Inventos patentados en España.

Inventos patentados en España.

Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2013.

Remolacha tolerante al glifosato.

Patente Internacional (Tratado de Cooperación de Patentes). Resumen:

Una planta de remolacha tolerante al glifosato, caracterizada porque

a) un fragmento de ADN del ADN genómico de la planta de remolacha

, partes o semillas de la misma, puedeser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencianucleotídica de SEQ ID NO: 3 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 4,presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 6, y/o

b) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puedeser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencianucleotídica de SEQ ID NO: 9 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 10,presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 12, y/o

c) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puedeser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencianucleotídica de SEQ ID NO: 14 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 16,presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 17.

Solicitante: KWS SAAT AG.

Nacionalidad solicitante: Alemania.

Dirección: Grimsehlstrasse 31 37555 Einbeck ALEMANIA.

Inventor/es: NEHLS,REINHARD, KRAUS,JOSEF, SAUERBREY,ELKE, LOOCK,ANDREAS, JANSEN,RUDOLF.

Fecha de Publicación de la Concesión: 18 de Julio de 2012.

Clasificación Internacional de Patentes: A01H5/00 (Plantas con flores, es decir, angiospermas), C12N15/82 (....para células vegetales [5]), C12Q1/68 (.en los que intervienen ácidos nucleicos [3]).

Volver al resumen de la patente.

Remolacha tolerante al glifosato.
Descripción:

Remolacha tolerante al glifosato

La invención se refiere a plantas de remolacha, material vegetal y semillas tolerantes al glifosato, así como a un procedimiento y un kit de ensayo para la identificación de una planta de remolacha tolerante al glifosato.

La remolacha (Beta vulgaris) se produce como un cultivo comercial en muchos países, con una cosecha global de más de 240 millones de toneladas métricas.

La N-fosfonometilglicina, comúnmente denominada glifosato, es un herbicida de amplio espectro que se usa extensamente debido a su alto rendimiento, biodegradabilidad y baja toxicidad para animales y seres humanos. El glifosato inhibe la ruta del ácido shikímico que lleva a la síntesis de compuestos aromáticos, incluyendo aminoácidos y vitaminas. En particular, el glifosato inhibe la conversión del ácido fosfoenolpirúvico y el shikimato-3-fosfato en 5enolpiruvil-shikimato-3-fosfato, por inhibición de la enzima 5-enolpiruvil-shikimato-3-fosfato sintasa (EPSP sintasa o EPSPS) . Cuando plantas convencionales son tratadas con glifosato, las plantas no pueden producir los aminoácidos aromáticos (por ejemplo fenilalanina y tirosina) necesarios para crecer y sobrevivir. EPSPS está presente en todas las plantas, bacterias y hongos. No está presente en animales, quienes no sintetizan sus propios aminoácidos aromáticos. Debido a que la ruta biosintética de los aminoácidos aromáticos no está presente en mamíferos, aves ni formas de vida acuáticas, el glifosato tiene poca o ninguna toxicidad para estos organismos. La enzima EPSPS está presente naturalmente en alimentos procedentes de fuentes vegetales y microbianas.

El glifosato es el ingrediente activo en herbicidas como por ejemplo Roundup®, producido por Monsanto Company, EE.UU. Típicamente, se formula como una sal soluble en agua como por ejemplo una sal de amonio, alquilamina, metal alcalino o trimetil-sulfonio. Una de las formulaciones más comunes es la sal de isopropilamina del glifosato, que es la forma empleada en el herbicida Roundup®.

Se ha demostrado que se pueden obtener plantas tolerantes al glifosato insertando en el genoma de la planta la capacidad para producir una EPSP sintasa que es tolerante al glifosato, por ejemplo la CP4-EPSPS de la cepa CP4AcO de Agrobacterium sp.

Se puede obtener una planta de remolacha tolerante al glifosato por transformación mediada por Agrobacterium, introduciendo en el genoma de la planta un gen que codifica para una EPSPS tolerante al glifosato tal como CP4-EPSPS. Esta planta de remolacha que expresa CP4-EPSPS se ha descrito en el documento WO 99/23232. Sin embargo, las plantas de remolacha cultivadas a partir de células transformadas de esta manera con el gen para CP4-EPSPS difieren mucho en sus características, debido al hecho de que el gen es insertado en una posición aleatoria en el genoma de la planta. La inserción de un transgen particular en una ubicación específica en un cromosoma se denomina frecuentemente "evento". El término "evento" también se usa para diferenciar variedades de cultivos modificados por ingeniería genética. Los eventos deseados son muy raros. La gran mayoría de los eventos son desechados porque el transgen se inserta en un gen de la planta importante para el crecimiento, lo que hace que el gen se altere y no se exprese, o el transgen se inserta en una porción del cromosoma que no permite la expresión del transgen o permite una expresión demasiado baja. Por esta razón es necesario examinar un gran número de eventos para identificar un evento caracterizado por una expresión suficiente del gen introducido. Este procedimiento consume mucho tiempo y genera muchos gastos y no garantiza de ninguna manera que pueda encontrarse una planta con propiedades satisfactorias.

Por lo tanto, el objetivo de la presente invención es proporcionar una planta de remolacha que muestre un alto nivel de tolerancia contra el glifosato, pero que no tenga desventajas con respecto a otras propiedades agronómicas importantes, tales como crecimiento, rendimiento, calidad, resistencia a patógenos, etc.

La planta de remolacha tolerante al glifosato de acuerdo con la invención se caracteriza porque: a) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 3 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 4, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 6, y/o b) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 9 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 10, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 12, y/o c) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 14 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 16, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 17.

La reacción en cadena de polimerasa (PCR) es un método estándar bien conocido para amplificar moléculas de ácido nucleico (véase por ejemplo la patente norteamericana US 4.683.202) .

La planta de remolacha de acuerdo con la invención (en adelante denominada "evento H7-1") muestra una alta tolerancia al herbicida glifosato. Además, las características de crecimiento y otras propiedades agronómicas importantes del evento H7-1 no son afectadas por el proceso de transformación. El evento H7-1 expresa a un alto nivel el gen CP4-EPSPS de Agrobacterium, que está incorporado de forma estable en el genoma de la planta y que confiere a la planta tolerancia al glifosato. La planta fue obtenida por tecnología de transformación mediada por Agrobacterium, usando el vector binario PV-BVGT08. Este vector contiene, entre la región de borde (“Border"-Region) izquierda y la derecha, las siguientes secuencias: una región de codificación compuesta de una secuencia de codificación de un péptido de tránsito de los cloroplastos de la EPSPS de Arabidopsis thaliana (denominada ctp2) unida a la secuencia de codificación de CP4-EPSPS, y bajo la regulación del promotor del virus de mosaico de escrofularia (pFMV) y la secuencia de terminación de la transcripción E9-3' de Pisum sativum.

En una forma de realización preferida de la invención, los fragmentos de ADN de 3706 bp, 751 bp y 1042 bp muestran al menos 95%, de preferencia al menos 99%, de mayor preferencia al menos 99, 9% de identidad con las secuencias nucleotídicas de SEQ ID NO: 6, SEQ ID NO: 12 o SEQ ID NO: 17, respectivamente. Por ejemplo, 95% de identidad significa que el 95% de los nucleótidos de una secuencia dada son idénticos a la secuencia comparada. Para este propósito, las secuencias pueden ser alineadas y comparadas usando el programa BLAST (disponible por ejemplo en http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html) . De máxima preferencia, el fragmento de ADN de 3706 bp tiene la secuencia nucleotídica de SEQ ID NO: 6, el fragmento de ADN de 751 bp tiene la secuencia nucleotídica de SEQ ID NO: 12 y/o el fragmento de ADN de 1042 bp tiene la secuencia nucleotídica de SEQ ID NO: 17.

La presente invención también se refiere a la semilla depositada en NCIMB, Aberdeen (Escocia, Reino Unido) , y que tiene el número de acceso NCIMB 41158 o NCIMB 41159. Dicha semilla se puede usar para obtener una planta de remolacha tolerante al glifosato. La semilla se puede sembrar y la planta obtenida será tolerante al glifosato.

La invención también se refiere a una célula, tejido o parte de una planta de remolacha tolerante al glifosato.

Otro aspecto de la presente invención es un método para la identificación de una planta de remolacha tolerante al glifosato, caracterizado porque el método comprende la (s) etapa (s) de: a) amplificar un fragmento de ADN de 3500-3900 bp, de preferencia 3706 bp, del ADN genómico de plantas de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 3 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 4, y/o b) amplificar un fragmento de ADN de 710-790 bp, de preferencia 751 bp, del ADN genómico de la planta de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 9 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 10, y/o c) amplificar un fragmento de ADN de 990-1100 bp, de preferencia 1042 bp, del ADN genómico de la planta de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 14 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 16.

El método permite la detección de una planta de remolacha transgénica tolerante al glifosato, con técnicas estándar de biología molecular.

La invención también se refiere a un kit de ensayo para identificar una planta de remolacha transgénica tolerante al glifosato, sus células, tejidos o partes, comprendiendo al menos un par de cebadores con un primer y un segundo cebador para una reacción en cadena de polimerasa, donde el primer cebador reconoce una secuencia dentro del ADN foráneo incorporado en el genoma de dicha planta, y el segundo cebador reconoce una secuencia dentro de las regiones flanqueadoras 3' o 5' de dicho ADN, siendo la planta una planta de acuerdo con la reivindicación 1. Según una realización preferida de la invención, el kit de ensayo está caracterizado porque a) el primer cebador presenta la secuencia nucleotídica de SEQ ID NO: 9 y el segundo cebador presenta la secuencia nucleotídica de SEQ ID NO: 10, y/o b) el primer cebador presenta la secuencia nucleotídica de SEQ ID NO: 14 y el segundo cebador presenta la secuencia nucleotídica de SEQ ID NO: 16.

De preferencia, el primer cebador presenta la secuencia nucleotídica de SEQ ID NO: 9 o SEQ ID NO: 14, y el segundo cebador presenta la secuencia nucleotídica de SEQ ID NO: 10 o SEQ ID NO: 16.

Las siguientes figuras sirven para aclarar la invención. Ellas muestran:

Figura 1:Mapa del vector binario PV-BVGT08.

Figura 2:Identificación de H7-1 por análisis PCR. Se analizaron muestras de ADN provenientes de 18 plantas. Control negativo = ADN de remolacha no transformada; control positivo = ADN del transformante original H7-1.

Figura 3:Identificación del evento H7-1 por PCR Multiplex y discriminación entre el evento transgénico H7-1 y plantas no transgénicas. Se analizaron muestras de ADN provenientes de 54 plantas.

Figura 4:El inserto pFMV-ctp2-CP4-EPSPS-E9-3' con los sitios de corte de las enzimas de restricción HindIII, XbaI, ClaI, PstI y BamHI.

Figura 5:Análisis del número de insertos/copias del evento H7-1. Para el análisis de inmunotransferencia "Southern blot", 10 !g de ADN genómico de H7-1 fueron digeridos con PstI, HindIII, XbaI, ClaI y BamHI (carriles 3 a 7) . ADN genómico no transformado, como control negativo, fue digerido con BamHI (carril 8) . El plásmido PV-BVGT08, como control positivo, fue digerido con BamHI. Los carriles 2 y 9 representan marcadores de tamaño. La mancha fue

sondeada con una región de codificación de CP4-EPSPS marcada con 32P. La sonda es una secuencia interna del gen CP4-EPSPS que abarca los pares de bases 447-1555.

Figura 6: Análisis "Southern blot" del evento H7-1 para evaluar el estado intacto de la región de codificación de ctp2-CP4-EPSPS. 10 !g de ADN genómico de H7-1, ADN de control no transgénico y ADN de control no transgénico mezclado con PV-BVGT08 fueron digeridos con XbaI y HindIII/BamHI. La mancha fue sondeada con un fragmento

de CP4-EPSPS generado por PCR marcado con 32P.

Figura 7:Análisis "Southern blot" del evento H7-1 para evaluar el estado intacto de la región del promotor. 10 !g de ADN genómico de H7-1, ADN de control no transgénico y ADN de control no transgénico mezclado con PV-BVGT08 fueron digeridos con HindIII, XbaI y SacI/XhoI. La mancha fue sondeada con un fragmento del promotor (HindIII)

marcado con 32P (= secuencia de PV-BVGT08, bp 7972-8583) o con el casete completo promotor-ctp2-CP4EPSPS-E9-3' (PmeI/XhoI) (= secuencia de PV-BVGT08, bp 7935-2389) .

Figura 8:Análisis "Southern blot" del evento H7-1 para evaluar el estado intacto de la región poliadenilada (poli A) . 10 !g de ADN genómico de H7-1, ADN de control no transgénico y ADN de control no transgénico mezclado con PV-BVGT08 fueron digeridos con EcoRI/PstI, XbaI, HindIII y PstI. La mancha fue sondeada con un fragmento de

poliadenilación E9-3' (BamHI/XhoI) marcado con 32P (= secuencia de PV-BVGT08, bp 1702-2389) .

Figura 9:Fragmentos usados como sondas para evaluar la ausencia de ADN del esqueleto del vector en el evento H7-1.

Figura 10: Análisis "Southern blot" del evento H7-1 para evaluar la ausencia de ADN del esqueleto del vector en el

evento H7-1. 10 μg de ADN genómico de H7-1, ADN de control no transgénico y ADN de control no transgénico mezclado con PV-BVGT08 fueron digeridos con XbaI. La mancha fue sondeada con un fragmento marcado con 32P que abarcaba el esqueleto completo de PV-BVGT08 (sondas 1-4) .

Figura 11: Comparación entre los fragmentos de PCR y las secuencias de PV-BVGT08 en la región de borde izquierdo (LB, del inglés “left border”)

Figura 12: Comparación entre los fragmentos de PCR y las secuencias de PV-BVGT08 en la región de borde derecho (RB, del inglés “right border”) .

Figura 13: Análisis del ADN genómico fuera del sitio de unión derecho del inserto. Aproximadamente 50 ng, ya sea de ADN genómico del evento H7-1, ADN de control no transgénico o agua fueron usados para reacciones PCR con las combinaciones de cebadores P1, donde ambos cebadores están ubicados fuera del inserto, y P3, donde un cebador se localiza dentro del inserto y el otro cebador se dispone fuera del inserto.

Figura 14: Análisis del ADN genómico fuera del sitio de unión izquierdo del inserto. Aproximadamente 50 ng de ADN genómico de H7-1, ADN de control no transgénico y agua fueron usados para reacciones PCR con las combinaciones de cebadores P2, donde ambos cebadores están ubicados fuera del inserto, y P4, donde un cebador se localiza dentro del inserto y el otro cebador se dispone fuera del inserto.

Figura 15: Mapa de progenies de los cultivos de semillas de H71-1.

Figura 16: Análisis "Southern blot" del evento H7-1 para evaluar si el ADN insertado está integrado en forma estable dentro del genoma. 10 !g de ADN genómico de H7-1 (el transformante original H-7-1-1995 y tres progenies, H7-11996 a 1998) y ADNs de control no transgénicos de diferentes orígenes fueron digeridos con BamHI, XbaI y HindIII.

La mancha se estudió con una sonda de CP4-EPSPS marcada con 32P de PV-BVGT08 (= bp 447-1555) .

La invención se explica más detalladamente a continuación, mediante los ejemplos seleccionados.

A continuación se presenta una lista de abreviaturas:

~ aproximadamente °C grado Celsius bidest agua estéril doblemente destilada bp par (es) de bases CTAB bromuro de cetiltrimetilamonio ADN ácido desoxirribonucleico

E. coli Escherichia coli EDTA ácido etilendiaminotetraacético Fig. Figura h Hora HCl ácido clorhídrico kb par (es) de kilobases kg Kilogramo M, mM molar, milimolar min Minutos Na2HPO4/NaH2PO4 fosfato de sodio

NaCl cloruro de sodio NaOH hidróxido de sodio nt Nucleótido PCR reacción en cadena de polimerasa pmol Picomol ARNasa nucleasa del ácido ribonucleico rpm revoluciones por minuto RR Roundup Ready® RT temperatura ambiente SDS dodecilsulfato de sodio seg Segundo SEVAG cloroformo:alcohol isoamílico (24:1) SSC solución salina de citrato de sodio TE tampón Tris-EDTA TRIS tris (hidroximetil) aminometano

EJEMPLO 1: Identificación del evento H7-1

La remolacha (Beta vulgaris) de genotipo 3S0057 fue modificada genéticamente para expresar una CP4-5enolpiruvil-shikimato-3-fosfato sintasa o CP4-EPSPS, que confiere tolerancia al herbicida glifosato y también se usa como un marcador seleccionable. Esta línea transgénica fue producida por tecnología de transformación mediada por Agrobacterium tumefaciens, usando el vector binario PV-BVGT08. El ADN-T del vector usado para la

transformación de la remolacha contenía, entre la región de borde izquierda y la derecha, las siguientes secuencias: una región de codificación compuesta de una secuencia de codificación de un péptido de tránsito de cloroplastos proveniente de la EPSPS de Arabidopsis thaliana (denominada ctp2) fusionada con la secuencia de codificación de CP4-EPSPS, y bajo la regulación del promotor del virus de mosaico de escrofularia 35S (pFMV) y la secuencia del terminador de transcripción 3' del gen rbcS-E9 de Pisum sativum.

Se usaron los métodos siguientes:

I. Extracción de ADN: Método 1:

Se recolectaron hojas frescas u otros tejidos (20 a 100 mg en un tubo de ensayo de 1, 5 ml) y se agregaron 400 !l de tampón de extracción (véase más abajo) . El tejido fue molido con una pequeña mano de mortero. La mezcla fue sometida a vórtice durante 5 segundos e incubada entre 30 minutos y 60 minutos a temperatura ambiente. A continuación se efectuó una etapa de centrifugación a 13.000 rpm durante 1 minuto. El sobrenadante que contenía

el ADN se vertió en un nuevo tubo de ensayo de 1, 5 ml y se mezcló con 120 !l de isopropanol. La mezcla fue incubada a temperatura ambiente durante 2 minutos. Un precipitado de ADN se formó tras la adición de etanol. Después de una centrifugación a 13.000 rpm durante 5 minutos, el etanol fue decantado. La muestra se dejó secar al aire. El pellet fue redisuelto en 400 !l de H2O o tampón TE (véase más abajo) .

Tampón de extracción (100 ml) :

ml de Tris 1 M (pH 7, 5) 5 ml de NaCl 5 M 5 ml de EDTA 0, 5 M

2, 5 ml de SDS al 20% 67, 5 ml de H2O

Tampón TE: Tris-HCl 10 mM (pH 8, 0) EDTA 1 mM

Método 2: Se reunió material vegetal fresco (20 a 100 mg) en un tubo Eppendorf de 1, 5 ml y se agregaron 500 !l de tampón CTAB (a 65°C) (véase más abajo) . La mezcla se incubó a 65°C durante 1 a 1, 5 h y posteriormente se centrifugó durante 5 segundos. Se agregaron 5 !l de ARNasa A (10 mg/ml) . La mezcla fue incubada durante 30 minutos a

37°C y posteriormente centrifugada durante 5 segundos. Se agregaron 200 !l de SEVAG. Después del mezclado y la centrifugación a 13.000 rpm durante 10 minutos, el sobrenadante fue transferido a un nuevo tubo de ensayo de 1, 5 ml. Un volumen de isopropanol (alrededor de 400 !l) se mezcló cuidadosamente con el sobrenadante. A continuación se efectuó una etapa de centrifugación a 13.000 rpm durante 10 minutos. Se agregaron 600 !l de etanol al 70%. El pellet se lavó invirtiendo el tubo de ensayo varias veces. La mezcla fue nuevamente centrifugada a

13.000 rpm durante 2 minutos. El etanol fue desechado cuidadosamente. El tubo de ensayo fue invertido y drenado sobre papel limpio. La muestra se dejó secar al aire durante 15 minutos. El pellet fue redisuelto en 50 !l de H2O (véase más abajo) .

Tampón CTAB:

NaCl 1, 4 M EDTA 20 mM Tris-HCl 100 mM CTAB al 2% (p/v)

SEVAG: Cloroformo:alcohol isoamílico (24:1)

Tampón de ARNasa: Tris 10 mM, NaCl 15 mM, pH 7, 5

ARNasa A: 10 mg de ARNasa/ml de tampón de ARNasa (5 ml de bidest + 50 mg de ARNasa A, alícuotas en tubos de ensayo de 1, 5 ml, hervir los tubos de ensayo durante 30 minutos a 100°C, almacenar a -20°C)

Normalmente se usó el Método 1. Con este método es posible extraer un gran número de muestras de ADN por día, y la calidad del ADN es aceptable. El Método 2 se usó cuando el material de hojas era más añejo o cuando había problemas con la calidad del ADN. El Método 2 es más complejo, requiere más tiempo y da un rendimiento más bajo de ADN, pero de más alta calidad.

Normalmente no se lleva a cabo una cuantificación del ADN y típicamente en una reacción PCR se emplean de 0, 5 a 1 !l de la solución del ADN extraído.

II. Reacción PCR:

45 Para la reacción PCR se preparó un tampón 10x, mezcla de tampón + dNTPs. El procedimiento es el siguiente:

Solución madre Volumen Conc. en tampón Conc. final en la reacción PCR 10x

Tris-HCl 1M, pH 8, 3 100 !l 0, 1 M Tris-HCl 10 mM, pH 8, 3 KCl 1M 500 !l 0, 5 M KCl 50 mM dATP 100 mM 20 !l 2 mM dATP 0, 2 mM dCTP 100 mM 20 !l 2 mM dCTP 0, 2 mM dTTP 100 mM 20 !l 2 mM dTTP 0, 2 mM dGTP 100 mM 20 !l 2 mM dGTP 0, 2 mM MgCl2 100 mM 150 !l 15 mM MgCl2 1, 5 mM

Agua HPLC 170 !l

1.000 !l en total

Reacción PCR (25 !l) : ADN 0, 5 !l

Cebador 1 1 !l (20 pmol) Cebador 2 1 !l (20 pmol) Taq polimerasa 1 0, 2 !l (1 U, de Oncor Appligene S.A., Heidelberg, Alemania) Tampón 10x conc. 2, 5 !l Agua 18, 8 !l

III. Identificación de H7-1 por PCR

La identificación de H7-1 se efectuó por PCR, usando cebadores específicos para el evento:

Cebador superior (SEQ ID NO: 1) : H7-207U30: 5' TTA ATT TTT GCA GGC GAT GGT GGC TGT TAT 3'

Cebador inferior (SEQ ID NO: 2) : 10 H7-841L30: 5' CAT ACG CAT TAG TGA GTG GGC TGT CAG GAC 3'

El cebador superior está ubicado fuera del inserto y es parte del ADN genómico de la remolacha. El cebador inferior está localizado dentro del gen CP4-EPSPS insertado.

Condiciones de la PCR: 94°C 4 min ETAPA 1 95°C 30 seg ETAPA 2a 55°C 30 seg ETAPA 2b 72°C 2 min ETAPA 2c 72°C 5 min ETAPA 3 4°C durante la noche ETAPA 4

reacción completa

Las etapas 2a-c se repitieron 34 veces.

El producto de PCR esperado es un fragmento de ADN de 664 bp (SEQ ID NO: 13, véase Figura 2) . 20

IV. Identificación de H7-1 por PCR Multiplex

Para la discriminación entre plantas no transgénicas y transgénicas, ya sea homocigóticas o heterocigóticas, se efectuó una PCR Multiplex con tres cebadores diferentes. Se usaron los siguientes cebadores:

H72 (SEQ ID NO: 14) : 5' GCTCTGACACAACCGGTAAATGCATTGGCC 3' H7S2 (SEQ ID NO: 15) : 5' GACCCATAGTTTGATTTTAAGCACGACATG 3' H7R2 (SEQ ID NO: 16) : 5' GCAGATTCTGCTAACTTGCGCCATCGGAG 3'

Condiciones de la PCR: 94°C 2 min ETAPA 1 94°C 1 seg ETAPA 2a 60°C 45 seg ETAPA 2b 72°C 90 seg ETAPA 2c 72°C 5 min ETAPA 3 4°C durante la noche ETAPA 4

reacción completa 30 Las etapas 2a-c se repitieron 34 veces.

Las plantas no transgénicas mostraron sólo un fragmento de PCR de aproximadamente 350 bp. Las plantas transgénicas homocigóticas mostraron un fragmento de aproximadamente 1.042 kb. Las plantas heterocigóticas 35 mostraron ambos fragmentos (véase Figura 3) .

EJEMPLO 2: Caracterización del evento H7-1

Se efectuó un análisis molecular para caracterizar el ADN integrado presente en el evento H7-1. Específicamente, se

determinó el número de insertos (número de sitios de integración dentro del genoma de la remolacha) , el número de copias (el número de fragmentos de ADN dentro de una posición) , la integridad de la región de codificación insertada y sus elementos reguladores, el promotor pFMV y la secuencia del terminador de la transcripción E9-3', la ausencia de secuencias del esqueleto del vector usado para la transformación y la herencia estable del inserto. Además, se identificaron las secuencias que flanqueaban el inserto de ADN.

El ADN insertado del evento de transformación H7-1 de la remolacha fue caracterizado usando las técnicas "Southern blot", PCR y PCR inversa. Se incluyeron controles positivos y negativos (PV-BVGT08, ADN de plantas no transgénicas) y fueron tratados de la misma manera que la sustancia de prueba (H7-1) .

Se aisló ADN del lote número 74903H de plantas del evento H7-1 cultivadas en 1997. También se aisló ADN del transformante original H7-1/3S0057 (= 6401VH) de 1995 y de tres progenies adicionales producidas en 1996, 1997 y 1998 (H7-1/64801H, H7-1/74922H y H7-1/83002S) .

La línea de remolacha no transgénica 3S0057 sirvió como control. Además, las líneas de remolacha 5R7150, 8K1180 y 6S0085 se emplearon como controles negativos. Estas líneas son líneas no transgénicas comunes usadas para cultivar remolacha convencional.

Las sustancias de referencia se correspondieron al plásmido PV-BVGT08 usado para la transformación. El ADN del plásmido y el ADN de la línea de remolacha de control fueron mezclados entre sí, digeridos con enzima de restricción y separados por electroforesis en geles de agarosa, en paralelo con las sustancias de prueba. El plásmido sirvió como un marcador de tamaño para el fragmento esperado y como un control de hibridación positivo. El ADN del plásmido se mezcló con el ADN genómico de la planta a una concentración que representa menos de una copia del elemento que está siendo analizado, para demostrar la sensibilidad del método "Southern blot" (~10 !g de ADN genómico y ~28 pg de ADN de PV-BVGT08) . Para las estimaciones de tamaño, se usó el marcador de tamaño molecular RAOUL® (ONCOR/Appligene, # de catálogo 160673) .

Aislamiento del ADN:

Tejidos vegetales (1 a 3 g de peso húmedo) del lote número 74903H del evento H7-1 se molieron en nitrógeno líquido a un polvo fino, usando mortero y mano de mortero. El polvo fue transferido a un tubo Oakridge de 50 ml y se agregaron 7, 5 ml de tampón CTAB precalentado (a 60°C) (CTAB al 2%, Tris-HCl 100 mM, EDTA 20 mM pH 8, 0, NaCl 1, 4 M y mercaptoetanol al 0, 2%) . Las muestras fueron incubadas a 65°C durante aproximadamente 30 minutos mezclando a la vez. Un volumen igual (8 ml) de una mezcla de cloroformo:alcohol isoamílico (24:1 v/v) a temperatura ambiente se agregó a las muestras. La suspensión se mezcló por inversión y las dos fases se separaron por centrifugación (10 minutos, 9.000 rpm) . La fase acuosa fue transferida a un nuevo tubo Oakridge de 50 ml y a continuación precipitó el ADN por adición de 5 ml de isopropanol. El ADN precipitó por centrifugación (2 minutos,

9.000 rpm) y se retiró el sobrenadante. El ADN precipitado fue incubado con una solución de lavado de etanol al 76% y acetato de amonio 10 mM durante alrededor de 20 minutos. Después de la centrifugación y decantación del sobrenadante, el ADN fue secado al vacío y redisuelto en TE, pH 8, 0 a 4°C durante la noche.

Como un método alternativo, el ADN se aisló mediante el kit DNeasy Plant Maxi Kit de Qiagen (Düsseldorf, Alemania, # de catálogo 68163) . El aislamiento del ADN se efectuó de acuerdo con el manual del fabricante.

Como un método alternativo adicional, el ADN se aisló mediante el kit DNeasy Plant Mini Kit de Qiagen (Düsseldorf, Alemania, # de catálogo 69103) . El aislamiento del ADN se efectuó de acuerdo con el manual del fabricante.

Cuantificación del ADN y digestión con enzimas de restricción:

La cuantificación del ADN se llevó a cabo usando un espectrofotómetro LKB Biochrom UV/visible (Amersham Pharmacia, Freiburg, Alemania) o alternativamente, la cuantificación del ADN se efectuó después de la electroforesis en gel de agarosa, escaneando el ADN con el programa RFLPscan (MWG-Biotech, Ebersberg, Alemania) . Como estándar de calibración se usó High DNA Mass Ladder de Gibco/Life Technologies (Karlsruhe, Alemania) (# de catálogo 10496-016) . Las enzimas de restricción se compraron a Boehringer Mannheim (Mannheim, Alemania) , Stratagene (Amsterdam, Países Bajos) o New England Biolabs (Frankfurt, Alemania) y se usaron de acuerdo con el manual del fabricante.

Preparación de la sonda de ADN:

ADN de PV-BVGT08 fue aislado de cultivos de E. coli. Sondas molde homólogas a la región de codificación de CP4-EPSPS, el promotor 35S, la región de poliadenilación E9-3', el casete 35S-ctp2-CP4-EPSPS-E9-3' y las regiones del esqueleto, se prepararon mediante digestión con las correspondientes enzimas de restricción y a continuación separación por electroforesis en gel de agarosa o por reacción en cadena de polimerasa (PCR) . Los productos se purificaron usando el Gene Clean II Kit de BIO 101 (La Jolla, CA) . El marcaje de las sondas (25 pg) con 32P-dCTP o 32P-dATP se efectuó usando el sistema de marcaje de ADN Megaprime® de Amersham-Pharmacia Biotech Europe (Freiburg, Alemania) .

Análisis "Southern blot":

Las muestras de ADN tratadas con enzimas de restricción se separaron por electroforesis en gel de agarosa durante ~15 horas a ~35 voltios. Después de fotografiar el gel, el ADN fue despurinado remojando el gel durante 15 minutos en una solución de HCl 0, 25 M, fue desnaturalizado incubando el gel durante 30 minutos en una solución desnaturalizante de NaOH 0, 5 M, NaCl 1, 5 M con agitación suave constante, y finalmente fue neutralizado remojando durante 2 horas en varios volúmenes de una solución de NaCl 2 M y Tris-HCl 1 M, pH 5, 5. Los ADNs provenientes de los geles de agarosa fueron transferidos a membranas de nylon Hybond-N® (Amersham Pharmacia Biotech Europe, Freiburg, Alemania) , usando Pressure Blotter de Stratagene de acuerdo con el protocolo del fabricante. Después de remojar el filtro durante 15 minutos en SSPE 2x (SSPE 20x: NaCl 3, 6 M, EDTA 20 mM, NaH2PO4/Na2HPO4 0, 2 M, pH 7, 4) , el ADN fue fijado a la membrana por iluminación con luz UV (Transilluminator

Pharmacia, Freiburg, Alemania) durante 1 minuto y por calentamiento durante 1 hora a 80°C en un horno al vacío. Las manchas fueron prehibridadas durante 4 horas en una solución acuosa de formamida al 50%, SSC 5x, laurilsarcosina al 0, 1%, SDS al 0, 02% y reactivo bloqueador al 2% (Boehringer Mannheim, Alemania, # de catálogo 1096176) . La hibridación con la sonda radiomarcada se efectuó en solución de prehibridación fresca durante 16-18 horas a 42°C. Después de la hibridación, las membranas fueron lavadas durante 5 minutos en SSC 2x a 42°C, durante 20 minutos en SSC 2x, SDS al 1% a 65°C, y durante dos períodos de 15 minutos en SSC 0, 2x, SDS al 0, 1% a 68°C. Se obtuvieron imágenes autorradiográficas de las manchas por exposición de las manchas, usando película Kodak Biomax MS® junto con pantallas intensificadoras Kodak Biomax MS®.

Identificación de las secuencias flanqueadoras genómicas 5' y 3':

El sitio de unión entre el ADN transgénico y el ADN genómico de la planta fue identificado usando la técnica de PCR inversa. El ADN genómico fue purificado como se ha descrito más arriba. Aproximadamente 1 !g del ADN fue digerido en reacciones separadas por las endonucleasas de restricción TaqI, AluI, NdeIII o RsaI. Los fragmentos de ADN digeridos fueron ligados nuevamente mediante T4-ligasa durante la noche, seguido por la reacción PCR. Las diversas combinaciones de cebadores inversos fueron obtenidas usando el software de análisis de cebadores OLIGO® de NBI (National Biosciences, Inc., Plymouth, Michigan) .

Los fragmentos resultantes de esta amplificación por PCR inversa fueron separados por electroforesis en gel, extraídos del gel y purificados usando el kit Gene Clean II®. Los fragmentos purificados fueron clonados dentro del vector pCR®2.1 usando el kit de clonación TOPO®TA de Invitrogen (Groningen, Países Bajos) . Los insertos fueron sometidos a secuenciación por MWG-Biotech (Ebersberg, Alemania) . El análisis de los datos de secuencias obtenidos se efectuó usando el software de análisis de ADN Mac Molly® Tetra (Soft Gene GmbH, Bochold, Alemania) .

Análisis PCR:

El ADN genómico fue preparado con el Mini Kit DNAeasy Plant (Qiagen, Düsseldorf, Alemania) de acuerdo con las instrucciones del fabricante. Aproximadamente 50 ng de ADN genómico fueron usados para la PCR. Las reacciones fueron sometidas a 95°C durante 30 segundos, a 55°C durante 30 segundos y a 72°C durante 2 minutos durante 35 ciclos. La PCR se efectuó en un ciclador PTC200 (Biozym, Oldendorf, Alemania) . Los productos de la PCR fueron analizados por electroforesis en gel de agarosa.

1. Número de insertos:

El número de insertos, el número de sitios de integración del ADN transgénico en el genoma de la remolacha, fue evaluado para H7-1. Con el fin de determinar el número de insertos, el ADN genómico fue digerido con las enzimas de restricción HindIII, XbaI y BamHI. Como control negativo, ADN de una planta de control no transformada, que representaba los mismos antecedentes genéticos, fue digerido con HindIII. Como control positivo, se usó ADN del vector de transformación (PV-BVGT08) .

XbaI y BamHI cortan PV-BVGT08 sólo una vez y no cortan dentro de la sonda de CP4-EPSPS marcada usada (véase Figura 4) . HindIII corta tres veces PV-BVGT08, pero los tres sitios están ubicados fuera de la sonda y al mismo lado, 5', con respecto a la sonda. Así, cada enzima debería liberar un fragmento de ADN único que se hibridaría con la sonda de CP4-EPSPS y contendría una parte del ADN insertado y ADN genómico adyacente de la planta. El número de fragmentos detectados indica el número de insertos presentes en el evento. Los resultados se muestran en la Figura 5.

Después de la digestión con las enzimas HindIII, XbaI o BamHI, solamente se encontró un fragmento de hibridación único, respectivamente. Los fragmentos de 5, 2 kb proveniente de la digestión con HindIII (carril 4) , de 4 kb proveniente de la digestión con XbaI (carril 5) y de aproximadamente 11 kb proveniente de la digestión con BamHI (carril 7) , muestran que el transformante H7-1 representa un evento con una integración única (Figura 4) . La fuerte señal en el carril 1 representa el plásmido PV-BVGT08 linealizado. Las señales débiles adicionales se refieren a pequeñas cantidades de PV-BVGT08 no digerido o a señales de fondo de hibridación inespecíficas.

2. Número de copias

Teóricamente, un sitio de integración podría estar constituido por más de una copia del ADN insertado. Pero debido a los tamaños de los fragmentos del análisis de restricción presentados más arriba, esto no fue posible. Si hubiera más de una copia del ADN insertado presente en H7-1, se detectarían fragmentos adicionales. Esto fue confirmado también por una digestión con la enzima de restricción PstI. PstI corta dos veces dentro de las secuencias de borde izquierda y derecha. Uno de los sitios de restricción está dentro de la región de codificación de CP4-EPSPS, de manera que después de la digestión se podrían esperar dos fragmentos que se hibridan con la sonda de CP4-EPSPS. Uno de los fragmentos esperados corresponde al fragmento interno de aproximadamente 1, 2 kb. El segundo fragmento debería ser un fragmento de borde. Nuevamente, si hubiera más de una copia, los fragmentos adicionales serían detectables. Pero los resultados indican que PstI corta el ADN como se esperaba. Se detectó el fragmento interno de 1, 2 kb y sólo un fragmento adicional de aproximadamente 4, 9 kb (Figura 5, carril 3; Figura 4) .

Como un control interno adicional, el ADN fue cortado con ClaI (Figura 5, carril 6; Figura 4) . Como se esperaba, se hibridó un fragmento único de 2, 4 kb, ya que ClaI corta dos veces pero a la izquierda y a la derecha fuera del fragmento de CP4-EPSPS usado. Este resultado también es una prueba del estado intacto del fragmento de ADN integrado y concuerda con los resultados que se dan más adelante.

La hibridación del plásmido PV-BVGT08 (PV-BVGT08 = 8590 bp) con el fragmento de CP4-EPSPS da como resultado una señal de 8, 6 kb (Figura 5, carril 1) como se esperaba. Una segunda banda más pequeña y muy tenue se debe a la restricción incompleta de PV-BVGT08.

En resumen, los experimentos muestran que la línea de remolacha transformada H7-1 contiene una única copia del ADN-T de PV-BVGT08 en el genoma de la planta.

3. Estado intacto de la región de codificación

La integridad del casete del gen CP4-EPSPS con respecto a los elementos individuales (promotor P-FMV, región de codificación de ctp2-CP4-EPSPS y región no traducida E9-3') , fue determinada por digestión con las enzimas HindIII para P-FMV, HindIII más BamHI para ctp2-CP4-EPSPS, y EcoRI y PstI para la región no traducida E9-3'. Se efectuaron experimentos adicionales con SacI y XhoI para la región P-FMV-ctp2-CP4-EPSPS y para la región E9-3'. ADN del plásmido, mezclado con ADN de remolacha no transgénica y ADN de remolacha no transgénica solo, fueron digeridos con las mismas enzimas como controles positivo y negativo, respectivamente.

Estas enzimas cortan dentro del inserto de ADN objetivo, entre los bordes izquierdo y derecho del ADN-T (véase el mapa del plásmido en la Figura 1) , de manera que, si los elementos respectivos están intactos, el tamaño de los fragmentos hibridados debería ser idéntico en el ADN de H7-1 y el ADN de PV-BVGT08.

Como controles adicionales, los ADNs fueron digeridos con XbaI. XbaI corta una vez entre el promotor y la región de codificación de ctp2-CP4-EPSPS. Por lo tanto, se podría esperar un fragmento de 8, 6 kb con el ADN de PV-BVGT08 y, en el caso del H7-1, un fragmento de borde que difiere en tamaño comparado con el fragmento de PV-BVGT08. Los resultados se presentan en las Figuras 6, 7 y 8.

Figura 6: La digestión con HindIII y BamHI liberó el gen CP4-EPSPS y la mancha fue sondeada con un fragmento de CP4-EPSPS generado por PCR. El control negativo (carril 6) no mostró ninguna banda de hibridación. ADN genómico del evento H7-1 y plásmido PV-BVGT08 mezclado con ADN no transgénico produjeron ambos un fragmento de aproximadamente 1, 7 kb, que corresponde al tamaño esperado. La digestión con XbaI dio como resultado el fragmento de 8, 6 kb esperado del PV-BVGT08 linealizado. Para el evento H7-1, la digestión dio como resultado el fragmento de borde de aproximadamente 4, 0 kb (véanse también las Figuras 4 y 5) . Nuevamente, el control negativo no mostró ninguna señal.

Figura 7:La digestión con HindIII liberó el promotor del virus de mosaico de escrofularia y la mancha fue sondeada con un fragmento del promotor generado por PCR. El control negativo (carril 5) no mostró ninguna señal de hibridación. Tanto el ADN genómico del evento H7-1 como el plásmido PV-BVGT08 mezclado con ADN no transgénico produjeron ambos un fragmento que se hibrida con un tamaño aproximado de 0, 6 kb. Este fragmento corresponde al tamaño esperado del promotor (carriles 4 y 6) .

La digestión con XbaI dio como resultado el fragmento de 8, 6 kb esperado del PV-BVGT08 linealizado y el fragmento de borde izquierdo de aproximadamente 1, 3 kb (carriles 1 y 3) del evento H7-1. Este fragmento de 1, 3 kb también es una prueba adicional de que el evento H7-1 contiene solamente una copia única del transgen. Nuevamente, el control negativo (carril 2) no mostró ninguna señal.

La digestión con SacI/XhoI liberó el promotor junto con la región de codificación de CP4-EPSPS y la región de poliadenilación. La hibridación con el casete completo promotor-ctp2-CP4-EPSPS-señal de poliadenilación (fragmento PmeI/XhoI) produjo los fragmentos esperados promotor-ctp2-CP4-EPSPS de 2, 3 kb y señal de poliadenilación de 0, 7 kb, tanto con el ADN de PV-BVGT08 mezclado con ADN no transgénico como con ADN genómico de H7-1 (carriles 9 y 11) .

Figura 8:La digestión con PstI y EcoRI liberó la señal de poliadenilación E9-3' y la mancha fue sondeada con un fragmento de señal de poliadenilación. El control negativo (carril 3) no mostró ninguna banda de hibridación. Tanto el plásmido PV-BVGT08 mezclado con ADN no transgénico como el ADN genómico del evento H7-1 produjeron un fragmento de aproximadamente 0, 6 kb que corresponde al tamaño esperado. La digestión con XbaI dio como resultado el fragmento esperado de 8, 6 kb del PV-BVGT08 linealizado y un fragmento de borde de aproximadamente 4, 0 kb con el evento H7-1.

La digestión con PstI liberó la señal de poliadenilación E9-3' combinada con una porción 3' de 0, 5 kb de la región de codificación de CP4-EPSPS. El fragmento de 1, 2 kb resultante era detectable como se esperaba, con el ADN genómico de H7-1 y también con el ADN de PV-BVGT08.

La digestión con HindIII dio como resultado el fragmento de 8, 0 kb del PV-BVGT08 linealizado menos el fragmento del promotor (carril 13) y un fragmento de borde de 5, 2 kb (carril 11) con H7-1. El fragmento único de 5, 2 kb proveniente de la digestión con HindIII y el fragmento único de 4, 0 kb proveniente de la digestión con XbaI, también son una prueba adicional de que el evento H7-1 contiene sólo una copia del ADN insertado. Nuevamente, el control negativo no mostró ninguna señal.

En resumen, los resultados de las manchas prueban que todos los elementos del ADN transferido están intactos y que el evento H7-1 contiene una región de codificación de CTP2-CP4-EPSPS única intacta con sus elementos reguladores, el promotor pFMV y la secuencia de terminación de la transcripción E9-3'.

4. Análisis para la detección de fragmentos del esqueleto

La región del esqueleto de un plásmido Ti se define como la región fuera del ADN-T limitada por secuencias de borde izquierda y derecha, que está constituida por los genes ori y los genes de selección para la replicación bacteriana y la selección bacteriana, y que normalmente no es transferida al genoma de la planta por transformación mediada por Agrobacterium. Para confirmar la ausencia de ADN del esqueleto del vector en el evento H7-1, ADN genómico de H7-1, de un control no transformado y ADN genómico de H7-1 mezclado con ADN de PV-BVGT08, fueron digeridos con la enzima de restricción XbaI y sondeados con tres sondas solapadas generadas por PCR, que abarcaban la secuencia completa del esqueleto. Una cuarta sonda está constituida por el esqueleto completo en un fragmento.

Las sondas usadas representan la secuencia del esqueleto (véase Figura 9) :

1: bp 2730- 5370

2: bp 5278- 6419

3: bp 6302- 7851

4: bp 2730- 7851

La Figura 10 muestra el resultado del análisis "Southern blot". Carriles 6, 10, 14 y 18: el ADN genómico de H7-1 digerido, sondeado con los fragmentos de esqueleto del esqueleto completo, no mostró ninguna banda de hibridación. Sólo los carriles 4, 8, 12, 16 y 20: el ADN genómico de H7-1 mezclado con ADN de PV-BVGT08, muestra bandas de 8, 6 kb como se esperaba. Las bandas representan el ADN de PV-BVGT08 linealizado.

Carriles 2 y 4: el ADN genómico de H7-1 y el ADN genómico de H7-1 mezclado con PV-BVGT08, e hibridado con el fragmento de CP4-EPSPS, mostró señales de hibridación. La banda de 4 kb en el carril 2 representa el fragmento de borde derecho, las dos bandas del carril 4 representan nuevamente el fragmento de borde derecho de 4, 0 kb y elplásmido PV-BVGT08 linealizado de 8, 6 kb. Ambas bandas tienen la misma intensidad. Ésta es una clara indicación de que la concentración del ADN de PV-BVGT08 agregado es comparable a la concentración del elemento CP4-EPSPS en el ADN de H7-1. La concentración del ADN plasmídico usado es equivalente a 0, 5 copias. Si hubiera secuencias del esqueleto integradas en el genoma de H7-1, se podrían detectar señales claras.

Estos resultados prueban que H7-1 no contiene ninguna secuencia detectable del esqueleto del plásmido usado para la transformación. Este resultado también se sustentó en los datos del análisis de las regiones genómicas flanqueadoras 5' y 3' (véase más abajo) .

5. Identificación de secuencias genómicas flanqueadoras 5' y 3'

La transformación mediada por Agrobacterium normalmente conduce a la integración de todas las secuencias entre los bordes izquierdo y derecho dentro del genoma de la planta. Los extremos 5' y 3' del ADN plasmídico integrado deberían estar dentro de o cerca de las secuencias de borde izquierdo o de borde derecho, respectivamente. Por lo tanto, se usó una técnica de PCR inversa para identificar esas regiones. Los productos de PCR clonados fueron secuenciados y los datos de las secuencias fueron comparados con la secuencia de PV-BVGT08.

La Figura 11 muestra el alineamiento de la secuencia del fragmento de PCR inversa clonado (D1U.RPT) (=genoma H7-1, secuencia superior) , obtenido con cebadores para el análisis de la región de borde izquierdo, con la secuencia de PV-BVGT08 (secuencia inferior) . La comparación de ambas secuencias muestra que la homología se detiene exactamente dentro de la secuencia del borde.

La Figura 12 muestra el alineamiento de la secuencia del fragmento de PCR inversa clonado (B3UNI.RPT) (= genoma H7-1, secuencia superior) , obtenido con cebadores para el análisis de la región de borde derecho, versus la secuencia de PV-BVGT08 (secuencia inferior) . La comparación de ambas secuencias muestra que la homología se detiene ya 18 nucleótidos antes de la secuencia del borde.

En total, ésta es una clara indicación de que la secuencia entre los bordes izquierdo y derecho del plásmido Ti PV-BVGT08 está correctamente integrada. La secuencia se detiene dentro de o inmediatamente antes de los bordes. Estos datos sustentan los resultados del análisis del esqueleto, de que ninguna secuencia del esqueleto fuera de las regiones de borde fue integrada dentro del genoma de H7-1.

Para determinar si las secuencias flanqueadoras al lado derecho o izquierdo del inserto en el evento H7-1 de remolacha son secuencias genómicas intactas de la planta, se efectuó un análisis por PCR inversa con las combinaciones de cebadores P1, P2, P3 y P4.

Los cebadores de las combinaciones de cebadores P1 y P2 están ubicados fuera del inserto. Si el ADN de la posición de inserción dentro del evento H7-1 es idéntico al ADN de un control no transformado, la PCR debería dar como resultado dos fragmentos de PCR que representan la síntesis a partir de las dos combinaciones de cebadores. Los cebadores de las combinaciones de cebadores P3 y P4 están diseñados de manera tal que uno de los cebadores respectivos está ubicado dentro del inserto CP4-EPSPS y el otro cebador está ubicado fuera del inserto, dentro del ADN genómico de la planta. Por tanto, la PCR debería producir exclusivamente fragmentos del ADN del evento H7-1.

Los datos de secuencias de la técnica de PCR inversa combinados con los datos del vector PV-BVGT08 dan como resultado una secuencia que incluye el inserto de H7-1 (secuencia de PV-BVGT08) , las regiones de sitios de unión derecho e izquierdo y ADN genómico de remolacha adicional (SEQ ID NO: 5) .

Para la identificación de los sitios de unión del transgen al ADN genómico de la planta (identificación de la especificidad del evento) y para las regiones de ADN genómico a los lados izquierdo y derecho del inserto, se usaron las siguientes combinaciones de cebadores:

Combinación P1 (cebador para analizar el ADN genómico fuera de la región de borde derecho, SEQ ID NO: 18, SEC ID NO: 19) :

Cebador superior: 5'CGG TAA ATG CAT TGG CCT TTG TT Cebador inferior: 5'CAC CCA GAT CCC AAT AAA ACC GTA AT Producto de PCR esperado 241 bp

Combinación P2 (cebador para analizar el ADN genómico fuera de la región de borde izquierdo, SEQ ID NO: 20, SEC ID NO: 21) :

Cebador superior: 5'AAA TGG TTG TAG ATA AAT AAG GAA ATC A Cebador inferior: 5'ACA TGT TTG AGC ACT CTT CTT GT Producto de PCR esperado 377 bp

Combinación P3 (cebador para analizar el sitio de unión del transgen al ADN genómico de la planta, SEQ ID NO: 7, SEQ ID NO: 8) :

Cebador superior: 5'ATG CAT TGG CCT TTG TTT TTG AT Cebador inferior: 5'TGT CGT TTC CCG CCT TCA G Producto de PCR esperado 288 bp (SEQ ID NO: 11)

Combinación P4 (cebador para analizar el sitio de unión del transgen al ADN genómico de la planta, SEQ ID NO: 9, SEQ ID NO: 10) :

Cebador superior: 5'CGC TGC GGA CAT CTA CAT TTT TGA AT Cebador inferior: 5'AGT TAA CTT TCC ACT TAT CGG GGC ACT G Producto de PCR esperado 751 bp (SEQ ID NO: 12)

Los experimentos de PCR con ADN del evento H7-1 y con ADN de una planta de control no transgénica usando la combinación de cebadores P3, que tiene un cebador que está ubicado dentro del inserto de H7-1, proporcionan un fragmento con el ADN del evento H7-1 solamente. Por el contrario, los experimentos de PCR usando la combinación de cebadores P1, homóloga a secuencias fuera del inserto, proporcionan fragmentos tanto con evento H7-1 como con ADN de control no transgénico. Véase la Figura 13 para estos resultados.

Los resultados indican que la secuencia contigua al sitio de unión derecho del inserto está presente tanto en el ADN del evento transgénico H7-1 como en el ADN de plantas no transgénicas. Puede concluirse de ello que este ADN fuera del inserto del evento H7-1 es ADN genómico no transgénico.

Los experimentos de PCR efectuados con ADN del evento H7-1 y con ADN de una planta de control no transgénica usando la combinación de cebadores P4, que tiene un cebador ubicado dentro del inserto CP4-EPSPS, proporcionan un fragmento con el ADN del evento H7-1 solamente. Por el contrario, los experimentos de PCR usando la combinación de cebadores P2, homóloga a secuencias fuera del inserto, proporcionan fragmentos tanto con ADN del evento H7-1 como con ADN de control no transgénico (Figura 14) .

Los resultados indican que la secuencia contigua al sitio de unión izquierdo del inserto está presente tanto en el ADN del evento transgénico H7-1 como en el ADN de plantas no transgénicas. Puede concluirse de ello que este ADN fuera del inserto del evento H7-1 es ADN genómico no transgénico.

En resumen, se puede constatar que las secuencias fuera del inserto del evento H7-1 de remolacha son idénticas a las secuencias presentes en plantas no transgénicas. Puede concluirse que estas secuencias son secuencias genómicas de la planta presentes en la línea parental usada para la transformación y en otras líneas de remolacha convencionales.

6. Estabilidad a través de las generaciones

Para demostrar la estabilidad del ADN integrado, el evento de transformación original H7-1 fue comparado con tres progenies (64801H, 74922H y 83002S; véase Figura 15) de esta línea, resultantes de la autopolinización con líneas de remolacha no transgénicas. La línea transformada original y las progenies fueron producidas en 1995, 1996, 1997 y 1998.

Como controles, se analizaron cuatro líneas de remolacha no transgénicas diferentes (3S0057, 5R7150, 8K1180, 6S0085) . Todos los ADNs fueron digeridos con XbaI, HindIII y BamHI, respectivamente, e hibridados con un fragmento de CP4-EPSPS marcado. Para demostrar que el ADN-T está integrado de forma estable en el genoma de la planta, todos los carriles de las progenies de H7-1 digeridas con la misma enzima de restricción deberían mostrar una banda exactamente del mismo tamaño.

Los ADNs de las progenies de H7-1, carriles 3 a 6, muestran los fragmentos esperados: el ADN digerido con BamHI dio como resultado bandas de aproximadamente 11 kb, las digestiones con XbaI produjeron fragmentos de 4, 0 kb y la restricción con HindIII produjo bandas de 5, 2 kb. Todas las bandas de la misma restricción pero de años diferentes eran idénticas en tamaño. Todas las líneas no transgénicas no mostraron ninguna señal (Figura 16) .

Estos resultados demuestran que la secuencia introducida está integrada de forma estable en el ADN genómico y es heredada de forma estable.

Protocolo de secuencia – texto libre

SEQ ID: 5 <223>: ADN insertado con secuencias flanqueadoras 3’ y 5’

SEQ ID: 6 <223>: Producto de PCR

SEQ ID: 11 <223>: Producto de PCR

SEQ ID: 12 <223>: Producto de PCR

SEQ ID: 13 <223>: Producto de PCR

SEQ ID: 17 <223>: Producto de PCR

LISTADO DE SECUENCIA

<110> KWS SAAT AG

<120> Remolacha tolerante al glifosato

<130> PCT 0079

<150> EP 03003866.5

<151> 2003-02-20

<150> US 10/376763

<151> 2003-02-28

<160> 21

<170> PatentIn version 3.1

<210> 1

<211> 30

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 1 ttaatttttg caggcgatgg tggctgttat 30

<210> 2

<211> 30

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 2 catacgcatt agtgagtggg ctgtcaggac

<210> 3

<211> 20

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 3 atgttatctt taccacagtt 20

<210> 4

<211> 24

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 4 gtccctaaat gaaatacgta aaac

<210> 5

<211> 3778

<212> ADN

<213> Secuencia artificial

<220>

<223> ADN insertado con secuencias flanqueadoras 3’ y 5’

<400> 5 ctcgagcggc cgccagtgtg atggatatct gcagaattcg cccttatgtt atctttacca 60 cagtttgttg ctctgacaca accggtaaat gcattggcct ttgtttttga tggcatcaac 120 tttggagcat ctgattttgc atattcagcc ttttccatgg taattctttt acaagaattt 180 tcattctttc ttaagtataa acacttagct tgggacaaac ttctgatcct atttcttaat 240 ttttgcaggt gatggtggct gttatgagca ttttgtgttt gatgtttctt tcttctcatt 300 acggttttat tgggatctgg gtggctctaa ctatttacat gagcctccgc gcgtttgctg 360 aaggcgggaa acgacaatct gatccccatc aagcttgagc tcaggattta gcagcattcc 420 agattgggtt caatcaacaa ggtacgagcc atatcacttt attcaaattg gtatcgccaa 480 aaccaagaag gaactcccat cctcaaaggt ttgtaaggaa gaattctcag tccaaagcct 540 caacaaggtc agggtacaga gtctccaaac cattagccaa aagctacagg agatcaatga 600 agaatcttca atcaaagtaa actactgttc cagcacatgc atcatggtca gtaagtttca 660 gaaaaagaca tccaccgaag acttaaagtt agtgggcatc tttgaaagta atcttgtcaa 720 catcgagcag ctggcttgtg gggaccagac aaaaaaggaa tggtgcagaa ttgttaggcg 780 cacctaccaa aagcatcttt gcctttattg caaagataaa gcagattcct ctagtacaag 840 tggggaacaa aataacgtgg aaaagagctg tcctgacagc ccactcacta atgcgtatga 900 cgaacgcagt gacgaccaca aaagaattcc ctctatataa gaaggcattc attcccattt 960 gaaggatcat cagatactca accaatcctt ctagaagatc taagcttatc gataagcttg 1020 atgtaattgg aggaagatca aaattttcaa tccccattct tcgattgctt caattgaagt 1080 ttctccgatg gcgcaagtta gcagaatctg caatggtgtg cagaacccat ctcttatctc 1140 caatctctcg aaatccagtc aacgcaaatc tcccttatcg gtttctctga agacgcagca 1200 gcatccacga gcttatccga tttcgtcgtc gtggggattg aagaagagtg ggatgacgtt 1260 aattggctct gagcttcgtc ctcttaaggt catgtcttct gtttccacgg cgtgcatgct 1320 tcacggtgca agcagccgtc cagcaactgc tcgtaagtcc tctggtcttt ctggaaccgt 1380 ccgtattcca ggtgacaagt ctatctccca caggtccttc atgtttggag gtctcgctag 1440 cggtgaaacc cgtatcaccg gtcttttgga aggtgaagat gttatcaaca ctggtaaggc 1500 tatgcaagct atgggtgcca gaatccgtaa ggaaggtgat acttggatca ttgatggtgt 1560 tggtaacggt ggactccttg ctcctgaggc tcctctcgat ttcggtaacg ctgcaactgg 1620 ttgccgtttg actatgggtc ttgttggtgt ttacgatttc gatagcactt tcattggtga 1680 cgcttctctc actaagcgtc caatgggtcg tgtgttgaac ccacttcgcg aaatgggtgt 1740 gcaggtgaag tctgaagacg gtgatcgtct tccagttacc ttgcgtggac caaagactcc 1800 aacgccaatc acctacaggg tacctatggc ttccgctcaa gtgaagtccg ctgttctgct 1860 tgctggtctc aacaccccag gtatcaccac tgttatcgag ccaatcatga ctcgtgacca 1920 cactgaaaag atgcttcaag gttttggtgc taaccttacc gttgagactg atgctgacgg 1980

tgtgcgtacc atccgtcttg aaggtcgtgg taagctcacc ggtcaagtga ttgatgttcc 2040 aggtgatcca tcctctactg ctttcccatt ggttgctgcc ttgcttgttc caggttccga 2100 cgtcaccatc cttaacgttt tgatgaaccc aacccgtact ggtctcatct tgactctgca 2160 ggaaatgggt gccgacatcg aagtgatcaa cccacgtctt gctggtggag aagacgtggc 2220 tgacttgcgt gttcgttctt ctactttgaa gggtgttact gttccagaag accgtgctcc 2280 ttctatgatc gacgagtatc caattctcgc tgttgcagct gcattcgctg aaggtgctac 2340 cgttatgaac ggtttggaag aactccgtgt taaggaaagc gaccgtcttt ctgctgtcgc 2400 aaacggtctc aagctcaacg gtgttgattg cgatgaaggt gagacttctc tcgtcgtgcg 2460 tggtcgtcct gacggtaagg gtctcggtaa cgcttctgga gcagctgtcg ctacccacct 2520 cgatcaccgt atcgctatga gcttcctcgt tatgggtctc gtttctgaaa accctgttac 2580 tgttgatgat gctactatga tcgctactag cttcccagag ttcatggatt tgatggctgg 2640 tcttggagct aagatcgaac tctccgacac taaggctgct tgatgagctc aagaattcga 2700 gctcggtacc ggatcctcta gctagagctt tcgttcgtat catcggtttc gacaacgttc 2760 gtcaagttca atgcatcagt ttcattgcgc acacaccaga atcctactga gtttgagtat 2820 tatggcattg ggaaaactgt ttttcttgta ccatttgttg tgcttgtaat ttactgtgtt 2880 ttttattcgg ttttcgctat cgaactgtga aatggaaatg gatggagaag agttaatgaa 2940 tgatatggtc cttttgttca ttctcaaatt aatattattt gttttttctc ttatttgttg 3000 tgtgttgaat ttgaaattat aagagatatg caaacatttt gttttgagta aaaatgtgtc 3060 aaatcgtggc ctctaatgac cgaagttaat atgaggagta aaacacttgt agttgtacca 3120 ttatgcttat tcactaggca acaaatatat tttcagacct agaaaagctg caaatgttac 3180 tgaatacaag tatgtcctct tgtgttttag acatttatga actttccttt atgtaatttt 3240 ccagaatcct tgtcagattc taatcattgc tttataatta tagttatact catggatttg 3300 tagttgagta tgaaaatatt ttttaatgca ttttatgact tgccaattga ttgacaacat 3360 gcatcaatcg acctgcagcc actcgaagcg gccgccactc gagtggtggc cgcatcgatc 3420 gtgaagtttc tcatctaagc ccccatttgg acgtgaatgt agacacgtcg aaataaagat 3480 ttccgaatta gaataatttg tttattgctt tcgcctataa atacgacgga tcgtaatttg 3540 tcgttttatc aaaatgtact ttcattttat aataacgctg cggacatcta catttttgaa 3600 ttgaaaaaaa ttggtaatta ctctttcttt ttctccatat tgaccatcat actcattgct 3660 gatccatgta gatttcccgg acatgaagcc atttacaatt gaatatatcc taagtaaaac 3720 ctcataggtt ttacgtattt catttaggga caagggcgaa ttccagcaca ctggcggc 3778

<210> 6

<211> 3706

<212> ADN

<213> Secuencia artificial <220>

<223> Producto de PCR

<400> 6 atgttatctt taccacagtt tgttgctctg acacaaccgg taaatgcatt ggcctttgtt 60 tttgatggca tcaactttgg agcatctgat tttgcatatt cagccttttc catggtaatt 120 cttttacaag aattttcatt ctttcttaag tataaacact tagcttggga caaacttctg 180 atcctatttc ttaatttttg caggtgatgg tggctgttat gagcattttg tgtttgatgt 240 ttctttcttc tcattacggt tttattggga tctgggtggc tctaactatt tacatgagcc 300 tccgcgcgtt tgctgaaggc gggaaacgac aatctgatcc ccatcaagct tgagctcagg 360 atttagcagc attccagatt gggttcaatc aacaaggtac gagccatatc actttattca 420 aattggtatc gccaaaacca agaaggaact cccatcctca aaggtttgta aggaagaatt 480 ctcagtccaa agcctcaaca aggtcagggt acagagtctc caaaccatta gccaaaagct 540 acaggagatc aatgaagaat cttcaatcaa agtaaactac tgttccagca catgcatcat 600 ggtcagtaag tttcagaaaa agacatccac cgaagactta aagttagtgg gcatctttga 660 aagtaatctt gtcaacatcg agcagctggc ttgtggggac cagacaaaaa aggaatggtg 720 cagaattgtt aggcgcacct accaaaagca tctttgcctt tattgcaaag ataaagcaga 780 ttcctctagt acaagtgggg aacaaaataa cgtggaaaag agctgtcctg acagcccact 840 cactaatgcg tatgacgaac gcagtgacga ccacaaaaga attccctcta tataagaagg 900 cattcattcc catttgaagg atcatcagat actcaaccaa tccttctaga agatctaagc 960 ttatcgataa gcttgatgta attggaggaa gatcaaaatt ttcaatcccc attcttcgat 1020 tgcttcaatt gaagtttctc cgatggcgca agttagcaga atctgcaatg gtgtgcagaa 1080 cccatctctt atctccaatc tctcgaaatc cagtcaacgc aaatctccct tatcggtttc 1140 tctgaagacg cagcagcatc cacgagctta tccgatttcg tcgtcgtggg gattgaagaa 1200 gagtgggatg acgttaattg gctctgagct tcgtcctctt aaggtcatgt cttctgtttc 1260 cacggcgtgc atgcttcacg gtgcaagcag ccgtccagca actgctcgta agtcctctgg 1320 tctttctgga accgtccgta ttccaggtga caagtctatc tcccacaggt ccttcatgtt 1380 tggaggtctc gctagcggtg aaacccgtat caccggtctt ttggaaggtg aagatgttat 1440 caacactggt aaggctatgc aagctatggg tgccagaatc cgtaaggaag gtgatacttg 1500 gatcattgat ggtgttggta acggtggact ccttgctcct gaggctcctc tcgatttcgg 1560 taacgctgca actggttgcc gtttgactat gggtcttgtt ggtgtttacg atttcgatag 1620 cactttcatt ggtgacgctt ctctcactaa gcgtccaatg ggtcgtgtgt tgaacccact 1680 tcgcgaaatg ggtgtgcagg tgaagtctga agacggtgat cgtcttccag ttaccttgcg 1740 tggaccaaag actccaacgc caatcaccta cagggtacct atggcttccg ctcaagtgaa 1800 gtccgctgtt ctgcttgctg gtctcaacac cccaggtatc accactgtta tcgagccaat 1860 catgactcgt gaccacactg aaaagatgct tcaaggtttt ggtgctaacc ttaccgttga 1920 gactgatgct gacggtgtgc gtaccatccg tcttgaaggt cgtggtaagc tcaccggtca 1980 agtgattgat gttccaggtg atccatcctc tactgctttc ccattggttg ctgccttgct 2040 tgttccaggt tccgacgtca ccatccttaa cgttttgatg aacccaaccc gtactggtct 2100 catcttgact ctgcaggaaa tgggtgccga catcgaagtg atcaacccac gtcttgctgg 2160 tggagaagac gtggctgact tgcgtgttcg ttcttctact ttgaagggtg ttactgttcc 2220 agaagaccgt gctccttcta tgatcgacga gtatccaatt ctcgctgttg cagctgcatt 2280 cgctgaaggt gctaccgtta tgaacggttt ggaagaactc cgtgttaagg aaagcgaccg 2340 tctttctgct gtcgcaaacg gtctcaagct caacggtgtt gattgcgatg aaggtgagac 2400 ttctctcgtc gtgcgtggtc gtcctgacgg taagggtctc ggtaacgctt ctggagcagc 2460 tgtcgctacc cacctcgatc accgtatcgc tatgagcttc ctcgttatgg gtctcgtttc 2520 tgaaaaccct gttactgttg atgatgctac tatgatcgct actagcttcc cagagttcat 2580 ggatttgatg gctggtcttg gagctaagat cgaactctcc gacactaagg ctgcttgatg 2640 agctcaagaa ttcgagctcg gtaccggatc ctctagctag agctttcgtt cgtatcatcg 2700 gtttcgacaa cgttcgtcaa gttcaatgca tcagtttcat tgcgcacaca ccagaatcct 2760 actgagtttg agtattatgg cattgggaaa actgtttttc ttgtaccatt tgttgtgctt 2820 gtaatttact gtgtttttta ttcggttttc gctatcgaac tgtgaaatgg aaatggatgg 2880 agaagagtta atgaatgata tggtcctttt gttcattctc aaattaatat tatttgtttt 2940 ttctcttatt tgttgtgtgt tgaatttgaa attataagag atatgcaaac attttgtttt 3000 gagtaaaaat gtgtcaaatc gtggcctcta atgaccgaag ttaatatgag gagtaaaaca 3060 cttgtagttg taccattatg cttattcact aggcaacaaa tatattttca gacctagaaa 3120 agctgcaaat gttactgaat acaagtatgt cctcttgtgt tttagacatt tatgaacttt 3180 cctttatgta attttccaga atccttgtca gattctaatc attgctttat aattatagtt 3240 atactcatgg atttgtagtt gagtatgaaa atatttttta atgcatttta tgacttgcca 3300 attgattgac aacatgcatc aatcgacctg cagccactcg aagcggccgc cactcgagtg 3360 gtggccgcat cgatcgtgaa gtttctcatc taagccccca tttggacgtg aatgtagaca 3420 cgtcgaaata aagatttccg aattagaata atttgtttat tgctttcgcc tataaatacg 3480 acggatcgta atttgtcgtt ttatcaaaat gtactttcat tttataataa cgctgcggac 3540 atctacattt ttgaattgaa aaaaattggt aattactctt tctttttctc catattgacc 3600 atcatactca ttgctgatcc atgtagattt cccggacatg aagccattta caattgaata 3660 tatcctaagt aaaacctcat aggttttacg tatttcattt agggac 3706

<210> 7

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 7 atgcattggc ctttgttttt gat 23

<210> 8

<211> 19

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 8 tgtcgtttcc cgccttcag 19

<210> 9

<211> 26

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 9 cgctgcggac atctacattt ttgaat 26

<210> 10

<211> 28

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 10 agttaacttt ccacttatcg gggcactg 28

<210> 11

<211> 288

<212> ADN

<213> Secuencia artificial

<220>

<223> Producto de PCR

<400> 11 atgcattggc ctttgttttt gatggcatca actttggagc atctgatttt gcatattcag 60

ccttttccat ggtaattctt ttacaagaat tttcattctt tcttaagtat aaacacttag 120

cttgggacaa acttctgatc ctatttctta atttttgcag gcgatggtgg ctgttatgag 180

cattttgtgt ttgatgtttc tctcttctca ttacggtttt attgggatct gggtggctct 240

aactatttac atgagcctcc gcgcgtttgc tgaaggcggg aaacgaca 288

<210> 12

<211> 751

<212> ADN

<213> Secuencia artificial <220>

<223> Producto de PCR

<400> 12 cgctgcggac atctacattt ttgaattgaa aaaaaattgg taattactct ttctttttct 60 ccatattgac catcatactc attgctgatc catgtagatt tcccggacat gaagccattt 120 acaattgaat atatcctaag taaaacctca taggttttac gtatttcatt tagggactaa 180 aatggtttag gataattact ttagctaaca taagataata aataaataaa taaataaaaa 240 taaaatggtt gtagataaat aaggaaatca ataatgaata tgagtgtgag tgataggacg 300 ggaatgggaa acttttacac tactttaacg ctattgaacg agtatgagta tgttataaac 360 gtaaaatgtt ttatgtgtta gacaatggcc tcaagtgaaa gtgaccctat taatggagga 420 aatgcaaacc acgagtctga ggtcacgctc gaagaaatga gggcaaggat cgacgcattg 480 cgtagcgacc ctgtttttgg agatgccacg ggagatgcta gtgataaccg aatggattta 540 atgaggttga tgatgatgga gcttttacaa ggaaatcgac aaaggcctag aactgaacaa 600 gaagagtgct caaacatgtt caagaggttt tcggctcata agcccccaac ttatgatgga 660 aagccagacc ccactgagtt tgaagaatgg ctcaacggca tggaaaaatt gttcgatgcc 720 acccagtgcc ccgataagtg gaaagttaac t 751

<210> 13

<211> 664

<212> ADN

<213> Secuencia artificial

<220>

<223> Producto de PCR

<400> 13 ttaatttttg caggcgatgg tggctgttat gagcattttg tgtttgatgt ttctctcttc 60 tcattacggt tttattggga tctgggtggc tctaactatt tacatgagcc tccgcgcgtt 120 tgctgaaggc gggaaacgac aatctgatcc ccatcaagct tgagctcagg atttagcagc 180 attccagatt gggttcaatc aacaaggtac gagccatatc actttattca aattggtatc 240 gccaaaacca agaaggaact cccatcctca aaggtttgta aggaagaatt ctcagtccaa 300 agcctcaaca aggtcagggt acagagtctc caaaccatta gccaaaagct acaggagatc 360 aatgaagaat cttcaatcaa agtaaactac tgttccagca catgcatcat ggtcagtaag 420 tttcagaaaa agacatccac cgaagactta aagttagtgg gcatctttga aagtaatctt 480 gtcaacatcg agcagctggc ttgtggggac cagacaaaaa aggaatggtg cagaattgtt 540 aggcgcacct accaaaagca tctttgcctt tattgcaaag ataaagcaga ttcctctagt 600 acaagtgggg aacaaaataa cgtggaaaag agctgtcctg acagcccact cactaatgcg 660 tatg 664

<210> 14

<211> 30

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 14 gctctgacac aaccggtaaa tgcattggcc 30

<210> 15

<211> 30

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 15 gacccatagt ttgattttaa gcacgacatg 30

<210> 16

<211> 29

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 16 gcagattctg ctaacttgcg ccatcggag 29

<210> 17

<211> 1042

<212> ADN

<213> Secuencia artificial

<220>

<223> Producto de PCR

<220>

<221> misc_feature

<223> Producto de PCR

<400> 17 gctctgacac aaccggtaaa tgcattggcc tttgtttttg atggcatcaa ctttggagca 60 tctgattttg catattcagc cttttccatg gtaattcttt tacaagaatt ttcattcttt 120 cttaagtata aacacttagc ttgggacaaa cttctgatcc tatttcttaa tttttgcagg 180 cgatggtggc tgttatgagc attttgtgtt tgatgtttct ctcttctcat tacggtttta 240 ttgggatctg ggtggctcta actatttaca tgagcctccg cgcgtttgct gaaggcggga 300 aacgacaatc tgatccccat caagcttgag ctcaggattt agcagcattc cagattgggt 360 tcaatcaaca aggtacgagc catatcactt tattcaaatt ggtatcgcca aaaccaagaa 420 ggaactccca tcctcaaagg tttgtaagga agaattctca gtccaaagcc tcaacaaggt 480

cagggtacag agtctccaaa ccattagcca aaagctacag gagatcaatg aagaatcttc 540 aatcaaagta aactactgtt ccagcacatg catcatggtc agtaagtttc agaaaaagac 600

atccaccgaa gacttaaagt tagtgggcat ctttgaaagt aatcttgtca acatcgagca 660

gctggcttgt ggggaccaga caaaaaagga atggtgcaga attgttaggc gcacctacca 720

aaagcatctt tgcctttatt gcaaagataa agcagattcc tctagtacaa gtggggaaca 780

aaataacgtg gaaaagagct gtcctgacag cccactcact aatgcgtatg acgaacgcag 840

tgacgaccac aaaagaattc cctctatata agaaggcatt cattcccatt tgaaggatca 900

tcagatactg aaccaatcct tctagaagat ctaagcttat cgataagctt gatgtaattg 960

gaggaagatc aaaattttca atccccattc ttcgattgct tcaattgaag tttctccgat 1020

ggcgcaagtt agcagaatct gc 1042

<210> 18

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 18 cggtaaatgc attggccttt gtt 23

<210> 19

<211> 26

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 19 cacccagatc ccaataaaac cgtaat 26

<210> 20

<211> 28

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 20 aaatggttgt agataaataa ggaaatca 28

<210> 21

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador

<400> 21 acatgtttga gcactcttct tgt 23




Reivindicaciones:

1. Una planta de remolacha tolerante al glifosato, caracterizada porque a) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 3 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 4, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 6, y/o b) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 9 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 10, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 12, y/o c) un fragmento de ADN del ADN genómico de la planta de remolacha, partes o semillas de la misma, puede ser amplificado mediante reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 14 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 16, presentando el fragmento de ADN al menos 95% de identidad con la secuencia nucleotídica de SEQ ID NO: 17.

2. Semillas de una planta de acuerdo con la reivindicación 1.

3. Célula, tejido o partes de la planta de acuerdo con la reivindicación 1.

4. Método para la identificación de una planta de remolacha tolerante al glifosato, caracterizado porque el método comprende la (s) etapa (s) de: a) amplificar un fragmento de ADN de 3500-3900 bp, de preferencia 3706 bp, del ADN genómico de dicha planta de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 3 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 4, y/o b) amplificar un fragmento de ADN d.

71. 790 bp, de preferencia 751 bp, del ADN genómico de dicha planta de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 9 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 10, y/o c) amplificar un fragmento de ADN d.

99. 1100 bp, de preferencia 1042 bp, del ADN genómico de dicha planta de remolacha, partes o semillas de la misma, usando una reacción en cadena de polimerasa con un primer cebador que presenta la secuencia nucleotídica de SEQ ID NO: 14 y un segundo cebador que presenta la secuencia nucleotídica de SEQ ID NO: 16.

5. Kit de ensayo para identificar una planta de remolacha transgénica tolerante al glifosato, sus células, tejidos

o partes, comprendiendo al menos un par de cebadores con un primer y un segundo cebador para una reacción en cadena de polimerasa, donde el primer cebador reconoce una secuencia dentro del ADN foráneo incorporado en el genoma de dicha planta, y el segundo cebador reconoce una secuencia dentro de las regiones flanqueadoras 3' o 5' de dicho ADN, siendo la planta una planta de acuerdo con la reivindicación 1.

6. Kit de ensayo según la reivindicación 5, caracterizado porque a) el primer cebador presenta la secuencia nucleotídica de SEQ ID NO: 9 y el segundo cebador presenta la secuencia nucleotídica de SEQ ID NO: 10, y/o b) el primer cebador presenta la secuencia nucleotídica de SEQ ID NO: 14 y el segundo cebador presenta la secuencia nucleotídica de SEQ ID NO: 16.






Acerca de · Contacto · Patentados.com desde 2007 hasta 2014 // Última actualización: 21/12/2014.