan o inhibe el crecimiento de células que no comprenden dicho vector, en el que dicho herbicida comprende fosfinotricina.

PDF original: ES-2609848_T3.pdf

Sesquiterpeno sintasas y procedimientos de uso.

(14/09/2016). Solicitante/s: FIRMENICH SA. Inventor/es: CLARK,ANTHONY, SCHALK,MICHEL.

Un ácido nucleico aislado que codifica un polipéptido al menos 90 % idéntico a SEQ ID NO: 1; en el que el polipéptido codificado por dicho ácido nucleico es una cubebol sintasa.

PDF original: ES-2607122_T3.pdf

Mejoramiento genético inverso.

(10/08/2016) Método para producir de manera eficaz plantas homocigotas a partir de una planta de partida heterocigota, que comprende: a) proporcionar una planta de partida heterocigota; b) permitir que la planta de partida produzca células haploides a la vez que evita o suprime al menos parcialmente la aparición de recombinación con el fin de obtener un número limitado de células haploides genéticamente diferentes; c) crear plantas homocigotas a partir de las células haploides obtenidas de ese modo; y d) seleccionar las plantas que tienen el conjunto deseado de cromosomas, en donde la prevención o supresión de la recombinación se consigue: - interfiriendo con uno o más genes…

Reproducción precisa.

(10/08/2016). Solicitante/s: J.R. SIMPLOT COMPANY. Inventor/es: YE,Jingsong , ROMMENS,CAIUS M.T, YAN,HUA, RICHAEL,CRAIG, SWORDS,KATHLEEN M, MENENDEZ-HUMARA,JAIME, BRINKERHOFF,W. LEIGH.

Un método de reducción de la acumulación de acrilamida producida por la reacción de Maillard durante la fritura, que comprende transformar en un genoma de vegetal de cultivo un casete de expresión que comprende una secuencia que, tras la expresión, (a) silencia un gen R1 endógeno, (b) silenciar un gen de fosforilasa de tipo L endógeno, y/o (c) sobreexpresar un gen inhibidor de invertasa.

PDF original: ES-2602133_T3.pdf

Evento de maíz MIR604.

(27/07/2016) Un método para identificar una planta de maíz que comprende el inserto heterólogo MIR604 que comprende un gen cry3A055 de la SEC ID NO: 59 flanqueado por las secuencias de nucleótidos expuestas en la SEC ID NO: 1 y la SEC ID NO: 3, y la SEC ID NO: 2 y la SEC ID NO: 4, respectivamente, o por sus complementos, entre otras plantas de maíz que no comprenden dicho inserto heterólogo, que comprende los pasos de: (a) amplificar una secuencia de ADN diana procedente de la planta de maíz que se va a identificar utilizando cebadores nucleotídicos que comprenden una primera secuencia de ADN que comprende al menos aproximadamente 11 nucleótidos contiguos seleccionados del grupo que consiste…

Composiciones quiméricas y métodos para la regulación de la expresión génica en plantas.

(06/07/2016). Solicitante/s: THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEARCH LIMITED. Inventor/es: ESPLEY,RICHARD, HELLENS,ROGER P, ALLAN,ANDREW C, CHAGNE,DAVID, BRENDOLISE,CYRIL.

Un método para la producción de un polinucleótido promotor quimérico capaz de controlar la transcripción de un polinucleótido unido operativamente en una célula vegetal o en una planta, en el que el método comprende la combinación de: a) al menos un motivo de secuencia de un promotor natural, motivo que comprende una secuencia con al menos un 70 % de identidad con la SEQ ID NO: 1, 11 o 12, y b) un promotor natural diferente, en el que el promotor quimérico esta modulado por un factor de transcripción MYB, y en el que el promotor quimérico no se encuentra de forma natural en las plantas en su totalidad.

PDF original: ES-2595953_T3.pdf

Resistencia al mildiú velloso de la cebolla que provoca el hongo Peronospora destructor.

(09/03/2016) Planta de la especie Allium cepa o Allium fistulosum que es resistente al mildiú velloso de la cebolla que provoca el hongo Peronospora destructor (Pd) debido a un locus de resistencia a Pd presente de manera homocigota en el brazo largo del cromosoma 3 en el genoma de dicha planta, estando el locus de resistencia a Pd en un fragmento de introgresión de Allium roylei, en el que, al llevar a cabo el siguiente procedimiento:. a) Restricción del ADN genómico de dicha planta con las enzimas de restricción Pstl y Msel; b) Ligamiento con los siguientes adaptadores oligonucleotídicos: alfa 5'- CTCGTAGACTGCGTACATGCA CATCTGACGCATGT - 5', y beta 5'- GACGATGAGTCCTGAG TACTCAGGACTCAT - 5'; c) Amplificación…

Polinizador mejorado y método para incrementar el rendimiento de sandías sin semillas.

(24/02/2016). Solicitante/s: SYNGENTA PARTICIPATIONS AG. Inventor/es: ZHANG,XINGPING, WILLIAMS,TOM VARE.

Uso de una planta de sandía diploide que comprende un gen e como polinizador para plantas de sandía triploides en un procedimiento para producir frutos de sandía triploide sin semillas, en donde los frutos de la planta de sandía diploide están en un intervalo de tamaño de entre 0,9 y 3,2 kg y la cáscara de los frutos es frágil, rompiéndose bajo una presión en el intervalo de 90 a 150 g/mm2.

PDF original: ES-2568897_T3.pdf

Evento de maíz MIR604.

(10/02/2016). Ver ilustración. Solicitante/s: SYNGENTA PARTICIPATIONS AG. Inventor/es: MEGHJI,MOEZ, STEINER,HENRY-YORK, CHEN,ERIC.

Un método para detectar la presencia de ADN del evento de maíz MIR604 que comprende una secuencia nucleotídica de un gen cry3A055 de SEC ID NO: 59 flanqueada por las secuencia nucleotídicas expuestas en SEC ID NO: 1 y SEC ID NO: 3 y SEC ID NO: 2 y SEC ID NO: 4, respectivamente, o sus complementos en una muestra biológica, que comprende: (a) poner en contacto la muestra con un primer cebador polinucleotídico y un segundo cebador polinucleotídico que actúan juntos en una reacción de amplificación del ácido nucleico en presencia de un molde de ADN del evento de maíz MIR604 para producir un amplicón de diagnóstico para el evento de maíz; (b) realizar una reacción de amplificación del ácido nucleico para producir de esta manera el amplicón; y (c) detectar el amplicón; donde el amplicón comprende una secuencia nucleotídica seleccionada del grupo que consiste en SEC ID NO: 1, SEC ID NO: 2, SEC ID NO: 3, SEC ID NO: 4 y sus complementos.

PDF original: ES-2568896_T3.pdf

Métodos para aumentar la tolerancia al estrés abiótico y/o la biomasa en plantas generadas mediante el mismo.

(14/01/2016). Ver ilustración. Solicitante/s: Evogene Ltd. Inventor/es: RONEN,GIL, KARCHI,HAGAI, YELIN,RODRIGO, RABINOVICH,LARISA.

Un método para aumentar la tolerancia de una planta a un estrés abiótico, que comprende expresar en la planta un polinucleótido exógeno que codifica un polipéptido que comprende una secuencia de aminoácidos al menos un 90 % homóloga a SEC ID Nº: 12, aumentando de este modo la tolerancia de la planta al estrés abiótico en comparación con la planta no transformada, en el que dicho estrés abiótico se selecciona del grupo que consiste en estrés osmótico, estrés por sequía, salinidad y déficit de nutrientes.

PDF original: ES-2556216_T3.pdf

Glicosiltransferasas, polinucleótidos que las codifican y métodos de uso.

(29/12/2015). Ver ilustración. Solicitante/s: THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEARCH LIMITED. Inventor/es: JUGDE,HELENE, ATKINSON,ROSS.

Un método de producción de una célula vegetal o una planta con al menos uno de entre: a) mayor contenido de floricina y b) mayor actividad de la floretina glicosiltransferasa; método que comprende la transformación de una célula vegetal o de una planta con un polinucleótido que codifica un polipéptido con la secuencia de aminoácidos de SEC ID Nº 1 o un polipéptido con al menos el 85 % de identidad de secuencia con la secuencia de aminoácidos de SEC ID Nº 1 y actividad de la floretina glicosiltransferasa.

PDF original: ES-2555206_T3.pdf

Plantas no transgénicas resistentes a herbicidas.

(23/12/2015) Método para la producción de una planta no transgénica, que es resistente o tolerante a un herbicida de la familia de la fosfonometilglicina comprendiendo: (a) la introducción en células vegetales de una oligonucleobase recombinagénica con una mutación objetivo en el gen EPSPS para producir células vegetales con un gen EPSPS mutante que expresa una proteína EPSP que es mutada en una o más posiciones de aminoácidos, dichas posiciones siendo seleccionadas en el grupo que consiste en Leu173, Ala179, Met180, Arg181, Ser98, Ser255 y Leu198 en la proteína EPSPS de Arabidopsis…

Mapeado de progenie inverso.

(21/12/2015). Ver ilustración. Solicitante/s: RIJK ZWAAN ZAADTEELT EN ZAADHANDEL B.V.. Inventor/es: DIRKS,ROBERT HELENE GHISLAIN, SCHUT,JOHANNES WILHELMUS.

Un método para mapear rasgos en plantas, que comprende las etapas de: a) proporcionar una población de plantas SDR-0, que surgen todas de un miembro de una población de gametos no reducidos resultantes de restitución de segunda división, en particular una población de esporas no reducidas; b) producir poblaciones de progenie SDR-1 de cada una de dichas plantas SDR-0; c) fenotipar las poblaciones de progenie SDR-1 para identificar rasgos segregativos en cada población de progenie SDR-1; d) si la progenie segregativa está presente en una población de progenie SDR-1, genotipar la correspondiente planta SDR-0 y comparar el genotipo de la misma con el genotipo de las otras plantas SDR-0 para identificar regiones cromosomales heterocigotas asociadas a la presencia del rasgo segregativo identificado en dicha población de progenie SDR-1.

PDF original: ES-2554471_T3.pdf

Nuevos genes marcadores seleccionables.

(07/12/2015) Una célula vegetal transgénica que comprende un polinucleótido que codifica una proteína que tiene actividad fosfinotricina acetiltransferasa, en la que dicha proteína tiene al menos 90% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:2.

Planta híbrida citoplasmática perteneciente al género Lactuca y método para la producción de la misma.

(22/07/2015) Planta cíbrida del género Lactuca, progenie de la misma, o parte de la misma, que comprende, en el citoplasma de la misma, un gen derivado de las mitocondrias de una planta del género Helianthus y que tiene esterilidad masculina citoplasmática, en la que la planta cíbrida se produce mediante un método caracterizado porque comprende: fusionar protoplastos de una planta del género Helianthus con protoplastos de una planta del género Lactuca; cultivar una o más de las células fusionadas; y en la que la etapa de cultivo de las células fusionadas comprende cultivar las células fusionadas en un medio líquido; y luego añadir goma gelán al medio y continuar con el cultivo, en la que la goma gelán se añade a los de 3 a 7…

Planta de maíz MON88017 y composiciones y procedimientos de detección de la misma.

(06/05/2015) Una planta de maíz, progenie, semilla o parte de la misma, tolerante a glifosato y resistente al gusano de la raíz del maíz, el genoma de dicha planta, progenie, semilla o parte que comprende el inserto transgénico mostrado en la Figura 2 y las secuencias de unión transgénica/genómica de SEC ID Nos: 1 y 2, el inserto transgénico mostrado en la Figura 2 que está presente en el evento de maíz MON88017 depositado en la Colección Americana de Cultivos Tipo (ATCC) con número de acceso PTA-5582.

Método para mejorar la eficiencia del uso de agua en plantas.

(06/05/2015) Un método de aumento de la eficiencia de uso del agua por una planta, comprendiendo el método: (a) transformar una población de plantas con una casete de expresión recombinante que comprende un promotor SARK inducible por senescencia enlazado operativamente a una secuencia de ácido nucleico que codifica isopentenil-transferasa; y (b) seleccionar una planta que tiene una eficiencia de uso del agua incrementada, en donde el promotor SARK es (i) al menos 95% idéntico al promotor de SEQ ID NO: 1 o (ii) al menos 95% idéntico a 800 pb del extremo 5' de SEQ ID NO: 1.

Evento de maíz MIR604.

(15/04/2015) Un método para caracterizar una planta de raíz, o una parte de la misma, que comprende un inserto heterólogo que comprende un gen cry3A055 de SEC ID NO: 59 flanqueado por secuencias nucleotídicas expuestas en SEC ID NO: 1 y SEC ID NO: 3, y SEC ID NO: 2, y SEC ID NO: 4, respectivamente, o por sus complementos, que comprende digerir el ADN genómico de la planta con la endonucleasa de restricción KpnI y sondar el ADN digerido con una sonda que comprende al menos una molécula de ácido nucleico de longitud suficiente de nucleótidos contiguos homólogos o complementarios a una secuencia nucleotídica seleccionada del grupo que consiste en SEC ID NO: 1, SEC ID NO: 2, SEC ID NO: 3, y SEC ID NO: 4, que funciona como una sonda de ADN específica para dicho ADN.

1 · · 3 · 4 · ››

 

Últimas patentes publicadas

 

Clasificación Internacional de Patentes 2015