Variantes sintéticas de fitasa.

Una fitasa que tiene una secuencia de aminoácidos con una identidad de al menos 85 % con la secuencia de aminoácidos de la SEC ID 24

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/IB2012/051933.

Solicitante: BASF SE.

Nacionalidad solicitante: Alemania.

Dirección: 67056 LUDWIGSHAFEN ALEMANIA.

Inventor/es: HAEFNER,Stefan, WELZEL,ANNEGRET, THUMMER,ROBERT.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > C07K14/00 (Péptidos con más de 20 aminoácidos; Gastrinas; Somatostatinas; Melanotropinas; Sus derivados)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Enzimas, p. ej. ligasas (6.; Proenzimas; Composiciones... > C12N9/16 (actúan sobre los enlaces éster (3.1))
google+ twitter facebookPin it
Ilustración 1 de Variantes sintéticas de fitasa.
Ilustración 2 de Variantes sintéticas de fitasa.
Ilustración 3 de Variantes sintéticas de fitasa.
Ilustración 4 de Variantes sintéticas de fitasa.
Ver la galería de la patente con 7 ilustraciones.
Variantes sintéticas de fitasa.

Texto extraído del PDF original:

DESCRIPCIÓN

Variantes sintéticas de fitasa La presente invención se refiere a fitasas, a secuencias de aminoácidos que codifican enzimas fitasas y a secuencias nucleotídicas que codifican fitasas y a procesos para la preparación y el uso de fitasas y a alimentos para animales que comprenden estas fitasas.

El fósforo es un elemento esencial para el crecimiento de los organismos vivos. En la producción animal, los alimentos, como norma, tienen que suplementarse con fósforo inorgánico con el fin de alcanzar buenas tasas de crecimiento. En los cereales y las legumbres, el fósforo se almacena principalmente en forma de fitato. Sin embargo, los animales monogástricos, tales como el cerdo, las aves de corral y los peces, no son capaces de absorber directamente el fitato o ácido fítico, lo que tiene como resultado la excreción de fitato, lo que significa sobrecargas de fósforo en las áreas de producción intensiva de ganado. Además, el ácido fítico, que se une a metales tales como calcio, cobre o cinc, actúa como sustancia con un efecto negativo sobre el metabolismo de los animales monogástricos. Con objeto de compensar el déficit de fosfato de estos animales y garantizar un crecimiento suficiente y salud suficiente se añade el fosfato inorgánico en la dieta del animal. Esta adición de fosfato inorgánico es costosa y conduce a un efecto adverso adicional sobre el ambiente. Mediante el uso de una fitasa en los alimentos para animales, el fitato se hidroliza y da lugar a un menor contenido de fosfato de inositol y fosfatos inorgánicos en el estiércol. La adición de fitasas a alimentos para animales mejora la disponibilidad de fósforo orgánico y reduce el efecto adverso sobre el medio ambiente por los fosfatos unidos a fitato excretados. En la literatura se han descrito varias fitasas naturales tanto fúngicas como bacterianas.

Las fitasas, también conocidas como mioinositol hexakisfosfato fosfohidrolasa, son una clase de fosfatasas que son capaces de escindir al menos un residuo de fosfato a partir de fitato.

El documento EP 420 358 describe generalmente la clonación y expresión de fitasas microbianas, el documento WO 2006/38062 describe fitasas microbianas derivadas de Citrobacter freundii como aditivo para alimentos para animales y el documento WO 2007/112739 describe fitasas sobre la base de una fitasa natural de Citrobacter braakii

y procesos para su preparación y el uso de alimentos para animales.

Haefner y col., (Haefner S., Knietsch A., Scholten E., Braun J., Lohscheidt M. y Zelder O. (2005) Biotechnological production and application of phytases. Appl Microbiol Biotechnol 68:588–597) describen una multiplicidad de usos conocidos de las fitasas en el campo de la nutrición humana o animal. Usos adicionales de las fitasas tal como, por ejemplo, el uso para la hidrólisis de biomasa o almidón en la producción de bioetanol se describen en el documento WO 2008/097620.

El documento WO 2008/116878 y el documento WO 2010/034835 describe una fitasa de Hafnia alvei, su secuencia de proteínas y variantes de la misma. Zinin y col., (FEMS Microbiology Letters (2004) 236:283–290) divulgan una fitasa de Obesumbacterium proteus, cuya secuencia está depositada en la base de datos UNIPROT con el número de acceso Q6U677. Las solicitudes de patentes WO 2006/043178, WO 2008/097619 y WO 2008/092901 describen fitasas de diversas especies de Buttiauxella sp. Las fitasas naturales con las actividades específicas más altas actualmente incluyen las fitasas naturales de Yersinia intermedia (documento WO 2007/128160) y Yersinia pestis (documento WO 02/048332).

No obstante, ninguna de estas fitasas disponibles actualmente presenta las propiedades necesarias para la preparación de aditivos para alimentos para animales. Las fitasas disponibles en la actualidad no son suficientemente termoestables para su uso en la preparación de gránulos de alimento para animales sin una pérdida considerable de su actividad. En la preparación de gránulos de alimentos para animales, la fitasa junto con otros componentes de la alimentación de los animales usuales se comprime a temperaturas y humedad altas con el fin de administrar al ganado como una sola entidad. Una destrucción efectiva de salmonella sp. y la gelatinización del almidón solo se alcanza por encima de una temperatura de 80 °C durante la preparación (Amerah y col., Worlds Poulty Science Journal (2011) 67:29–45). Esta compresión en condiciones de calor y humedad da lugar a pérdidas considerables de actividad fitasa. Una posibilidad de evitar esta pérdida de actividad es el laborioso recubrimiento de las partículas de fitasa, de modo que estén protegidas contra el efecto del calor. Este recubrimiento de las adiciones de fitasa provoca costes adicionales considerables como resultado de las grasas o polímeros empleados para el recubrimiento. Las dosis de fitasas comerciales se determinan por lo general sobre la base de la determinación de la actividad a pH 5,5 (DIN ISO 30024: 2009) y no están adaptadas para coincidir con el pH en los respectivos tractos digestivos. Esto se traduce en considerables dosis erróneas por la variación de la actividad a valores de pH distintos de 5,5.

Por lo tanto, era un objeto de la presente invención proporcionar una fitasa que tiene una estabilidad térmica suficiente, de modo que se puede emplear en la preparación de gránulos de pienso sin salmonella sin medidas de protección adicionales, tales como el recubrimiento, y con pérdidas de actividad que son las más bajas posibles. Otro objeto de la invención era proporcionar una fitasa que se puede usar en un amplio intervalo de pH acompañado por una reducción de la actividad enzimática lo más baja posible, de forma que se pueda usar en los diversos intervalos de pH de los tractos digestivos de diferentes especies animales y, por tanto, que se asegure una actividad enzimática suficiente en el tracto digestivo incluso cuando el intervalo de pH fluctúa como resultado de variar los componentes del pienso.

Estos objetos se consiguen mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos un 85 % con la secuencia de aminoácidos de SEC ID 24. Estas fitasas de acuerdo con la invención tienen una termoestabilidad de al menos 80 °C y, por tanto, son adecuadas para su uso en la preparación de gránulos de pienso sufrir una pérdida de actividad considerable como resultado de las condiciones de calor y humedad durante la formación de los gránulos.

Adicionalmente tiene un amplio intervalo de pH de más de 3 unidades de pH dentro del cual conservan al menos un 50 % de la actividad determinada a pH 5,5, de modo que, cuando la dosis se determina sobre la base de la actividad en 5,5, que pueden ser empleados en una multiplicidad de animales con diferente pH digestivo y junto con diferentes componentes del pienso, sin una dosis excesivamente baja que resulta en pérdidas de actividad y, por lo tanto, un aumento de la excreción del fosfato por los animales.

Además, la fitasa de acuerdo con la invención sorprendentemente tiene una estabilidad proteolítica elevada, y por lo tanto, puede atravesar el estómago sin pérdidas sustanciales de actividad y se conserva la actividad en el sitio real de la acción, en el intestino. Además, las fitasas de acuerdo con la invención tienen una estabilidad a pH 2 de al menos 85 % y, por lo tanto, garantizan solo pequeñas pérdidas de actividad en el intervalo altamente ácido.

La fitasa sintético también puede tener una secuencia de aminoácidos con una identidad de al menos 90 % con la secuencia de aminoácidos de la SEC ID 24.

Preferiblemente, la fitasa sintética de acuerdo con la invención tiene una secuencia de aminoácidos con una identidad de al menos 94 %, en particular de preferencia del 95 %, y preferiblemente del 96, 97, 98 o 99 % con la secuencia de aminoácidos de la SEC ID 24.

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-001 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-002 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-003 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-004 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-005 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-006 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-007 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-008 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-009 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0010 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0011 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0012 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0013 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0014 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0015 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0016 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0017 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0018 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-0019 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-020 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-021 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-022 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-023 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-024 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-025 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-026 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-027 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-028 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-029 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-030 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-031 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-032 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-033 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-034 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-035 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-036 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-037 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-038 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-039 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-040 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-041 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-042 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-043 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-044 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-045 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-046 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-047 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-048 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-049 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-050 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-051 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-052 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-053 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-054 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-055 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-056 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-057 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-058 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-059 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-060 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-061 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-062 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-063 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-064 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-065 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-066 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-067 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-068 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-069 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-070 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-071 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-072 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-073 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-074 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-075 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-076 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-077 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-078 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-079 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-080 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-081 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-082 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-083 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-084 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-085 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-086 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-087 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-088 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-089 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-090 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-091 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-092 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-093 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-094 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-095 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-096 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-097 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-098 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-099 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-100 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-101 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-102 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-103 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-104 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-105 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-106 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-107 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-109 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-110 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-111 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-112 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-113 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-114 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-115 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-116 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-117 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-118 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-119 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-120 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-121 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-122 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-123 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-124 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-125 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-126 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-127 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-128 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-129 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-130 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-131 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-132 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-133 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-134 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-135 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-136 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-137 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-138 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-139 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-140 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-141 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-142 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-143 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-144 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-145 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-146 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

El objeto se consigue además mediante una fitasa sintética que tiene una secuencia de aminoácidos con una identidad de al menos 95 %, preferentemente 96 %, preferiblemente 97, 98 o 99 %, con la secuencia de aminoácidos del PHV-147 mutante (véase la Tabla 1, las mutaciones según la columna 2 basado en la SEC ID 24).

La identidad entre dos secuencias de proteínas o secuencias de ácido nucleico se define como la identidad calculada mediante el programa Needle en la versión disponible en abril de 2011. Needle es parte del paquete de software EMBOSS de libre acceso, que se puede descargar del sitio web http: // emboss.sourceforge.net/. Se utilizan los parámetros estándar: gapopen 10,0 ("penalización por abertura de espacio"), gapextend 0,5 ("penalización por extensión de espacio"), archivo de datos EBLOSUM62 (matriz) en el caso de la proteína y archivo de datos EDNAFULL (matriz) en el caso del ADN.

En una realización, la fitasa sintética tiene al menos un intercambio conservador de aminoácidos en al menos una posición en comparación con una de las fitasas descritas anteriormente de acuerdo con la invención: Para los fines de la presente invención, conservador significa un intercambio del aminoácido G a A; A a G, S; V a I, L, A, T, S; I a V, L, M; L a I, M, V; M a L, I, V; P a A, S, N; F a Y, W, H; Y a F, W, H; W a Y, F, H; R a K, E, D; K a R, E, D; H a Q, N, S; D a N, E, K, R, Q; E a Q, D, K, R, N; S a T, A; T a S, V, A; C a S, T, A; N a D, Q, H, S; Q a E, N, H, K, R. Aquí, es posible combinar cualquier intercambio conservador de un aminoácido con cualquier intercambio conservador de otro aminoácido, siempre y cuando se mantenga la actividad de fitasa.

Ventajosamente, la fitasa sintética es una fitasa aislada. También es viable que la fitasa sintético está presente no como una fitasa purificada aislada, sino como un licor de fermentación, con la biomasa separada totalmente, parcialmente o no separada. Aquí, el licor se puede concentrar o secar completamente eliminando el líquido. Es posible emplear estas soluciones de fitasa no purificadas o parcialmente purificadas o sólidos de fitasa como aditivos en diversos productos.

La fitasa sintética de acuerdo con la invención tiene, ventajosamente, una estabilidad elevada a la pepsina, una estabilidad al ácido mejorada a pH 2, una ampliación del intervalo de pH activo y / o un termoestabilidad elevada en comparación con los dos fitasas de tipo salvaje de los organismos Yersinia mollaretii y Hafnia sp., que eran la base de la construcción del constructo de fitasa sintética de la SEC ID 18.

La invención también comprende una secuencia de nucleico aislada que codifica la fitasa con una secuencia de aminoácidos con al menos una identidad del 81 %, ventajosamente del 85 o 90 %, especialmente preferiblemente del 94 % y en particular del 95, 96, 97, 98 o 99 % con la secuencia de aminoácidos de la SEC ID 24.

Asimismo la invención comprende una secuencia de ácido nucleico aislada que codifica una enzima con actividad fitasa, en la que la secuencia de ácido nucleico tiene una identidad de al menos 85 % con la secuencia de ácido nucleico de SEC ID 25, o una secuencia de ácido nucleico que hibrida en condiciones altamente rigurosas con la cadena complementaria de una de las secuencias mencionadas anteriormente con una identidad de al menos 85 % con la secuencia de ácido nucleico de la SEC ID 25. En una realización particular, la secuencia de ácido nucleico aislada que tiene una identidad de más de 90 %, en particular de al menos 91, 92 , 93, 94, 95, 96, 97, 98 o 99 % con la SEC ID 25.

La invención comprende además un vector de expresión recombinante que comprende una de las secuencias de ácido nucleico de acuerdo con la invención.

Asimismo La invención comprende una célula huésped recombinante que comprende uno de los ácidos nucleicos de acuerdo con la invención o que comprende el vector de expresión recombinante de acuerdo con la invención.

El objeto se consigue adicionalmente mediante un organismo de producción recombinante, que es un organismo de producción no humano que comprende una de las secuencias de ácido nucleico de acuerdo con la invención o que comprende el vector de expresión recombinante de acuerdo con la invención. El organismo de producción recombinante es especialmente preferiblemente uno de los géneros Aspergillus, Pichia, Trichoderma, Hansenula, Saccharomyces, Bacillus, Escherischia, Kluyveromyces, Schizosaccharomyces.

La invención comprende adicionalmente un aditivo alimenticio para animales que comprende al menos una de las fitasas de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV–003, PhV–004, PhV–005, PhV–006, PhV–007, PhV–008, PhV–009, PhV–010, PhV–011, PhV–012, PhV–013, PhV–014, PhV–015, PhV–016, PhV–017, PhV–018, PhV–019, PhV–020, PhV–021, PhV–022, PhV–023, PhV–024, PhV–025, PhV–026, PhV–027, PhV–028, PhV–029, PhV–030, PhV–031, PhV–032, PhV–033, PhV–034, PhV–035, PhV–036, PhV–037, PhV–038, PhV–039, PhV–040, PhV–041, PhV–042, PhV–043, PhV–044, PhV–045, PhV–046, PhV–047, PhV–048, PhV–049, PhV–050, PhV–051, PhV–052, PhV–053, PhV–054, PhV–055, PhV–056, PhV–057, PhV–058, PhV–059, PhV–060, PhV–061, PhV–062, PhV–063, PhV–064, PhV–065, PhV–066, PhV–067, PhV–068, PhV–069, PhV–070, PhV–071, PhV–072, PhV–073, PhV–074, PhV–075, PhV–076, PhV–077, PhV–078, PhV–079, PhV–080, PhV–081, PhV–082, PhV–083, PhV–084, PhV–085, PhV–086, PhV–087, PhV–088, PhV–089, PhV–090, PhV–091, PhV–092, PhV–093, PhV–094, PhV–095, PhV–096, PhV–097, PhV–098, PhV–099, PhV–100, PhV–101, PhV–102, PhV–103, PhV–104, PhV–105, PhV–106, PhV–107, PhV–109, PhV–110, PhV–111, PhV–112, PhV–113, PhV–114, PhV–115, PhV–116, PhV–117, PhV–118, PhV–119, PhV–120, PhV–121, PhV–122, PhV–123, PhV–124, PhV–125, PhV–126, PhV–127, PhV–128, PhV–129, PhV–130, PhV–131, PhV–132, PhV–133, PhV–134, PhV–135, PhV–136, PhV–137, PhV–138, PhV–139, PhV–140, PhV–141, PhV–142, PhV–143, PhV–144, PhV–145, PhV–146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, y aditivos para pienso habituales, por ejemplo para ganado, aves de corral o cerdos, tales como, por ejemplo, vitaminas, minerales u otros aditivos.

La invención comprende adicionalmente un alimento para animales que comprende al menos una de las fitasas sintéticas descritas de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV–003, PhV–004, PhV–005, PhV–006, PhV–007, PhV– 008, PhV–009, PhV–010, PhV–011, PhV–012, PhV–013, PhV–014, PhV–015, PhV–016, PhV–017, PhV–018, PhV– 019, PhV–020, PhV–021, PhV–022, PhV–023, PhV–024, PhV–025, PhV–026, PhV–027, PhV–028, PhV–029, PhV– 030, PhV–031, PhV–032, PhV–033, PhV–034, PhV–035, PhV–036, PhV–037, PhV–038, PhV–039, PhV–040, PhV– 041, PhV–042, PhV–043, PhV–044, PhV–045, PhV–046, PhV–047, PhV–048, PhV–049, PhV–050, PhV–051, PhV– 052, PhV–053, PhV–054, PhV–055, PhV–056, PhV–057, PhV–058, PhV–059, PhV–060, PhV–061, PhV–062, PhV– 063, PhV–064, PhV–065, PhV–066, PhV–067, PhV–068, PhV–069, PhV–070, PhV–071, PhV–072, PhV–073, PhV– 074, PhV–075, PhV–076, PhV–077, PhV–078, PhV–079, PhV–080, PhV–081, PhV–082, PhV–083, PhV–084, PhV– 085, PhV–086, PhV–087, PhV–088, PhV–089, PhV–090, PhV–091, PhV–092, PhV–093, PhV–094, PhV–095, PhV– 096, PhV–097, PhV–098, PhV–099, PhV–100, PhV–101, PhV–102, PhV–103, PhV–104, PhV–105, PhV–106, PhV– 107, PhV–109, PhV–110, PhV–111, PhV–112, PhV–113, PhV–114, PhV–115, PhV–116, PhV–117, PhV–118, PhV– 119, PhV–120, PhV–121, PhV–122, PhV–123, PhV–124, PhV–125, PhV–126, PhV–127, PhV–128, PhV–129, PhV– 130, PhV–131, PhV–132, PhV–133, PhV–134, PhV–135, PhV–136, PhV–137, PhV–138, PhV–139, PhV–140, PhV– 141, PhV–142, PhV–143, PhV–144, PhV–145, PhV–146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, junto con los componentes del alimento habituales. En este contexto, los componentes del alimento viables son todos aquellos que se emplean convencionalmente en los gránulos de pienso para el engorde de la carne, vacas lecheras, aves o cerdos.

La invención comprende además el uso de una de las fitasas sintéticas descritas de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV– 002, PhV–003, PhV–004, PhV–005, PhV–006, PhV–007, PhV–008, PhV–009, PhV–010, PhV–011, PhV–012, PhV– 013, PhV–014, PhV–015, PhV–016, PhV–017, PhV–018, PhV–019, PhV–020, PhV–021, PhV–022, PhV–023, PhV– 024, PhV–025, PhV–026, PhV–027, PhV–028, PhV–029, PhV–030, PhV–031, PhV–032, PhV–033, PhV–034, PhV– 035, PhV–036, PhV–037, PhV–038, PhV–039, PhV–040, PhV–041, PhV–042, PhV–043, PhV–044, PhV–045, PhV– 046, PhV–047, PhV–048, PhV–049, PhV–050, PhV–051, PhV–052, PhV–053, PhV–054, PhV–055, PhV–056, PhV– 057, PhV–058, PhV–059, PhV–060, PhV–061, PhV–062, PhV–063, PhV–064, PhV–065, PhV–066, PhV–067, PhV– 068, PhV–069, PhV–070, PhV–071, PhV–072, PhV–073, PhV–074, PhV–075, PhV–076, PhV–077, PhV–078, PhV– 079, PhV–080, PhV–081, PhV–082, PhV–083, PhV–084, PhV–085, PhV–086, PhV–087, PhV–088, PhV–089, PhV– 090, PhV–091, PhV–092, PhV–093, PhV–094, PhV–095, PhV–096, PhV–097, PhV–098, PhV–099, PhV–100, PhV– 101, PhV–102, PhV–103, PhV–104, PhV–105, PhV–106, PhV–107, PhV–109, PhV–110, PhV–111, PhV–112, PhV– 113, PhV–114, PhV–115, PhV–116, PhV–117, PhV–118, PhV–119, PhV–120, PhV–121, PhV–122, PhV–123, PhV– 124, PhV–125, PhV–126, PhV–127, PhV–128, PhV–129, PhV–130, PhV–131, PhV–132, PhV–133, PhV–134, PhV– 135, PhV–136, PhV–137, PhV–138, PhV–139, PhV–140, PhV–141, PhV–142, PhV–143, PhV–144, PhV–145, PhV– 146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, o del aditivo para alimentos para animales de acuerdo con la invención que comprende al menos una de las fitasas sintéticas de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV– 003, PhV–004, PhV–005, PhV–006, PhV–007, PhV–008, PhV–009, PhV–010, PhV–011, PhV–012, PhV–013, PhV– 014, PhV–015, PhV–016, PhV–017, PhV–018, PhV–019, PhV–020, PhV–021, PhV–022, PhV–023, PhV–024, PhV– 025, PhV–026, PhV–027, PhV–028, PhV–029, PhV–030, PhV–031, PhV–032, PhV–033, PhV–034, PhV–035, PhV– 036, PhV–037, PhV–038, PhV–039, PhV–040, PhV–041, PhV–042, PhV–043, PhV–044, PhV–045, PhV–046, PhV– 047, PhV–048, PhV–049, PhV–050, PhV–051, PhV–052, PhV–053, PhV–054, PhV–055, PhV–056, PhV–057, PhV– 058, PhV–059, PhV–060, PhV–061, PhV–062, PhV–063, PhV–064, PhV–065, PhV–066, PhV–067, PhV–068, PhV– 069, PhV–070, PhV–071, PhV–072, PhV–073, PhV–074, PhV–075, PhV–076, PhV–077, PhV–078, PhV–079, PhV– 080, PhV–081, PhV–082, PhV–083, PhV–084, PhV–085, PhV–086, PhV–087, PhV–088, PhV–089, PhV–090, PhV– 091, PhV–092, PhV–093, PhV–094, PhV–095, PhV–096, PhV–097, PhV–098, PhV–099, PhV–100, PhV–101, PhV– 102, PhV–103, PhV–104, PhV–105, PhV–106, PhV–107, PhV–109, PhV–110, PhV–111, PhV–112, PhV–113, PhV– 114, PhV–115, PhV–116, PhV–117, PhV–118, PhV–119, PhV–120, PhV–121, PhV–122, PhV–123, PhV–124, PhV– 125, PhV–126, PhV–127, PhV–128, PhV–129, PhV–130, PhV–131, PhV–132, PhV–133, PhV–134, PhV–135, PhV– 136, PhV–137, PhV–138, PhV–139, PhV–140, PhV–141, PhV–142, PhV–143, PhV–144, PhV–145, PhV–146 o PhV– 147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, en un alimento para animales. En este contexto, el uso puede tener lugar en la forma de la adición de la fitasa de acuerdo con la invención o del aditivo para alimentos para animales de acuerdo con la invención antes de la granulación de los componentes del alimento restantes. También es factible aplicar la fitasa a estos gránulos después de la preparación de gránulos de pienso, en particular, en forma líquida.

La invención se consigue adicionalmente mediante el uso de una de las fitasas sintéticas descritas anteriormente de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV–003, PhV–004, PhV–005, PhV–006, PhV–007, PhV–008, PhV–009, PhV– 010, PhV–011, PhV–012, PhV–013, PhV–014, PhV–015, PhV–016, PhV–017, PhV–018, PhV–019, PhV–020, PhV– 021, PhV–022, PhV–023, PhV–024, PhV–025, PhV–026, PhV–027, PhV–028, PhV–029, PhV–030, PhV–031, PhV– 032, PhV–033, PhV–034, PhV–035, PhV–036, PhV–037, PhV–038, PhV–039, PhV–040, PhV–041, PhV–042, PhV– 043, PhV–044, PhV–045, PhV–046, PhV–047, PhV–048, PhV–049, PhV–050, PhV–051, PhV–052, PhV–053, PhV– 054, PhV–055, PhV–056, PhV–057, PhV–058, PhV–059, PhV–060, PhV–061, PhV–062, PhV–063, PhV–064, PhV– 065, PhV–066, PhV–067, PhV–068, PhV–069, PhV–070, PhV–071, PhV–072, PhV–073, PhV–074, PhV–075, PhV– 076, PhV–077, PhV–078, PhV–079, PhV–080, PhV–081, PhV–082, PhV–083, PhV–084, PhV–085, PhV–086, PhV– 087, PhV–088, PhV–089, PhV–090, PhV–091, PhV–092, PhV–093, PhV–094, PhV–095, PhV–096, PhV–097, PhV– 098, PhV–099, PhV–100, PhV–101, PhV–102, PhV–103, PhV–104, PhV–105, PhV–106, PhV–107, PhV–109, PhV– 110, PhV–111, PhV–112, PhV–113, PhV–114, PhV–115, PhV–116, PhV–117, PhV–118, PhV–119, PhV–120, PhV– 121, PhV–122, PhV–123, PhV–124, PhV–125, PhV–126, PhV–127, PhV–128, PhV–129, PhV–130, PhV–131, PhV– 132, PhV–133, PhV–134, PhV–135, PhV–136, PhV–137, PhV–138, PhV–139, PhV–140, PhV–141, PhV–142, PhV– 143, PhV–144, PhV–145, PhV–146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, o del aditivo para alimentos para animales de acuerdo con la invención que comprende al menos una de las fitasas sintéticas de acuerdo con la invención, en particular con una secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV–003, PhV–004, PhV–005, PhV–006, PhV–007, PhV–008, PhV–009, PhV– 010, PhV–011, PhV–012, PhV–013, PhV–014, PhV–015, PhV–016, PhV–017, PhV–018, PhV–019, PhV–020, PhV– 021, PhV–022, PhV–023, PhV–024, PhV–025, PhV–026, PhV–027, PhV–028, PhV–029, PhV–030, PhV–031, PhV– 032, PhV–033, PhV–034, PhV–035, PhV–036, PhV–037, PhV–038, PhV–039, PhV–040, PhV–041, PhV–042, PhV– 043, PhV–044, PhV–045, PhV–046, PhV–047, PhV–048, PhV–049, PhV–050, PhV–051, PhV–052, PhV–053, PhV– 054, PhV–055, PhV–056, PhV–057, PhV–058, PhV–059, PhV–060, PhV–061, PhV–062, PhV–063, PhV–064, PhV– 065, PhV–066, PhV–067, PhV–068, PhV–069, PhV–070, PhV–071, PhV–072, PhV–073, PhV–074, PhV–075, PhV– 076, PhV–077, PhV–078, PhV–079, PhV–080, PhV–081, PhV–082, PhV–083, PhV–084, PhV–085, PhV–086, PhV– 087, PhV–088, PhV–089, PhV–090, PhV–091, PhV–092, PhV–093, PhV–094, PhV–095, PhV–096, PhV–097, PhV– 098, PhV–099, PhV–100, PhV–101, PhV–102, PhV–103, PhV–104, PhV–105, PhV–106, PhV–107, PhV–109, PhV– 110, PhV–111, PhV–112, PhV–113, PhV–114, PhV–115, PhV–116, PhV–117, PhV–118, PhV–119, PhV–120, PhV– 121, PhV–122, PhV–123, PhV–124, PhV–125, PhV–126, PhV–127, PhV–128, PhV–129, PhV–130, PhV–131, PhV– 132, PhV–133, PhV–134, PhV–135, PhV–136, PhV–137, PhV–138, PhV–139, PhV–140, PhV–141, PhV–142, PhV– 143, PhV–144, PhV–145, PhV–146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, en un alimento para animales que comprende al menos una de las fitasas sintéticas descritas, en particular con la secuencia de aminoácidos correspondiente a la SEC ID 24 o uno de los mutantes PhV–001, PhV–002, PhV–003, PhV–004, PhV– 005, PhV–006, PhV–007, PhV–008, PhV–009, PhV–010, PhV–011, PhV–012, PhV–013, PhV–014, PhV–015, PhV– 016, PhV–017, PhV–018, PhV–019, PhV–020, PhV–021, PhV–022, PhV–023, PhV–024, PhV–025, PhV–026, PhV– 027, PhV–028, PhV–029, PhV–030, PhV–031, PhV–032, PhV–033, PhV–034, PhV–035, PhV–036, PhV–037, PhV– 038, PhV–039, PhV–040, PhV–041, PhV–042, PhV–043, PhV–044, PhV–045, PhV–046, PhV–047, PhV–048, PhV– 049, PhV–050, PhV–051, PhV–052, PhV–053, PhV–054, PhV–055, PhV–056, PhV–057, PhV–058, PhV–059, PhV– 060, PhV–061, PhV–062, PhV–063, PhV–064, PhV–065, PhV–066, PhV–067, PhV–068, PhV–069, PhV–070, PhV– 071, PhV–072, PhV–073, PhV–074, PhV–075, PhV–076, PhV–077, PhV–078, PhV–079, PhV–080, PhV–081, PhV– 082, PhV–083, PhV–084, PhV–085, PhV–086, PhV–087, PhV–088, PhV–089, PhV–090, PhV–091, PhV–092, PhV– 093, PhV–094, PhV–095, PhV–096, PhV–097, PhV–098, PhV–099, PhV–100, PhV–101, PhV–102, PhV–103, PhV– 104, PhV–105, PhV–106, PhV–107, PhV–109, PhV–110, PhV–111, PhV–112, PhV–113, PhV–114, PhV–115, PhV– 116, PhV–117, PhV–118, PhV–119, PhV–120, PhV–121, PhV–122, PhV–123, PhV–124, PhV–125, PhV–126, PhV– 127, PhV–128, PhV–129, PhV–130, PhV–131, PhV–132, PhV–133, PhV–134, PhV–135, PhV–136, PhV–137, PhV– 138, PhV–139, PhV–140, PhV–141, PhV–142, PhV–143, PhV–144, PhV–145, PhV–146 o PhV–147 (según la definición en la Tabla 1) o con una secuencia de aminoácidos con una identidad de al menos 90, 91, 92, 93, 94, 95, 96, 97, 98 o 99 % con la misma, para reducir el contenido de fosfato en el estiércol del ganado.

Las realizaciones descritas son para ilustrar y proporcionar mejor comprensión de la invención y de ninguna manera deben interpretarse como limitantes. Otras características de la invención son el resultado de la descripción siguiente en el presente documento de realizaciones preferidas junto con las reivindicaciones dependientes. En este contexto, las características individuales de la invención pueden, en una realización, realizarse en cada caso individualmente o en conjunto y no constituyen limitación alguna de la invención a la realización descrita. La redacción de las reivindicaciones de la patente se hace expresamente por la presente materia objeto de la descripción.

Descripción de las figuras

La Figura 1 muestra la estabilidad térmica de la fitasa HF598 (SEC ID 24). La fitasa se calienta durante 20 minutos a pH 5,5 a la temperatura indicada. Después de enfriar, se determina la actividad residual a pH 5,5 y 37 °C. Para determinar la actividad residual relativa, la actividad de una muestra de referencia incubada durante 20 minutos a temperatura ambiente se fija en 100 %.

Las Figuras 2 A y B muestran los perfiles de pH de la fitasa HF598 (SEC ID 24) y algunas variantes de los mismos. La actividad fitasa se determina al pH respectivo especificado. Para determinar los datos de actividad relativa, la actividad determinada a pH 5,5 se fija en 100 %. A) Las fitasas se expresan en A. niger y se miden en el sobrenadante del cultivo. B) Las fitasas se expresan en E. coli, se concentraron utilizando una columna de Ni- NTA y después se midieron.

La Figura 3 muestra el mapa del plásmido del plásmido de expresión pGLA53-HF598.

La Figura 4 muestra el mapa del plásmido del plásmido de expresión pFus5#2.

La Figura 5 muestra el mapa del plásmido del plásmido de expresión pH6–Fus5#2.

La Figura 6 muestra el mapa del plásmido del plásmido de expresión pGLA53–Fus5#2.

Ejemplos

Clonación de la fitasa de Hafnia sp. LU11047

Las fitasas se buscan en una serie de enterobacterias de forma análoga a las publicaciones de Huang y col., (2006) A novel phytase with preferable characteristics from Yersinia intermedia. Biochem Biophys Res Commun 350: 884– 889, Shi y col., (2008) A novel phytase gene appA from Buttiauxella sp. GC21 isolated from grass carp intestine. Aquaculture 275:70–75 y el documento WO2008116878 (Ejemplo 1) con la ayuda de los oligos degenerados Haf1090 5'–GAYCCNYTNTTYCAYCC–3' (SEC ID: 1) y Haf1092 5'–GGNGTRTTRTCNGGYTG–3' (SEC ID: 2) a temperaturas de hibridación de entre 40 °C y 50 °C, utilizando PCR. Los productos de la PCR formados se emplean como molde para una PCR semianidada utilizando los oligos Haf1090 5'–GAYCCNYTNTTYCAYCC–3' (SEC ID 1) y Haf1091 5'–GCDATRTTNGTRTCRTG–3' (SEC ID 3) en condiciones de hibridación idénticas. Se puede aislar un fragmento de una cepa bacteriana del género Hafnia (Hafnia sp. LU11047). El fragmento aislado se subclonó con la ayuda del kit "TOPO TA Cloning ® Kit" (Invitrogen) siguiendo las instrucciones del fabricante y posteriormente se secuenció. A partir de esta secuencia parcial se amplifica la secuencia de longitud completa de la fitasa por medio del procedimiento denominado TAIL-PCR (Yao–Guang Liu y Robert F. Whittier (1995) Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25, 674–681). Para este fin se usan los siguientes oligonucleótidos: Amplificación del extremo 3’: 1. Haf1165 (5'–WCAGNTGWTNGTNCTG– 3', SEC ID 4) y Haf1167 (5'–CTTCGAGAGCCACTTTATTACCGTCG – 3', SEC ID 5) 2. Haf1165 (5'– WCAGNTGWTNGTNCTG – 3', SEC ID 4) y Haf1168 (5'–CCAATGTTGTGCTGCTGACAATAGG– 3', SEC ID 6) 3. Haf1165 (5'– WCAGNTGWTNGTNCTG– 3', SEC ID 4) y Haf1169 (5'–CCGAACTCATCAGCGCTAAAGATGC– 3', SEC ID 7) Amplificación del extremo 5’: 1.

Haf1077 (5'– CAWCGWCNGASASGAA– 3', SEC ID 8) y Haf1170 (5'– CGCAGTTTGACTTGATGTCGCGCACG– 3', SEC ID 9) 2.

Haf1077 (5'– CAWCGWCNGASASGAA– 3', SEC ID 8) y Haf1171 (5'– GTCGCGCACGCCCTATATCGCCAAGC–3', SEC ID 10) 3.

Haf1077 (5'– CAWCGWCNGASASGAA– 3', SEC ID 8) y Haf1172 (5'– CTGCAAACCATCGCACACGCACTGG– 3', SEC ID 11) Los fragmentos de ADN obtenidos se clonan con la ayuda del kit· TOPO TA Cloning ® Kit" (Invitrogen) y se secuencian. Las secuencias de nucleótidos dan el gen de SEC ID 12, que codifica la fitasa de Hafnia sp. LU11047.

La secuencia de aminoácidos SEC ID 13, que deriva del mismo, tiene una identidad del 98 % con la secuencia de la fitasa de una fitasa de Hafnia alvei del documento WO200811678. Usando el software SignalP 2.0, se prevé que los aminoácidos 1-33 sean un péptido señal. La enzima madura, en consecuencia, comienza con la serina en la posición 34.

1. Fitasa sintética Fus5 # 2

Clonación de la fitasa Fus5#2

Comenzando a partir del ADN cromosómico de Hafnia sp. LU11047, un fragmento de las bases 1 - 1.074 de la fitasa (SEC ID 14) se amplifica por medio de PCR. Los oligonucleótidos derivan de la secuencia de ADN de una supuesta fitasa (o fosfatasa ácida) de Yersinia mollaretii ATCC43969, NCBI Sequenz ID ZP_00824387 para amplificar los nucleótidos 1057 - 1323. Esto se utiliza para amplificar un segundo fragmento de la fitasa del ADN cromosómico de

Yersinia mollaretii ATCC 43969 (SEC ID 15). Tras la amplificación de los dos fragmentos de fitasa se genera un solapamiento de 20 pb con el respectivo otro fragmento de fitasa, con la ayuda de los oligos utilizados, tanto en el extremo 3’ del fragmento de Hafnia y el extremo 5 ' del fragmento de Yersinia. De esta manera, los dos fragmentos se pueden combinar mediante fusión de PCR para dar la secuencia de la fitasa SEC ID 16, que codifica la fitasa sintética Fus5 #2. Para la secuencia de aminoácidos SEC ID 17 derivada de la misma, mediante el software SignalP 2.0 se predice que los aminoácidos 1-33 son un péptido señal. La fitasa madura Fus5#2 (SEC ID 18) está codificada por la secuencia de nucleótidos SEC ID 19.

Para clonar un plásmido de expresión para E. coli se genera un sitio de escisión de restricción NdeI en el extremo 5' del fragmento de ADN de la fitasa de SEC ID 16 y se generan un sitio de escisión de restricción HindIII y un codón de terminación en el extremo 3'. Las secuencias adicionalmente necesarias para esto se introducen por medio de una reacción de PCR a través de los cebadores utilizados, con la ayuda de la SEC ID 16 de fitasa como molde.

Usando estos sitios de corte, el gen que codifica la fitasa se clona en el vector de expresión de E. coli pET22b (Novagen). Usando el sitio de escisión de restricción NdeI y mediante la introducción del codón de terminación se elimina la secuencia señal pelB del vector y se evita la lectura en el marcador 6xHis, que está presente en el plásmido. El plásmido pFus5 # 2 (SEC ID 20) generado de este modo se transforma en la cepa de E. coli BL21 (DE3) (Invitrogen).

Para la mejora de la purificación de la proteína fitasa, una variante de la fitasa con un marcador 6xHis en N-terminal se clona. Utilizando el oligocebador sentido H6: 5'–ctatggatccgcatcatcatcatcatcacagtgataccgcccctgc–3' (SEc ID 21), que introduce no solo el marcador 6xHis, sino también un sitio de escisión BamHI y que actúa como molde para la secuencia SEC ID 19, que codifica la proteína fitasa madura, se amplifica un producto de PCR. En el extremo 3 'del producto de la PCR, de nuevo se introducen un codón de terminación y un sitio de escisión de restricción NdeI utilizando el mismo oligo antisentido. El fragmento generado de este modo se clona en el vector pET22b a través de BamHI/NdeI, dando lugar al plásmido pH 6-Fus5 # 2 (SEC ID 22), que asimismo se transforma en E. coli BL21 (DE3). En el caso de esta construcción, la secuencia señal pelB, que está comprendida en pET22b, se utiliza para el transporte hacia el periplasma.

Ensayo de fitasa

La actividad fitasa se determina en placas de microtitulación. La muestra de enzima se diluye en tampón de reacción (acetato Na 250 mM de, CaCl2, 1 mM, 0,01 % de Tween 20, pH 5,5). 10 µl de la solución de enzima se incuban con140 µl de la solución de sustrato (fitato Na 6 mM (Sigma P3168) en tampón de reacción) durante 1 hora a 37 °C. La reacción se inactiva mediante la adición de 150 µl de solución de ácido tricloroacético (15 % p/p). Para detectar el fosfato liberado, 20 µl de la solución de reacción inactivada se tratan con 280 µl de reactivo de color recién preparado (ácido L-ascórbico 60 mM (Sigma A7506), molibdato de amonio tetrahidrato 2,2 mM, H2SO4 325 mM), y se incuban durante 25 minutos a 50 °C, y la absorción a 820 nm se determinó posteriormente. Para el valor en blanco, el tampón de sustrato por sí solo se incuba a 37 °C y los 10 µl de la muestra de enzima solamente se añaden después de inactivar con ácido tricloroacético. La reacción de color se lleva a cabo de manera análoga a las mediciones restantes. La cantidad de fosfato liberado se determina a través de una curva de calibración de la reacción de color con una solución de fosfato de concentración conocida.

Expresión en Escherichia coli

Las cepas de E. coli BL21 (DE3), que albergan un plásmido con un casete de expresión de fitasa, se cultivan a 37 °C en medio LB suplementado con ampicilina (100 mg / l). La expresión de la fitasa se induce a una DO (600 nm) de 0,6 mediante la adición de IPTG 1 mM. Después de 4 horas de inducción, se añade 10 % (v / v) de una solución 10x BugBuster (Novogen) y la mezcla se incuba durante 15 minutos a temperatura ambiente. Después de la centrifugación, el sobrenadante se utiliza para determinar la actividad fitasa.

Purificación mediante cromatografía de afinidad de Ni

Para purificar las variantes de fitasa marcadas con 6xHis, un caldo de cultivo de E.coli que expresa fitasa inducido se trata con NaCl 300 mM, inhibidor de proteasa Complete™ sin EDTA (siguiendo las instrucciones del fabricante Roche Applied Science) y con 10 % (v / v) de una solución 10x BugBuster (Novogen) y la mezcla se incuba durante 15 minutos a temperatura ambiente. Después de la centrifugación, el sobrenadante se une a columnas de Ni-NTA / KIT (Qiagen) siguiendo las instrucciones del fabricante. La elución después de las etapas de lavado se lleva a cabo usando tampón de elución en frío (tampón de acetato de Na 50 mM, NaCl 300 mM, imidazol 500 mM, CaCl2 1 mM).

Antes de determinar el contenido de proteína, la muestra se somete a un intercambio de tampón para citrato de sodio 2 mM a pH 5,5 mediante diálisis.

Expresión en Aspergillus niger

Para expresar la fitasa Fus5#2 en Aspergillus niger, se prepara primero una construcción de expresión que comprende el gen de la fitasa bajo el control del promotor de la glucoamilasa de A. niger (glaA), flanqueado por la región no codificante 3'–glaA. De esta manera, la construcción se destina a la integración en la región 3'–glaA en A. niger. La secuencia señal utilizada para la secreción de proteína extracelular es la secuencia señal de la fitasa de A. ficuum. La base utilizada para la construcción de expresión es el plásmido pGBGLA-53 (también denominado pGBTOPFYT-1 en el documento WO9846772), que se describe en detalle en el documento EP0635574B1. Con la ayuda de técnicas de clonación basadas en PCR conocidas por un experto en la técnica, el segmento génico de la fitasa de A. ficuum, que codifica la proteína fitasa madura a comenzando con la secuencia de aminoácidos ASRNQSS, en pGBGLA-53 se sustituye por el segmento génico de la SEC ID 19, que codifica la fitasa Fus5 # 2 madura. Esto da lugar al plásmido resultante pGLA53-Fus5 # 2 (SEC ID 23). La cotransformación del casete de expresión lineal, aislado a partir del plásmido resultante usando HindIII, junto con un casete marcador amdS, aislado del plásmido pGBLA50 (documento EP0635574B1) / pGBAAS-1 (nombre del mismo plásmido en el documento WO9846772), en una cepa de expresión de A. niger con deleción de gla-A y la posterior expresión de la fitasa en matraces de agitación se lleva a cabo como se describe en las dos especificaciones de patentes citadas. La actividad fitasa en el sobrenadante del cultivo se determina diariamente después de que se han centrifugado las células. La máxima actividad se alcanza entre el día 3 y el día 6.

2. Variantes de fitasa de la fitasa Fus5#2

Las variantes de la fitasa se generan mediante la mutación de la secuencia génica de SEC ID 19 por medio de PCR. El "Quickchange Site–directed Mutagenesis Kit" (Stratagene) se utiliza para llevar a cabo una mutagénesis dirigida. Una mutagénesis aleatoria sobre toda la secuencia de codificación, o bien sobre solo una parte de la misma, de la SEC ID 19 se realiza con la ayuda del kit "GeneMorph II Random Mutagenesis Kit" (Stratagene). La tasa de mutagénesis se establece en la cantidad deseada de 1-5 mutaciones a través de la cantidad de molde de ADN usada. Se generan mutaciones mediante la combinación dirigida de mutaciones individuales o mediante la realización secuencial de varios ciclos de mutagénesis.

Las variantes de fitasa generadas se analizan para determinar la actividad fitasa y la termoestabilidad en un ensayo con capacidad de alto rendimiento. Con este fin, los clones de E. coli BL21 (DE3) obtenidos después de la transformación con la construcción de expresión basada en pET22b se incuban (30 °C, 900 rpm, desviación del agitador de 2 mm) en placas de microtitulación de 96 pocillos en medio LB (2 % de glucosa, ampicilina 100 mg / l). La inducción se lleva a cabo con IPTG 1 mM durante 4 horas a una DO (600 nm) de aproximadamente 0,5. A continuación se añade 10 % (v / v) de una solución 10x BugBuster (Novogen) y la mezcla se incuba durante 15 minutos a temperatura ambiente. Se determinan la actividad fitasa y la actividad residual después de 20 minutos de estrés térmico.

La fitasa HF598 (SEC ID 24) generada de esta manera y las variantes de la misma se clonan en el vector de expresión de E. coli pET22b (Novagen) de forma análoga a los procedimientos descritos en la sección anterior y, posteriormente, se expresa con la ayuda de la cepa de E. coli BL21 (DE3). Además, las construcciones de expresión adecuados para Aspergillus niger se clonan de modo que la fitasa se pueda expresar después de la transformación en A. niger. Cuando se utiliza un gen sintético (SEC ID 25), que codifica la variante HF598 madura (SEC ID 24) y que se había adaptado al uso de codones de A. niger (GENEART AG, Regensburg), se obtiene el plásmido pGla53- HF598 (SEC ID 26).

Determinación de la termoestabilidad (T50)

Para registrar la curva de inactivación térmica, la muestra de enzima que se diluye en tampón de reacción (acetato de Na 250 mM, CaCl2 1 mM, 0,01 % de Tween 20, pH 5,5) se calienta durante 20 minutos a las respectivas temperaturas y posteriormente se enfría a 4 °C. Una muestra de referencia que no ha sufrido tratamiento térmico se deja a temperatura ambiente durante 20 minutos y, después, también se enfría a 4 °C. Después del pretratamiento térmico, la actividad enzimática de las muestras se determina por medio del ensayo de fitasa. La actividad de la muestra de referencia se normaliza a 100 %. La termoestabilidad de las diversas variantes de fitasa se caracteriza por lo que se conoce como el valor de T50. La T50 indica la temperatura a la cual todavía hay actividad residual del 50 % después de la inactivación térmica, en comparación con una muestra de referencia que no ha sufrido tratamiento térmico. Los cambios en la termoestabilidad de dos variantes de fitasa dos, expresada en °C, es el resultado de la diferencia de los respectivos valores de T50.

Tabla 1: Termoestabilidad (T50) de la fitasa HF598 (véase la Figura 1) y sus variantes en °C. Los cambios sobre la SEC ID 24 se especifican en los intercambios de aminoácidos individuales en la forma [aminoácido original] [posición 4] [nuevo aminoácido]. El símbolo"–" indica una deleción del aminoácido en cuestión. La numeración de la posición del aminoácido se refiere siempre a la SEC ID 24.

Mutante

Mutación

T50 [°C]

HF598 SEC ID 24 84 PhV–001 D2E A4E A6S F8Y D33M K76N N78T E144A G217S D398E 84 PhV–002 D2E A4E A6S F8Y D33M K76N N78T N92A E144A G217S 85 D398E PhV–003 D2E A4E A6S F8Y D33M R67L K76N N78T N92A E144A 85 G217S M260I D398E PhV–004 D2E A4E A6S F8Y D33M R67L K76N N78T Q109N Q159N 85 M260I D398E PhV–005 D33N P75N D77T V123A E144A G152T G217S 81 PhV–006 D33N Q71E T121Q V123A E144A G152T G217S 81 PhV–007 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T V123A E144A G152T G217S PhV–008 D33N T121Q V123A S136K E144A G152T G217S Q406K 81 PhV–009 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 H37Y K76N N78T V123A E144A G152T G217S PhV–010 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A E144A G152T G217S PhV–011 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 H37Y P75N D77T V123A E144A G152T G217S (continuación)

Mutante

Mutación

T50 [°C]

PhV–012 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T G217S D398E PhV–013 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T V123A E144A G152T G217S D398K PhV–014 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T V123A E144A G152T G217S D398G PhV–015 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T Q109E V123A E144A G152T G217S PhV–016 S1–D2–T3Q A4G P5AA6D G7K F8M Q9K K12R D33N K76N 81 N78T Q109N V123A E144A G152T G217S PhV–017 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T Q159N G217S PhV–018 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T V123A E144A G152T G217S T322Q PhV–019 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A E144A G152A G217S PhV–020 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 83 K76N N78T V123A E144A G217S PhV–021 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 V123A E144A G152T G217S PhV–022 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G217S PhV–023 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T G217S I300L PhV–024 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A S136K Q141K E144A G152T G217S PhV–025 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A S136K E144A G152T G217S PhV–026 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N 77SQD79 V123A E144A G152T G217S PhV–027 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N 77SQG79 V123A E144A G152T G217S PhV–028 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A S136K E144A G152T A166E G217S PhV–029 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A S136K E144A G152T A166H G217S PhV–030 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A S136K E144A G152T PhV–031 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G152T 83 G217S PhV–032 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A E144A G152T N159K G217S PhV–033 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A E144A G152T G217S Q406K PhV–034 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T E144A G152T G217S PhV–035 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T E144A G152T G217S I300L PhV–036 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A G152T A166E G217S PhV–037 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A G152T A166H G217S PhV–038 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A G152T PhV–039 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A E144A G152T A166H G217S D398E PhV–040 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A E144A G152T D398E (continuación)

Mutante

Mutación

T50 [°C]

PhV–041 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A S136K E144A G152T G217S D398E PhV–042 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T V123A S136K E144A G152T Q193L G217S PhV–043 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T N119A V123A E144A G152T G217S PhV–044 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T N119T V123A E144A G152T G217S PhV–045 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 83 K76N N78T Q109N V123A E144A G217S I300L PhV–046 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T Q109N V123A E144A G217S K268N I300L PhV–047 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T Q109N V123A E144A G152T G217S K268N I300L PhV–048 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M K76I 83 N78T V123A E144A G217S PhV–049 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76R N78T V123A E144A G217S PhV–050 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76D N78T V123A E144A G217S PhV–051 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T Q118S V123A E144A G152T G217S PhV–052 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T Q118S N119A V123A E144A G152T G217S PhV–053 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 83 K76N N78T E144A G217S I300L PhV–054 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T Q118S N119A V123A E144A G217S PhV–055 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 83 Q276N PhV–056 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G152T 82 G217S Q276N N346G PhV–057 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T Q109N V123A E144A G217S Q276N I300L N346G PhV–058 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 83 PhV–059 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 83 D398E PhV–060 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 83 K76N N78T Q109N V123A E144A G217S I300L N346G PhV–061 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 81 K76N N78T V123A E144A G152T E155N G217S D345G PhV–062 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 82 K76N N78T S136K E144A G217S PhV–063 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155N G217S Q276N PhV–064 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92A V123A E144A G152T G217S PhV–065 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T N92T V123A E144A G152T G217S PhV–066 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T N92V V123A E144A G152T G217S PhV–067 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 85 K76N N78T N92A E144A G152T G217S PhV–068 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92E E144A G152T G217S PhV–069 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92T E144A G152T G217S PhV–070 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 85 K76N N78T N92V E144A G152T G217S (continuación)

Mutante

Mutación

T50 [°C]

PhV–071 S1A D2S T3R A4N P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T V123A E144A G152T G217S PhV–072 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92E V123A E144A G152T G217S PhV–073 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N K76I 83 N78T Q109N V123A E144A G152T G217S I300L PhV–074 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N K76I 83 N78T Q109N V123A E144A G152T G217S I300L D398E PhV–075 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T Q109N V123A G152T I300L PhV–076 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92A E144A G152T G217S I300L PhV–077 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T N92E E144A G152T G217S I300L PhV–078 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 84 K76N N78T N92T E144A G152T G217S I300L PhV–079 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T N92V E144A G152T G217S I300L PhV–080 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 81 K76N N78T V123A S136K Q141 K E144A G152T G217S I300L PhV–081 D2E A4E A6S F8Y D33M K76N N78T E144A G217S D398E 84 PhV–082 D2E A4E A6S F8Y D33M K76N N78T V123A E144A T156G 82 G217S Q276N D398E PhV–083 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 83 Q276N I300L D398E PhV–084 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 83 K76N N78T N92A V123A S136K E144A G152T G217S PhV–085 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N K76I 84 N78T N92A Q109N V123A E144A G152T G217S I300L PhV–086 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T Q109N E144A G152T G217S K268A Q276N I300L N346G PhV–087 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155N G217S PhV–088 D2E A4E A6S F8Y D33M K76N N78T V123A E144A T156G 83 G217S D398E PhV–089 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 83 I300L D398E PhV–090 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155H G217S PhV–091 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155G G217S D345G PhV–092 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155N G217S D345G PhV–093 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 82 K76N N78T V123A E144A G152T E155H G217S D345M PhV–094 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 83 K76N N78T Q109N E144A T156G G217S Q276N I300L N346G PhV–095 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M K76I 83 N78T V123A D398E PhV–096 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N K76I 84 N78T N92A E144A G152T G217S PhV–097 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N 85 K76N N78T N92A Q109N E144A G152T Q159N G217S PhV–098 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33N K76I 84 N78T N92A V123A S136K E144A G152T G217S PhV–099 D2E A4E A6S F8Y K76N N78T V123A E144A G217S 84 PhV–100 K76N N78T V123A E144A G152T G217S N258D H261S 82 Q270N PhV–101 K76N N78T V123A E144A G217S N258D H261S Q270N 83 (continuación)

Mutante

Mutación

T50 [°C]

PhV–102 D33M K76N N78T V123A E144A G152T G217S N258D 82 H261S Q270N PhV–103 V123A E144A G217S 84 PhV–104 D33M K76N N78T V123A E144A G217S 84 PhV–105 T121Q V123A E144A G152T G217S 83 PhV–106 K76N N78T V123A E144A G217S Q270N 83 PhV–107 K76N N78T V123A E144A G152T G217S 83 PhV–109 Q159N G217S 83 PhV–110 V123A E144A Q159N M260I 84 PhV–111 N92A V123A E144A Q159N M260I 85 PhV–112 S1–D2–T3Q A4G P5A V123A E144A G217S 84 PhV–113 S1–D2–T3Q A4G P5A V123A E144A G217S 84 PhV–114 A6D G7K F8M Q9K V123A E144A G217S 84 PhV–115 N92A Q159N M260I 85 PhV–116 Q159N M260I 84 PhV–117 S1A D2S T3R A4N V123A E144A G217S 84 PhV–118 M260I 84 PhV–119 V123A E144A Q159N M260I 84 PhV–120 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S 84 PhV–121 S1–D2–T3Q A4G P5A A6D G7K F8M Q9K K12R D33M 84 K76N N78T V123A E144A G217S PhV–122 D33M K76N N78T V123A E144A G217S 84 PhV–123 D2E A4E A6S F8Y T121Q V123A E144A G152T G217S 82 N258D H261S Q270N PhV–124 D2E A4E A6S F8Y K76N N78T V123A E144A G217S Q270N 85 PhV–125 N92A E144A G217S 84 PhV–126 N92A E144A G217S M260I 84 PhV–127 V123A Q159N M260I 84 PhV–128 A4E A6S V123A E144A G217S 84 PhV–129 R67L V123A Q159N M260I 84 PhV–130 L16V V123A Q159N M260I 83 PhV–131 K12R V123A Q159N M260I 84 PhV–132 K12R L16V V123A E144A Q159N M260I 83 PhV–133 R67L E144A Q159N M260I 85 PhV–134 V123A Q159N A166E M260I 85 PhV–135 R67L Q159N A166E M260I 84 PhV–136 N92A Q159N A166E M260I 84 PhV–137 N92A V123A E144A Q159N A166E M260I D398E 83 PhV–138 Q159N A166E M260I D398E 84 PhV–139 V123A Q159N 84 PhV–140 K12R R67L 84 PhV–141 L16V R67L 84 PhV–142 R67L A166E 84 PhV–143 A166E I300L 84 PhV–144 I120L I300L 84 PhV–145 I120L L371A 84 PhV–146 R67L I120L A166E L371A 84 PhV–147 I120L I300L L371A 84

Determinación del perfil de pH

Para determinar el perfil de pH, un tampón de reacción modificado (acetato de Na 100 mM, glicina 100 mM, imidazol 100 mM, CaCl2 1 mM, 0,01 % de Tween 20), que se lleva a valores de pH en el intervalo de pH 1,5 – 7 usando ácido clorhídrico diluido, se utiliza para el ensayo de fitasa. Para determinar la actividad relativa, la actividad determinada a pH 5,5 se fija en 100 %. Los resultados se muestran en las tablas 2 y 3.

Tabla 2: Perfiles de pH de la fitasa HF598 y sus variantes. La fitasa se expresa en A. niger y se mide directamente en el sobrenadante del cultivo. La actividad de la fitasa se muestra en % como un valor relativo de la actividad determinada a pH 5,5 (véase la figura 2A).

pH

1,5

2

3

4

5,0

5,5

6

7,0

HF598 8 57 81 123 100 68 4 PhV–107 8 24 51 78 117 100 3 PhV–109 6 24 49 76 127 100 59 3 PhV–110 6 27 48 85 134 100 4 PhV–111 7 38 76 105 134 100 57 3 PhV–124 7 41 61 76 125 100 67 4 Tabla 3: perfiles de pH de algunas variantes de la fitasa. La fitasa se expresa en E. coli y se purifica mediante cromatografía de afinidad de Ni. La actividad de la fitasa se muestra en % como un valor relativo de la actividad determinada a pH 5,5 (véase la figura 2B).

pH

1,5

2

2,5

3

3,5

4

4,5

5

5,5

6

6,5

7

PhV–007 7 23 43 80 126 155 160 142 100 13 4 PhV–058 3 22 44 75 108 138 147 132 100 51 4 PhV–067 6 32 123 171 201 182 158 100 52 17 PhV–071 4 23 44 77 119 151 157 143 100 53 16 4 PhV–081 4 23 79 110 125 131 130 100 53 16 1

Determinación de la estabilidad a pH 2

Para determinar la estabilidad a pH 2, la muestra de fitasa se diluye en tampón (glicina 250 mM, 3 mg / ml de BSA, pH 2) a 30 U / ml. La muestra se incuba durante 30 minutos a 37 °C. Después, la muestra se diluye directamente con tampón de reacción (acetato de Na 250 mM, CaCl2 1 mM, 0,01 % de Tween 20, pH 5,5) al intervalo de medición óptimo de la determinación de la actividad fitasa (aprox. 0,6 U / ml) y se mide la actividad de fitasa. A modo de referencia, la muestra se incuba en paralelo durante 30 minutos a 37 °C en tampón de reacción a una concentración de 30 U / ml y también se analiza la actividad de fitasa. Las actividades de las muestras sometidas a estrés de pH estresadas se normalizan con el valor de referencia, que se establece como una estabilidad del 100 %. En el ensayo también se usa Natuphos® (BASF) a modo de comparación con una fitasa comercial.

Tabla 4: Determinación de la estabilidad a pH 2 de la fitasa HF598 y sus variantes y de la fitasa Fus5 # 2 y la fitasa comercial Natuphos®. Las muestras con una estabilidad de > 90 % se marcan como "estables". Para una mejor diferenciación gradual entre las muestras inestables, las estabilidades medidas se indican en %.

Fitasa

Estabilidad a pH 2

Natuphos® 65 % Fus5#2 SEC ID 18 estable Mutante Mutación HF598 SEC ID 24 estable PhV–056 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G152T estable G217S Q276N N346G PhV–057 S1– D2– T3Q A4G P5A A6D G7K F8M Q9K K12R D33M estable K76N N78T Q109N V123A E144A G217S Q276N I300L N346G PhV–058 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S estable (continuación)

Fitasa

Estabilidad a pH 2

PhV–059 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S estable D398E PhV–067 S1– D2– T3Q A4G P5A A6D G7K F8M Q9K K12R D33N estable K76N N78T N92A E144A G152T G217S PhV–071 S1A D2S T3R A4N P5A A6D G7K F8M Q9K K12R D33N estable K76N N78T V123A E144A G152T G217S PhV–081 D2E A4E A6S F8Y D33M K76N N78T E144A G217S D398E estable PhV–107 K76N N78T V123A E144A G152T G217S estable PhV–109 Q159N G217S estable PhV–110 V123A E144A Q159N M260I estable PhV–111 N92A V123A E144A Q159N M260I estable Determinación de la estabilidad a la pepsina Para determinar la estabilidad a la pepsina, la muestra de fitasa se diluya hasta 30 U / ml en tampón que comprende pepsina (glicina 250 mM, 3 mg / ml de BSA, pH 2, 10 mg / ml de pepsina (Sigma P-7000, 445 U / mg). La muestra se incuba durante 30 minutos a 37 °C. Después, la muestra se diluye directamente con tampón de reacción (acetato de Na 250 mM, CaCl2 1 mM, 0,01 % de Tween 20, pH 5,5) al intervalo de medición óptimo de la determinación de la actividad fitasa (aprox. 0,6 U / ml) y se determina la actividad de fitasa. A modo de referencia, la muestra se incuba en paralelo durante 30 minutos a 37 °C en tampón de reacción a pH 5,5 a una concentración de 30 U / ml y también se analiza la actividad de fitasa. Las actividades de las muestras previamente tratadas con pepsina se normalizan con el valor de referencia, que se establece como una estabilidad del 100 %. En el ensayo también se usó Natuphos® (Natuphos® 10000L, BASF SE) a modo de comparación con una fitasa comercial.

Tabla 5: Determinación de la estabilidad a la pepsina de la fitasa HF598 y sus variantes y de la fitasa Fus5 # 2 y la fitasa comercial Natuphos®. Las muestras con una estabilidad de > 80 % se marcan como "estables". Para una mejor diferenciación gradual entre las muestras inestables, las estabilidades medidas se indican en %.

Fitasa

Estabilidad a la pepsina

Natuphos® 20 % Fus5#2 SEC ID 18 1 % Mutante Mutación HF598 SEC ID 24 estable PhV–056 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G152T estable G217S Q276N N346G PhV–057 S1– D2– T3Q A4G P5A A6D G7K F8M Q9K K12R D33M estable K76N N78T Q109N V123A E144A G217S Q276N I300L N346G PhV–058 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S estable PhV–059 D2E A4E A6S F8Y D33M K76N N78T V123A E144A G217S estable D398E PhV–067 S1– D2– T3Q A4G P5A A6D G7K F8M Q9K K12R D33N estable K76N N78T N92A E144A G152T G217S PhV–071 S1A D2S T3R A4N P5A A6D G7K F8M Q9K K12R D33N estable K76N N78T V123A E144A G152T G217S PhV–081 D2E A4E A6S F8Y D33M K76N N78T E144A G217S D398E estable PhV–107 K76N N78T V123A E144A G152T G217S estable PhV–109 Q159N G217S estable PhV–110 V123A E144A Q159N M260I estable PhV–111 N92A V123A E144A Q159N M260I estable LISTADO DE SECUENCIAS <110> BASF SE <120> Variantes sintéticas de fitasa <130> PF 72013 <140> PCT/US <141> <150> 61/477637 (Solicitud provisional de Estados Unidos) 11163410.1 (Solicitud de prioridad EP) <151> 21 de abril del 2011 <160> 26 <170> PatentIn versión 3.4 <210> 1 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Cebador <220> <221> misc_feature <222> (6)..(6) <223> n es a, c, g, o t <220> <221> misc_feature <222> (9)..(9) <223> n es a, c, g, o t <400> 1 gayccnytnt tycaycc 17 <210> 2 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Cebador <220> <221> misc_feature <222> (3)..(3) <223> n es a, c, g, o t <220> <221> misc_feature <222> (12)..(12) <223> n es a, c, g, o t <400> 2 ggngtrttrt cnggytg 17 <210> 3 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Cebador <220> <221> misc_feature <222> (9)..(9) <223> n es a, c, g, o t <400> 3 gcdatrttng trtcrtg 17 <210> 4 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Cebador <220> <221> misc_feature <222> (5)..(5) <223> n es a, c, g, o t <220> <221> misc_feature <222> (10)..(10) <223> n es a, c, g, o t <220> <221> misc_feature <222> (13)..(13) <223> n es a, c, g, o t <400> 4 wcagntgwtn gtnctg 16 <210> 5 <211> 26 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 5 cttcgagagc cactttatta ccgtcg 26 <210> 6 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 6 ccaatgttgt gctgctgaca atagg 25 <210> 7 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 7 ccgaactcat cagcgctaaa gatgc 25 <210> 8 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Cebador <220> <221> misc_feature <222> (8)..(8) <223> n es a, c, g, o t <400> 8 cawcgwcnga sasgaa 16 <210> 9 <211> 26 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 9 cgcagtttga cttgatgtcg cgcacg 26 <210> 10 <211> 26 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 10 gtcgcgcacg ccctatatcg ccaagc 26 <210> 11 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Cebador <400> 11 ctgcaaacca tcgcacacgc actgg 25 <210> 12 <211> 1341 <212> ADN <213> Hafnia sp.

<220> <221> sig_peptide <222> (1)..(99) <400> 12 <210> 13 <211> 446 <212> PRT <213> Hafnia sp.

<220> <221> SEÑAL <222> (1)..(33) <400> 13 <210> 14 <211> 1074 <212> ADN <213> Hafnia sp.

<400> 14 <210> 15 <211> 270 <212> ADN <213> Yersinia mollaretii

<400> 15 <210> 16 <211> 1344 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <220> <221> sig_peptide <222> (1)..(99) <400> 16 <210> 17 <211> 447 <212> PRT <213> Secuencia artificial <220> <223> construcción sintética <220> <221> SEÑAL <222> (1)..(33) <400> 17 <210> 18 <211> 414 <212> PRT <213> Secuencia artificial <220> <223> proteína quimérica <400> 18 <210> 19 <211> 1245 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <400> 19 <210> 20 <211> 6729 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <400> 20 <210> 21 <211> 46 <212> ADN <213> Secuencia artificial <220> <223> cebador <400> 21 ctatggatcc gcatcatcat catcatcaca gtgataccgc ccctgc 46 <210> 22 <211> 6738 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <400> 22 <210> 23 <211> 10331 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <400> 23 <220> <223> construcción sintética <400> 24 <210> 25 <211> 1245 <212> ADN <213> Secuencia artificial <220> <223> gen sintético adaptado para el uso de codones de Aspergillus niger

<400> 25 <210> 26 <211> 10331 <212> ADN <213> Secuencia artificial <220> <223> construcción sintética <400> 26

REIVINDICACIONES

1. Una fitasa que tiene una secuencia de aminoácidos con una identidad de al menos 85 % con la secuencia de aminoácidos de la SEC ID 24.

2. La fitasa sintética de acuerdo con la reivindicación 1, que tiene una secuencia de aminoácidos con una identidad de al menos 90 %, preferentemente de 94 % y en particular de 95, 96, 97, 98 or 99 % con la secuencia de aminoácidos de la SEC ID 24.

3. La fitasa de acuerdo con la reivindicación 1 o 2, que tiene al menos un intercambio de aminoácidos conservador en al menos una posición en comparación con una fitasa de acuerdo con la reivindicación 1.

4. La fitasa de acuerdo con cualquiera de las reivindicaciones precedentes, que es una fitasa aislada.

5. La fitasa según de acuerdo con cualquiera de las reivindicaciones precedentes, que tiene una estabilidad elevada a la pepsina, una termoestabilidad elevada y / o una actividad específica elevada en comparación con los dos fitasas de tipo salvaje de Yersinia mollaretii y Hafnia sp.

6. Una secuencia de ácido nucleico aislada, que codifica una fitasa, que codifica una de las fitasas de acuerdo con una cualquiera de las reivindicaciones 1 a 5.

7. Una secuencia de ácido nucleico aislada, que codifica una fitasa, que a) tiene al menos una identidad del 85 % con la secuencia de ácido nucleico de la SEC ID 25, b) hibrida en condiciones altamente rigurosas con la hebra complementaria de una de las secuencias de a).

8. Un vector de expresión recombinante que comprende una secuencia de ácido nucleico de acuerdo con la reivindicación 6 o 7.

9. Una célula huésped recombinante que comprende una secuencia de ácido nucleico de acuerdo con la reivindicación 6 o 7 o el vector de acuerdo con la reivindicación 8.

10. Un organismo de producción no humano recombinante que comprende una secuencia de ácido nucleico de acuerdo con la reivindicación 6 o 7 o el vector de acuerdo con la reivindicación 8.

11. Un aditivo para alimento para animales que comprende al menos una de las fitasas de acuerdo con cualquiera de las reivindicaciones 1 a 5 y otros aditivos para alimentos para animales.

12. Un alimento para animales que comprende al menos una de las fitasas de acuerdo con cualquiera de las reivindicaciones 1 a 5.

13. El uso de una fitasa de acuerdo con cualquiera de las reivindicaciones 1 a 5, o del aditivo para alimentos para animales de acuerdo con la reivindicación 11, en un alimento para animales.

14. El uso de una fitasa de acuerdo con cualquiera de las reivindicaciones 1 a 5, del aditivo para alimentos para animales de acuerdo con la reivindicación 11, o del alimento para animales de acuerdo con la reivindicación 12 para reducir el contenido en fosfatos en el estiercol del ganado.

ES 2 553 458 T3