Derivados sustituidos de aminopropenil piperidina o morfolina como nuevos inhibidores de histona deacetilasa.

Un compuesto de fórmula (I),**Fórmula**

a las formas de N-óxido, a las sales de adición farmacéuticamente aceptables y a las formas estereoquímicamente isoméricas de los mismos, en los que

cada X es independientemente N o CH;

cada Y es independientemente O, CH o CH2, y cuando Y es CH, entonces el sustituyente está unido al átomo de Y de la estructura anular;

n es 0 o 1, y cuando n es 0, entonces está previsto un enlace directo;

R1 es fenilo, naftalenilo o heterociclilo; en el que

cada uno de dicho fenilo o naftalenilo está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo, hidroxi, ciano, amino, alquil C1-6-carbonilamino, alquil C1-6-sulfonilamino, hidroxicarbonilo, alquil C1-6- oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oximetilo, aminometilo, alquil C1-6-aminometilo, alquil C1-6- carbonilaminometilo, alquil C1-6-sulfonilaminometilo, aminosulfonilo, alquil C1-6-aminosulfonilo o heterociclilo; R2 es -CH2-R5, trifluorometilo, -C

(≥O)-R6, o -CH2-NR7R8; en el que

cada R5 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, piperazinilo, Nmetilpiperazinilo, morfolinilo, tiomorfolinilo, imidazolilo o triazolilo;

cada R6 se selecciona independientemente de hidroxi, alquil C1-6-oxi, amino o mono- o di(alquil C1-6)amino, cicloalquil C3-6-amino, piperazinilo, N-metilpiperazinilo, morfolinilo o tiomorfolinilo;

cada R7 y R8 se selecciona independientemente de hidrógeno, alquilo de C1-6, alquil C1-6-carbonilo, alquil C1-6-sulfonilo, o mono- o di(alquil C1-4)aminosulfonilo;

R3 es hidrógeno, alquilo de C1-6, ciano-alquilo de C1-4, alquil C1-6-oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oxi-alquilo de C1-6, cicloalquilo de C3-6, cicloalquil C3-6-alquilo de C1-6, aril-alquilo de C1-6, alquil C1-6- carbonilo, alquil C1-6-sulfonilo;

R4 es hidroxi o un radical de fórmula (a-1)**Fórmula**

en la que

R9 es hidroxi o -NH2;

R10 es hidrógeno, tienilo, furanilo o fenilo, y cada tienilo, furanilo o fenilo puede estar opcionalmente sustituido con halo, amino, nitro, ciano, hidroxi, fenilo, alquilo de C1-6, (di-alquil C1-6)amino, alquil C1-6-oxi, fenil-alquil C1-6-oxi, hidroxi-alquilo de C1-6, alquil C1-6-oxicarbonilo, hidroxicarbonilo, alquil C1-6-carbonilo, polihalo-alquil C1-6-oxi, polihalo-alquilo de C1-6, alquil C1-6-sulfonilo, hidroxicarbonil-alquilo de C1-6, alquil C1-6- carbonilamino, aminosulfonilo, aminosulfonil-alquilo de C1-6, isoxazolilo, aminocarbonilo, fenil-alquenilo de C2-6, fenil-alquinilo de C3-6 o piridinil-alquinilo de C3-6; R11, R12 y R13 son cada uno independientemente hidrógeno, -NH2, nitro, furanilo, halo, alquilo de C1-6, alquil C1-6-oxi, trifluorometilo, tienilo, fenilo, alquil C1-6- carbonilamino, aminocarbonil-alquilo de C1-6 o -C≡C-CH2-R14;

en el que R14 es hidrógeno, alquilo de C1-6, hidroxi, amino o alquil C1-6-oxi; y

heterociclilo en lo anterior es furanilo, tienilo, pirrolilo, pirrolinilo, pirolidinilo, dioxolilo, oxazolilo, tiazolilo, imidazolilo, imidazolinilo, imidazolidinilo, pirazolilo, pirazolinilo, pirazolidinilo, isoxazolilo, isotiazolilo, oxadiazolilo, triazolilo, tiadiazolilo, piranilo, piridinilo, piperidinilo, dioxanilo, morfolinilo, ditianilo, tiomorfolinilo, piridazinilo, pirimidinilo, pirazinilo, piperazinilo, triazinilo, tritianilo, indolizinilo, indolilo, indolinilo, benzofuranilo, benzotiofenilo, indazolilo, bencimidazolilo, benztiazolilo, purinilo, quinolizinilo, quinolinilo, cinolinilo, ftlazinilo, quinazolinilo, quinoxalinilo o naftiridinilo; en el que

cada uno de dichos heterociclos está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, ciano, amino, mono- o di(alquil C1-4)- amino.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2006/062324.

Solicitante: JANSSEN PHARMACEUTICA N.V..

Nacionalidad solicitante: Bélgica.

Dirección: TURNHOUTSEWEG 30 2340 BEERSE BELGICA.

Inventor/es: PILATTE, ISABELLE, NOELLE, CONSTANCE, VAN BRANDT,SVEN FRANCISCUS ANNA, ANGIBAUD,PATRICK,RENE, MARCONNET-DECRANE,LAURENCE FRANÇOISE BERNADETTE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > A61P35/00 (Agentes antineoplásicos)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen ingredientes... > A61K31/505 (Pirimidinas; Pirimidinas hidrogenadas, p. ej. trimetoprima)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > COMPUESTOS HETEROCICLICOS (Compuestos macromoleculares... > Compuestos heterocíclicos que contienen a la vez... > C07D405/14 (que contienen tres o más heterociclos)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > COMPUESTOS HETEROCICLICOS (Compuestos macromoleculares... > Compuestos heterocíclicos que contienen dos o más... > C07D401/04 (directamente unidos por un enlace entre dos miembros cíclicos)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Derivados sustituidos de aminopropenil piperidina o morfolina como nuevos inhibidores de histona deacetilasa Esta invención se refiere a compuestos que tienen actividad enzimática inhibidora de histona desacetilasa (HDAC). También se refiere a procedimientos para su preparación, a composiciones que los comprenden, así como a su uso, tanto in vitro como in vivo, en un método para inhibir HDAC y como una medicina, por ejemplo como una medicina para inhibir afecciones proliferativas, tales como cáncer y psoriasis.

Se sabe que las histonas nucleares son componentes integrales y dinámicos de la maquinaria responsable de regular la transcripción génica y otros procesos en los que interviene el ADN como molde, tales como la replicación, reparación, recombinación, y segregación cromosómica. Son el objeto de modificaciones postraduccionales, incluyendo acetilación, fosforilación, metilación, ubiquitinación y ribosilación de ADP.

La(s) histona(s) desacetilasa(s), denominada(s) en este documento “HDACs”, son enzimas que catalizan la eliminación de la modificación de acetilo en restos de lisina de proteínas, incluyendo las histonas nucleosómicas nucleares H2A, H2B, H3 y H4. Junto con la(s) histona(s) acetiltransferasa(s), llamadas en este documento “HATs”, las HDACs regulan el nivel de acetilación de las histonas. El equilibrio de acetilación de las histonas nucleosómicas desempeña un papel importante en la transcripción de muchos genes. La hipoacetilación de histonas está asociada con la estructura de cromatina condensada que da como resultado la represión de la transcripción génica, mientras que las histonas acetiladas están asociadas con una estructura de cromatina más abierta y la activación de la transcripción.

Se han descrito once HDACs estructuralmente relacionadas, y se dividen en dos clases. Las HDACs clase I consisten en HDAC 1, 2, 3, 8 y 11, mientras que las HDACs clase II consisten en HDAC 4, 5, 6, 7, 9 y 10. Los miembros de una tercera clase de HDACs no están estructuralmente relacionados con las HDACs clase I y clase II. Las HDACs clase I/II funcionan por mecanismos dependientes del cinc, mientras que las HDACs clase III dependen de NAD.

Además de las histonas, otras proteínas también han sido sustrato para la acetilación, en particular factores de transcripción tales como p53, GATA-1 y E2F; receptores nucleares tales como el receptor de glucocorticoides, los receptores de tiroides, los receptores de estrógenos; y proteínas reguladoras del ciclo celular tales como pRb. La acetilación de proteínas se ha relacionado con la estabilización de proteínas, tal como la estabilización de p53, el reclutamiento de cofactores y la mayor unión al ADN. p53 es un supresor tumoral que puede inducir a la detención del ciclo celular o a la apoptosis como respuesta a una variedad de señales de estrés, tal como el daño al ADN. La diana principal para la detención de ciclo celular inducida por p53 parece ser el gen p21. Tras su activación por p53, p21 se ha identificado en virtud de su asociación con complejos de cinasas de ciclina/dependientes de ciclina que da como resultado la detención del ciclo celular tanto en las fases G1 como G2, su aumento durante la senectud, y su interacción con el antígeno nuclear de células proliferantes.

El estudio de inhibidores de las HDACs indica que desempeñan un papel importante en la detención del ciclo celular, la diferenciación celular, la apoptosis y la inversión de fenotipos transformados.

El inhibidor tricostatina A (TSA), por ejemplo, causa detención del ciclo celular tanto en la fase G1 como G2, invierte el fenotipo transformado de diferentes estirpes celulares, e induce diferenciación de células de leucemia de Friend y otras. Se ha dado a conocer que TSA (y el ácido suberoilanilidahidroxámico, SAHA) inhibe el crecimiento celular, induce la diferenciación terminal, y previene la formación de tumores en ratones (Finnin et al., Nature, 401: 188-193, 1999).

También se ha dado a conocer que la tricostatina A es útil en el tratamiento de fibrosis, por ejemplo fibrosis hepática y cirrosis hepática. (Geerts et al., solicitud de patente europea EP 0 827742, publicada el 11 de marzo de 1998).

El farmacóforo para los inhibidores de HDACs consiste en un dominio de unión a metal, que se interacciona con el sitio activo que contiene cinc de las HDAC, un dominio enlazador, y un dominio de reconocimiento de superficie o región de encaperuzamiento, que interacciona con restos en el borde del sitio activo.

También se ha dado a conocer que los inhibidores de las HDACs inducen la expresión del gen p21. La activación transcripcional del gen p21 por estos inhibidores está promovida por la remodelación de la cromatina, tras la acetilación de histonas H3 y H4 en la región del promotor de p21. Esta activación de p21 se produce de una manera independiente de p53, y de esto modo, los inhibidores de HDAC están operativos en células con genes p53 mutados, un sello distintivo de numerosos tumores.

Además, los inhibidores de HDACs pueden tener actividades indirectas tales como un aumento de las respuestas inmunes del hospedante y la inhibición de la angiogenesis tumoral, y de este modo pueden suprimir el crecimiento de tumores primarios e impedir la metástasis (Mai et al., Medicinal Research Reviews, 25: 261-309, 2005) En vista de lo anterior, los inhibidores de HDACs pueden tener un gran potencial en el tratamiento de enfermedades o afecciones de células proliferativas, incluyendo tumores con genes p53 mutados.

La solicitud de patente EP1472216, publicada el 14 de agosto de 2003, describe hidroxamatos bicíclicos como inhibidores de histona desacetilasa.

Las solicitudes de patente EP1485099, EP1485348, EP1485353, EP1485354, EP1485364, EP1485365, EP1485370, EP1485378, publicadas el 18 de septiembre de 2003, entre otras, describen ácidos piperazinilpirimidinilhidroxámicos sustituidos como inhibidores de histona desacetilasa; además, el documento EP1485365 describe R306465.

La solicitud de patente EP1492534, publicada el 9 de octubre de 2003, describe compuestos de ácido carbámico que comprenden un enlace de piperazina, como inhibidores de HDAC.

La solicitud de patente EP1495002, publicada el 23 de octubre de 2003, describe compuestos de piperazinil-fenil- benzamida sustituidos, como inhibidores de histona desacetilasa.

La solicitud de patente WO03/092686, publicada el 13 de noviembre de 2003, describe benzamidas como inhibidores de histona desacetilasa.

La solicitud de patente WO04/009536, publicada el 29 de enero de 2004, describe derivados que contienen un enlazador de alquilo entre el grupo arilo y el hidroxamato, como inhibidores de histona desacetilasa.

La solicitud de patente EP1525199, publicada el 12 de febrero de 2004, describe hidroxamatos bicíclicos sustituidos con (hetero)arilalquenilo, como inhibidores de histona desacetilasa.

La solicitud de patente EP1572626, publicada el 24 de junio de 2004, describe derivados de (2-amino-fenil)amida de ácidos arilencarboxílicos como agentes farmacológicos.

La solicitud de patente EP 1581484, publicada el 29 de julio de 2004, describe derivados de derivados de N-hidroxi- benzamida con actividad anti-inflamatoria y antitumoral.

La solicitud de patente EP 1585735, publicada el 29 de julio de 2004, describe derivados de aril hidroxamato sustituidos, como inhibidores de histona desacetilasa.

La solicitud de patente EP1592667, publicada el 19 de agosto de 2004, describe derivados de O-fenilendiaminas monoacilados como agentes farmacológicos.

La solicitud de patente EP1590340, publicada el 19 de agosto de 2004, describe derivados diaminofenilénicos como inhibidores de histona desacetilasa.

La solicitud de patente EP 1592665, publicada el 26 de agosto de 2004, describe derivados de benzamida como inhibidores de histona desacetilasa.

La solicitud de patente WO04/072047, publicada el 26 de agosto de 2004, describe indoles, bencimidazoles y naftimidazoles como inhibidores de histona desacetilasa.

La solicitud de patente EP1608628, publicada el 30 de septiembre de 2004, describe hidroxamatos enlazados a sistemas anulares heterocíclicos no aromáticos como inhibidores de histona desacetilasa.

La solicitud de patente EP1613622, publicada el 14 de octubre de 2004, describe derivados de oxima como inhibidores de histona desacetilasa.

La solicitud de patente EP1611088, publicada el 28 de octubre de 2004, describe derivados de hidroxamato como inhibidores de histona desacetilasa.

La solicitud de patente WO05/028447, publicada el 31 de marzo de 2005, describe bencimidazoles como inhibidores de histona desacetilasa.

Las solicitudes de patentes WO05/030704 y WO05/030705, publicadas el 7 de abril de 2005, describen benzamidas como inhibidores de histona desacetilasa.

La solicitud de patente WO05/040101, publicada el 6 de mayo de 2005, describe hidroxamatos conectados a acilurea y conectados a sulfonilurea como inhibidores de histona desacetilasa.

La solicitud de patente WO05/040161, también publicada el 6 de mayo de 2005, describe hidroxamatos enlazados a biarilo como inhibidores de histona desacetilasa.

La solicitud de patente WO05/075469, publicada el 18 agosto de 2005, describe ácidos tiazolilhidroxámicos y ácidos tiadiazolilhidroxámicos como inhibidores de histona desacetilasa.

La solicitud de patente WO05/086898, publicada el 22 de septiembre de 2005, describe ácidos hidroxámicos heteropentacíclicos como inhibidores de histona desacetilasa.

La solicitud de patente WO05/092899, publicada el 6 de octubre de 2005, describe alquenilbenzamidas como histona desacetilasas.

Los compuestos de la presente invención difieren de la técnica anterior en su estructura, en su actividad farmacológica y/o su potencia farmacológica.

El problema a resolver es proporcionar inhibidores de histona desacetilasas con actividad enzimática y celular elevadas que tengan mayor biodisponibilidad y/o potencia in vivo.

Los nuevos compuestos de la presente invención resuelven el problema descrito anteriormente. Los compuestos de la presente invención muestran una excelente actividad enzimática y celular inhibiendo histona desacetilasas. Tienen una alta capacidad para activar el gen p21, tanto a nivel celular como in vivo. Tienen un perfil farmacocinético deseable y pueden tener baja afinidad por las enzimas P450, lo que reduce el riesgo de la interacción adversa fármaco-fármaco, permitiendo también un margen de seguridad más amplio.

Las características ventajosas de los presentes compuestos son la estabilidad metabólica, la solubilidad y/o la capacidad de inducción de p21. Más en particular, los compuestos de la presente invención tienen mayores semividas en hepatocitos de rata, tienen una mayor solubilidad/estabilidad en disoluciones acuosas, y/o tienen mayores capacidades inductoras del promotor p21 in vivo.

Esta invención se refiere a compuestos de fórmula (I): a las formas de N-óxido, a las sales de adición farmacéuticamente aceptables y a las formas estereoquímicamente isoméricas de los mismos, en los que cada X es independientemente N o CH; cada Y es independientemente O, CH o CH2, y cuando Y es CH, entonces el sustituyente está unido al átomo de Y de la estructura anular; n es 0 o 1, y cuando n es 0, entonces está previsto un enlace directo; R1 es fenilo, naftalenilo o heterociclilo; en el que cada uno de dicho fenilo o naftalenilo está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo, hidroxi, ciano, amino, alquil C1-6-carbonilamino, alquil C1-6-sulfonilamino, hidroxicarbonilo, alquil C1-6- oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oximetilo, aminometilo, alquil C1-6-aminometilo, alquil C1-6- carbonilaminometilo, alquil C1-6-sulfonilaminometilo, aminosulfonilo, alquil C1-6-aminosulfonilo o heterociclilo; R2 es -CH2-R5, trifluorometilo, -C(=O)-R6, o -CH2-NR7R8; en el que cada R5 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, piperazinilo, N- metilpiperazinilo, morfolinilo, tiomorfolinilo, imidazolilo o triazolilo; cada R6 se selecciona independientemente de hidroxi, alquil C1-6-oxi, amino o mono- o di(alquil C1-6)amino, cicloalquil C3-6-amino, piperazinilo, N-metilpiperazinilo, morfolinilo o tiomorfolinilo; cada R7 y R8 se selecciona independientemente de hidrógeno, alquilo de C1-6, alquil C1-6-carbonilo, alquil C1-6-sulfonilo, o mono- o di(alquil C1-4)aminosulfonilo; R3 es hidrógeno, alquilo de C1-6, ciano-alquilo de C1-4, alquil C1-6-oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oxi-alquilo de C1-6, cicloalquilo de C3-6, cicloalquil C3-6-alquilo de C1-6, aril-alquilo de C1-6, alquil C1-6- carbonilo, alquil C1-6-sulfonilo; R4 es hidroxi o un radical de fórmula (a-1) en la que R9 es hidroxi o -NH2; R10 es hidrógeno, tienilo, furanilo o fenilo, y cada tienilo, furanilo o fenilo puede estar opcionalmente sustituido con halo, amino, nitro, ciano, hidroxi, fenilo, alquilo de C1-6, (di-alquil C1-6)amino, alquil C1-6-oxi, fenil-alquil C1-6-oxi, hidroxi-alquilo de C1-6, alquil C1-6-oxicarbonilo, hidroxicarbonilo, alquil C1-6-carbonilo, polihalo-alquil C1-6-oxi, polihalo-alquilo de C1-6, alquil C1-6-sulfonilo, hidroxicarbonil-alquilo de C1-6, alquil C1-6- carbonilamino, aminosulfonilo, aminosulfonil-alquilo de C1-6, isoxazolilo, aminocarbonilo, fenil-alquenilo de C2-6, fenil-alquinilo de C3-6 o piridinil-alquinilo de C3-6; R11, R12 y R13 son cada uno independientemente hidrógeno, -NH2, nitro, furanilo, halo, alquilo de C1-6, alquil C1-6-oxi, trifluorometilo, tienilo, fenilo, alquil C1-6- carbonilamino, aminocarbonil-alquilo de C1-6 o -C≡C-CH2-R14; en el que R14 es hidrógeno, alquilo de C1-6, hidroxi, amino o alquil C1-6-oxi; y heterociclilo en lo anterior es furanilo, tienilo, pirrolilo, pirrolinilo, pirolidinilo, dioxolilo, oxazolilo, tiazolilo, imidazolilo, imidazolinilo, imidazolidinilo, pirazolilo, pirazolinilo, pirazolidinilo, isoxazolilo, isotiazolilo, oxadiazolilo, triazolilo, tiadiazolilo, piranilo, piridinilo, piperidinilo, dioxanilo, morfolinilo, ditianilo, tiomorfolinilo, piridazinilo, pirimidinilo, pirazinilo, piperazinilo, triazinilo, tritianilo, indolizinilo, indolilo, indolinilo, benzofuranilo, benzotiofenilo, indazolilo, bencimidazolilo, benztiazolilo, purinilo, quinolizinilo, quinolinilo, cinolinilo, ftlazinilo, quinazolinilo, quinoxalinilo o naftiridinilo; en el que cada uno de dichos heterociclos está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, ciano, amino, mono- o di(alquil C1-4)- amino.

Las líneas dibujadas en los sistemas anulares a partir de sustituyentes indican que el enlace puede unirse a cualquiera de los átomos anulares adecuados del sistema anular.

La expresión “inhibidor de histona desacetilasas” o “inhibidor de histona desacetilasa” se usa para identificar un compuesto, que es capaz de interaccionar con una histona desacetilasa e inhibir su actividad, más particularmente su actividad enzimática. Inhibir la actividad enzimática de histona desacetilasa significa reducir la capacidad de una histona desacetilasa para eliminar un grupo acetilo de una histona. Preferiblemente, tal inhibición es específica, es decir, el inhibidor de histona desacetilasa reduce la capacidad de una histona desacetilasa para eliminar un grupo acetilo de una histona a una concentración que es inferior a la concentración del inhibidor que se requiere para producir algún otro efecto biológico no relacionado.

Tal como se usa en las definiciones anteriores y en lo sucesivo en el presente documento, halo es genérico para fluoro, cloro, bromo y yodo; alquilo de C1-4 define radicales hidrocarbonados saturados, de cadena lineal o ramificada que tienen de 1 a 4 átomos de carbono, tales como, por ejemplo, metilo, etilo, propilo, butilo, 1-metiletilo, 2- metilpropilo y similares; alquilo de C1-6 incluye alquilo de C1-4 y sus homólogos superiores que tienen 5 a 6 átomos de carbono, tales como, por ejemplo, pentilo, 2-metilbutilo, hexilo, 2-metilpentilo y similares; polihalo-alquilo de C1-6 define alquilo de C1-6 que contiene tres sustituyentes halo idénticos o diferentes, por ejemplo trifluorometilo; cicloalquilo de C3-6 incluye grupos hidrocarbonados cíclicos que tienen de 3 a 6 carbonos, tales como ciclopropilo, ciclobutilo, ciclopentilo, ciclopentenilo, ciclohexilo y similares, y arilo es fenilo, o fenilo sustituido con uno o más sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, trifluorometilo, ciano o hidroxicarbonilo.

Las sales de adición farmacéuticamente aceptables abarcan sales de adición de ácidos farmacéuticamente aceptables y sales de adición de bases farmacéuticamente aceptables. Las sales de adición de ácidos farmacéuticamente aceptables, como se mencionó anteriormente en el presente documento, pretenden comprender las formas de sales de adición de ácidos no tóxicas terapéuticamente activas que pueden formar los compuestos de fórmula (I). Los compuestos de fórmula (I) que tienen propiedades básicas pueden convertirse en sus sales de adición de ácidos farmacéuticamente aceptables tratando dicha forma de base con un ácido apropiado. Los ácidos apropiados comprenden, por ejemplo, ácidos inorgánicos tales como ácidos halohídricos, por ejemplo ácido clorhídrico o bromhídrico; ácidos sulfúrico; nítrico; fosfórico y similares; o ácidos orgánicos tales como, por ejemplo, ácidos acético, trifluoroacético, propanoico, hidroxiacético, láctico, pirúvico, oxálico, malónico, succínico (es decir, ácido butanodioico), maleico, fumárico, málico, tartárico, cítrico, metanosulfónico, etanosulfónico, bencenosulfónico, p-toluenosulfónico, ciclámico, salicílico, p-amino-salicílico, pamoico y similares.

Los compuestos de fórmula (I) que tienen propiedades ácidas pueden convertirse en sus sales de adición de bases farmacéuticamente aceptables tratando dicha forma de ácido con una base orgánica o inorgánica adecuada. Las formas de sales de bases apropiadas comprenden, por ejemplo, las sales de amonio, las sales de metal alcalino y alcalino-térreo, por ejemplo las sales de litio, sodio, potasio, magnesio, calcio y similares, sales con bases orgánicas, por ejemplo la benzatina, N-metil-D-glucamina, sales de hidrabamina, y sales con aminoácidos tales como, por ejemplo, arginina, lisina y similares.

La expresión “sales de adición de ácidos o bases” también comprende los hidratos y las formas de adición de disolvente que pueden formar los compuestos de fórmula (I). Ejemplos de tales formas son, por ejemplo, hidratos, alcoholatos y similares.

La expresión “formas estereoquímicamente isoméricas de compuestos de fórmula (I)”, tal como se usa en el presente documento, define todos los posibles compuestos constituidos por los mismos átomos enlazados mediante la misma secuencia de enlaces pero que tienen estructuras tridimensionales diferentes, que no son intercambiables, que pueden poseer los compuestos de fórmula (I). A menos que se mencione o indique lo contrario, la denominación química de un compuesto abarca la mezcla de todas las formas estereoquímicamente isoméricas posibles que puede poseer dicho compuesto. Dicha mezcla puede contener todos los diastereómeros y/o enantiómeros de la estructura molecular básica de dicho compuesto. Todas las formas estereoquímicamente isoméricas de los compuestos de fórmula (I), tanto en forma pura como en mezcla entre sí, pretenden estar abarcadas dentro del alcance de la presente invención.

Las formas de N-óxido de los compuestos de fórmula (I) pretenden comprender aquellos compuestos de fórmula (I) en los que uno o varios átomos de nitrógeno están oxidados para dar el denominado N-óxido, particularmente aquellos N-óxidos en los que uno o más de los nitrógenos de piperidina, piperazina o piridazinilo están N-oxidados.

Algunos de los compuestos de fórmula (I) también pueden existir en sus formas tautoméricas. Tales formas, aunque no se indican explícitamente en la fórmula anterior, pretenden incluirse dentro del alcance de la presente invención.

Siempre que se use en lo sucesivo en el presente documento, la expresión “compuestos de fórmula (I)” pretende incluir además las sales de adición farmacéuticamente aceptables y todas las formas estereoisoméricas.

Tal como se usa en el presente documento, las expresiones “histona desacetilasa” y “HDAC” pretender referirse a una cualquiera de una familia de enzimas que eliminan grupos acetilo de los grupos -amino de restos de lisina en el término N de una histona. A menos que se indique lo contrario por contexto, el término “histona” pretende referirse a cualquier proteína de histona, incluyendo H1, H2A, H2B, H3, H4 y H5, de cualquier especie. Las proteínas o productos génicos de HDAC humanos incluyen, pero no se limitan a, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10 y HDAC-11. La histona desacetilasa también puede derivarse a partir de una fuente protozoica o fúngica.

Un primer grupo de compuestos interesantes consiste en aquellos compuestos de fórmula (I) en los que se aplica una o más de las siguientes restricciones: a) cada X es N; b) cada Y es independientemente O o CH; c) R1 es fenilo o fenilo opcionalmente sustituido con alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo o halo, más particularmente fenilo sustituido con 4-fluoro; d) R2 es -CH2-R5 o -C(=O)-R6; e) cada R5 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, alquil C1-6-oxi-alquil C1-6- oxi, alquil C1-6-carboniloxi, N-metilpiperazinilo, morfolinilo, o imidazolilo; f) cada R6 se selecciona independientemente de alquil C1-6-amino, cicloalquil C1-6-amino, hidroxialquil C1-6- amino, di(alquil C1-6)aminoalquil C1-6-amino o morfolinilo; g) R3 es hidrógeno, alquil C1-6-carbonilo o alquil C1-6-sulfonilo.

h) R9 es -NH2; i) R10 es hidrógeno; o j) R11, R12 y R13 son cada uno independientemente hidrógeno.

Un segundo grupo de compuestos interesantes consiste en aquellos compuestos de fórmula (I) en los que se aplica una o más de las siguientes restricciones: a) cada X es N; b) cada Y es independientemente O o CH; c) R1 es fenilo; d) R2 es -CH2OH o metilo; e) R3 es hidrógeno, alquil C1-6-carbonilo o alquil C1-6-sulfonilo; f) R9 es -NH2; g) R10 es hidrógeno; o h) R11, R12 y R13 son cada uno independientemente hidrógeno.

Un tercer grupo de compuestos interesantes consiste en aquellos compuestos de fórmula (I) en los que se aplica una o más de las siguientes restricciones: a) cada X es N; b) cada Y es CH; c) n es 1; d) R1 es fenilo; e) R2 es -CH2-R5 o metilo; f) cada R5 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, o alquil C1-6-carboniloxi; g) R3 es hidrógeno o alquil C1-6-sulfonilo; o h) R4 es hidroxi.

Un cuarto grupo de compuestos interesantes consiste en aquellos compuestos de fórmula (I) en los que se aplica una o más de las siguientes restricciones: a) cada X es N; b) cada Y es CH; c) n es 1; d) R1 es fenilo; e) R2 es -CH2OH o metilo; f) R3 es hidrógeno o alquil C1-6-sulfonilo; o g) R4 es hidroxi.

Un grupo de compuestos preferidos consiste en aquellos compuestos de fórmula (I) en los que cada X es N; cada Y es independientemente O o CH; R1 es fenilo; R2 es -CH2OH o metilo; R3 es hidrógeno, alquil C1-6-carbonilo o alquil C1-6-sulfonilo; R9 es NH2; R10 es hidrógeno; y R11, R12 y R13 son cada uno independientemente hidrógeno.

Un grupo de compuestos más preferidos consiste en aquellos compuestos de fórmula (I) en los que cada X es N; cada Y es CH; n es 1; R1 es fenilo; R2 es -CH2OH o metilo; R3 es hidrógeno o alquil C1-6-sulfonilo; y R4 es hidroxi.

Los compuestos más preferidos son el compuesto nº 1 y el compuesto nº 8.

Los compuestos de fórmula (I) y sus sales farmacéuticamente aceptables y N-óxidos y sus formas estereoquímicamente isoméricas pueden prepararse de manera convencional. Los materiales de partida y algunos de los intermedios son compuestos conocidos y están comercialmente disponibles, o pueden prepararse según procedimientos de reacción convencionales generalmente conocidos en la técnica.

Algunos métodos de preparación se describirán más detalladamente en lo sucesivo en este documento. Otros métodos para obtener los compuestos finales de fórmula (I) se describen en los ejemplos.

Los compuestos de fórmula (I), en la que R4 es hidroxi, denominados en el presente documento compuestos de fórmula (I-a), se pueden preparar haciendo reaccionar un intermedio de fórmula (II) con un ácido apropiado, tal como, por ejemplo, ácido trifluoroacético. Dicha reacción se realiza en un disolvente apropiado, tal como, por ejemplo, metanol o diclorometano.

Los compuestos de fórmula (I), en la que R4 es un radical de fórmula (a-1) y R9 es NH2, denominados en el presente documento compuestos de fórmula (I-b), se pueden preparar haciendo reaccionar un intermedio de fórmula (III), en la que M representa hidrógeno o sodio o litio o un catión de metal alcalino: por ejemplo, sodio, con un intermedio de fórmula (IV) en presencia de reactivos apropiados tales como por ejemplo hexafluorofosfato de benzotriazol-1-iloxi- tris(pirrolidino)fosfonio (PyBOP). La reacción se puede llevar a cabo en presencia de una base, tal como trietilamina, en un disolvente apropiado, tal como una mezcla de diclorometano y tetrahidrofurano.

Los compuestos de fórmula (I-b) también se pueden preparar haciendo reaccionar un intermedio de fórmula (V) con un ácido apropiado, tal como, por ejemplo, ácido trifluoroacético. Dicha reacción se realiza en un disolvente apropiado, tal como, por ejemplo, metanol o diclorometano.

Los compuestos de fórmula (I), en la que R4 es un radical de fórmula (a-1) y R9 es hidroxi, denominados en el presente documento compuestos de fórmula (I-c), se pueden preparar haciendo reaccionar un intermedio de fórmula (VI) con fluoruro de tetrabutilamonio en un disolvente apropiado, tal como, por ejemplo, tetrahidrofurano. TBDMS, en el intermedio de fórmula (VI), significa terc-butil(dimetil)silanilo.

Los intermedios de fórmula (II) se pueden preparar haciendo reaccionar un intermedio de fórmula (III) con un intermedio de fórmula (VII) en presencia de reactivos apropiados tales como N’-(etilcarbonimidoil)-N,N-dimetil-1,3- propanodiamina, monohidrocloruro (EDC) y 1-hidroxi-1H-benzotriazol (HOBT). La reacción se puede llevar a cabo en presencia de una base tal como trietilamina, en un disolvente adecuado, tal como una mezcla de diclorometano y tetrahidrofurano.

Los intermedios de fórmula (III) se pueden preparar haciendo reaccionar un intermedio de fórmula (VIII) con una disolución ácida apropiada, por ejemplo ácido clorhídrico, o disolución básica, por ejemplo hidróxido de litio o hidróxido de sodio, en un disolvente adecuado, por ejemplo un alcohol, tal como etanol o propanol.

La presente invención también se refiere a los compuestos de fórmula (VIII) a las formas de N-óxido, a las sales de adición farmacéuticamente aceptables y a las formas estereoquímicamente isoméricas de los mismos, en los que cada X es independientemente N o CH; cada Y es independientemente O, CH o CH2, y cuando Y es CH, entonces el sustituyente está unido al átomo de Y de la estructura anular; n es 0 o 1, y cuando n es 0, entonces está previsto un enlace directo; R1 es fenilo, naftalenilo o heterociclilo; en el que cada uno de dicho fenilo o naftalenilo está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo, hidroxi, ciano, amino, alquil C1-6-carbonilamino, alquil C1-6-sulfonilamino, hidroxicarbonilo, alquil C1-6- oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oximetilo, aminometilo, alquil C1-6-aminometilo, alquil C1-6- carbonilaminometilo, alquil C1-6-sulfonilaminometilo, aminosulfonilo, alquil C1-6-aminosulfonilo o heterociclilo; R2 es -CH2-R4, trifluorometilo, -C(=O)-R5, o -CH2-NR6R7; en el que cada R4 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, piperazinilo, N- metilpiperazinilo, morfolinilo, tiomorfolinilo, imidazolilo o triazolilo; cada R5 se selecciona independientemente de hidroxi, alquil C1-6-oxi, amino o mono- o di(alquil C1-6)amino, cicloalquil C1-6-amino, piperazinilo, N-metilpiperazinilo, morfolinilo o tiomorfolinilo; cada R6 y R7 se selecciona independientemente de hidrógeno, alquilo de C1-6, alquil C1-6-carbonilo, alquil C1-6-sulfonilo, o mono- o di(alquil C1-4)aminosulfonilo; R3 es hidrógeno, alquilo de C1-6, ciano-alquilo de C1-4, alquil C1-6-oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oxi-alquilo de C1-6, cicloalquilo de C3-6, cicloalquil C3-6-alquilo de C1-6, aril-alquilo de C1-6, alquil C1-6- carbonilo, alquil C1-6-sulfonilo; y heterociclilo en lo anterior furanilo, tienilo, pirrolilo, pirrolinilo, pirolidinilo, dioxolilo, oxazolilo, tiazolilo, imidazolilo, imidazolinilo, imidazolidinilo, pirazolilo, pirazolinilo, pirazolidinilo, isoxazolilo, isotiazolilo, oxadiazolilo, triazolilo, tiadiazolilo, piranilo, piridinilo, piperidinilo, dioxanilo, morfolinilo, ditianilo, tiomorfolinilo, piridazinilo, pirimidinilo, pirazinilo, piperazinilo, triazinilo, tritianilo, indolizinilo, indolilo, indolinilo, benzofuranilo, benzotiofenilo, indazolilo, bencimidazolilo, benztiazolilo, purinilo, quinolizinilo, quinolinilo, cinolinilo, ftlazinilo, quinazolinilo, quinaxolinilo o naftiridinilo; en el que cada uno de dichos heterociclos está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, ciano, amino, o mono- o di(alquil C1-4)- amino.

Pueden definirse grupos de compuestos interesantes, preferidos, más preferidos y los más preferidos para los compuestos de fórmula (V), según los grupos definidos para los compuestos de fórmula (I).

Los nuevos intermedios de fórmula (VIII) se pueden preparar: convirtiendo los intermedios de fórmula (VIII), en los que R2 es -CH2OH, denominados en este documento intermedios de fórmula (VIII-a), en los intermedios de fórmula (VIII), en los que R2 es distinto a -CH2OH, denominados en este documento intermedios de fórmula (VIII-b), mediante reacciones conocidas en la técnica o transformaciones de grupos funcionales. Por ejemplo, los alcoholes de fórmula (VIII-a) se pueden convertir en aminas, ésteres y éteres. Las aminas primarias se pueden convertir en aminas secundarias o terciarias, y/o las aminas primarias y/o secundarias se pueden convertir en amidas.

Los nuevos intermedios de fórmula (VIII), en los que R2 es -CH2OH y R3 es hidrógeno, denominados en el presente documento intermedios de fórmula (VIII-c), se pueden preparar en una sola etapa haciendo reaccionar el intermedio de fórmula (IX) con 1,4-dioxano-2,5-diol y el ácido borónico apropiado de fórmula (X), en el que R1 es como se define anteriormente, en un disolvente adecuado, por ejemplo un alcohol, tal como el etanol.

Los nuevos intermedios de fórmula (VIII), en los que R2 es distinto de -CH2OH y R3 es hidrógeno, denominados en el presente documento intermedios de fórmula (VIII-d), se pueden preparar haciendo reaccionar los intermedios de fórmula (IX) con la cetona apropiada de fórmula (XI) en presencia de un reactivo apropiado, tal como tetraquis(etanolato)titanio o un borohidruro de sodio, en un disolvente adecuado, por ejemplo 1,2-dicloroetano.

Los intermedios de fórmula (IX), en los que Y es O, denominados en el presente documento intermedios de (IX-a), se pueden preparar haciendo reaccionar un intermedio de fórmula (XII) con un ácido apropiado, tal como, por ejemplo, ácido trifluoroacético. Dicha reacción se realiza en un disolvente apropiado, tal como, por ejemplo, metanol o diclorometano.

Los intermedios de fórmula (XII) se pueden preparar haciendo reaccionar un intermedio de fórmula (XIII) con un intermedio de fórmula (XIV), en el que W es un grupo saliente apropiado tal como, por ejemplo, halo, por ejemplo cloro, o un radical sulfonilo tal como metilsulfonilo y similar. La reacción se puede llevar a cabo en un disolvente inerte para la reacción tal como, por ejemplo, N,N-dimetilformamida, nitrobenceno, acetonitrilo y similar. Se puede utilizar la adición de una base apropiada tal como, por ejemplo, un carbonato o hidrogenocarbonato de metal alcalino o alcalino-térreo, por ejemplo trietilamina o carbonato de sodio, para recoger el ácido que se libera durante el transcurso de la reacción. Para promover la reacción, se puede añadir una pequeña cantidad de un yoduro de metal apropiado, por ejemplo yoduro de sodio o de potasio. La agitación puede potenciar la velocidad de la reacción. La reacción se puede llevar a cabo convenientemente a una temperatura que oscila entre la temperatura ambiente y la temperatura de reflujo de la mezcla de reacción, y, si se desea, la reacción se puede llevar a cabo a una mayor presión.

De forma idéntica, los intermedios de fórmula (VIII) se pueden preparar haciendo reaccionar un intermedio de fórmula (VIII-d) con un intermedio de fórmula (XV) en el que W es un grupo saliente apropiado como se define anteriormente.

Los compuestos de fórmula (I) y algunos de los intermedios pueden tener al menos un centro estereogénico en su estructura. Este centro estereogénico puede estar presente en una configuración R o S.

Los compuestos de fórmula (I), según se preparan en los procedimientos descritos aquí anteriormente, son generalmente mezclas racémicas de enantiómeros, que se pueden separar entre sí siguiendo procedimientos de resolución conocidos por la técnica. Los compuestos racémicos de fórmula (I) se pueden convertir en las formas salinas diastereoméricas correspondientes mediante la reacción con un ácido quiral adecuado. Dichas formas salinas diastereoméricas se separan posteriormente, por ejemplo, por cristalización selectiva o fraccionada, y los enantiómeros se liberan de ella por un álcali. Una manera alternativa de separar las formas enantioméricas de los compuestos de fórmula (I) o de los intermedios de fórmula (V-b) implica la cromatografía de líquidos usando una fase estacionaria quiral. Dichas formas estereoquímicamente isoméricas puras también pueden obetenerse a partir de las formas estereoquímicamente isoméricas puras correspondientes de los materiales de partida apropiados, con la condición de que la reacción ocurra estereoespecíficamente. Preferiblemente, si se desea un estereoisómero específico, dicho compuesto se sintetizaría mediante métodos de preparación estereoespecíficos. Estos métodos emplearán ventajosamente materiales de partida enantioméricamente puros.

Los compuestos de fórmula (I), las sales de adición de ácidos farmacéuticamente aceptables y las formas estereoisoméricas de los mismos tienen propiedades farmacológicas valiosas por cuanto tienen un efecto inhibidor de histona desacetilasa (HDAC).

Se describe aquí un método para inhibir el crecimiento anómalo de células, incluyendo células transformadas, mediante la administración de una cantidad eficaz de un compuesto de la invención. El crecimiento anómalo de células se refiere al crecimiento celular independiente de mecanismos reguladores normales (por ejemplo pérdida de inhibición de contacto). Esto incluye la inhibición del crecimiento tumoral tanto directamente provocando detención del crecimiento, diferenciación terminal y/o apoptosis de células cancerosas, como indirectamente, inhibiendo la neovascularización de tumores.

Se describe aquí un método para inhibir el crecimiento tumoral mediante la administración de una cantidad eficaz de un compuesto de la presente invención, a un sujeto, por ejemplo un mamífero (y más particularmente un ser humano) que necesita dicho tratamiento. En particular, esta invención proporciona un método para inhibir el crecimiento de tumores mediante la administración de una cantidad eficaz de los compuestos de la presente invención. Ejemplos de tumores que pueden inhibirse son, pero no se limitan a, cáncer de pulmón (por ejemplo adenocarcinoma e incluyendo cáncer de pulmón no microcítico), cánceres pancreáticos (por ejemplo carcinoma pancreático, tal como, por ejemplo, carcinoma pancreático exocrino), cánceres de colon (por ejemplo carcinomas colorrectales, tales como, por ejemplo, adenocarcinoma de colon y adenoma de colon), cáncer de próstata, incluyendo la enfermedad avanzada, tumores hematopoyéticos de linaje linfoide (por ejemplo leucemia linfocítica aguda, linfoma de células B, linfoma de Burkitt), leucemias mieloides (por ejemplo, leucemia mielogenosa aguda (LMA)), cáncer folicular de tiroides, síndrome mielodisplásico (MDS), tumores de origen mesenquimatoso (por ejemplo fibrosarcomas y rabdomiosarcomas), melanomas, teratocarcinomas, neuroblastomas, gliomas, tumor benigno de la piel (por ejemplo queratoacantomas), carcinoma de mama (por ejemplo cáncer de mama avanzado), carcinoma de riñón, carcinoma de ovario, carcinoma de vejiga y carcinoma epidérmico.

El compuesto según la invención se puede usar para otros fines terapéuticos, por ejemplo: a) la sensibilización de tumores a radioterapia administrando el compuesto según la invención antes, durante o tras la irradiación del tumor para tratar el cáncer; b) tratar artropatías y estados osteopatológicos tales como artritis reumatoide, osteoartritis, artritis juvenil, gota, poliartritis, artritis psoriásica, espondilitis anquilosante y lupus eritematoso sistémico; c) inhibir la proliferación celular de músculo liso, incluyendo trastornos proliferativos vasculares, aterosclerosis y reestenosis; d) tratar patologías inflamatorias y patologías dérmicas tales como colitis ulcerosa, enfermedad de Crohn, rinitis alérgica, enfermedad de injerto frente a hospedante, conjuntivitis, asma, ARDS, enfermedad de Behcet, rechazo de trasplantes, urticaria, dermatitis alérgica, alopecia areata, escleroderma, exantema, eccema, dermatomiositis, acné, diabetes, lupus eritematoso sistémico, enfermedad de Kawasaki, esclerosis múltiple, enfisema, fibrosis cística y bronquitis crónica; e) tratar endometriosis, fibroides uterinos, sangrado uterino disfuncional e hiperplasia endometrial; f) tratar la vascularización ocular, incluyendo vasculopatía que afecta a los vasos retinianos y coroideos; g) tratar una disfunción cardiaca; h) inhibir estados inmunosupresores tales como el tratamiento de infecciones por VIH; i) tratar la disfunción renal; j) suprimir los trastornos endocrinos; k) inhibir la disfunción de gluconeogénesis; l) tratar una neuropatología, por ejemplo enfermedad de Parkinson, o una neuropatología que da como resultado un trastorno cognitivo, por ejemplo enfermedad de Alzheimer o enfermedades neuronales relacionadas con poliglutamina; m) tratar trastornos psiquiátricos, por ejemplo esquizofrenia, trastorno bipolar, depresión, ansiedad y psicosis; n) inhibir una patología neuromuscular, por ejemplo esclerosis lateral amiotrófica; o) tratar la atrofia muscular espinal; p) tratar otros estados patológicos susceptibles de tratamiento al potenciar la expresión de un gen; q) potenciar la terapia génica; r) inhibir la adipogénesis; s) tratar parasitosis tal como malaria.

Por tanto, la presente invención describe los compuestos de fórmula (I) para uso como medicamento, así como el uso de estos compuestos de fórmula (I) para la fabricación de un medicamento para tratar uno o más de los estados mencionados anteriormente.

Los compuestos de fórmula (I), las sales de adición de ácidos farmacéuticamente aceptables y las formas estereoisoméricas de los mismos pueden tener propiedades de diagnóstico valiosas por cuanto pueden usarse para detectar o identificar una HDAC en una muestra biológica, que comprende detectar o medir la formación de un complejo entre un compuesto marcado y una HDAC.

Los métodos de detección o identificación pueden usar compuestos que están marcados con agentes marcadores tales como radioisótopos, enzimas, sustancias fluorescentes, sustancias luminosas, etc. Los ejemplos de los radioisótopos incluyen 125I, 131I, 3H y 14C. Las enzimas habitualmente se hacen detectables mediante conjugación de un sustrato apropiado que, a su vez, cataliza una reacción detectable. Sus ejemplos incluyen, por ejemplo, beta- galactosidasa, beta-glucosidasa, fosfatasa alcalina, peroxidasa y malato deshidrogenasa, preferiblemente peroxidasa de rábano picante. Las sustancias luminosas incluyen, por ejemplo, luminol, derivados de luminol, luciferina, acuorina y luciferasa.

Las muestras biológicas pueden definirse como tejido corporal o fluidos corporales. Ejemplos de fluidos corporales son líquido cefalorraquídeo, sangre, plasma, suero, orina, esputo, saliva y similares.

En vista de sus propiedades farmacológicas útiles, los compuestos objeto pueden formularse en diversas formas farmacéuticas para fines de administración.

Para preparar las composiciones farmacéuticas de esta invención, una cantidad eficaz de un compuesto particular, en forma de sal de adición de ácidos o de bases, como ingrediente activo, se combina en mezcla íntima con un vehículo farmacéuticamente aceptable, pudiendo adoptar dicho vehículo una amplia variedad de formas dependiendo de la forma de preparación deseada para la administración. Estas composiciones farmacéuticas están de manera deseable en forma de dosificación unitaria adecuada, preferiblemente, para la administración por vía oral, por vía rectal, por vía percutánea o mediante inyección parenteral. Por ejemplo, en la preparación de las composiciones en forma de dosificación oral, puede emplearse cualquiera de los medios farmacéuticos habituales, tales como, por ejemplo, agua, glicoles, aceites, alcoholes y similares en el caso de preparaciones líquidas orales tales como suspensiones, jarabes, elixires y disoluciones; o vehículos sólidos tales como almidones, azúcares, caolín, lubricantes, aglutinantes, agentes disgregantes y similares en el caso de polvos, píldoras, cápsulas y comprimidos.

Debido a su facilidad de administración, los comprimidos y las cápsulas representan la forma de dosificación unitaria oral más ventajosa, en cuyo caso se emplean obviamente vehículos farmacéuticos sólidos. Para composiciones parenterales, el vehículo comprenderá habitualmente agua estéril, al menos en gran parte, aunque pueden incluirse otros ingredientes, para ayudar a la solubilidad por ejemplo. Pueden prepararse disoluciones inyectables, por ejemplo, en las que el vehículo comprende disolución salina, disolución de glucosa o una mezcla de disolución salina y disolución de glucosa. También pueden prepararse suspensiones inyectables, en cuyo caso pueden emplearse vehículos líquidos, agentes de suspensión y similares apropiados. En las composiciones adecuadas para administración percutánea, el vehículo comprende opcionalmente un agente potenciador de la penetración y/o un agente humectante adecuado, combinado opcionalmente con aditivos adecuados de cualquier naturaleza en proporciones menores, aditivos lo cuales no provocan un efecto perjudicial significativo a la piel. Dichos aditivos pueden facilitar la administración a la piel y/o pueden ser útiles para preparar las composiciones deseadas. Estas composiciones pueden administrarse de diversas maneras, por ejemplo como un parche transdérmico, como formulación de aplicación sobre una zona, o como pomada.

Es especialmente ventajoso formular las composiciones farmacéuticas mencionadas anteriormente en forma de dosificación unitaria por la facilidad de administración y uniformidad de la dosificación. Forma de dosificación unitaria, como se usa en la memoria descriptiva y las reivindicaciones en el presente documento, se refiere a unidades físicamente discretas adecuadas como dosificaciones unitarias, conteniendo cada unidad una cantidad predeterminada de ingrdiente activo, calculada para producir el efecto terapéutico deseado, en asociación con el vehículo farmacéutico requerido. Ejemplos de tales formas de dosificación unitarias son comprimidos (incluyendo comprimidos ranurados o recubiertos), cápsulas, píldoras, paquetes de polvo, obleas, disoluciones o suspensiones inyectables, cucharaditas, cucharadas y similares, y múltiples segregados de las mismas.

Los expertos en la técnica podrán determinar fácilmente la cantidad eficaz a partir de los resultados de ensayo presentados a continuación en el presente documento. En general, se contempla que una cantidad terapéuticamente eficaz sería de 0,005 mg/kg a 100 mg/kg de peso corporal, y en particular de 0,005 mg/kg a 10 mg/kg de peso corporal. Puede ser apropiado administrar la dosis requerida como dos, tres, cuatro o más subdosis en intervalos apropiados a lo largo del día. Dichas subdosis pueden formularse como formas de dosificación unitarias, por ejemplo, que contienen 0,5 a 500 mg, y en particular 10 mg a 500 mg de ingrediente activo por forma de dosificación unitaria.

Como otro aspecto de la presente invención, se prevé una combinación de un inhibidor de HDAC con otro agente contra el cáncer, especialmente para uso como medicamento, más específicamente en el tratamiento de cáncer o enfermedades relacionadas.

Para el tratamiento de los afecciones anteriores, los compuestos de la invención pueden emplearse ventajosamente en combinación con uno o más de otros agentes medicinales, más particularmente, con otros agentes contra el cáncer. Ejemplos de agentes contra el cáncer son: - compuestos de coordinación de platino, por ejemplo cisplatino, carboplatino u oxaliplatino; - compuestos de taxano, por ejemplo paclitaxel o docetaxel; - inhibidores de topoisomerasa I, tales como compuestos de camptotecina, por ejemplo irinotecán o topotecán; - inhibidores de topoisomerasa II, tales como derivados de podofilotoxina antitumorales, por ejemplo etopósido o tenipósido; - alcaloides de la vinca antitumorales, por ejemplo vinblastina, vincristina o vinorrelbina; - derivados de nucleósidos antitumorales, por ejemplo 5-fluorouracilo, gemcitabina o capecitabina; - agentes alquilantes, tales como mostaza de nitrógeno o nitrosourea, por ejemplo ciclofosfamida, clorambucilo, carmustina o lomustina; - derivados de antraciclina antitumorales, por ejemplo daunorrubicina, doxorrubicina, idarrubicina o mitoxantrona; - anticuerpos anti-HER2, por ejemplo trastuzumab; - antagonistas de receptores de estrógeno o moduladores de receptores de estrógeno selectivos, por ejemplo tamoxifeno, toremifeno, droloxifeno, faslodex o raloxifeno; - inhibidores de aromatasa, tales como exemestano, anastrozol, letrazol y vorozol; - agentes de diferenciación, tales como retinoides, vitamina D y agentes de bloqueo del metabolismo del ácido retinoico (RAMBA), por ejemplo acutano; - inhibidores de ADN metil transferasa, por ejemplo azacitidina; - inhibidores de cinasas, por ejemplo flavoperidol, mesilato de imatinib, o gefitinib; - inhibidores de farnesil transferasa; - otros inhibidores de HDAC; - inhibidores de la ruta ubiquitina-proteasoma, por ejemplo VeIcade; o - Yondelis.

La expresión “compuesto de coordinación de platino” se usa en el presente documento para indicar cualquier compuesto de coordinación de platino que inhibe el crecimiento de células tumorales, que proporciona platino en forma de un ion.

La expresión “compuestos de taxano” indica una clase de compuestos que tienen el sistema anular de taxano y relacionados con o derivados de extractos de determinadas especies de árboles de tejo (Taxus).

La expresión “inhibidores de topoisomerasa” se usa para indicar enzimas que son capaces de alterar la topología del ADN en células eucariotas. Son críticas para funciones celulares importantes y la proliferación celular. Existen dos clases de topoisomerasas en células eucariotas, a saber, tipo I y tipo II. La topoisomerasa I es una enzima monomérica de aproximadamente 100.000 de peso molecular. La enzima se une a ADN e introduce una ruptura monocatenaria transitoria, desenrolla la doble hélice (o le permite que se desenrolle) y posteriormente sella nuevamente la ruptura antes de disociarse de la hebra de ADN. La topoisomerasa II tiene un mecanismo de acción similar que implica la inducción de rupturas de hebras de ADN o la formación de radicales libres.

La expresión “compuestos de camptotecina” se usa para indicar compuestos que están relacionados con o derivan del compuesto de camptotecina original que es un alcaloide insoluble en agua derivado del árbol chino Camptothecin acuminata y el árbol indio Nothapodytes foetida.

La expresión “compuestos de podofilotoxina” se usa para indicar compuestos que están relacionados con o derivan de la podofilotoxina original, que se extrae de la planta de la mandrágora.

La expresión “alcaloides de la vinca antitumorales” se usa para indicar compuestos que están relacionados con o derivan de extractos de la planta vincapervinca (Vinca rosea).

La expresión “agentes alquilantes” abarca un grupo diverso de sustancias químicas que tienen la característica común de que tienen la capacidad de contribuir, en condiciones fisiológicas, con grupos alquilo a macromoléculas biológicamente vitales tales como ADN. Con la mayoría de los agentes más importantes tales como las mostazas de nitrógeno y las nitrosoureas, los restos alquilantes activos se generan in vivo tras reacciones degradativas complejas, algunas de las cuales son enzimáticas. Las acciones farmacológicas más importantes de los agentes alquilantes son las que alteran los mecanismos fundamentales relativos a la proliferación celular, en particular síntesis de ADN y división celular. La capacidad de los agentes alquilantes para interferir con la función y la integridad del ADN en tejidos que proliferan rápidamente proporciona la base para sus aplicaciones terapéuticas y para muchas de sus propiedades tóxicas.

La expresión “derivados de antraciclina antitumorales” comprende antibióticos obtenidos del hongo Strep. peuticus var. caesius y sus derivados, caracterizados porque tienen una estructura anular de tetraciclina con un azúcar no habitual, daunosamina, unido mediante un enlace glucosídico.

Se ha mostrado que la amplificación de la proteína del receptor 2 del factor de crecimiento epidérmico humano (HER 2) en carcinomas de mama primarios se correlaciona con un mal pronóstico clínico para determinados pacientes. El trastuzumab es un anticuerpo IgG1 kappa monoclonal humanizado derivado de ADN recombinante altamente purificado que se une con elevada afinidad y especificidad al dominio extracelular del receptor HER2.

Muchos cánceres de mama tienen receptores de estrógeno, y el crecimiento de estos tumores puede estimularse mediante estrógeno. Las expresiones “antagonistas de receptores de estrógeno” y “moduladores de receptores de estrógeno selectivos” se usan para indicar inhibidores competitivos de estradiol que se unen al receptor de estrógeno (ER). Los moduladores de receptores de estrógeno selectivos, cuando están unidos al ER, inducen un cambio en la forma tridimensional del receptor, modulando su unión al elemento sensible al estrógeno (ERE) en el ADN.

En mujeres posmenopáusicas, la fuente principal de estrógeno circulante procede de la conversión de andrógenos adrenales y ováricos (androstenodiona y testosterona) en estrógenos (estrona y estradiol) mediante la enzima aromatasa en tejidos periféricos. La privación de estrógeno a través de la inhibición o inactivación de aromatasa es un tratamiento eficaz y selectivo para algunas pacientes posmenopáusicas con cáncer de mama dependiente de hormonas.

La expresión “agente antiestrogénico” se usa en el presente documento para incluir no solo antagonistas de receptores de estrógeno y moduladores de receptores de estrógeno selectivos sino también inhibidores de aromatasa tal como se comentó anteriormente.

La expresión “agentes de diferenciación” abarca compuestos que pueden, de diversas maneras, inhibir la proliferación celular e inducir la diferenciación. Se sabe que la vitamina D y los retinoides desempeñan un papel importante en la regulación del crecimiento y la diferenciación de una amplia variedad de tipos celulares normales y malignos. Los agentes de bloqueo del metabolismo del ácido retinoico (RAMBA) aumentan los niveles de ácidos retinoicos endógenos inhibiendo el catabolismo de ácidos retinoicos mediado por citocromo P450.

Los cambios de metilación del ADN están entre las anomalías más comunes en la neoplasia humana. La hipermetilación dentro de los promotores de genes seleccionados está asociada habitualmente con la inactivación de los genes implicados. La expresión “inhibidores de ADN metil transferasa” se usa para indicar compuestos que actúan a través de la inhibición farmacológica de ADN metil transferasa y la reactivación de la expresión del gen oncosupresor.

La expresión “inhibidores de cinasas” comprende inhibidores de cinasas potentes que están implicados en la progresión del ciclo celular y la muerte celular programada (apoptosis).

La expresión “inhibidores de farnesil transferasa” se usa para indicar compuestos que se diseñaron para impedir la farnesilación de Ras y otras proteínas intracelulares. Se ha mostrado que tienen un efecto sobre la proliferación y supervivencia de células malignas.

La expresión “otros inhibidores de HDAC” comprende, pero no se limita a: - carboxilatos, por ejemplo butirato, ácido cinámico, 4-fenilbutirato o ácido valproico; - ácidos hidroxámicos, por ejemplo ácido suberoilanilidahidroxámico (SAHA), análogos de SAHA que contienen piperazina, hidroxamato de biarilo A-161906 y sus análogos de carbozolil éter, tetrahidropiridina y tetralona, aril-N- hidroxicarboxamidas bicíclicas, piroxamida, CG-1521, PXD-101, ácido sulfonamidahidroxámico, LAQ-824, tricostatina A (TSA), oxamflatina, scriptaid, moléculas tricíclicas relacionadas con scriptaid, ácido m-carboxicinámico, ácido bishidroxámico (CBHA), ácidos hidroxámicos similares a CBHA, análogo de ácido trapoxinhidroxámico, R306465 y ácidos benzoil y heteroarilhidroxámicos relacionados, aminosuberatos y malonildiamidas; -tetrapéptidos cíclicos, por ejemplo trapoxina, apidicina, depsipéptido, compuestos relacionados con espirucostatina, RedFK-228, tetrapéptidos cíclicos que contienen sulfhidrilo (SCOPs), tetrapéptidos cíclicos que contienen ácido hidroxámico (CHAPs), TAN-174s y azumamidas; - benzamidas, por ejemplo MS-275 o CI-994, o - depudecina.

La expresión “inhibidores de la ruta ubiquitina-proteasoma” se usa para identificar compuestos que inhiben la destrucción dirigida de proteínas celulares en el proteasoma, incluyendo proteínas reguladoras del ciclo celular.

Para el tratamiento de cáncer, los compuestos según la presente invención se pueden administrar a un paciente tal como se describió anteriormente, junto con irradiación. La irradiación significa radiación , y en particular radiación gamma, especialmente la emitida por aceleradores lineales o por radionúclidos que se usan de manera habitual hoy en día. La irradiación del tumor mediante radionúclidos puede ser externa o interna.

La presente invención también se refiere a una combinación de un agente contra el cáncer y un inhibidor de HDAC según la invención.

La presente invención también se refiere a una combinación según la invención para uso en terapia médica, por ejemplo para inhibir el crecimiento de células tumorales.

La presente invención también se refiere a una combinación según la invención para inhibir el crecimiento de células tumorales.

La presente invención también se refiere a un método para inhibir el crecimiento de células tumorales en un sujeto humano, que comprende administrar al sujeto una cantidad eficaz de una combinación según la invención.

Esta invención proporciona además un método para inhibir el crecimiento anómalo de células, incluyendo células transformadas, administrando una cantidad eficaz de una combinación según la invención.

El otro agente medicinal y el inhibidor de HDAC se pueden administrar simultáneamente (por ejemplo en composiciones separadas o unitarias) o secuencialmente en cualquier orden. En el último caso, los dos compuestos se administrarán dentro de un periodo y en una cantidad y manera que sea suficiente para asegurar que se logra un efecto ventajoso o sinérgico. Se apreciará que el método y el orden de administración preferidos y las cantidades y regímenes de dosificación respectivos para cada componente de la combinación dependerán del otro agente medicinal e inhibidor de HDAC que se esté administrando, su vía de administración, el tumor particular que se esté tratando y el hospedante particular que se esté tratando. El método y orden de administración óptimos y las cantidades y el régimen de dosificación pueden determinarse fácilmente por los expertos en la técnica usando métodos convencionales y en vista de la información expuesta en el presente documento.

El compuesto de coordinación de platino se administra ventajosamente en una dosificación de 1 a 500 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 50 a 400 mg/m2, particularmente para cisplatino en una dosificación de alrededor de 75 mg/m2 y para carboplatino en alrededor de 300 mg/m2 por ciclo de tratamiento.

El compuesto de taxano se administra ventajosamente en una dosificación de 50 a 400 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 75 a 250 mg/m2, particularmente para paclitaxel en una dosificación de alrededor de 175 a 250 mg/m2 y para docetaxel en alrededor de 75 a 150 mg/m2 por ciclo de tratamiento.

El compuesto de camptotecina se administra ventajosamente en una dosificación de 0,1 a 400 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 1 a 300 mg/m2, particularmente para irinotecán en una dosificación de alrededor de 100 a 350 mg/m2 y para topotecán en alrededor de 1 a 2 mg/m2 por ciclo de tratamiento.

El derivado de podofilotoxina antitumoral se administra ventajosamente en una dosificación de 30 a 300 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 50 a 250 mg/m2, particularmente para etopósido en una dosificación de alrededor de 35 a 100 mg/m2 y para tenipósido en alrededor de 50 a 250 mg/m2 por ciclo de tratamiento.

El alcaloide de la vinca antitumoral se administra ventajosamente en una dosificación de 2 a 30 mg por metro cuadrado (mg/m2) de área de superficie corporal, particularmente para vinblastina en una dosificación de alrededor de 3 a 12 mg/m2, para vincristina en una dosificación de alrededor de 1 a 2 mg/m2, y para vinorrelbina en dosificación de alrededor de 10 a 30 mg/m2 por ciclo de tratamiento.

El derivado de nucleósido antitumoral se administra ventajosamente en una dosificación de 200 a 2500 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 700 a 1500 mg/m2, particularmente para 5-FU en una dosificación de 200 a 500 mg/m2, para gemcitabina en una dosificación de alrededor de 800 a 1200 mg/m2, y para capecitabina en alrededor de 1000 a 2500 mg/m2 por ciclo de tratamiento.

Los agentes alquilantes tales como mostaza de nitrógeno o nitrosourea se administran ventajosamente en una dosificación de 100 a 500 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 120 a 200 mg/m2, particularmente para ciclofosfamida en una dosificación de alrededor de 100 a 500 mg/m2, para clorambucilo en una dosificación de alrededor de 0,1 a 0,2 mg/kg, para carmustina en una dosificación de alrededor de 150 a 200 mg/m2, y para lomustina en una dosificación de alrededor de 100 a 150 mg/m2 por ciclo de tratamiento.

El derivado de antraciclina antitumoral se administra ventajosamente en una dosificación de 10 a 75 mg por metro cuadrado (mg/m2) de área de superficie corporal, por ejemplo 15 a 60 mg/m2, particularmente para doxorrubicina en una dosificación de alrededor de 40 a 75 mg/m2, para daunorrubicina en una dosificación de alrededor de 25 a 45 mg/m2, y para idarrubicina en una dosificación de alrededor de 10 a 15 mg/m2 por ciclo de tratamiento.

El trastuzumab se administra ventajosamente en una dosificación de 1 a 5 mg por metro cuadrado (mg/m2) de área de superficie corporal, particularmente de 2 a 4 mg/m2 por ciclo de tratamiento.

El agente antiestrogénico se administra ventajosamente en una dosificación de alrededor de 1 a 100 mg diariamente dependiendo del agente particular y del estado que esté tratándose. El tamoxifeno se administra ventajosamente por vía oral en una dosificación de 5 a 50 mg, preferiblemente 10 a 20 mg dos veces al día, continuando la terapia durante tiempo suficiente para lograr y mantener un efecto terapéutico. El toremifeno se administra ventajosamente por vía oral en una dosificación de alrededor de 60 mg una vez al día, continuando la terapia durante tiempo suficiente para lograr y mantener un efecto terapéutico. El anastrozol se administra ventajosamente por vía oral en una dosificación de alrededor de 1 mg una vez al día. El droloxifeno se administra ventajosamente por vía oral en una dosificación de alrededor de 20-100 mg una vez al día. El raloxifeno se administra ventajosamente por vía oral en una dosificación de alrededor de 60 mg una vez al día. El exemestano se administra ventajosamente por vía oral en una dosificación de alrededor de 25 mg una vez al día.

Estas dosificaciones pueden administrarse, por ejemplo, una vez, dos veces o más por ciclo de tratamiento, que puede repetirse, por ejemplo, cada 7, 14, 21 o 28 días.

En vista de sus propiedades farmacológicas útiles, los componentes de las combinaciones según la invención, es decir, el otro agente medicinal y el inhibidor de HDAC, pueden formularse en diversas formas farmacéuticas para fines de administración. Los componentes pueden formularse por separado en composiciones farmacéuticas individuales o en una composición farmacéutica unitaria que contiene ambos componentes.

Por lo tanto, la presente invención también se refiere a una composición farmacéutica que comprende el otro agente medicinal y el inhibidor de HDAC junto con uno o más vehículos farmacéuticos.

La presente invención también se refiere a una combinación según la invención en forma de una composición farmacéutica que comprende un agente contra el cáncer y un inhibidor de HDAC según la invención junto con uno o más vehículos farmacéuticos.

La presente invención se refiere además al uso de una combinación según la invención en la fabricación de una composición farmacéutica para inhibir el crecimiento de células tumorales.

La presente invención se refiere además a un producto que contiene como primer ingrediente activo un inhibidor de HDAC según la invención y como segundo ingrediente activo un agente contra el cáncer, como una preparación combinada para uso simultáneo, separado o secuencial en el tratamiento de pacientes que sufren cáncer.

Parte experimental Los siguientes ejemplos se proporcionan para fines de ilustración.

Aquí en lo sucesivo, “DCM” se define como diclorometano, “DIPE” se define como éter diisopropílico, “EDC” se define como monohidrocloruro de N’-(etilcarbonimidoil)-N,N-dimetil-1,3-propanodiamina, “EtOAc” se define como acetato de etilo, “EtOH” se define como etanol, “HOBT” se define como 1-hidroxi-1H-benzotriazol, “MeOH” se define como metanol, “PyBOP” se define como fósforo(1+), (1-hidroxi-1H-benzotriazolato-O)tri-1-pirrolidinilo-, (T-4)-, hexafluorofosfato(1-), “TFA” se define como ácido trifluoroacético, y “THF” se define como tetrahidrofurano.

A. Preparación de los compuestos intermedios

Ejemplo A1

a) Preparación del intermedio 1 Una mezcla de éster etílico del ácido 2-(4-aminometil-piperidin-1-il)-pirimidin-5-carboxílico (0,003 moles), ácido (2- feniletenil)-borónico (0,003 moles) y 1,4-dioxano-2,5-diol (0,003 moles) en EtOH (40 ml) se agitó durante 2 días a temperatura ambiente, y después el disolvente se evaporó (vac.), produciendo el intermedio 1 (usado como tal en la siguiente etapa de reacción sin purificación adicional).

b) Preparación del intermedio 2 Una mezcla de intermedio 1 (0,0014 moles) en hidróxido de sodio 1N (10 ml) y THF (30 ml) se agitó a temperatura ambiente durante 48 horas. Se añadió ácido clorhídrico 1N (10 ml). El disolvente se evaporó, produciendo el intermedio 2 (usado como tal en la siguiente etapa de reacción sin purificación adicional).

c) Preparación del intermedio 3 Se añadieron trietilamina (0,0042 moles), N’-(etilcarbonimidoil)-N,N-dimetil-1,3-propanodiamina (0,0021 moles), 1- hidroxi-1H-benzotriazol (0,0021 moles) y O-(tetrahidro-2H-piran-2-il)-hidroxilamina (0,0021 moles) a una mezcla de intermedio 2 (0,0014 moles) en una mezcla de DCM (30 ml) y THF (30 ml), y después la mezcla de reacción se agitó durante 5 horas a 40ºC. Se añadió agua. La capa orgánica se separó, se secó (MgSO4), se separó por filtración, y el disolvente se evaporó. El residuo se purificó mediante cromatografía en columna (5 m) (eluyente en gradiente: DCM/MeOH/NH4OH 99/1/0,5 hasta 95/5/0,25). Las fracciones del producto se recogieron, y el disolvente orgánico se evaporó produciendo 0,03 g (4 %) de intermedio 3.

Ejemplo A2

a) Preparación del intermedio 4 Una disolución de éster etílico del ácido 2-metanosulfonil-pirimidin-5-carboxílico (0,0434 moles) en acetonitrilo se añade en nitrógeno a una disolución de 4-N-(tercbutoxicarbonil)aminopiperidina (0,0362 moles) y carbonato de potasio (0,0724 moles). La mezcla se agitó a temperatura ambiente durante 15 horas, y se vertió en hielo. El precipitado se filtró, se lavó con agua y con DIPE, y se secó produciendo 7,9 g de intermedio 4.

b) Preparación del intermedio 5 Se añadió ácido trifluoroacético (20 ml) a temperatura ambiente a una disolución de intermedio 4 (0,0225 moles) en DCM (110 ml). La mezcla se agitó a temperatura ambiente durante 15 horas, y después se evaporó hasta sequedad.

El residuo se recogió en EtOAc. Se añadió agua. Se añadió K2CO3. El EtOAc se evaporó. El precipitado se filtró, se lavó con agua, después con éter dietílico, y se secó. La mezcla se extrajo con DCM, la capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó, produciendo 2 g de intermedio 5.

c) Preparación del intermedio 6 Se añadieron ácido (2-feniletenil)-borónico (0,014 moles) y el intermedio 5 (0,014 moles) a una disolución de 1,4- dioxano-2,5-diol (0,014 moles) en EtOH (175 ml). La mezcla se agitó a temperatura ambiente durante 24 horas. El EtOH se evaporó. El residuo se recogió en DCM/H2O. Se añadió NaHCO3. La mezcla se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (6,6 g) se purificó mediante cromatografía en columna sobre gel de sílice (20-45 m) (eluyente: DCM/MeOH/NH4OH 98/2/0,1). Se recogieron tres fracciones, y el disolvente se evaporó, produciendo 1,5 g de intermedio 6.

d) Preparación del intermedio 7 Una mezcla de intermedio 6 (0,0037 moles) e hidróxido de litio monohidratado (0,0113 moles) en THF (50 ml) y agua (25 ml) se agitó a temperatura ambiente durante 48 horas. Se añadió ácido clorhídrico 1N (15 ml). La mezcla se evaporó hasta sequedad, produciendo el intermedio 7. Este producto se usó directamente en la siguiente etapa de reacción.

e) Preparación del intermedio 8.

Se añadieron a temperatura ambiente 1-hidroxi-1H-benzotriazol (0,0056 moles), después N’-(etilcarbonimidoil)-N,N- dimetil-1,3-propanodiamina (0,0056 moles) y O-(tetrahidro-2H-piran-2-il)-hidroxilamina (0,0056 moles) a una disolución de intermedio 7 (0,0037 moles) y trietilamina (0,0113 moles) en DCM/THF (200 ml) bajo un caudal de N2.

La mezcla se agitó a temperatura ambiente durante 3 horas, después se agitó a 45ºC durante 72 horas, se vertió en agua, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (2,4 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 94/6/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,43 g) se cristalizó en DIPE/2-propanona. El precipitado se separó por filtración y se secó, produciendo 0,19 g (11%) de intermedio 8.

Ejemplo A3

a) Preparación del intermedio 9 Se añadió etóxido de titanio (IV) (0,0052 moles) a temperatura ambiente a una disolución de éster etílico del ácido 2- (4-aminometil-piperidin-1-il)-pirimidin-5-carboxílico (0,0026 moles) y 4-fenil-3-buten-2-ona en 1,2-dicloro-etano (30 ml), bajo un caudal de N2. La mezcla se agitó a temperatura ambiente durante 48 horas. Se añadió triacetoxiborohidruro de sodio (0,0052 moles). La mezcla se agitó a temperatura ambiente durante 6 horas, se vertió en agua con hielo, y se filtró sobre celita. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (1 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 96/4/0,2). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,6 g) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo 0,545 g (53%) de intermedio 9, punto de fusión 79ºC.

b) Preparación del intermedio 10 Una mezcla de intermedio 9 (0,0012 moles) e hidróxido de sodio (0,0049 moles) en EtOH (50 ml) se agitó y se puso a reflujo durante 6 horas, después se enfrió hasta la temperatura ambiente, y el disolvente se evaporó hasta sequedad. El residuo se recogió en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,537 g (>100%) de intermedio 10, punto de fusión > 260ºC.

c) Preparación del intermedio 11 Se añadieron a temperatura ambiente 1-hidroxi-1H-benzotriazol (0,0028 moles), después N’-(etilcarbonimidoil)-N,N- dimetil-1,3-propanodiamina (0,0028 moles) a una disolución de intermedio 10 en THF (55 ml) y DCM (55 ml) bajo un caudal de N2. La mezcla se agitó a temperatura ambiente durante 30 minutos. Se añadió O-(tetrahidro-2H-piran-2-il)- hidroxilamina (0,0028 moles). La mezcla se agitó a temperatura ambiente durante 48 horas, se vertió en agua, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,8 g) se purificó mediante cromatografía en columna sobre gel de sílice (10 m) (eluyente: DCM/MeOH/NH4OH 95/5/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,295 g, 46%) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo 0,282 g (43%) de intermedio 11, punto de fusión 80ºC.

Ejemplo A4

a) Preparación del intermedio 12 Una disolución de cloruro de acetilo (0,0015 moles) en DCM (2 ml) se añadió gota a gota a una disolución de intermedio 9 y trietilamina (0,003 moles) en DCM (20 ml). La mezcla se enfrió hasta 5ºC bajo un caudal de N2, se agitó a 5ºC durante 30 minutos, después se agitó a temperatura ambiente durante 3 horas, se vertió en agua con hielo, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,43 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 98/2/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó, produciendo 0,38 g (86%) de intermedio 12.

b) Preparación del intermedio 13 Una mezcla de intermedio 12 (0,0008 moles) e hidróxido de sodio (0,0034 moles) en EtOH (40 ml) se agitó y se puso a reflujo durante 15 horas, y después se evaporó hasta sequedad, produciendo 0,37 g de intermedio 13. Esta fracción se usó directamente en la siguiente etapa de reacción.

c) Preparación del intermedio 14 Se añadieron a temperatura ambiente 1-hidroxi-1H-benzotriazol (0,0013 moles) y N’-(etilcarbonimidoil)-N,N-dimetil- 1,3-propanodiamina (0,0013 moles) a una disolución de intermedio 13 (0,0008 moles) y O-(tetrahidro-2H-piran-2-il)- hidroxilamina (0,0013 moles) en DCM/THF (50 ml/50 ml) bajo un caudal de N2. La mezcla se agitó a temperatura ambiente durante 5 días, se vertió en agua, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,79 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 99/1/0,5 hasta 92/8/0,5). Las fracciones puras se recogieron, y el disolvente se evaporó, produciendo 0,235 g (53%) de intermedio 14.

Ejemplo A5

a) Preparación del intermedio 15 Una disolución de éster etílico del ácido 2-(metilsulfonil)-5-pirimidincarboxílico (0,0118 moles) en acetonitrilo (30 ml) se añadió gota a gota a una disolución de éster 1,1-dimetiletílico del ácido (2-morfolinilmetil)-carbámico (0,0098 moles) y carbonato de potasio (0,0196 moles) en acetonitrilo (80 ml) bajo un caudal de N2. La mezcla se agitó a temperatura ambiente durante 12 horas, se vertió en agua, y se extrajo con EtOAc. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó hasta sequedad. El residuo (5,6 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-35 m) (eluyente: DCM/MeOH 99/1). Se recogieron dos fracciones, y el disolvente se evaporó. El residuo (0,75 g) se cristalizó en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,3 g de intermedio 15, punto de fusión 100ºC.

b) Preparación del intermedio 16 Se añadió TFA (7,5 ml) a 0ºC a una mezcla de intermedio 15 (0,037 moles) en DCM (150 ml). La mezcla se agitó a temperatura ambiente durante 48 horas. El disolvente se evaporó. Se añadió éter dietílico. El precipitado se separó por filtración y se secó, produciendo 13,5 g (96%) de intermedio 16, punto de fusión 180ºC.

c) Preparación del intermedio 17 Se añadió Intermedio 16 (0,0105 moles) a una disolución acuosa de carbonato de potasio al 10% (100 ml) en DCM (100 ml). La mezcla se agitó a temperatura ambiente durante 15 minutos, y después se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó, produciendo 2,6 g de intermedio 17.

d) Preparación del intermedio 18 Una mezcla de intermedio 17 (0,0093 moles), ácido [(1E)-2-feniletenil]-borónico (0,0031 moles) y 1,4-dioxano-2,5- diol (0,0031 moles) en EtOH (125 ml) se agitó a temperatura ambiente durante 4 días, y después se evaporó hasta sequedad. La mezcla se recogió en EtOAc. La mezcla se lavó con agua, y después con NaCl saturado. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (3,3 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 95/5/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,95 g) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo 0,3 g de intermedio 18, punto de fusión 146ºC.

e) Preparación del intermedio 19 Una mezcla de intermedio 18 (0,001 moles) e hidróxido de sodio (0,002 moles) en EtOH (10 ml) se agitó a 70ºC durante 6 horas, y después se evaporó hasta sequedad. El residuo se recogió en acetonitrilo varias veces, y después se evaporó hasta sequedad, produciendo el intermedio 19. Este producto se usó directamente en la siguiente etapa de reacción.

f) Preparación del intermedio 20 Se añadieron a temperatura ambiente HOBT (0,0025 moles) y después EDC (0,0025 moles) a una disolución de intermedio 19 (0,001 moles) y O-(tetrahidro-2H-piran-2-il)-hidroxilamina (0,0025 moles) en DCM-THF (100 ml) bajo un caudal de N2. La mezcla se agitó a temperatura ambiente durante 48 horas, se vertió en agua, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,65 g) se purificó mediante cromatografía en columna sobre gel de sílice (5 m) (eluyente: DCM/MeOH/NH4OH 98/2/0,2 hasta 90/10/1). Las fracciones puras se recogieron, y el disolvente se evaporó, produciendo 0,26 g (54%) de intermedio 20.

Ejemplo A6

a) Preparación del intermedio 21 Se añadió cloruro de metanosulfonilo (0,0012 moles) a temperatura ambiente a una disolución de intermedio 9 (0,0008 moles) y trietilamina (0,0025 moles) en DCM (20 ml) bajo un caudal de N2. La mezcla se agitó durante 15 horas. La capa orgánica se lavó con agua, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,5 g) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo 0,3 g (73%) de intermedio 21, punto de fusión 128ºC.

b) Preparación del intermedio 22 Una mezcla de intermedio 21 (0,0006 moles) e hidróxido de sodio (0,0025 moles) en EtOH (40 ml) se agitó y se puso a reflujo durante 15 horas, y después se evaporó hasta sequedad, produciendo el intermedio 22. Este producto se usó directamente en la siguiente etapa de reacción.

c) Preparación del intermedio 23 Se añadieron HOBT (0,0012 moles) y después EDC (0,0012 moles) a temperatura ambiente a una disolución de intermedio 22 (0,0006 moles) y O-(tetrahidro-2H-piran-2-il)-hidroxilamina (0,0012 moles) en DCM/THF (100 ml). La mezcla se agitó a temperatura ambiente durante 72 horas, se vertió en hielo, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (0,65 g) se purificó mediante cromatografía en columna sobre gel de sílice (10 m) (eluyente: DCM/MeOH/NH4OH 99/1/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó, produciendo 0,2 g (59%) de intermedio 23.

La Tabla F-1 enumera los intermedios que se prepararon en los Ejemplos anteriores.

Tabla F-1 (intermedios) (E); Interm. 1; Ej. [A1] (E); Interm. 6; Ej. [A2] (E); Interm. 9; Ej. [A3]; p.f. 79ºC (E); interm. 12; Ej. [A4]; B. Preparación de los compuestos finales

Ejemplo B1

Preparación del compuesto 1 Una mezcla de intermedio 3 (0,0002 moles) en TFA (0,47 ml) y MeOH (9,5 ml) se agitó a temperatura ambiente durante 48 horas, y después el disolvente se evaporó. El residuo se cristalizó en éter dietílico/MeOH. El precipitado se separó por filtración y se secó, produciendo 0,073 g (70%) de compuesto 1, punto de fusión 196ºC.

Ejemplo B2

Preparación del compuesto 2 Una mezcla de intermedio 8 (0,0003 moles) en ácido trifluoroacético (0,9 ml) y MeOH (18 ml) se agitó a temperatura ambiente durante 24 horas. El residuo (0,28 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/H2O 80/20/2). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,12 g) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo 0,11 g (73%) de compuesto 2, punto de fusión 109ºC.

Ejemplo B3

Preparación del compuesto 3 Una mezcla de intermedio 11 (0,0005 moles) en TFA (1 ml) y MeOH (30 ml) se agitó a temperatura ambiente durante 3 días, y después el disolvente se evaporó. El residuo se cristalizó en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,23 g (82%) de compuesto 3, punto de fusión 155ºC.

Ejemplo B4

Preparación del compuesto 4 Una mezcla de intermedio 14 (0,0005 moles) en TFA (1,15 ml) y MeOH (23 ml) se agitó a temperatura ambiente durante 24 horas, y después el disolvente se evaporó. El residuo se cristalizó en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,135 g (71%) de compuesto 4, punto de fusión 100ºC.

Ejemplo B5

Preparación del compuesto 5 Se añadieron PyBOP (0,004 moles), después trietilamina (0,008 moles) y después monohidrocloruro de 1,2- bencenodiamina (0,007 moles) a una disolución de intermedio 2 (0,002 moles) en DCM/THF (200 ml). La mezcla se agitó durante 48 horas, se vertió en agua, y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó. El residuo (4,4 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 93/7/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó.

El residuo (0,46 g) se cristalizó en EtOAc. El precipitado se separó por filtración y se secó, produciendo 0,13 g (14%) de compuesto 5, punto de fusión 178ºC.

Ejemplo B6

Preparación del compuesto 6 Se añadió TFA (1,3 ml) gota a gota a 5ºC a una disolución de intermedio 20 (0,0005 moles) en MeOH (26 ml). La mezcla se agitó a temperatura ambiente durante 48 horas, y después se evaporó hasta sequedad. El residuo (0,3 g) se purificó mediante cromatografía en columna sobre gel de sílice revestida con amino (25-40 m) (eluyente: DCM/MeOH/H2O 90/10/1). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,17 g) se cristalizó en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,145 g de compuesto 6, punto de fusión 111ºC.

Ejemplo B7

Preparación del compuesto 7 Se añadieron a temperatura ambiente PyBOP (0,0046 moles), después trietilamina (0,0091 moles) y después monohidrocloruro de 1,2-bencenodiamina (0,008 moles) a una disolución de intermedio 19 (0,0022 moles) en DCM/THF (50/50) (200 ml). La mezcla se agitó a temperatura ambiente, se vertió en agua y se extrajo con DCM. La capa orgánica se separó, se secó (MgSO4), se filtró, y el disolvente se evaporó hasta sequedad. El residuo (5 g) se purificó mediante cromatografía en columna sobre gel de sílice (15-40 m) (eluyente: DCM/MeOH/NH4OH 95/5/0,1). Las fracciones puras se recogieron, y el disolvente se evaporó. El residuo (0,19 g) se cristalizó en DIPE. El precipitado se separó por filtración y se secó, produciendo: 0,17 g (16%) de compuesto 7, punto de fusión 95ºC.

Ejemplo B8

Preparación del compuesto 8 Se añadió TFA (0,48ml) gota a gota a una disolución de intermedio 23 (0,0003 moles) en MeOH (19 ml). La mezcla se enfrió hasta 5ºC, después se agitó a temperatura ambiente durante 24 horas, y se evaporó hasta sequedad. El residuo se cristalizó en éter dietílico. El precipitado se separó por filtración y se secó, produciendo 0,11 g de compuesto 8, punto de fusión 110ºC.

La Tabla F-2 enumera los compuestos que se prepararon en los Ejemplos anteriores. En las tablas se usaron las siguientes abreviaturas: .C2HF3O2 representa la sal de trifluoroacetato.

Tabla F-2 (compuestos finales) (E) 1,1C2HF3O2 . 0,32 H2O; Co. nº 1; Ej. [B1]; p.f. 196ºC (E) .0,52 H2O; Co. nº 2; ej. [B2]; p.f. 109ºC (E) 1,12 C2HF3O2 ; Co. nº 3; ej. [B3]; p.f. 155ºC (E); Co. nº 4; ej. [B4]; p.f. 100ºC (E); Co. nº 5; ej. [B5]; p.f. 178ºC (E); Co. nº 6; ej. [B6]; p.f. 111ºC (E); Co. nº 7; ej. [B7]; p.f. 95ºC (E); Co. nº 8; ej. [B8]; p.f. 110ºC

C. Ejemplo farmacológico:

El ensayo in vitro para la inhibición de histona desacetilasa (véase el ejemplo C.1) mide la inhibición de actividad enzimática de HDAC obtenida con los compuestos de fórmula (I).

La actividad celular de los compuestos de fórmula (I) se determinó en células tumorales A2780 usando un ensayo colorimétrico para toxicidad o supervivencia celulares (Mosmann Tim, Journal of Immunological Methods 65: 55-63, 1983) (véase el ejemplo C.2).

La solubilidad de un compuesto mide la capacidad de un compuesto para permanecer en disolución. La solubilidad de un compuesto a diferentes pH se puede medir con el uso de un detector de nitrógeno quimioluminescente (véase el ejemplo C.3.b).

La permeabilidad de un fármaco expresa su capacidad para moverse desde un medio a otro o a través de otro. Expresamente, su capacidad para moverse a través de la membrana intestinal en el torrente sanguíneo y/o a partir del torrente sanguíneo hacia la diana. La permeabilidad (véase el ejemplo C.4) se puede medir por la formación de una bicapa fosfolipídica de membrana artificial inmovilizada en un filtro. En el ensayo de la membrana artificial inmovilizada en un filtro, se forma un “sandwich” con una placa de microtitulación de 96 pocillos y una placa de filtro de 96 pocillos, de manera que cada pocillo compuesto está dividido en dos cámaras con una disolución dadora en el fondo y una disolución aceptora encima, separadas por un disco de microfiltro de 125 m (poros 0,45 m), revestido con una disolución en dodecano al 2% (p/v) de dioleoilfosfatidil-colina, bajo condiciones en las que las bicapas multi- laminares forman dentro de los canales de filtro cuando el sistema se pone en contacto con una disolución tampón acuosa. La permeabilidad de los compuestos a través de esta membrana artificial se mide en cm/s. El objetivo es buscar la penetración de los fármacos a través de una membrana artificial paralela a 2 pH diferentes: 4,0 y 7,4. La detección del compuesto se hace con espectrometría de UV a una longitud de onda óptima entre 250 y 500 nm.

El metabolismo de los fármacos significa que un compuesto xenobiótico o endobiótico soluble en lípidos es transformado enzimáticamente en (a) metabolito(s) polar(es), soluble(s) en agua y excretable(s). El órgano principal para el metabolismo del fármaco es el hígado. Los productos metabólicos son a menudo menos activos que el fármaco progenitor o inactivo. Sin embargo, algunos metabolitos pueden tener mayor actividad o efectos tóxicos. Así, el metabolismo del fármaco puede incluir tanto procesos de “intoxicación” como de “desintoxicación”. Uno de los sistemas enzimáticos principales que determinan la capacidad del organismo en el manejo de fármacos y sustancias químicas se representa por las citocromo P450 monooxigenasas, que son enzimas dependientes del NADPH. La estabilidad metabólica de los compuestos puede ser determinada in vitro con el uso de tejido humano subcelular (véase el ejemplo C.5.a.). En este caso, la estabilidad metabólica de los compuestos se expresa como % del fármaco metabolizado después de una incubación durante 15 minutos de estos compuestos con microsomas. La cuantificación de los compuestos se determinó mediante análisis de LC-MS. La estabilidad metabólica de los compuestos también puede ser determinada calculando la semivida de los compuestos en hepatocitos de rata (véase el ejemplo C.5.b.).

Se ha demostrado que una amplia variedad de agentes antitumorales activa la proteína p21, incluyendo agentes que dañan el ADN e inhibidores de la histona desacetilasa. Los agentes que dañan el ADN activan el gen p21 a través del supresor tumoral p53, mientras que los inhibidores de histona desacetilasa activan transcripcionalmente el gen p21 vía el factor de transcripción Sp1. Así, los agentes que dañan el ADN activan al promotor p21 a través del elemento sensible a p53, mientras que los inhibidores de histona desacetilasa activan el promotor p21 a través de los sitios sp1 (localizados en la región de -60 bp a +40 bp con respecto a la caja TATA), conduciendo ambos a una mayor expresión de la proteína p21. Cuando el promotor p21 en unas células consiste en un fragmento promotor de 1300 pb de p21 que no comprende elementos sensibles a p53, no es, en consecuencia, sensible a los agentes que dañan el ADN. La capacidad de los compuestos para inducir p21 puede ser evaluada de varias maneras. Un primer método evalúa la capacidad de los compuestos para inducir p21 como consecuencia de la inhibición de HDAC a nivel celular. Las células pueden ser transfectadas establemente con un vector de expresión que contiene un fragmento promotor de 1300 pb de p21 que no comprende los elementos sensibles a p53, y en el que un aumento de la expresión del gen informador, comparado con los niveles de control, identifica si el compuesto tiene capacidad de inducción de p21. El gen informador es una proteína fluorescente, y la expresión del gen informador se mide como la cantidad de luz fluorescente emitida (véase el ejemplo C.6.a.). El segundo método es un método in vivo en el que se usan ratones para identificar la actividad farmacéutica de un compuesto. Las células tumorales establemente transformadas descritas anteriormente pueden ser administradas a ratones en una cantidad suficiente para efectuar la producción de un tumor. Después de que las células tumorales tengan el tiempo suficiente para formar un tumor, se puede administrar a los animales un compuesto potencialmente activo y se evalúa el efecto de dicho compuesto en las células tumorales midiendo la expresión del gen informador. La incubación con compuestos activos farmacéuticos dará como resultado un aumento de la expresión del gen informador comparado con los niveles control (véase el ejemplo C.6.b.) Los inhibidores de HDAC específicos no deberían de inhibir otras enzimas como las proteínas CYP P450 abundantes. Las proteínas CYP P450 (expresadas en E.coli) 3A4, 2D6 y 2C9 convierten sus sustratos específicos en una molécula fluorescente. La proteína CYP3A4 convierte 7-benciloxi-trifluorometil-cumarina (BFC) en 7-hidroxi- trifluorometil-cumarina. La proteína CYP2D6 convierte a 3-[2-(N,N-dietil-N-metilamino)etil-7-metoxi-4-metilcuramina (AMMC) en hidrocloruro de 3-[2-(N,N-dietilamino)etil-7-hidroxi-4-metilcumarina, y la proteína CYP2C9 convierte 7- metoxi-4-trifluorometil-cumarina (MFC) en 7-hidroxi-trifluorometil-cumarina. Los compuestos que inhiben la reacción enzimática darán como resultado una disminución de la señal fluoresente (véase el ejemplo C.7).

Ejemplo C.1.: Ensayo in vitro para inhibición de histona desacetilasa:

Se usó el ensayo de actividad fluorescente de HDAC/kit de detección de fármacos de Biomol (nº de cat. AK-500- 0001). El ensayo de actividad fluorescente de HDAC está basado en la combinación del sustrato Fluor de Lys (abreviatura de “Fluorogenic Histone deAcetilase Lysyl”) y revelador. El sustrato Fluor de Lys comprende una cadena lateral de lisina acetilada. La desacetilación del sustrato sensibiliza al sustrato de modo que, en la segunda etapa, el tratamiento con el revelador Fluor de Lys produce un fluoróforo.

Se incubaron extractos nucleares de HeLa (proveedor: Biomol) a 60 g/ml con 75 M de sustrato. El sustrato Fluor de Lys se añadió en un tampón que contenía Tris 25 mM, NaCl 137 mM, KCl 2,7 mM y MgCl2.6H2O 1 mM a pH 7,4.

Después de 30 minutos, se añadió 1 volumen del revelador. El fluoróforo se excitó con luz a 355 nm, y la luz emitida (450 nm) se detectó en un lector de placas fluorométrico.

Para cada experimento, se ejecutaron en paralelo controles (que contenían extracto nuclear de HeLa y tampón), una incubación en blanco (que contenía tampón pero nada de extracto nuclear de HeLa) y muestras (que contenían compuesto disuelto en DMSO y diluido adicionalmente en tampón, y extracto nuclear de HeLa). En primer lugar, los compuestos se sometieron a ensayo a una concentración de 10-5 M. Cuando los compuestos mostraron actividad a 10-5M, se obtuvo una curva de respuesta frente a la concentración en la que los compuestos se ensayaron a concentraciones entre 10-5 M y 10-9 M. Toda la muestra se ensayó 4 veces. En cada ensayo, el valor en blanco se restó tanto del control como de los valores de la muestra. La muestra control representó 100 % de la desacetilatión del sustrato. Para cada muestra, la fluorescencia se expresó como un porcentaje del valor medio de los controles. Cuando fue apropiado, los valores de IC50 (concentración del fármaco, necesaria para reducir la cantidad de metabolitos al 50% del control) se obtuvieron usando el análisis de probitios para los datos gradados. En este documento, los efectos de los compuestos de ensayo se expresan como pIC50 (el valor del log negativo del valor de IC50) (véase la Tabla F-3).

Ejemplo C.2: Determinación de la actividad antiproliferativa en células A2780

Todos los compuestos ensayados se disolvieron en DMSO y se realizaron diluciones adicionales en el medio de cultivo. Las concentraciones de DMSO finales nunca excedieron 0,1% (v/v) en los ensayos de proliferación celular. Los controles contenían células A2780 y DMSO sin compuesto, y los blancos contenían DMSO, pero ninguna célula. MTT se disolvió en 5 mg/ml en PBS. Se preparó un tampón de glicina que comprendía glicina 0,1 M y NaCl 0,1 M tamponado hasta pH 10,5 con NaOH (1 N) (todos los reactivo eran de Merck).

Las células de carcinoma ovárico A2780 humanas (un obsequio amabilidad del doctor T. C. Hamilton [Fox Chase Cancer Centre, Pensilvania, USA]) se cultivaron en medio RPMI 1640 suplementado con L-glutamina 2 mM, gentamicina a 50 g/ml y suero fetal de ternero al 10%. Las células se mantuvieron rutinariamente como cultivos en monocapas a 37ºC en una atmósfera de CO2 al 5 % humedecida. Las células se pasaron una vez por semana usando una disolución de tripsina/EDTA en una relación de división de 1:40. Todos los medios y suplementos se obtuvieron de Life Technologies. Las células estaban libres de contaminación por micoplasmas, según se determina usando el kit Gen-Probe Mycoplasma Tissue Culture (proveedor: BioMerieux).

Las células se sembraron en placas de 96 pocillos de cultivo de NUNCTM (Proveedor: Life Technologies) y se les permitió adherirse al plástico durante la noche. Las densidades usadas para la siembra en placa fueron 1500 células por pocillo en un volumen total de 200 l de medio. Tras la adhesión de las células a las placas, el medio se cambió, y se añadieron los fármacos y/o disolventes hasta un volumen final de 200 l. Tras cuatro días de incubación, el medio se sustituyó por 200 l de medio recién preparado, y la densidad y viabilidad celulares se evaluaron usando un ensayo a base de MTT. A cada pocillo, se añadieron 25 l de disolución de MTT, y las células se incubaron adicionalmente durante 2 horas a 37ºC. El medio se aspiró después con cuidado, y el producto MTT-formazano azul se solubilizó por adición de 25 l de tampón de glicina seguido de 100 l de DMSO. Las placas de microensayo se agitaron durante 10 minutos en un agitador de microplacas, y se midió la absorbancia a 540 nm usando un espectrofotómetro de 96 pocillos Emax (Proveedor: Sopachem). En un experimento, los resultados para cada condición experimental son la media de 3 pocillos repetidos. Con fines de identificación inicial, los compuestos se ensayaron a una concentración fija única de 10-6 M. Para compuestos activos, los experimentos se repitirieon para establecer las curvas de respuesta frente a la concentración total. Para cada experimento, se ensayaron en paralelo controles (que no contenían ningún fármaco) y una incubación en blanco (que no contenía ninguna célula o fármaco). El valor del blanco se restó de todos los valores de control y muestra. Para cada muestra, el valor medio para el crecimiento de las células (en unidades de absorbancia) se expresó como el porcentaje del valor medio para el crecimiento de las células del control. Cuando fue apropiado, los valores de IC50 (concentración del fármaco, necesaria para reducir el crecimiento de las células hasta 50% del control) se calcularon usando el análisis de probitios para los datos gradados (Finney, D. J., Probit Analyses, 2ª Ed. Capítulo 10, Graded Responses, Cambridge University Press, Cambridge 1962). En este documento, los efectos de los compuestos de ensayo se expresan como pIC50 (el valor del log negativo del valor de IC50) (véase la Tabla F-3).

Ejemplo C.3: Solubilidad/Estabilidad

La solubilidad de un compuesto, a pH diferentes, también puede ser medida con el uso de un detector de nitrógeno quimioluminescente. El compuesto nº 2 mostró una solubilidad en agua >0,5 mg/ml; el compuesto nº 3 mostró una solubilidad en agua > 1 mg/ml, y el compuesto nº 4 mostró una solubilidad en agua > 0,1 mg/ml.

Ejemplo C.4: Análisis de permeabilidad de la membrana artificial en paralelo

Las muestras madre (alícuotas de 10 l de una disolución madre 5 mM en DMSO al 100%) se diluyeron en una placa de pocillos profundos o placa de premezcla que contenía 2 ml de un sistema tampón acuoso a pH 4 o pH 7,4 (PSR4 System Solution Concentrate (pION)).

Antes de que las muestras se añadieran a la placa de referencia, se añadieron 150 l del tampón a los pocillos, y se realizó una medida de UV del blanco. Después, el tampón se desechó, y la placa se usó como placa de referencia. Todas las medidas se realizaron en placas resistentes a UV (proveedor: Costar o Greiner).

Después de la medida del blanco de la placa de referencia, a la placa de referencia se añadieron 150 l de las muestras diluidas, y se añadieron 200 l de las muestras diluidas a la placa dadora 1. Una placa de filtro aceptora 1 (proveedor: Millipore, tipo:MAIP N45) se revistió con 4 l de la disolución artificial formadora de membrana (1,2- Dioleoil-sn-Glicer-3-Fosfocolina en Dodecano que contiene 2,6-Di-terc-butil-4-metilfenol al 0,1% y se colocó encima de la placa dadora 1 para formar un “sándwich”. El tampón (200 l) se dispensó en los pocillos aceptores en la parte superior. El sándwich se cubrió con una tapa y se almacenó durante 18 h a temperatura ambiente en la oscuridad.

Se llevó a cabo una medida en blanco de la placa aceptora 2 mediante adición de 150 l de tampón a los pocillos, seguido de una medida de UV. Después de la medida en blanco de la placa aceptora 2, el tampón se desechó, y se transfirieron 150 l de la disolución aceptora desde la placa de filtro aceptora 1 a la placa aceptora 2. Después, la placa de filtro aceptora 1 se retiró del sándwich. Después de la medida del blanco de la placa dadora 2 (véase más arriba), se transfirieron 150 l de la disolución dadora desde la placa dadora 1 a la placa dadora 2. Se escaneraon os espectros de UV de la placa dadora 2, de la placa aceptora 2 y de los pocillos de la placa de referencia (con un SpectraMAX 190). Todos los espectros se procesaron para calcular la permeabilidad con el PSR4p Command Software. Todos los compuestos se midieron por triplicado. Se usaron carbamazepina, griseofulvina, acicloguanisina, atenolol, furosemida y clorotiazida como patrones en cada experimento. Los compuestos se clasificaron en 3 categorías según tuvieran una permeabilidad baja (efecto medio < 0,5 x 10-6 cm/s; puntuación 1), una permeabilidad media (1 x 10-6 cm/s > efecto medio  0,5 x 10-6 cm/s; puntuación 2) o una permeabilidad alta ( 1 x 10-6 cm/s; puntuación 3).

Ejemplo C.5: Estabilidad metabólica

Ejemplo C.5.a.

Se obtuvieron preparaciones de tejido subcelular según Gorrod et al. (Xenobiotica 5: 453-462, 1975) por separación centrífuga tras la homogeneización mecánica del tejido. El tejido hepático se enjuagó en tampón Tris-HCI 0,1 M helado (pH 7,4) para lavar la sangre en exceso. El tejido se secó entonces, se transfirió, se pesó y se cortó bastamente usando tijeras quirúrgicas. Los pedazos de tejido se homogeneizaron en 3 volúmenes de tampón de fosfato 0,1 M (pH 7,4) enfriado en hielo, usando Potter-S (Braun, Italia) equipado con una mano de almirez de Teflón o bien un homogeneizador Omni-mix de Sorvall, durante 7 x 10 segundos. En ambos casos, el matraz se mantuvo en hielo durante el proceso de homogeneización.

Los homogenados tisulares se centrifugaron a 9000 x g durante 20 minutos a 4ºC usando una centrifugadora Sorvall o Ultracentrifugadora Beckman. El sobrenadante resultante se lamacenó a -80ºC y se denominó 'S9'.

La fracción S9 puede ser centrifugada adicionalmente a 100.000 x g durante 60 minutos (4ºC) usando una ultracentrifugadora Beckman. El sobrenadante resultante se aspiró con cuidado, se dividió en alícuotas y se denominó 'citosol'. El pelete se resuspendió en tampón de fosfato 0,1 M (pH 7,4) en un volumen final de 1 ml por 0,5 g de peso de tejido original, y se denominó 'microsomas'.

Todas las fracciones subcelulares se dividieron en alícuotas, se congelaron inmediatamente en nitrógeno líquido y se almacenaron a -80 ºC hasta su uso.

Para las muestras a ensayar, la mezcla de incubación contenía PBS (0,1M), compuesto (5 M), microsomas (1 mg/ml) y un sistema generador de NADPH (glucosa-6-fosfato 0,8 mM, cloruro de magnesio 0,8 mM y 0,8 unidades de glucosa-6-fosfato deshidrogenasa). Las muestras de control contenían el mismo material, pero los microsomas fueron sustituidos por microsomas inactivados con calor (10 minutos a 95 grados Celsius). La recuperación de los compuestos en las muestras de control era siempre del 100 %.

Las mezclas se preincubaron durante 5 minutos a 37 grados Celsius. La reacción fue comenzada en el punto de tiempo cero (t=0) por adición de NADP 0,8 mM, y las muestras se incubaron durante 15 minutos (t=15). La reacción se terminó por adición de 2 volúmenes de DMSO. Entonces, las muestras se centrifugaron durante 10 minutos a 900 x g, y los sobrenadantes se almacenaron a temperatura ambiente durante no más de 24 h antes del análisis. Todas las incubaciones se realizaron por duplicado. El análisis de los sobrenadantes se realizó con análisis de LC-MS. La elución de las muestras se llevó a cabo en Xterra MS C18 (50 x 4,6 mm, 5 m, Waters, US). Se usó un sistema de HPLC Alliance 2790 (Proveedor: Waters, US). La elución se realizó con tampón A (acetato de amonio 25 mM (pH 5,2) en H2O/acetonitrilo (95/5)), siendo el disolvente B acetonitrilo, y el disolvente C metanol, a un caudal de 2,4 ml/min. El gradiente empleado aumentaba la concentración de la fase orgánica desde 0% a más del 50% de B y al 50% de C en 5 minutos hasta el 100% de B en 1 minuto de modo lineal, y la concentración de la fase orgánica se mantuvo estacionaria durante 1,5 minutos más. El volumen de inyección total de las muestras fue 25 l.

Se usó como detector un espectrómetro de masas con triple quadrupolo Quattro (proveedor: Micromass, Manchester, UK) equipado con una fuente de ESI. La fuente y la temperatura de desolvatación se ajustaron a 120 y 350ºC, respectivamente, y se usó nitrógeno como nebulizador y gas secante. Los datos fueron adquiridos en el modo de barrido positivo (reacción de ión único). El voltaje del cono se ajustó a 10 V, y el tiempo de residencia fue 1 segundo.

La estabilidad metabólica se expresó como % de metabolismo del compuesto después de 15 minutos de incubación en presencia de microsomas activos (E (act)) (% de metabolismo = 100 % - ((corriente iónica total (TIC) de E(act) a t = 15 ) / (TIC de E (act) a t = 0)) x 100). Los compuestos que tuvieron un porcentaje de metabolismo menor que 20% se definieron como metabólicos muy estables. El compuesto que tuvieron un metabolismo entre 20 y 70% se definió como intermediamente estable, y los compuestos que mostraron un porcentaje de metabolismo mayor que 70 se definieron como metabólicos poco estables. Siempre se incluyeron tres compuestos de referencia cuando se realizaba un cribado de estabilidad metabólica. El Verapamil se incluyó como un compuesto con una estabilidad metabólica baja (% metabolismo= 73%). La Cisaprida se incluyó como un compuesto con una estabilidad metabólica media (% metabolismo = 45%), y el propanol se incluyó como un compuesto con una estabilidad metabólica de intermedia a alta (metabolismo del 25%). Estos compuestos de referencia fueron usados para validar el ensayo de estabilidad metabólica.

C.5.b: Estabilidad metabólica con cultivos celulares de hepatocitos de rata Los hepatocitos de ratas se aislaron de ratas macho Sprague Dowley. Los compuestos se disolvieron en una disolución madre 5 mM en DMSO al 100 % y se incubaron a una concentración final de 5 M durante 0, 15, 30, 60 y 120 minutos con cultivos de hepatocitos de rata (0,5 millones de células viables/0,5 ml) usando placas de 24 pocillos.

Las muestras se prepararon para el análisis de LC-MS por adición de dos volúmenes de DMSO. Las muestras se agitaron a fondo y posteriormente se centrifugaron a 900g durante 10 minutos (temperatura ambiente). Todos los experimentos se realizaron por triplicado. Del sobrenadante resultante, se analizaron 50 l mediante LC-MS.

Para LC-MS, la elución de las muestras se realizó en una columna Hypersil BDS C18 (50 x 4,6 mm, 5 m, Thermohypersil, UK). El sistema de HPLC comprendió un sistema de suministro Surveyor (Surveyor Inc, San Jose, US) equipado con un dispositivo de automuestreo Surveyor. La elución se realizó con tampón A (acetato de amonio 10 mM (pH 6,9) en H2O/Acetonitrilo (95:5)) y disolvente B (acetonitrilo) a un caudal de 1,2 ml/min. El gradiente empleado fue 0,5 minutos de disolvente A como condición de partida seguido del aumento de la concentración de la fase orgánica de 0% de B a 95% de B a lo largo de 2 minutos de una manera lineal. Esta fase se mantuvo estacionaria durante 2 minutos más, y se redujo otra vez a 0% de B en 0,5 minutos.

El volumen de inyección total de las muestras fue 50 l. La temperatura de la estufa de la columna se mantuvo a 40ºC. El flujo de LC se dividió para la detección de MS, y se dejaron entrar 0,1 ml a la fuente.

Para la detección, se usó un espectrómetro de masas, espectrómetro de masas de cuadripolo triple TSQ Quantum (Thermofinnigan, La Jolla, US), equipado con una fuente de ESI. El voltaje de la fuente se ajustó a 3800 voltios, la temperatura del capilar a 300ºC. El espectrómetro de masas se hizo funcionar en el modo de ión positivo en SIM ajustado a la masa de M+H con una anchura de barrido de 1 Da con fines de cuantificación. El control del instrumento, la adquisición de los datos y el procesamiento se llevaron a cabo usando el software Xcalibur (ThermoFinnigan, San Jose, California., U.S.A.). La estabilidad metabólica de los compuestos en los hepatocitos de rata se expresó como semividas in vitro.

Como referencia, se usó el compuesto R306465 (documento WO03/76422) (semivida in vitro: 8 minutos). El compuesto 1 tiene una semivida in vitro de 103 minutos.

Ejemplo C.6: Capacidad de inducción de p21

Ejemplo C.6.a.: Método celular Se cultivaron células A2780 (ATCC) en medio RPMI 1640 suplementado con FCS al 10%, L-glutamina 2 mM y gentamicina a 37ºC en una incubadora humedecida con CO2 al 5%. Todas las disoluciones del cultivo celular son proporcionadas por Gibco-BRL (Gaithersburg, Md.). Otros materiales fueron proporcionados por Nunc.

El ADN genómico se extrajo de células A2780 proliferantes y fue usado como molde para el aislamiento por PCR anidada del promotor p21. La primera amplificación se realizó durante 20 ciclos a una temperatura de hibridación de 55ºC usando el par de oligonucleótidos GAGGGCGCGGTGCTTGG y TGCCGCCGCTCTCTCACC con el ADN genómico como molde. El fragmento de 4,5 kb resultante que contiene los fragmentos de -4551 a +88 con respecto a la caja TATA se amplificó de nuevo con los oligonucleótidos TCGGGTACCGAGGGCGCGGTGCTTGG y ATACTCGAGTGCCGCCGCTCTCTCACC durante 20 ciclos con hibridación a 88ºC, dando como resultado un fragmento de 4,5 kb, y posteriormente con el par de oligonucleótidos TCGGGTACCGGTAGATGGGAGCGGATAGACACATC y ATACTCGAGTGCCGCCGCTCTCTCACC durante 20 ciclos con hibridación a 88ºC, dando como resultado un fragmento de 1,3 kb que contiene el fragmento de -1300 a +88 con respecto a la caja TATA. Los sitios de restricción XhoI y KpnI presentes en los oligonucleótidos (secuencia subrayada) se usaron para la subclonación.

El informador de luciferasa se eliminó del pGL3-basic y se sustituyó por el informador ZsGreen (del plásmido pZsGreen1-N1) en los sitios de restricción KpnI y XbaI. El pGL3-basic-ZsGreen-1300 se construyó vía la inserción del fragmento de 1,3 kb mencionado anteriormente de la región del promotor p21 humana en pGL3-basic-ZsGreen en los sitios XhoI y KpnI. Todas las enzimas de restricción son proporcionadas por Boehringer Manheim (Alemania). Las células A2780 fueron puestas en placas en una placa de 6 pocillos a una densidad de 2 x 105 células, se incubaron durante 24 horas, y se transfectaron con 2 ug de pGL3-basic-ZsGreen-1300 y 0,2 g del vector pSV2neo usando Lipofectamina 2000 (Invitrogen, Bruselas, Bélgica) como se describe por el fabricante. Las células transfectadas se seleccionaron durante 10 días con G418 (Gibco-BRL, Gaithersburg, Md.) y se hicieron crecer suspensiones de células individuales. Después de tres semanas, se obtuvieron clones individuales.

Los clones seleccionados de A2780 se expandieron y se sembraron a 10000 células por pocillo en placas de 96 pocillos. 24 horas después de la siembra, las células fueron tratadas durante 24 horas adicionales con los compuestos (que afectan a los sitios sp1 en la región promotora p21 proximal). Posteriormente, las células se fijaron con PFA al 4% durante 30' y se contratiñeron con tinte de Hoechst. La activación del promotor p21 que conduce a la producción de ZsGreen y así a la generación de fluorescencia, se monitorizó mediante el Ascent Fluoroskan (Thermo Labsystems, Bruselas, Bélgica).

Para cada experimento, se realizaron en paralelo controles (que no contenían ningún fármaco) y una incubación en blanco (que no contenía ninguna célula o fármacos). El valor en blanco se restó de todos los valores de control y muestra. Para cada muestra, el valor para la inducción de p21 se expresó como el porcentaje del valor para el p21 presente en el control. Un porcentaje de inducción mayor que 130% se definió como una inducción significativa.

El compuesto 1 se ensayó y mostró una inducción significativa.

Ejemplo C.6.c.: Método in vivo

Un clon seleccionado se inyectó subcutáneamente (107 células/200 l) en el flanco de ratones atímicos, y después de 12 días se obtuvo un tumor medible con calibre. A partir del día 12, los animales fueron medicados, oral o intravenosamente, diariamente durante 6 días con disolvente y compuesto 20-40 mpk (4-10 animales cada uno). Los tumores se evaluaron por fluorescencia mediante el Sistema de Representación de Cuerpo Entero Automatizado desarrollado en nuestro laboratorio (estereomicroscopio fluorescente tipo Olimpo® SZX12 equipado con un filtro de GFP y conectado a una cámara CCD tipo JAI® CV-M90 controlado por un paquete de software basado en el Software de Visión IMAQ de National Instruments®). Como referencia, se usó el compuesto R306465 (documento WO03/76422). Los compuestos se clasificaron como inactivos (ninguna fluorescencia medible), más débil, idéntica o mejor que R306465. El compuesto 1 se ensayó y era mejor que R306465 después de la administración oral.

Ejemplo C.7: Capacidad inhibidora de P450

Todos los compuestos ensayados se disolvieron en DMSO (5 mM) y se hizo una dilución adicional hasta 5 x 10-4 M en acetonitrilo. Otras diluciones se realizaron en tampón de ensayo (tampón de fosfato NaK 0,1M, pH 7,4), y la concentración del disolvente final nunca fue mayor que 2%.

El ensayo para la proteína CYP3A4 comprende por pocillo 15 pmol de P450/mg de proteína (en tampón de fosfato NaK 0,01M + KCl al 1,15 %), un sistema generador de NADPH (glucosa-6-fosfato 3,3 mM, 0,4 U/ml de glucosa-6- fosfato deshidrogenasa, NADP 1,3 mM y MgCl2.6H2O 3,3 mM en tampón de ensayo) y compuesto en un volumen de ensayo total de 100 l. Después de una preincubación durante 5 minutos a 37ºC, la reacción enzimática se inició con la adición de 150 M del sustrato de sonda fluorescente BFC en tampón de ensayo. Después de una incubación durante 30 minutos a temperatura ambiente, la reacción se terminó tras la adición de 2 volúmenes de acetonitrilo.

Las determinaciones fluorescentes se realizaron a una longitud de onda de excitación de 405 nm y una longitud de onda de emisión de 535 nm. El ketoconazol (valor de IC50 = 3 x 10-8 M) se incluyó como compuesto de referencia en este experimento.

El ensayo para la proteína CYP2D6 comprende por pocillo 6 pmol de P450/mg de proteína (en tampón de fosfato NaK 0,01M + KCl al 1,15 %), un sistema generador de NADPH (glucosa-6-fosfato 0,41 mM, 0,4 U/ml de glucosa-6- fosfato deshidrogenasa, NADP 0,0082 mM y MgCl2.6H2O 0,41 mM en tampón de ensayo) y compuesto en un volumen de ensayo total de 100 l. Después de una preincubación durante 5 minutos a 37ºC, la reacción enzimática se inició con la adición de 3 M del sustrato de sonda fluorescente AMMC en tampón de ensayo. Después de una incubación durante 45 minutos a temperatura ambiente, la reacción se terminó tras la adición de 2 volúmenes de acetonitrilo. Las determinaciones fluorescentes se realizaron a una longitud de onda de excitación de 405 nm y una longitud de onda de emisión de 460 nm. La quinidina (valor de IC50 < 5 x 10-8M) se incluyó como compuesto de referencia en este experimento.

El ensayo para la proteína CYP2C9 comprende por pocillo 15 pmol de P450/mg de proteína (en tampón de fosfato NaK 0,01M + KCl al 1,15 %), un sistema generador de NADPH (glucosa-6-fosfato 3,3 mM, 0,4 U/ml de glucosa-6- fosfato deshidrogenasa, NADP 1,3 mM y MgCl2.6H2O 3,3 mM en tampón de ensayo) y compuesto en un volumen de ensayo total de 100 l. Después de una preincubación de 5 minutos a 37ºC, la reacción enzimática se inició con la adición de 200 M del sustrato de sonda fluorescente MFC en tampón de ensayo. Después de una incubación durante 30 minutos a temperatura ambiente, la reacción se terminó tras la adición de 2 volúmenes de acetonitrilo. Las determinaciones fluorescentes se realizaron a una longitud de onda de excitación de 405 nm y una longitud de onda de emisión de 535 nm. El sulfafenazol (valor de IC50 = 6,8 x 10-7M) se incluyó como compuesto de referencia en este experimento.

Con fines de identificación inicial, los compuestos se ensayaron a una concentración fija única de 1 x 10-5 M. Para compuestos activos, los experimentos se repitieron para establecer las curvas de respuesta frente a la concentración total. Para cada experimento, se realizaron en paralelo controles (que no contenían ningún fármaco) y una incubación en blanco (que no contenía ninguna enzima o fármacos). Todos los compuestos se evaluaron por cuadruplicado. El valor en blanco se restó de todos los valores de control y muestra. Para cada muestra, el valor medio de la actividad de P450 de la muestra (en unidades de fluorescencia relativas) se expresó como un porcentaje del valor medio de la actividad de P450 del control. El porcentaje de inhibición se expresó como 100% menos el valor medio de la actividad de P450 de la muestra. Cuando fue apropiado, se calcularon los valores de IC50 (concentración del fármaco, necesaria para reducir la actividad de P450 hasta 50% del control).

Tabla F-3: enumera los resultados de los compuestos que se ensayaron según el ejemplo C.1 y C.2 Co. nº Actividad enzimática pIC50 Actividad celular pIC50 1 9,0 7,6 2 8,0 6,8 3 8,3 7,3 4 8,7 6,8 6,0 5,5 6 8,1 7,1 7 6,0 5,9 8 9,5 6,7

D. Ejemplo de composición: Comprimidos revestidos de película

Preparación del núcleo del comprimido Una mezcla de 100 g de un compuesto de fórmula (I), 570 g de lactosa y 200 g de almidón se mezcla bien y después se humedece con 5 g de una disolución de dodecilsulfato de sodio y 10 g de polivinil-pirrolidona en alrededor de 200 ml de agua. La mezcla en polvo húmeda se tamiza, se seca y se tamiza otra vez, Entonces se añaden 100 g de celulosa microcristalina y 15 g de aceite vegetal hidrogenado. Se mezcla todo bien y se prensa como comprimidos, dando 10.000 comprimidos, comprendiendo cada uno 10 mg de un compuesto de fórmula (I).

Revestimiento A una disolución de 10 g de metilcelulosa en 75 ml de etanol desnaturalizado se añade una disolución de 5 g de etilcelulosa en 150 ml de diclorometano. Entonces se añaden 75 ml de diclorometano y 2,5 ml de 1,2,3-propanotriol, Se funden 10 g de polietilenglicol y se disuelven en 75 ml de diclorometano. Esta última disolución se añade a la primera y entonces se añaden 2,5 g de octadecanoato de magnesio, 5 g de polivinilpirrolidona y 30 ml de suspensión de color concentrada, y el conjunto se homogeniza. Los núcleos del comprimido se revisten con la mezcla así obtenida en un aparato de revestimiento.

REIVINDICACIONES

1. Un compuesto de fórmula (I), a las formas de N-óxido, a las sales de adición farmacéuticamente aceptables y a las formas estereoquímicamente isoméricas de los mismos, en los que cada X es independientemente N o CH; cada Y es independientemente O, CH o CH2, y cuando Y es CH, entonces el sustituyente está unido al átomo de Y de la estructura anular; n es 0 o 1, y cuando n es 0, entonces está previsto un enlace directo; R1 es fenilo, naftalenilo o heterociclilo; en el que cada uno de dicho fenilo o naftalenilo está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo, hidroxi, ciano, amino, alquil C1-6-carbonilamino, alquil C1-6-sulfonilamino, hidroxicarbonilo, alquil C1-6- oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oximetilo, aminometilo, alquil C1-6-aminometilo, alquil C1-6- carbonilaminometilo, alquil C1-6-sulfonilaminometilo, aminosulfonilo, alquil C1-6-aminosulfonilo o heterociclilo; R2 es -CH2-R5, trifluorometilo, -C(=O)-R6, o -CH2-NR7R8; en el que cada R5 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, piperazinilo, N- metilpiperazinilo, morfolinilo, tiomorfolinilo, imidazolilo o triazolilo; cada R6 se selecciona independientemente de hidroxi, alquil C1-6-oxi, amino o mono- o di(alquil C1-6)amino, cicloalquil C3-6-amino, piperazinilo, N-metilpiperazinilo, morfolinilo o tiomorfolinilo; cada R7 y R8 se selecciona independientemente de hidrógeno, alquilo de C1-6, alquil C1-6-carbonilo, alquil C1-6-sulfonilo, o mono- o di(alquil C1-4)aminosulfonilo; R3 es hidrógeno, alquilo de C1-6, ciano-alquilo de C1-4, alquil C1-6-oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oxi-alquilo de C1-6, cicloalquilo de C3-6, cicloalquil C3-6-alquilo de C1-6, aril-alquilo de C1-6, alquil C1-6- carbonilo, alquil C1-6-sulfonilo; R4 es hidroxi o un radical de fórmula (a-1) en la que R9 es hidroxi o -NH2; R10 es hidrógeno, tienilo, furanilo o fenilo, y cada tienilo, furanilo o fenilo puede estar opcionalmente sustituido con halo, amino, nitro, ciano, hidroxi, fenilo, alquilo de C1-6, (di-alquil C1-6)amino, alquil C1-6-oxi, fenil-alquil C1-6-oxi, hidroxi-alquilo de C1-6, alquil C1-6-oxicarbonilo, hidroxicarbonilo, alquil C1-6-carbonilo, polihalo-alquil C1-6-oxi, polihalo-alquilo de C1-6, alquil C1-6-sulfonilo, hidroxicarbonil-alquilo de C1-6, alquil C1-6- carbonilamino, aminosulfonilo, aminosulfonil-alquilo de C1-6, isoxazolilo, aminocarbonilo, fenil-alquenilo de C2-6, fenil-alquinilo de C3-6 o piridinil-alquinilo de C3-6; R11, R12 y R13 son cada uno independientemente hidrógeno, -NH2, nitro, furanilo, halo, alquilo de C1-6, alquil C1-6-oxi, trifluorometilo, tienilo, fenilo, alquil C1-6- carbonilamino, aminocarbonil-alquilo de C1-6 o -C≡C-CH2-R14; en el que R14 es hidrógeno, alquilo de C1-6, hidroxi, amino o alquil C1-6-oxi; y heterociclilo en lo anterior es furanilo, tienilo, pirrolilo, pirrolinilo, pirolidinilo, dioxolilo, oxazolilo, tiazolilo, imidazolilo, imidazolinilo, imidazolidinilo, pirazolilo, pirazolinilo, pirazolidinilo, isoxazolilo, isotiazolilo, oxadiazolilo, triazolilo, tiadiazolilo, piranilo, piridinilo, piperidinilo, dioxanilo, morfolinilo, ditianilo, tiomorfolinilo, piridazinilo, pirimidinilo, pirazinilo, piperazinilo, triazinilo, tritianilo, indolizinilo, indolilo, indolinilo, benzofuranilo, benzotiofenilo, indazolilo, bencimidazolilo, benztiazolilo, purinilo, quinolizinilo, quinolinilo, cinolinilo, ftlazinilo, quinazolinilo, quinoxalinilo o naftiridinilo; en el que cada uno de dichos heterociclos está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, ciano, amino, mono- o di(alquil C1-4)- amino.

2. Un compuesto como se reivindica en la reivindicación 1, en el que cada X es N; cada Y es independientemente O o CH; R1 es fenilo; R2 es -CH2OH o metilo; R3 es hidrógeno, alquil C1- 6-carbonilo o alquil C1-6-sulfonilo; R9 es -NH2; R10 es hidrógeno; y R11, R12 y R13 son cada uno independientemente hidrógeno.

3. Un compuesto como se reivindica en la reivindicación 1 y 2, en el que cada X es N; cada Y es CH; n es 1; R1 es fenilo; R2 es -CH2OH o metilo; R3 es hidrógeno o alquil C1-6-sulfonilo; y R4 es hidroxi.

4. Un compuesto como se reivindica en la reivindicación 1, 2 y 3, en el que dicho compuesto es el compuesto nº 1 o el compuesto nº 8 5. Una composición farmacéutica que comprende vehículos farmacéuticamente aceptables y, como ingrediente activo, una cantidad terapéuticamente eficaz de un compuesto como se reivindica en la reivindicación 1 a 4.

6. Un procedimiento para la preparación de una composición farmacéutica como se reivindica en la reivindicación 5, en el que los vehículos farmacéuticamente aceptables y un compuesto como se reivindica en la reivindicación 1 a 4 se mezclan íntimamente.

7. Un compuesto como se reivindica en cualquiera de las reivindicaciones 1 a 4, para su uso como medicamento.

8. Uso de un compuesto como se reivindica en cualquiera de las reivindicaciones 1 a 4, para la fabricación de un medicamento para el tratamiento de enfermedades proliferativas.

9. Una combinación de un agente contra el cáncer y un inhibidor de HDAC como se reivindica en cualquiera de las reivindicaciones 1 to 4.

10. Un procedimiento para la preparación de un compuesto como se reivindica en la reivindicación 1, caracterizado por a) hacer reaccionar un intermedio de fórmula (II) con un ácido apropiado, produciendo un compuesto de fórmula (I), en la que R4 es hidroxi, denominado aquí como un compuesto de fórmula (I-a), o b) hacer reaccionar un intermedio de fórmula (III) con un intermedio de fórmula (IV) en la que M representa hidrógeno, o sodio, litio o un catión de metal alcalino, en presencia de reactivos apropiados, produciendo un compuesto de fórmula (I), en la que R4 es un radical de fórmula (a-1) y R9 es -NH2, denominado aquí como un compuesto de fórmula (I-b).

11. Un compuesto de fórmula (VIII), a las formas de N-óxido, a las sales de adición farmacéuticamente aceptables y a las formas estereoquímicamente isoméricas de los mismos, en los que cada X es independientemente N o CH; cada Y es independientemente O, CH o CH2, y cuando Y es CH, entonces el sustituyente está unido al átomo de Y de la estructura anular; n es 0 o 1, y cuando n es 0, entonces está previsto un enlace directo; R1 es fenilo, naftalenilo o heterociclilo; en el que cada uno de dicho fenilo o naftalenilo está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, polihalo-alquilo de C1-6, arilo, hidroxi, ciano, amino, alquil C1-6-carbonilamino, alquil C1-6-sulfonilamino, hidroxicarbonilo, alquil C1-6- oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oximetilo, aminometilo, alquil C1-6-aminometilo, alquil C1-6- carbonilaminometilo, alquil C1-6-sulfonilaminometilo, aminosulfonilo, alquil C1-6-aminosulfonilo o heterociclilo; R2 es -CH2-R4, trifluorometilo, -C(=O)-R5, o -CH2-NR6R7; en el que cada R4 se selecciona independientemente de hidrógeno, hidroxi, alquil C1-6-oxi, piperazinilo, N- metilpiperazinilo, morfolinilo, tiomorfolinilo, imidazolilo o triazolilo; cada R5 se selecciona independientemente de hidroxi, alquil C1-6-oxi, amino o mono- o di(alquil C1-6)amino, cicloalquil C1-6-amino, piperazinilo, N-metilpiperazinilo, morfolinilo o tiomorfolinilo; cada R6 y R7 se selecciona independientemente de hidrógeno, alquilo de C1-6, alquil C1-6-carbonilo, alquil C1-6-sulfonilo, o mono- o di(alquil C1-4)aminosulfonilo; R3 es hidrógeno, alquilo de C1-6, ciano-alquilo de C1-4, alquil C1-6-oxicarbonilo, hidroxi-alquilo de C1-6, alquil C1-6-oxi-alquilo de C1-6, cicloalquilo de C3-6, cicloalquil C3-6-alquilo de C1-6, aril-alquilo de C1-6, alquil C1-6- carbonilo, alquil C1-6-sulfonilo; y heterociclilo en lo anterior furanilo, tienilo, pirrolilo, pirrolinilo, pirolidinilo, dioxolilo, oxazolilo, tiazolilo, imidazolilo, imidazolinilo, imidazolidinilo, pirazolilo, pirazolinilo, pirazolidinilo, isoxazolilo, isotiazolilo, oxadiazolilo, triazolilo, tiadiazolilo, piranilo, piridinilo, piperidinilo, dioxanilo, morfolinilo, ditianilo, tiomorfolinilo, piridazinilo, pirimidinilo, pirazinilo, piperazinilo, triazinilo, tritianilo, indolizinilo, indolilo, indolinilo, benzofuranilo, benzotiofenilo, indazolilo, bencimidazolilo, benztiazolilo, purinilo, quinolizinilo, quinolinilo, cinolinilo, ftlazinilo, quinazolinilo, quinaxolinilo o naftiridinilo; en el que cada uno de dichos heterociclos está opcionalmente sustituido con uno o dos sustituyentes seleccionados cada uno independientemente de halo, alquilo de C1-6, alquil C1-6-oxi, ciano, amino, o mono- o di(alquil C1-4)- amino.

12. Un procedimiento para la preparación de un compuesto como se reivindica en la reivindicación 11, caracterizado por a) convertir compuestos de fórmula (VIII), en la que R2 es -CH2OH, denominados aquí como compuestos de fórmula (VIII-a), en compuestos de fórmula (VIII), en la que R2 es distinto a -CH2OH, denominados aquí compuestos de fórmula (VIII-b), mediante reacciones conocidas en la técnica o transformaciones de grupos funcionales, o b) hacer reaccionar el intermedio de fórmula (IX) con 1,4-dioxano-2,5-diol y el ácido borónico apropiado de fórmula (X), en la que R1 es como se define en la reivindicación 11, produciendo los compuestos de fórmula (VIII), en la que R2 es -CH2OH y R3 es hidrógeno, denominados aquí como compuestos de fórmula (VIII-c), o c) hacer reaccionar los compuestos de fórmula (IX) con la cetona apropiada de fórmula (XI), en la que R1 y R2 son como se definen en la reivindicación 11, produciendo los compuestos de fórmula (VIII), en la que R2 es distinto de -CH2OH y R3 es hidrógeno, denominados aquí como compuestos de fórmula (VIII-d), o d) hacer reaccionar un compuesto de fórmula (VIII-d) con un compuesto de fórmula (XV) en la que W es un grupo saliente apropiado, produciendo un compuesto de fórmula (VIII).