Ribozimas autoescindibles y usos de las mismas.

Ribozima autoescindible que comprende una secuencia seleccionada del grupo que consiste en: **Fórmula**

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2004/038199.


Nacionalidad solicitante: Estados Unidos de América.


Inventor/es: .

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/63 (Introducción de material genético extraño utilizando vectores; Vectores; Utilización de huéspedes para ello; Regulación de la expresión)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/113 (Acidos nucleicos no codificantes que modulan la expresión de genes, p.ej. oligonucleótidos antisentido)

PDF original: ES-2488641_T3.pdf


google+ twitter facebookPin it
Ilustración 1 de Ribozimas autoescindibles y usos de las mismas.
Ilustración 2 de Ribozimas autoescindibles y usos de las mismas.
Ilustración 3 de Ribozimas autoescindibles y usos de las mismas.
Ilustración 4 de Ribozimas autoescindibles y usos de las mismas.
Ver la galería de la patente con 10 ilustraciones.
Ribozimas autoescindibles y usos de las mismas.

Fragmento de la descripción:

Ribozimas autoescindibles y usos de las mismas Antecedentes de la invención Se están desarrollando enzimas de ARN (ribozimas) para el tratamiento de una serie de enfermedades que van desde los trastornos metabólicos congénitos a las infecciones víricas y las enfermedades adquiridas, tales como el cáncer. Las ribozimas se pueden utilizar tanto para reprimir como para reparar los genes patógenos. En algunos casos es deseable la administración exógena a corto plazo de ARN estabilizado, pero muchos tratamientos requerirán la introducción mediante virus para proporcionar la expresión del catalizador terapéutico a largo plazo. Aunque están disponibles algunas variaciones de las ribozimas que se producen en la naturaleza, no han sido muy

eficaces en las células de mamíferos. Existe la necesidad de desarrollar ribozimas modificadas que muestren una mejoría de la actividad y que funcionen en las células de mamíferos con una gran eficacia. Estas ribozimas son útiles para desarrollar sistemas de expresión génica regulada y que tengan un gran valor terapéutico.

Compendio de la invención La presente invención se refiere a composiciones y procedimientos para nuevos sistemas de regulación génica basados en ribozimas que funcionan en las células de mamíferos. En algunos aspectos, la presente invención da a conocer una ribozima autoescindible, que escinde con eficacia una molécula de ARN que comprende la ribozima autoescindible. La terminología "ribozima", tal y como se utiliza en la presente memoria, incluye las ribozimas que se producen en la naturaleza (de tipo silvestre) y las ribozimas modificadas (denominadas mutantes o variantes) . Una ribozima de ejemplo de la invención es una ribozima de esquistosoma y los mutantes de la misma.

De acuerdo con la presente invención, se da a conocer una ribozima autoescindible que comprende una secuencia seleccionada del grupo que consiste en:

agguacauccagcugaugagucccaaauaggacgaaacgcgcuucggugcguccuggauuccacu (SEQ ID nº : 10) ; ccagcugaugagucccaaauaggacgaaacgcgcuucggugcguccugg (SEQ ID nº : 11) ;

En otro aspecto, se da a conocer una ribozima autoescindible que comprende la secuencia nucleotídica de: cugagaugcagguacaucagcugaNgagucccaaauaggacgaaacgcnggguccugauuccacugcaucca c (SEQ ID nº : 64) , en donde cada N es independientemente cualquier nucleótido; cada A, U, G y C es adenosina, uridina, guanosina y

citidina, respectivamente; y n es de 3 a 40 nucleótidos; y, de manera optativa, en donde la ribozima autoescindible comprende además otros nucleótidos en el extremo 5' y/o 3' de la secuencia nucleotídica de la SEQ ID nº 64. Preferiblemente, el motivo de ARN de la ribozima autoescindible tiene una secuencia nucleotídica de:

en donde N es cualquier nucleótido; cada A, U, G y C es adenosina, uridina, guanosina y citidina, respectivamente; y, de manera optativa, en donde la ribozima autoescindible comprende además otros nucleótidos en el extremo 5' y/o 3' de la secuencia nucleotídica de la SEQ ID nº 65; y además, de manera optativa, en donde N es el nucleótido U.

En otro aspecto se da a conocer un ácido nucleico que codifica una ribozima autoescindible según está descrito más arriba.

En otro aspecto se da a conocer un ácido nucleico que codifica (i) una ribozima autoescindible tal y como se describe más arriba y (ii) un aptámero en una posición de tal forma que la actividad escisora de dicha ribozima autoescindible se pueda modular mediante la fijación de un efector al aptámero.

Aún otro aspecto más da a conocer una molécula polinucleotídica recombinante que comprende: (a) un promotor;

(b) un ácido nucleico que codifica un producto de ácido nucleico; y (c) un ácido nucleico que codifica una ribozima autoescindible tal y como se describe más arriba, en donde el ácido nucleico de (b) y el ácido nucleico de (c) están operativamente unidos al promotor y la transcripción del ácido nucleico de (b) y del ácido nucleico de (c) produce una molécula de ARN que comprende dicha ribozima autoescindible y un ARNm que codifica dicho producto de ácido nucleico, en donde dicha ribozima autoescindible es capaz de escindir dicha molécula de ARN de forma intramolecular.

Preferiblemente, la molécula polinucleotídica recombinante descrita más arriba comprende un ácido nucleico que codifica un aptámero que está en una posición de tal forma que la actividad de escisión de la ribozima autoescindible se puede regular por la fijación de un efector al aptámero; y en cuyo caso, de manera optativa, o bien: (a) en donde el ácido nucleico de (c) codifica al menos dos de las ribozimas autoescindibles; o bien (b) en donde la ribozima fosforotioato de ARN 2’-O-metoxietilado: (i) en donde la molécula polinucleotídica recombinante está presente en el genoma de una célula; o (ii) en donde la molécula polinucleotídica recombinante está presente en un vector.

Otro aspecto de la presente invención da a conocer una célula hospedadora aislada: (a) transformada con el ácido nucleico tal y como se describe más arriba; (b) que comprende la molécula polinucleotídica recombinante tal y como se describe más arriba; y en cuyo caso, de manera optativa: (i) en donde la célula es una célula de mamífero; o (ii) en donde la célula comprende además un agente que inhibe la escisión de la ribozima autoescindible, en donde el agente se selecciona del grupo que consiste en inhibidores aminoglucósidos, toyocamicina, 8-azaadenosina, sangivamicina, tubercidina, monofosfato cíclico de tubercidina, monofosfato de tubercidina, trifosfato de tubercidina, nebularina, nucleósido tricíclico, 5-fluorouridina, 5-bromouridina, 5-fluorouracilo, Syto-83, bromuro de etidio, naranja de acridina y un oligonucleótido antisentido de dicha ribozima autoescindible; o (c) que comprende el ácido nucleico descrito más arriba.

Un aspecto más da a conocer un vector vírico o un virus, que comprende: (a) un promotor; (b) un ácido nucleico que codifica un producto de ácido nucleico; (c) un ácido nucleico que codifica una ribozima autoescindible tal y como se describe más arriba, y en donde el ácido nucleico de (b) y el ácido nucleico de (c) están operativamente unidos al promotor y la transcripción del ácido nucleico de (b) y del ácido nucleico de (c) produce una molécula de ARN que comprende dicha ribozima autoescindible y un ARNm que codifica dicho producto de ácido nucleico, en donde dicha ribozima autoescindible es capaz de escindir dicha molécula de ARN de forma intramolecular.

Preferiblemente, el ácido nucleico de (c) comprende además un ácido nucleico que codifica un aptámero que está en una posición de tal forma que la actividad de escisión de dicha ribozima autoescindible se puede regular por la fijación de un efector a dicho aptámero.

Otro aspecto da a conocer un oligonucleótido antisentido modificado a partir de una ribozima autoescindible tal y como se describe más arriba.

Preferiblemente, el oligonucleótido antisentido modificado: (a) se selecciona del grupo que consiste en: morfolino, fosforotioato de ARN, ARN 2’-O-metilado, y fosforotioato de ARN 2'-O-metoxietilado; o (b) dicho oligonucleótido antisentido modificado aparea sus bases con una región de la ribozima autoescindible tal y como se presenta en gugcguccuggauuccacugcuaucc (SEQ ID nº 67) .

En un aspecto final de la presente invención se da a conocer un kit para regular la expresión génica, que comprende un ácido nucleico que comprende: (a) una secuencia que codifica una ribozima autoescindible tal y como se describe más arriba, y (b) un sitio de clonación para introducir una secuencia nucleotídica que se desea transcribir operativamente unida a la secuencia que codifica dicha ribozima autoescindible.

Preferiblemente,... [Seguir leyendo]



1. Ribozima autoescindible que comprende una secuencia seleccionada del grupo que consiste en:

agguacauccagcugaugagucccaaauaggacgaaacgcgcuucggugcguccuggauuccacu (SEQ ID nº : 10) ; ccagcugaugagucccaaauaggacgaaacgcgcuucggugcguccugg (SEQ ID nº : 11) ;

2. Ribozima autoescindible que comprende la secuencia nucleotídica de: 5

cugagaugcagguacaucagcugaNgagucccaaauaggacgaaacgcnggguccugauuccacugca uccac (SEQ ID nº 64) , en donde, cada N es independientemente cualquier nucleótido; cada A, U, G y C es adenosina, uridina, guanosina y citidina, respectivamente; y

n es de 3 a 40 nucleótidos; y, de manera optativa, en donde la ribozima autoescindible comprende además otros nucleótidos en el extremo 5' y/o 3' de la secuencia nucleotídica de la SEQ ID nº 64.

3. Ribozima autoescindible de acuerdo con la reivindicación 2, que tiene la secuencia nucleotídica de:

cugagaugcagguacaucagcugaNgagucccaaauaggacgaaacgcuucgggguccugauuccacu gcauccac (SEQ ID nº 65) , en donde, N es cualquier nucleótido; cada A, U, G y C es adenosina, uridina, guanosina y citidina, respectivamente; y, de manera optativa, en donde la ribozima autoescindible comprende además otros nucleótidos en el extremo 5'

y/o 3' de la secuencia nucleotídica de la SEQ ID nº 65; y además, de manera optativa, en donde N es el nucleótido U.

4. Ã?cido nucleico que codifica una ribozima autoescindible de acuerdo con la reivindicación 1 o 2.

5. Ã?cido nucleico que codifica (i) una ribozima autoescindible de acuerdo con la reivindicación 1 o 2 y (ii) un aptámero en una posición de tal forma que la actividad escisora de dicha ribozima autoescindible se pueda modular mediante la fijación de un efector al aptámero.

6. Molécula polinucleotídica recombinante que comprende:

(a) un promotor;

(b) un ácido nucleico que codifica un producto de ácido nucleico; y

(c) un ácido nucleico que codifica una ribozima autoescindible de acuerdo con la reivindicación 1 o 2, en donde el ácido nucleico de (b) y el ácido nucleico de (c) están operativamente unidos al promotor y la transcripción del ácido nucleico de (b) y del ácido nucleico de (c) produce una molécula de ARN que comprende dicha ribozima autoescindible y un ARNm que codifica dicho producto de ácido nucleico, en donde dicha ribozima autoescindible es capaz de escindir dicha molécula de ARN de forma intramolecular.

7. Molécula polinucleotídica recombinante de acuerdo con la reivindicación 6, en donde el ácido nucleico de (c) comprende además un ácido nucleico que codifica un aptámero que está en una posición de tal forma que la actividad escisora de la ribozima autoescindible se puede regular por la fijación de un efector al aptámero;

y en donde, de forma optativa, o:

(a) el ácido nucleico de (c) codifica al menos dos de las ribozimas autoescindibles; o

(b) la ribozima autoescindible es tal que además, de forma optativa:

(i) la molécula polinucleotídica recombinante está presente en el genoma de una célula; o

(ii) la molécula polinucleotídica recombinante está presente en un vector.

8. Célula hospedadora aislada:

(a) transformada con el ácido nucleico de la reivindicación 4;

(b) que comprende la molécula polinucleotídica recombinante de acuerdo con la reivindicación 7; y en donde de forma optativa:

(i) la célula es una célula de mamífero; o

(ii) la célula comprende además un agente que inhibe la escisión de la ribozima autoescindible, en donde el agente se selecciona del grupo que consiste en inhibidores aminoglucósidos, toyocamicina, 8azaadenosina, sangivamicina, tubercidina, monofosfato cíclico de tubercidina, monofosfato de tubercidina, trifosfato de tubercidina, nebularina, nucleósido tricíclico, 5-fluorouridina, 5-bromouridina, 5-fluorouracilo,

Syto-83, bromuro de etidio, naranja de acridina y un oligonucleótido antisentido de dicha ribozima autoescindible; o (c) que comprende el ácido nucleico de acuerdo con la reivindicación 4.

9. Vector vírico o virus, que comprende:

(a) un promotor;

(b) un ácido nucleico que codifica un producto de ácido nucleico;

(c) un ácido nucleico que codifica una ribozima autoescindible de acuerdo con la reivindicación 1 o 2, y en donde el ácido nucleico de (b) y el ácido nucleico de (c) están operativamente unidos al promotor y la transcripción del ácido nucleico de (b) y del ácido nucleico de (c) produce una molécula de ARN que comprende dicha ribozima autoescindible y un ARNm que codifica dicho producto de ácido nucleico, en donde dicha ribozima autoescindible es capaz de escindir dicha molécula de ARN de forma intramolecular.

10. Vector vírico o virus de acuerdo con la reivindicación 9, en donde el ácido nucleico de (c) comprende además un ácido nucleico que codifica un aptámero que está en una posición de tal forma que la actividad escisora de dicha ribozima autoescindible se puede regular por la fijación de un efector a dicho aptámero;

11. Oligonucleótido antisentido modificado de una ribozima autoescindible de acuerdo con la reivindicación 1 o 2.

12. Oligonucleótido antisentido modificado de acuerdo con la reivindicación 11:

(a) seleccionado del grupo que consiste en: morfolino, fosforotioato de ARN, ARN 2’-O-metilado, y fosforotioato de AR.

2. O-metoxietilado; o

(b) cuyo oligonucleótido antisentido modificado aparea sus bases con una región de la ribozima autoescindible tal y como se presenta en gugcguccuggauuccacugcuaucc (SEQ ID nº 67) .

13. Kit para regular la expresión génica, que comprende un ácido nucleico que comprende:

(a) una secuencia que codifica una ribozima autoescindible de acuerdo con la reivindicación 1 o 2, y

(b) un sitio de clonación para introducir una secuencia nucleotídica deseada que se ha de transcribir operativamente unida a la secuencia que codifica dicha ribozima autoescindible.

14. Kit de acuerdo con la reivindicación 13,

(a) que comprende además un agente que inhibe la escisión de la ribozima autoescindible, en donde el agente se selecciona del grupo que consiste en inhibidores aminoglucósidos, toyocamicina, 8-azaadenosina, sangivamicina, tubercidina, monofosfato cíclico de tubercidina, monofosfato de tubercidina, trifosfato de tubercidina, nebularina, nucleósido tricíclico, 5-fluorouridina, 5-bromouridina, 5-fluorouracilo, Syto-83, bromuro de etidio, naranja de acridina y un oligonucleótido antisentido de dicha ribozima autoescindible, en donde la transcripción de dicha secuencia nucleotídica deseada está inhibida en ausencia del inhibidor; o

(b) en donde el ácido nucleico comprende al menos dos de dichas ribozimas autoescindibles.