CIP 2015 : A61K 39/002 : Antígenos de protozoos.

CIP2015AA61A61KA61K 39/00A61K 39/002[1] › Antígenos de protozoos.

Notas[t] desde A61 hasta A63: SALUD; SALVAMENTO; DIVERSIONES
Notas[n] desde A61K 31/00 hasta A61K 47/00:
  • Una composición, es decir, una mezcla de dos o más componentes, se clasifica en el último de los grupos A61K 31/00 - A61K 47/00 que cubra al menos uno de estos componentes. Los componentes pueden ser compuestos simples u otros ingredientes simples.
  • Cualquier parte de una composición que, en aplicación de la Nota (1), no esté identificada como tal por una clasificación asignada, pero que por sí misma se considere nueva y no obvia, debe clasificarse también en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . La parte puede ser un componente simple o una composición propiamente dicha.
  • Cualquier parte de una composición que, en aplicación de las Notas (1) ó (2), no esté identificada como tal por una clasificación asignada, pero que se considere que representa información de interés para la búsqueda, puede clasificarse además en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . Este caso puede plantearse cuando se considera de interés facilitar las búsquedas de composiciones utilizando una combinación de símbolos de clasificación. Esta clasificación optativa debería ser dada como "información adicional".

A SECCION A — NECESIDADES CORRIENTES DE LA VIDA.

A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.

A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D).

A61K 39/00 Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53).

A61K 39/002 · Antígenos de protozoos.

CIP2015: Invenciones publicadas en esta sección.

Composición inmunogénica para la modulación del sistema inmunológico y uso de la misma, procedimiento para el tratamiento y prevención de enfermedades, procedimiento para inducir regeneración celular y procedimiento para restablecer la respuesta inmunitaria.

(08/02/2019) Una combinación inmunogénica que comprende: (i) 0,004 ng/ml de turberculina de Koch, (ii) 0,004 g/ml de derivado proteico purificado de bacilo de Koch (PPD), (iii) 6,94 μg/ml de lisado inactivado de Staphylococcus que consiste en lisado inactivado de Staphylococcus aureus y Staphylococcus epidermidis a partes iguales, (iv) 6,94 μg/ml de lisado inactivado de Streptococcus que consiste en Streptococcus pyogenes, Streptococcus 10 pneumonie y Enterococcus faecalis a partes iguales, (v) 0,444 μg/ml de estreptoquinasa obtenida por purificación a partir de lisado inactivado de Streptococcus betahemolitico, (vi) 0,111 μg/ml de dornasa obtenida por purificación a partir de lisado inactivado de Streptococcus betahemolitico, (vii) 6,94 μg/ml…

Proteínas GST de 28 KDa que provienen de esquistosomas para su utilización en el tratamiento de enfermedades inflamatorias autoinmunes que generan una respuesta de tipo Th1 y/o Th17.

(23/05/2018) Producto elegido entre una proteína, un fragmento de dicha proteína, una secuencia derivada y una secuencia homóloga de dicha proteína, caracterizado por que: - dicha proteína comprende o está constituida por la proteína Glutatión S-transferasa de 28 KDa de un esquistosoma elegido entre Schistosoma haematobium, Schistosoma mansoni, Schistosoma bovis representada respectivamente por las secuencias SEQ ID NO: 1, SEQ ID NO: 2, y SEQ ID NO: 3; - dicho fragmento es un fragmento de una de dichas proteínas que comprende, al menos una región comprendida entre las siguientes regiones: la región comprendida por el aminoácido de la posición 15 al aminoácido en la posición 60, la región comprendida por el aminoácido de la posición 20 al aminoácido en la posición 50, la región comprendida por el aminoácido de la posición 24 al aminoácido en…

Protozoo modificado que expresa al menos dos proteínas variables de superficie (VSP), vacuna que lo comprende, procedimientos, usos y métodos.

(31/01/2018). Solicitante/s: CONSEJO NACIONAL DE INVESTIGACIONES CIENTIFICAS Y TECNICAS (CONICET) . Inventor/es: LUJAN,HUGO DANIEL.

Protozoo parásito modificado Giardia en el que el gen Dicer, el gen ARN-polimerasa ARN-dependiente (RdRP) o ambos han sido silenciados mediante ingeniería genética, comprendiendo así una expresión simultánea en su superficie de más de una proteína variable de superficie.

PDF original: ES-2667773_T3.pdf

Mutantes con inactivación condicional de un receptor de tipo sortilina en parásitos apicomplejos y usos de los mismos.

(25/10/2017). Solicitante/s: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE. Inventor/es: TOMAVO,Stanislas, SLOVES,PIERRE-JULIEN, MOUVEAUX,THOMAS.

Una construcción de ácido nucleico, que comprende: (i) una secuencia que comprende de 100 a 10000 pb, ventajosamente de 150 a 4000 pb, más ventajosamente de 1000 a 2000 pb de nucleótidos contiguos de una región 5' no codificante y promotora de sortilina de un parásito apicomplejo, particularmente seleccionado entre Toxoplasma gondii, Plasmodium falciparum, Babesia bovis, Cryptosporidium hominis o Neospora caninum, (ii) un casete génico de selección, teniendo dicho casete génico su propia secuencia flanqueante UTR 5' y 3' a ambos lados de su secuencia codificante, (iii) una secuencia que comprende de 100 a 10000 pb, ventajosamente de 150 a 4000 pb, más ventajosamente de 1000 a 2000 pb de nucleótidos contiguos de una región 3' codificante de sortilina de dicho parásito apicomplejo, estando dicha secuencia activada por un transactivador sensible a anhidrotetraciclina (ATc).

PDF original: ES-2657070_T3.pdf

Vacuna mucosa que emplea nanogel catiónico.

(22/02/2017). Solicitante/s: Intellectual Property Strategy Network, Inc. Inventor/es: YUKI, YOSHIKAZU, AKIYOSHI KAZUNARI, KIYONO HIROSHI, NOCHI TOMONORI.

Un preparado de vacuna mucosa para su uso en un método de prevención o tratamiento de una infección microbiana, que comprende un compuesto de un nanogel y un antígeno de vacuna, en donde el nanogel es pululano portador de colesterol que tiene un grupo funcional catiónico, en donde el grupo funcional catiónico es un grupo amino y en donde el nanogel comprende de 5 a 30 de dichos grupos amino por 100 monosacáridos de glucosa de pululano portador de colesterol, y en donde el preparado de vacuna se administra por vía de la ruta mucosa transnasal.

PDF original: ES-2624722_T3.pdf

Propiedades de coadyuvancia y potenciación inmunitaria de productos naturales de Onchocerca volvulus.

(12/08/2015) Una composición inmunogénica para potenciar una respuesta inmunitaria específica a un radical antigénico en un mamífero que necesita de tal respuesta inmunitaria, comprendiendo la composición: un radical antigénico, en donde el radical antigénico es un poliaminoácido, y en donde el radical antigénico no es una proteína secretada asociada a la activación de Onchocerca volvulus (Ov-ASP); y un coadyuvante que comprende una cantidad eficaz de Ov-ASP.

Membranas víricas reconstituidas funcionalmente que contienen adyuvante.

(25/02/2015) Membrana vírica reconstituida para su uso farmacéutico mediante administración intranasal, comprendiendo su bicapa lipídica una proteína de fusión de un virus, un adyuvante anfifílico y, opcionalmente, un antígeno adicional, en el que: (a) la bicapa lipídica presenta una composición de lípidos que es compatible con la fusión, inducida por la proteína de fusión, de la membrana vírica con la membrana de una célula que puede fusionarse con el virus a partir del cual se ha derivado la proteína de fusión, (b) la proteína de fusión y el adyuvante anfifílico interactúan con el interior hidrófobo de la bicapa lipídica; y (c) la proteína de fusión, el adyuvante anfifílico y el antígeno adicional opcional no se encuentran unidos covalentemente, en la que el adyuvante anfifílico es un lipopéptido que es un ligando para un receptor de tipo Toll…

Procedimiento para el cribado de proteínas segregadas conservadas.

(07/05/2014) Procedimiento de diagnóstico in vitro para la detección de la presencia o ausencia de anticuerpos indicativos de la enfermedad de Chagas que se unen a un polipéptido segregado conservado, aislado o purificado, que consiste en la SEC. ID. nº 86 para formar un inmunocomplejo, que comprende las etapas siguientes: a. poner en contacto dicho polipéptido con una muestra biológica durante un tiempo y en condiciones suficientes para formar un inmunocomplejo; y b. detectar la presencia o ausencia del inmunocomplejo formado en a).

Complejo de péptido antigénico-proteína de choque térmico modificada.

(09/10/2013) Una dosis inyectable de una vacuna, comprendiendo la dosis células recombinantes no proliferativas modificadaspor ingeniería genética para secretar complejos de una proteína de choque térmico gp96 modificada y un antígenoen una cantidad suficiente para provocar la activación de una respuesta de linfocitos T CD8, independientes de CD4,frente al antígeno cuando se administra a un sujeto, en la que la proteína de choque térmico modificada carece deuna secuencia de retención en el retículo endoplásmico

Inmunización intralinfática para inducir respuestas de CTL efectores prolongadas.

(11/09/2013) El uso de un antígeno peptídico o un ácido nucleico que codifica dicho antígeno para la fabricación de unmedicamento para el tratamiento del cáncer o de infecciones crónicas, comprendiendo dicho medicamento unacomposición que contienen antígenos fisiológicamente aceptable para la administración directamente al bazo, a unnódulo linfático o a un vaso linfático de un mamífero, en el que dicho antígeno induce una respuesta de CTL efectores específicos de antígeno en el mamífero, yen el que el antígeno se administra al mamífero a un nivel suficiente como para inducir la respuesta de CTLefectores específicos de antígeno en el mamífero, y en el que el nivel del antígeno en el sistema linfático del mamífero se mantiene a lo largo de un tiempo suficientepara mantener…

EFECTO ADYUVANTE DE LA PROTEÍNA A27 DEL VIRUS VACCINIA (14K) Y SUS APLICACIONES EN VACUNAS.

(23/05/2013). Ver ilustración. Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC). Inventor/es: GOMEZ RODRIGUEZ, CARMEN ELENA, ESTEBAN RODRIGUEZ,MARIANO, VIJAYAN,Aneesh.

La presente invención se refiere a una estrategia vacunal basada en el uso de la proteína 14K de la envuelta del virus vaccinia, codificada por el gen A27L, sin los 28 primeros aminoácidos y fusionada con la proteína CS de Plasmodium yoelii que carece del dominio GPI y de la secuencia señal. Esta proteína, referida como CS14K, forma oligómeros estables, de manera que genera una respuesta inmune frente a antígenos de malaria superior a la descrita con el uso de otros diseños de vacuna. La proteína quimérica es ensayada en ratones usando protocolos de inmunización heterologos y desarrolla una potente respuesta inmune humoral y celular frente a CS evaluada mediante ELISA y análisis de citometría de flujo.

Expansión del repertorio de los linfocitos T para incluir epítopos subdominantes mediante vacunación con antígenos administrados en forma de fragmentos proteicos o cócteles peptídicos.

(10/04/2013) Una vacuna contra una enfermedad crónica que comprende una mezcla de péptidos que consiste en péptidossolapantes adyacentes que abarcan la secuencia de aminoácidos completa de una proteína que se expresadurante la fase crónica de la enfermedad, que también comprende un adyuvante en donde el adyuvante es un liposomacatiónico.

USO DEL PACAP COMO ADYUVANTE MOLECULAR PARA VACUNAS.

(07/03/2013). Solicitante/s: CENTRO DE INGENIERIA GENETICA Y BIOTECNOLOGIA. Inventor/es: ESTRADA GARCIA, MARIO PABLO, CARPIO GONZALEZ,YAMILA, LUGO GONZALEZ,JUANA,MARIA.

La presente invención se relaciona con el uso del péptido activador de la adenilato ciclasa de pituitaria (PACAP) como adyuvante molecular para vacunas. Entre otras aplicaciones, dichas vacunas pueden emplearse en la protección contra agentes infecciosos, tales como virus, bacterias y ectoparásitos que afectan a los mamíferos, las aves y a los organismos acuáticos. El PACAP, combinado con un antígeno particular, demuestra su efectividad como adyuvante al aumentar la respuesta inmunológica del huésped contra dicho antígeno. Este tipo de respuesta puede observarse cuando las composiciones o combinaciones vacunales que comprenden PACAP se administran por vía oral, inyección, o por baños de inmersión en el caso de los organismos acuáticos.

USO DEL GEN NcSRS9 Y LA PROTEÍNA NcSRS9 PARA LA PREVENCIÓN Y EL DIAGNÓSTICO DE LA NEOSPOROSIS.

(15/10/2012) Uso del gen NcSRS9 y la proteína NcSRS9 para la prevención y el diagnóstico de la neosporosis. La presente invención se refiere a la molécula polinucleotídica correspondiente al gen NcSRS9 de Neospora caninum y el antígeno que codifica, NcSRS9, proteína expresada durante el estadio de bradizoíto; así mismo, se refiere a los cebadores, los vectores recombinantes, las células hospedadoras transformadas o transfectadas y las proteínas expresadas de forma recombinante que derivan de dicho gen, así como al uso de estos productos y los anticuerpos específicos producidos frente a ellos como reactivos para técnicas de detección directa del parásito, a partir de muestras de los animales infectados, y para la producción de vacunas frente a la enfermedad.

Membranas víricas reconstituidas funcionalmente que contienen adyuvante.

(01/08/2012) Membrana vírica reconstituida, cuya bicapa lipídica comprende una proteína de fusión de un virus, un adyuvante anfifílico y, opcionalmente, un antígeno adicional: (a) presentando la bicapa lipídica una composición de lípidos que es compatible con la fusión, inducida por la proteína de fusión, de la membrana vírica con la membrana de una célula que puede fusionarse con el virus a partir del cual se ha obtenido la proteína de fusión, (b) interactuando la proteína de fusión y el adyuvante anfifílico con el interior hidrófobo de la bicapa lipídica; y (c) no encontrándose la proteína de fusión, el adyuvante anfifílico y el antígeno adicional opcional unidos covalentemente, en la que el…

Oligonucleótidos inmunoestimuladores y sus usos.

(18/05/2012) Un oligonucleótido inmunoestimulador que tiene hasta 100 nucleótidos y que comprende un motivo de secuencia no palindrómica de ácido nucleico que tiene la siguiente fórmula: TCATCATTTTGTCATTTTGTCATT(SEQ ID Nº 2)

Procedimiento para la producción y la aplicación de cultivos de protozoos.

(28/03/2012) Cultivo clonal de protozoos que comprende células protozoarias de una única especie de protozoo, seleccionándose la especie de protozoo del grupo constituido por Histomonas meleagridis, Tetratrichomonas gallinarum y Blastocystis sp., caracterizado porque el cultivo contiene bacterias simbióticas o su lisado.

USO DE UN NUEVO AISLADO DE NEOSPORA CANINUM PARA EL DESARROLLO DE PRUEBAS DE DIAGNOSTICO Y PARA LA FABRICACION DE PRODUCTOS PARA EL TRATAMIENTO Y PREVENCION DE LA INFENCCION CAUSADA POR NEOSPORA.

(26/07/2010) El uso de un nuevo aislado de Neospora caninum (depositado en la Culture Collection of Algae and Protozoa, con número de acceso CCAP 2051/1), y de los extractos obtenidos a partir del mismo, en la elaboración de pruebas de diagnóstico y en la fabricación de productos para el tratamiento y la prevención de la infección causada por Neospora se basa en la facilidad con que el nuevo aislado se transforma del estadio de taquizoíto al de bradizoíto en condiciones in-vitro. Así mismo y con las mismas aplicaciones, se emplean los polipéptidos y polinucleótidos obtenidos a partir del: nuevo aislado y los anticuerpos inmunoreactivos desarrollados…

ANTIGENOS RECOMBINANTES QUIMERICOS DE TOXOPLASMA GONDII.

(20/07/2010) Un antígeno quimérico recombinante que contiene la fusión de al menos tres regiones antigénicas diferentes de Toxoplasma gondii, en el que las tres regiones antigénicas diferentes tienen una secuencia de aminoácidos seleccionada entre el grupo constituido por: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 1

DNA QUE CODIFICA CANALES DE CLORURO CON APERTURA Y CIERRE REGULADOS POR GLUTAMATO.

(16/04/2006). Solicitante/s: MERCK & CO., INC.. Inventor/es: CULLY, DORIS, F., ARENA, JOSEPH, P., PARESS, PHILIP, S., LIU, KEN, K.

SE HA CLONADO Y CARACTERIZADO ADN QUE CODIFICA CANALES DE CLORURO SENSIBLES A LA AVERMECTINA Y AL GLUTAMATO. LA PROTEINA ES CAPAZ DE FORMAR CANALES QUE SE ABREN DE FORMA SELECTIVA CON AVERMECTINA O CON GLUTAMATO. EL ADNC SE HA EXPRESADO EN CELULAS HUESPED RECOMBINANTES QUE PRODUCEN LA PROTEINA RECOMBINANTE ACTIVA. LA PROTEINA RECOMBINANTE TAMBIEN SE PURIFICA A PARTIR DE LAS CELULAS HUESPED RECOMBINANTES. ADEMAS, LAS CELULAS HUESPED RECOMBINANTES SE UTILIZAN PARA ESTABLECER UN PROCEDIMIENTO PARA IDENTIFICAR MODULADORES DE LA ACTIVIDAD DE UN RECEPTOR, Y SE IDENTIFICAN MODULADORES DE UN RECEPTOR. LOS MODULADORES DE UN RECEPTOR ACTIVOS DEL PROCEDIMIENTO DESCRITO EN LA PRESENTE RESULTAN UTILES COMO AGENTES ECTOPARASITICIDAS, ANTIPARASITARIOS, ANTIHELMINTICOS, ACARICIDAS E INSECTICIDAS.

CASETE DE EXPRESION DE UNA PROTEINA P30 DE TOXOPLASMA GONDII.

(16/10/2005). Solicitante/s: TRANSGENE S.A. BIOMERIEUX. Inventor/es: JOLIVET, MICHEL, MOUGIN, BRUNO, JACOBS, ERIC, SILVESTRE, NATHALIE, BISSARDON, ODETTE.

LA PRESENTE INVENCION SE REFIERE A UNA CASILLA DE EXPRESION PARA LA PRODUCCION Y LA SECRECION DE UNA PROTEINA P30 DE TAXOPLASMA GONDII EN UNA CELULA NO MAMIFERA, UN VECTOR, UNA CELULA QUE LA COMPRENDE Y LOS ANTICUERPOS QUE PUEDEN SER GENERADOS. SE REFIERE TAMBIEN A UN PROCEDIMIENTO DE PREPARACION DE LA PROTEINA P30, UN PROCEDIMIENTO DE DETECCION DE ANTICUERPOS ANTITOXOPLASMA O DE LA PROTEINA P30, LOS REACTIVOS CORRESPONDIENTES ASI COMO A UNA COMPOSICION FARMACEUTICAS PARA EL TRATAMIENTO O LA PREVENCION DE UNA INFECCION CON TOXOPLASMA GONDII.

RESPUESTA MUCOSAL LINFOCITOS T CITOTOXICOS.

(16/07/2005). Ver ilustración. Solicitante/s: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTME. Inventor/es: BERZOFSKY, JAY, A., BELYAKOV, IGOR M., DERBY, MICHAEL, A., KELSALL, BRIAN, L., STROBER, WARREN.

Utilización de una composición para la fabricación de un medicamento para inducir una respuesta de linfocitos T citotóxicos, mucosal protectora, antígeno-específica, sistémica y rectal, mediante la administración de la composición a la mucosa rectal, donde la composición comprende un antígeno soluble purificado, el cual comprende una primera región que tiene unos epítopos superpuestos que activan la célula cooperadora T y una segunda región que tiene un epítopo que activa la célula T citotóxica, composición que se formula para la administración a la mucosa rectal.

COMPLEJOS PROTEINICOS DE ESTRES-PEPTIDO EN CALIDAD DE VACUNAS PROFILACTICAS Y TERAPEUTICAS CONTRA AGENTES PATOGENOS INTRACELULARES.

(16/07/2005). Solicitante/s: MOUNT SINAI SCHOOL OF MEDICINE OF THE CITY UNIVERSITY OF NEW YORK. Inventor/es: SRIVASTAVA, PRAMOD, K., UDONO, HEIICHIRO, BLACHERE, NATHALIE E.

SE DESCRIBE UNA FAMILIA DE VACUNAS QUE CONTIENE COMPLEJOS PEPTIDO-PROTEINAS DE ESTRES QUE, AL ADMINISTRARSE A UN MAMIFERO, INICIAN UNA RESPUESTA DE LAS CELULAS T CITOTOXICAS CONTRA CELULAS INFECTADAS CON UN PATOGENO INTRACELULAR PRESELECCIONADO. TAMBIEN SE DESCRIBEN LOS METODOS PARA PREPARAR Y ADMINISTRAR VACUNAS QUE CONTIENEN DICHOS COMPLEJOS PEPTIDO-PROTEINAS DE ESTRES.

DNA QUE CODIFICA LOS CANALES DE CLORURO DE APERTURA REGULADA POR GLUTAMATO.

(01/06/2005). Solicitante/s: MERCK & CO., INC. (A NEW JERSEY CORP.) THE TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK. Inventor/es: CULLY, DORIS, F., ARENA, JOSEPH, P., LIU, KEN, K., VASSILATIS, DEMETRIOS.

SE HAN CLONADO Y CARACTERIZADO DNAS QUE CODIFICAN PARA CANALES DE GLUTAMATO SENSIBLES A AVERMECTINA Y GLUTAMATO. LAS SUBUNIDADES INDIVIDUALES ALFA Y BETA, SON CAPACES DE FORMAR CANALES HOMOMERICOS Y HETEROMERICOS, QUE SE ABREN SELECTIVAMENTE, BIEN CON AVERMECTINA, BIEN CON GLUTAMATO. DICHOS CDNAS HAN SIDO EXPRESADOS EN CELULAS HUESPED RECOMBINANTES, QUE PRODUCEN PROTEINA RECOMBINANTE ACTIVA. LA PROTEINA RECOMBINANTE SE PURIFICA TAMBIEN A PARTIR DE LAS CELULAS HUESPED RECOMBINANTES. ADEMAS, LAS CELULAS HUESPED RECOMBINANTES SE UTILIZAN PARA ESTABLECER UN METODO DE IDENTIFICACION DE MODULADORES DE LA ACTIVIDAD RECEPTORA. LOS MODULADORES DE RECEPTORES SON UTILES COMO INSECTICIDAS Y COMO AGENTES ANTIHELMINTICOS.

PREPARACION PARA INDUCIR UNA RESPUESTA INMUNE A PROTOZOARIOS RUMINALES, UTIL EN LA MEJORA DE LA PRODUCTIVIDAD DE RUMIANTES.

(16/05/2005). Solicitante/s: COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION. Inventor/es: BAKER, SUZANNE, KAY, GNANASAMPANTHAN, GNANAPRAGASAM, PURSER, DOUGLAS, BARRIE, HOSKINSON, RONALD, MILTON.

UN PROCEDIMIENTO PARA MEJORAR LA PRODUCTIVIDAD DE UN ANIMAL RUMIANTE COMPRENDE ADMINISTRAR A DICHO ANIMAL UNA CANTIDAD DE UN PREPARADO INMUNOGENICO EFICAZ PARA INVOCAR UNA RESPUESTA INMUNE AL MENOS A UN PROTOZOO DEL RUMEN, DE MANERA QUE LA RESPUESTA INMUNE INVOCADA AL MENOS REDUZCA Y, A SER POSIBLE, ELIMINE TOTALMENTE LA ACTIVIDAD DE AL MENOS UNO DE LOS PROTOZOOS DEL RUMEN. LA INVENCION PROPORCIONA IGUALMENTE NUEVOS PREPARADOS INMUNOGENICOS QUE PUEDEN SER UTILES EN EL PROCEDIMIENTO DE LA INVENCION.

VACUNA DE NEOSPORA.

(01/04/2005). Solicitante/s: PFIZER PRODUCTS INC.. Inventor/es: BRAKE, DAVID ALAN, CAMPOS, MANUEL.

LA PRESENTE INVENCION PROPORCIONA UN HOMOGENEIZADO PREPARADO A PARTIR DE CELULAS DE NEOSPORA Y VACUNAS FRENTE A LA NEOSPOROSIS PREPARADAS A PARTIR DE LAS MISMAS, QUE SON UTILES PARA LA PREVENCION DE LA ENFERMEDAD CLINICA Y DEL ABORTO EN MAMIFEROS.

VACUNA DE NEOSPORA VIVA ATENUADA.

(01/03/2005). Solicitante/s: PFIZER INC. AUBURN UNIVERSITY. Inventor/es: BRAKE, DAVID, BLAGBURN, BYRON, LINDSAY, DAVID.

LA PRESENTE INVENCION PROPORCIONA CULTIVOS VIVOS ATENUADOS DEL PARASITO PROTOZOO PATOGENO NEOSPORA, Y VACUNAS VIVAS CONTRA NEOSPOROSIS PREPARADAS A PARTIR DEL MISMO QUE SON UTILES EN LA PREVENCION DE ENFERMEDADES CLINICAS Y ABORTOS EN MAMIFEROS.

VACUNAS CONTRA PROTOZOOS INTESTINALES.

(16/12/2002). Solicitante/s: UNIVERSITY TECHNOLOGIES INTERNATIONAL INC. Inventor/es: OLSON, MERLE E., CERI, HOWARD, MORCK, DOUGLAS W.

LA INVENCION PROPORCIONA VACUNAS Y METODOS PARA EVITAR O TRATAR INFECCIONES DE PROTOZOOS INTESTINALES EN UN ANIMAL. EN PARTICULAR, SE PROPORCIONAN VACUNAS Y METODOS PARA PREVENCION DE TRATAMIENTO DE GIARDIASIS. LA INVENCION TAMBIEN INCLUYE METODOS DE PREPARAR Y METODOS DE USO DE NUEVAS TOXINAS, ANTICUERPOS, CEPAS DE VACUNA Y COMPOSICIONES QUE RESULTAN DE O SON USADAS EN ESTOS METODOS.

COMPUESTOS Y METODO PARA LA DETECCION Y PREVENCION DE INFECCION POR T. CRUZI.

(16/06/2002). Solicitante/s: CORIXA CORPORATION. Inventor/es: SKEIKY, YASIR A.W., REED, STEVEN G., HOUGHTON, RAYMOND L., LODES, MICHAEL, J.

LA INVENCION SE REFIERE A COMPUESTOS Y METODOS PARA DIAGNOSTICAR INFECCIONES POR TRYPANOSOMA CRUZI. LOS COMPUESTOS REVELADOS SON POLIPEPTIDOS O SUS ANTICUERPOS, QUE CONTIENEN UNO O MAS EPITOPES DE ANTIGENOS DE T. CRUZI. LOS COMPUESTOS SON UTILES EN VARIOS ENSAYOS INMUNOLOGICOS PARA LA DETECCION DE INFECCIONES POR T. CRUZI. LOS COMPUESTOS POLIPEPTIDOS SON ADEMAS UTILES EN VACUNAS Y FORMULAS FARMACEUTICAS PARA INDUCIR UNA INMUNIDAD PROTECTORA FRENTE A LA ENFERMEDAD DE CHAGAS EN PERSONAS EXPUESTAS AL T. CRUZI.

PARASITOS QUE INFECTAN MACROFAGOS QUE EXPRESAN UN FACTOR QUE ESTIMULA COLONIAS DE MACROFAGOS GRANULOCITICOS.

(16/06/2002). Solicitante/s: UNIVERSITE LAVAL. Inventor/es: PAPADOPOULOU, BARBARA, OUELLETTE, MARC, OLIVIER, MARTIN.

SE PROPORCIONAN CEPAS DE LEISHMANIA Y OTROS PARASITOS INFECCIOSOS DE MACROFAGOS QUE EXPRESAN EL GEN GM-CSF QUE ES UTIL EN EL TRATAMIENTO DE HUESPEDES INFECTADOS POR EL PARASITO Y EN LA PROTECCION DE HUESPEDES CONTRA LA ENFERMEDAD CAUSADA POR LA INFECCION DE LOS HUESPEDES POR EL PARASITO. LOS PARASITOS TIENEN UNA CAPACIDAD REDUCIDA PARA INFECTAR O SOBREVIVIR EN MACROFAGOS, POR LO QUE ESTAN ATENUADOS. AL MENOS UN GEN DEL PARASITO QUE CONTRIBUYE A LA VIRULENCIA DEL MISMO PUEDE ESTAR DESACTIVADO FUNCIONALMENTE. LAS CEPAS ATENUADAS PUEDEN SER UTILIZADAS PARA LA ADMINISTRACION A UN HOSPEDADOR PARA (A) TRATAR UN HOSPEDADOR INFECTADO CON LEISHMANIA O (B) CONFERIR PROTECCION CONTRA ENFERMEDADES CAUSADAS POR UNA CEPA VIRULENTA DE LEISHMANIA, O COMO REACTIVO DE DIAGNOSTICO.

COMPUESTOS Y METODOS PARA LA DIAGNOSIS DE LA LEISHMANIASIS.

(01/03/2002). Ver ilustración. Solicitante/s: CORIXA CORPORATION. Inventor/es: SKEIKY, YASIR A.W., REED, STEVEN G..

SE DESCRIBEN COMPUESTOS Y PROCEDIMIENTOS PARA DIAGNOSTICAR LA INFECCION POR LEISHMANIA. LOS COMPUESTOS DESCRITOS INCLUYEN POLIPEPTIDOS QUE CONTIENEN AL MENOS UN EPITOPO DEL ANTIGENO RIBOSOMICO ACIDO DE LEISHMANIA CHAGASI LCPO, O UN VARIANTE DEL MISMO. ESTOS COMPUESTOS RESULTAN UTILES EN UNA DIVERSIDAD DE INMUNOENSAYOS PARA DETECTAR LA INFECCION POR LEISHMANIA Y PARA IDENTIFICAR INDIVIDUOS CON INFECCIONES ASINTOMATICAS QUE PROBABLEMENTE PUEDEN PROGRESAR HACIA UNA LEISHMANIASIS VISCERAL AGUDA. LOS COMPUESTOS POLIPEPTIDICOS ADEMAS RESULTAN UTILES EN VACUNAS Y COMPOSICIONES FARMACEUTICAS PARA EVITAR LA LEISHMANIASIS.

VACUNA CONTRA COCCIDIOSIS EN POLLOS.

(01/10/2001). Solicitante/s: AKZO NOBEL N.V.. Inventor/es: VERMEULEN, ARNOLDUS NICOLAAS, TOMLEY, FIONA MARGARET, DUNN, PAUL PATRICK JAMES, BUMSTEAD, JANENE MARYLIN.

ESTA INVENCION SE REFIERE A UNA NUEVA PROTEINA DE EIMERIA CON PROPIEDADES INMUNOGENICAS ASI COMO A SECUENCIAS DE ADN QUE CODIFICAN ESTAS PROTEINAS. ESTA PROTEINA SE PUEDE ADMINISTRAR A AVES DE CORRAL PARA PROTEGERLAS CONTRA LA COCCIDIOSIS. ADEMAS, EL ADN QUE CODIFICA ESTA PROTEINA SE PUEDE UTILIZAR PARA LA PREPARACION DE UNA VACUNA DE VECTOR CONTRA LA COCCIDIOSIS.

1 · ››

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015