Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.

Un método para reducción selectiva de una proteína transformada por ingeniería en su conformación activa que comprende al menos una cisteína no nativa, comprendiendo dicha proteína uno o más restos cisteína conjugados a través de un puente disulfuro a un tiol de peso molecular bajo

(RS-Cys), no estando implicados dicho resto o restos en puentes S-S intramoleculares (Cys-S-S-Cys) cuando la proteína se encuentra en su forma activa, comprendiendo el método el paso de permitir que la proteína conjugada con el tiol de peso molecular bajo reaccione con una mixtura que comprende un tampón redox en condiciones no desnaturalizantes, en donde el tampón redox es un par redox de glutatión reducido y oxidado, y la concentración del glutatión reducido está dentro del intervalo de 0,01-2 mM, y la concentración del glutatión oxidado está dentro del intervalo de 0,001-0,200 mM, y en donde la proteína es un polipéptido Factor VII (FVII/FVIIa).

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2006/063310.

Solicitante: NOVO NORDISK HEALTH CARE AG.

Nacionalidad solicitante: Suiza.

Dirección: Thurgauerstrasse 36/38 8050 Zürich SUIZA.

Inventor/es: PETERSEN,ANDERS,KLARSKOV, ØSTERGAARD,HENRIK.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/745 (Factores de coagulación sanguínea o de fibrinolisis)
google+ twitter facebookPin it
Ilustración 1 de Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.
Ilustración 2 de Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.
Ilustración 3 de Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.
Ilustración 4 de Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.
Ver la galería de la patente con 8 ilustraciones.
Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa.

Texto extraído del PDF original:

DESCRIPCIÓN

Reducción y derivatización selectivas de proteínas Factor VII transformadas por ingeniería que comprenden al menos una cisteína no nativa

Campo de la invención

La presente invención se refiere a un método para reducción y derivatización selectivas de proteínas transformadas por ingeniería preparadas recombinantemente que comprenden al menos una cisteína no nativa (v.g. Factores de coagulación o proteínas de la familia tripsina de serina-proteasas), en el que la reacción de reducción se realiza en presencia de un tampón redox.

Antecedentes de la invención

El Factor de coagulación VIIa es el iniciador clave de la hemostasia. Se trata de una proteína plasmática de 50 kDa con una semivida funcional circulatoria aproximada de 1-3 horas. La proteína madura contiene un total de 24 residuos cisteína apareados en 12 enlaces disulfuro. De éstos, el enlace disulfuro que puentea Cys340 y Cys368 en el dominio proteasa es sumamente lábil y es reducido fácilmente incluso por concentraciones bajas de agentes reductores utilizados comúnmente tales como β-mercaptoetanol, véase Higashi (1997). Cys340-Cys368 (o Cys191- Cys220 de acuerdo con la numeración de quimotripsina) está muy conservado en la familia tripsina de serina- proteasas que incluye los Factores de coagulación II, IX, X, XI y proteína C, véase Wang (1997). El mismo forma parte de la pared de la bolsa de enlace S1 y en la reducción de FVIIa del enlace disulfuro da como resultado una pérdida de actividad amidolítica, véase Higashi (1997).

La modificación covalente, v.g. por PEGilación o fijación de lípidos, se ha aplicado con éxito en varios productos farmacéuticos basados en proteínas para mejorar sus perfiles farmacocinético y farmacodinámico. La conjugación por cisteínas nativas o transformadas por ingeniería proporciona un medio atractivo de modificación con especificidad de sitio debido a la rareza de este aminoácido en la superficie de las proteínas, particularmente las secretadas por la célula, así como la alta selectividad de la química de acoplamiento de tiol.

El Factor VIIa nativo contiene 24 residuos cisteína y existen puentes disulfuro establecidos entre los residuos cisteína siguientes: C17 y C22, C50 y C61, C55 y C70, C72 y C81, C91 y C102, C98 y C112, C114 y C127, C135 y C262, C159 y C164, C178 y C194, C310 y C329, y entre C340 y C368.

La carencia de tioles libres en el Factor VIIa nativo ha conducido a la propuesta de que la prolongación de la semivida circulatoria podría lograrse por modificación, v.g. PEGilación, de cisteínas transformadas por ingeniería expuestas a disolvente, véanse, v.g. WO 02/077218 A1 y WO 01/58935 A2.

En este sentido, WO 01/58.935 A2 describe conjugados polipeptídicos Factor VII con restos distintos de polipéptidos y su preparación. Entre otras cosas, se sugiere que el resto no-polipéptido está conjugado al polipéptido Factor VII por una cisteína. Análogamente, WO 02/077218 A1 describe conjugados polipeptídicos de Factor VII con grupos químicos y su preparación. Se sugiere, entre otras cosas, que el grupo químico está conjugado al polipéptido Factor VII por una cisteína.

En la práctica, sin embargo, este enfoque resulta algo complicado por el hecho de que las cisteínas introducidas en porciones predominantes del polipéptido Factor VII se encuentran como disulfuros mixtos con compuestos tiol de peso molecular bajo tales como glutatión (γ-glutamil-cisteinilglicina), cisteína, y homocisteína (véase Figura 1) cuando el polipéptido se prepara por técnicas recombinantes, impidiendo con ello la conjugación química subsiguiente por la vía de los grupos tiol de las cisteínas. Por ello, existe necesidad de métodos en los cuales los disulfuros mixtos de tales cisteínas y tioles de peso molecular bajo puedan reducirse químicamente con preservación de los enlaces disulfuro nativos.

SE 9.501.285 A describe un proceso para la producción in vitro de proteínas reticuladas con disulfuro, plegadas adecuadamente y biológicamente activas utilizando una mixtura de una proteína disulfuro-oxidorreductasa (v.g. La proteína disulfuro-isomerasa (PDI)), una glutarredoxina y un tampón redox. La referencia está centrada en cisteínas implicadas en enlaces disulfuro intramoleculares.

WO 2005/003171 describe la reducción de una proteína transformada por ingeniería que comprende al menos una cisteína no nativa, comprendiendo dicha proteína uno o más restos cisteína conjugados a través de un puente disulfuro con un tiol de peso molecular bajo.

Breve descripción de la invención

Teniendo en cuenta los obstáculos arriba mencionados con respecto a la conjugación química por grupos tiol de cisteínas no implicadas en enlaces disulfuro intramoleculares de proteínas preparadas por técnicas recombinantes, la presente invención proporciona ahora el uso de una mixtura de tampón redox definida (v.g. En combinación con un catalizador redox tiol-disulfuro) para reducir selectivamente el enlace disulfuro mixto entre tioles de peso molecular bajo y una proteína transformada por ingeniería que comprende al menos una cisteína no nativa, v.g. un Factor de coagulación o una proteína de la familia tripsina de serina-proteasas, con tales cisteínas transformadas por ingeniería o nativas. Después de la reducción selectiva del disulfuro mixto, la cisteína libre puede modificarse luego por conjugación utilizando química de acoplamiento de tiol en la proteína como es conocido por las personas expertas en la técnica.

La conjugación química por la vía de cisteínas transformadas por ingeniería o nativas ofrece la posibilidad de modificación direccionada de proteínas con obtención de un producto homogéneo simple. Sin embargo, en casos en que la cisteína está conjugada a un tiol de peso molecular bajo y la proteína contiene enlaces disulfuro intramoleculares lábiles esta estrategia no es factible. La presente invención permite la eliminación selectiva del resto tiol de peso molecular bajo preparando cisteína liberada para modificación química subsiguiente.

Por tanto, un aspecto de la presente invención se refiere a un método para reducción selectiva de una proteína transformada por ingeniería en su conformación activa que comprende al menos una cisteína no nativa, v.g. un Factor de coagulación o una proteína de la familia tripsina de serina-proteasas, comprendiendo dicha proteína uno o más restos cisteína conjugados a través de un puente disulfuro a un tiol de peso molecular bajo (RS-Cys), no estando implicados dicho o dichos restos en puentes S-S intramoleculares (Cys-S-S-Cys) cuando la proteína se encuentra en su forma activa, comprendiendo el método el paso de permitir que la proteína conjugada al tiol de peso molecular bajo reaccione con una mixtura que comprende un tampón redox en condiciones no desnaturalizantes.

El término "reducida selectivamente" se refiere al hecho de que una porción predominante, v.g. una fracción de 60% o más, u 80% o más, tal como 90% o más, de los restos cisteína conjugados a través de un puente disulfuro a un tiol de peso molecular bajo se reducen para liberar un resto cisteína con un grupo tiol que está listo para conjugación con otros grupos, en tanto que una porción predominante, v.g. 60% o más, 80% o más, tal como 90% o más, de otros enlaces disulfuro (típicamente enlaces disulfuro intramoleculares) están preservados, de tal modo que la actividad biológica de la proteína transformada por ingeniería se preserva sustancialmente. En una realización, se dice que la proteína está "reducida selectivamente" si uno o más restos cisteína no nativos están reducidos en la proteína, mientras que la actividad biológica está preservada sustancialmente, v.g. 60% o más, tal como 80% o más, tal como 90% o más de la actividad está preservada en comparación con la actividad de la proteína no reducida.

Breve descripción de las figuras

Figura 1: Identificación de tioles de peso molecular bajo implicados en disulfuros mixtos con FVIIa 407C. La proteína se incubó en presencia de TCEP y SBD-f para liberar y derivatizar tioles unidos a la Cys407 transformada por ingeniería en la preparación de FVIIa 407C. Los tioles derivatizados con SBD se separaron por HPLC en fase inversa y se detectaron por fluorescencia (longitudes de onda de excitación y emisión de 386 y 516 nm, respectivamente). Las trazas HPLC de FVIIa tipo salvaje y una serie de compuestos tiol de peso molecular bajo (10 picomoles de cada uno; designado estándar) se muestran para comparación. Los picos marcados con un asterisco se deben a impurezas en la cisteamina disponible comercialmente. Los dos asteriscos indican un pico de identidad desconocida en la traza HPLC de FVIIa 407C. Los porcentajes encima de cada pico indican la cantidad de una especie tiol dada (identificada por su tiempo de retención) con relación a la cantidad de FVIIa 407C analizada. Basándose en los tiempos de retención, puede concluirse que los tioles principales conjugados con FVIIa 407C son glutatión, cisteína, y homocisteína. Abreviaturas: GSH (glutatión), γ-GC (γ-glutamilcisteína), CG (cisteinilglicina), Cys (cisteína), Hcy (homocisteína) y Cya (cisteamina).

Figura 2: Actividad amidolítica residual de FVIIa incubado a pH 7 en presencia de concentraciones variables de glutatión reducido y oxidado (dadas por la ratio [GSH]2/[GSSG]), 1 μM glutarredoxina 1 de levadura (yGr x 1p), y nada (círculos vacíos) o 25 mM p-aminobenzamidina (cuadrados vacíos). Se dejó que todas las muestras alcanzaran el equilibrio durante 3,5 horas a 30 ºC antes de medir la actividad amidolítica. Las actividades amidolíticas están normalizadas a 1 para FVIIa plenamente activo.

Figura 3: Titulación redox del disulfuro mixto entre FVIIa Cys407 y glutatión. Se dejó que FVIIa 407C alcanzara el equilibrio en tampón de pH 7 que contenía ratios variables de glutatión reducido y oxidado (dadas por la ratio [GSH]/ [GSSG]) y 10 µM glutarredoxina 2 (Grx2) de E. coli. Después de alcanzar el equilibrio durante 5 horas a 30 ºC, se detectó FVIIa 407C libre y se cuantificó por HPLC después de alquilación con PEG5k- maleimida. Las áreas de los picos están normalizadas a 1 para FVIIa totalmente 5k PEGilado.

Figura 4: Actividad amidolítica residual (líneas punteadas) y fracción de FVIIa 407C con un grupo tiol Cys407 libre (línea continua) en equilibrio en un tampón redox constituido por 0,5 mM GSH, concentraciones variables de GSSG, y nada (-PABA) o 25 mM p-aminobenzamidina (+PABA). Las curvas se trazaron utilizando las ecuaciones 2 y 4, valores KOX de 93 (-PABA) y 166 mM (+PABA), respectivamente, y un valor KSCOX de 1,02. El área sombreada indica el intervalo de concentración de GSSG que da como resultado actividad residual > 90% y >90% de tiol 407C libre.

Figura 5: Como la Figura 4 pero con 0,25 mM de GSH. El área sombreada indica el intervalo de concentración de GSSG que da como resultado >90% de actividad residual y >90% de tiol FVIIa 407C libre.

Figura 6: Como la Figura 4 pero con 1,0 mM de GSH en su lugar. El área sombreada indica el intervalo de concentración de GSSG que da como resultado >90% de actividad residual y >90% de tiol FVIIa 407C libre.

Figura 7: Análisis HPLC de FVIIa 407C antes (línea de puntos) y después de reducción selectiva (línea de trazos-puntos), y después de modificación con PEG20k-maleimida (línea continua). 407C, 407C-SR, y 407C-PEG20k indican picos que representan FVIIa 407C libre, conjugado con tiol de peso molecular bajo, y 20k-PEGilado, respectivamente. Los asteriscos indican picos de identidad desconocida, que representan probablemente especies químicas hiper-PEGiladas. La integración de los picos dio 89% de FVIIa 407C libre al final del paso de reducción frente a 11% en el material sin tratar. Después de alquilación del tiol, 85% de FVIIa 407C se había convertido en la especie mono-PEGilada.

Figura 8: Análisis SDS-PAGE reductor (panel derecho) y no reductor (panel izquierdo) de FVIIa 407C (pista A), FVIIa 407C-PEG5k (pista B), FVIIa 407C-PEG20k (pista C), FVIIa 407C-PEG40k (pista D), y FVIIa 407C-PEG3.4k-FVIIa 407C (pista E).

Descripción detallada de la invención

(A) Tampón redox

Como se ha mencionado arriba, la presente invención proporciona un método para reducción selectiva de una proteína transformada por ingeniería en su conformación activa que comprende al menos una cisteína no nativa, v.g. un Factor de coagulación o una proteína de la familia tripsina de serina-proteasas. La proteína en cuestión comprende uno o más restos cisteína conjugados a través de un puente disulfuro con un tiol de peso molecular bajo (RS-Cys), no estando implicados dicho o dichos restos en puentes S-S intramoleculares (Cys-S-S-Cys) cuando la partida se encuentra en su forma activa, comprendo el método el paso de permitir que la proteína conjugada con el tiol de peso molecular bajo reaccione con una mixtura compuesta por un tampón redox en condiciones no desnaturalizantes.

Cuando se utiliza en esta memoria, debe entenderse que el término "tampón redox" significa un par redox tiol/disulfuro en una ratio que es suficientemente reductora para alterar el o los disulfuros mixtos proteína-tiol de peso molecular bajo (RS-Cys) y al mismo tiempo suficientemente oxidante para preservar la integridad de los enlaces disulfuro nativos en la proteína.

Preferiblemente, el tampón redox comprende un par redox tiol de peso molecular bajo/disulfuro. Por el término "peso molecular bajo" se entiende que la forma tiol del par redox tiene un peso molecular de, como máximo, 500 g/mol. Ejemplos ilustrativos de tales pares redox son los seleccionados de (i) glutatión reducido y oxidado y (ii) γ- glutamilcisteína reducida y oxidada), (iii) cisteinilglicina reducida y oxidada, (iv) cisteína reducida y oxidada, (v) N- acetilcisteína reducida y oxidada, (vi) cisteamina, y (vii) dihidrolipoamida/lipoamida, preferiblemente a partir de (i) glutatión reducido y oxidado.

Las condiciones redox óptimas pueden determinarse por realización de una titulación redox de la proteína como es conocido por las personas expertas en la técnica y como se demuestra en las Figuras 2, 3, y 4; véase también Gilbert (1995).

En una realización, el tampón redox es un par redox de glutatión reducido y oxidado, y la ratio entre glutatión reducido y glutatión oxidado está comprendida en un intervalo de 2-200.

En otra realización, la proteína transformada por ingeniería es una proteína con enlaces disulfuro lábiles.

Como se utiliza en esta memoria, el término "proteína con enlaces disulfuro lábiles" significa una proteína que exhibe una pérdida progresiva de actividad biológica (tal como v.g. 50% con relación a la actividad biológica original en el transcurso de 2 horas) cuando se incuba a aproximadamente 25° en condiciones no desnaturalizantes a pH aprox. neutro en presencia de ditiotreitol 5 mM (DTT).

Para los polipéptidos Factor VII, la concentración del glutatión reducido está dentro del intervalo de 0,01%-2 mM, y la concentración de glutatión oxidado está dentro del intervalo de 0,001-0,200 mM.

Dado que glutatión y otros tioles de peso molecular bajo son generalmente reductores/oxidantes pobres en términos de cinética de reacción, se incluye muy preferiblemente un catalizador redox tiol/disulfuro en la mixtura en asociación con el tampón redox a fin de aumentar la velocidad de la reacción.

Catalizadores redox tiol/disulfuro adecuados para inclusión en la mixtura incluyen glutarredoxinas de tipo ditiol y de tipo monotiol. Las glutarredoxinas y sus funciones se describen generalmente en Fernandes et al. (2004). Ejemplos útiles de glutarredoxinas son las seleccionadas de Grx1, Grx2 o Grx3 de Escherichia coli (Holmgren et al., 1995), Grx1p, Grx2p, Grx3p, Grx4p, y Grx5p de Saccharomyces cerevisiae (Luikenhuis et al. 1998; Rodriguez-Manzaneque et al., 1999; Grant, 2001), Grx1 y Grx2 de Homo sapiens (Padilla et al. 1995; Lundberg et al., 2001), y variantes de las mismas. Las variantes incluyen, pero sin carácter limitante, glutarredoxinas de tipo ditiol en las cuales la cisteína C-terminal en el motivo CXXC ha sido reemplazada por otro aminoácido, típicamente serina o alanina (véase Yang et al., 1998).

El catalizador redox (en particular una glutarredoxina) se utiliza preferiblemente en una concentración de 0,001-20 µM.

Se prefiere que la mixtura no comprenda una proteína disulfuro-isomerasa (PDI).

El tampón redox puede comprender además otros componentes tales como sales, tampones de pH, etc., y el método de la invención puede conducirse a cualquier temperatura que sea adecuada para la proteína en cuestión, v.g. una temperatura dentro del intervalo de -5 ºC a 50 ºC, tal como en el intervalo de cero ºC a 25 ºC, dependiendo por supuesto de la estabilidad de la proteína en las condiciones dadas.

Debe entenderse que este método se realiza en condiciones nativas, con el significado de condiciones sin desnaturalizantes, en las cuales la proteína retiene su conformación activa natural.

La proteína

La estrategia de reducción selectiva utilizando un tampón redox como se describe anteriormente se considera que es aplicable generalmente a proteínas transformadas por ingeniería que comprenden al menos una cisteína no nativa, en particular tales proteínas que tienen cisteínas transformadas por ingeniería que no están implicadas en puentes S-S intramoleculares (Cys-S-S-Cys) cuando la proteína se encuentra en su forma activa, y que se encuentran por tanto potencialmente en forma conjugada con tiol (RS-Cys) de peso molecular bajo.

El término "forma conjugada con tiol (RS-Cys) de peso molecular bajo" y términos similares debe entenderse que significan que un grupo tiol de una cisteína de la proteína en cuestión está conjugado con un compuesto que tiene un grupo tiol, en donde dicho compuesto tiene un peso molecular menor que 500 Da. Ejemplos de tales compuestos son glutatión, γ-glutamilcisteína, cisteinilglicina, cisteína, N-acetilcisteína, cisteamina, etc.

El término "forma activa" se refiere a la forma (o formas) de la proteína en la cual la misma es capaz de realizar una acción deseable, v.g. como catalizador (enzima), zimógeno, o como un co-Factor, etc. Algunas veces se hace referencia a la "forma activa" como la "forma plegada correctamente".

En una realización interesante, una porción sustancial de la proteína (es decir al menos 50%) se encuentra en su forma activa cuando se realiza la reacción de reducción selectiva.

Una clase importante de tales proteínas (que se han sometido a introducción de una cisteína no nativa por "ingeniería de proteínas") incluye polipéptidos de Factores de coagulación, en particular los seleccionados de polipéptidos Factor II(FII/FIIa), polipéptidos Factor VII (FVII/FVIIa), polipéptidos Factor VIII (FVIII/FVIIIa), polipéptidos Factor IX (FIX/FIXa), polipéptidos Factor X (FX/FXa), polipéptidos Factor XI (FXI/FXIa), polipéptidos Factor XIII (FXIII/FXIIIa), y polipéptidos de proteína C, entre los cuales son particularmente interesantes los polipéptidos Factor VII.

Como se ha mencionado anteriormente, una proteína particularmente interesante es un polipéptido Factor VII.

Como se utiliza en esta memoria, "condiciones no desnaturalizantes" significa condiciones en las cuales la proteína retiene sustancialmente una conformación intacta, en la cual la actividad biológica está preservada sustancialmente, conservándose v.g. 60% o más, u 80% o más, tal como 90% o más de la actividad en comparación con la actividad del producto de partida.

Como se utiliza en esta memoria, los términos "polipéptido Factor VII", "polipéptido FVII", y análogos, significan cualquier proteína que comprende la secuencia de aminoácidos 1-406 del Factor VIIa humano de tipo salvaje (es decir, un polipéptido que tiene la secuencia de aminoácidos descrita en la patente US No. 4.784.950), variantes del mismo, así como polipéptidos afines al Factor VII, derivados del Factor VII y conjugados del Factor VII, en los cuales al menos un aminoácido ha sido sustituido por una cisteína. Esto incluye variantes de FVII, polipéptidos afines al Factor VII, y derivados de Factor VII que exhiben sustancialmente la misma o mejor actividad biológica con relación al Factor VIIa humano de tipo salvaje.

Los términos "Factor VII" o "FVII" tienen por objeto abarcar polipéptidos Factor VII en su forma no escindida (zimógeno), así como aquéllos que han sido procesados proteolíticamente para producir sus formas bioactivas respectivas, que pueden designarse Factor VIIa. Típicamente, el Factor VII se escinde entre los residuos 152 y 153 para producir el Factor VIIa. Tales variantes del Factor VII pueden exhibir propiedades diferentes con relación al Factor VII humano, incluyendo estabilidad, fijación de fosfolípidos, actividad específica alterada, y análogas.

Como se utiliza en esta memoria, el término "polipéptidos afines al Factor VII" abarca polipéptidos, con inclusión de variantes, en los cuales la actividad biológica del Factor VII ha sido modificada sustancialmente, tal como reducida o truncada (v.g. menos variantes de dominio Gla), con relación a la actividad del Factor VIIa de tipo salvaje. Estos polipéptidos incluyen, sin limitación, Factor VII o Factor VIIa en los cuales se han introducido alteraciones específicas de la secuencia de aminoácidos que modifican o alteran la bioactividad del polipéptido, siendo al menos una de tales modificaciones la introducción de una cisteína.

El término "derivado del Factor VII" como se utiliza esta memoria, debe entenderse que designa un polipéptido FVII que exhibe sustancialmente la misma o mejor actividad biológica con relación al Factor VII de tipo salvaje, en el cual uno o más de los aminoácidos del péptido parental han sido modificados genética y/o química y/o enzimáticamente, v.g. por alquilación, glicosilación, desglicosilación, PEGilación, acilación, formación de éster o formación de amida o análogos. Esto incluye, por sin carácter limitante, Factor VIIa PEGilado, Factor VIIa humano PEGilado con cisteína y variantes de los mismos.

El término "Factor VIIa PEGilado (y análogos) significa un polipéptido Factor VII conjugado con una molécula de PEG. Debe entenderse que la molécula de PEG puede estar unida a cualquier parte del polipéptido Factor VII, con inclusión de cualquier residuo de aminoácido o resto carbohidrato del polipéptido Factor VII. El término "Factor VII PEGilado a cisteína" significa polipéptido Factor VII que tiene una molécula de PEG conjugada a un grupo sulfhidrilo de una cisteína no nativa del polipéptido Factor VII.

Ejemplos no limitantes de derivados de factor VII incluyen derivados de FVII GlicoPegilados como se describen en WO 03/31464 y las solicitudes de patente US 20040043446, US 20040063911, US 20040142856, US 20040137557, y US 20040132640 (Neose Technologies, Inc.); conjugados de FVII como se describen en WO 01/04287, la solicitud de patente US 20030165996, WO 01/58935, WO 03/93465 (Maxygen ApS) y WO 02/02764, así como la solicitud de patente US 20030211094 (Universidad de Minnesota).

El término "actividad biológica mejorada" se refiere a polipéptidos Factor VII que tienen i) sustancialmente la misma o mejor actividad proteolítica comparados con el Factor VIIa humano de tipo salvaje recombinante o ii) a polipéptidos FVII que tienen sustancialmente la misma o mayor actividad de fijación TF comparados con el Factor VIIa humano de tipo salvaje recombinante, o iii) a polipéptidos Factor VII que tienen sustancialmente la misma o mayor semivida en plasma sanguíneo comparados con el Factor VIIa humano de tipo salvaje recombinante. El término "Factor VIIa humano PEGilado" significa Factor VIIa humano, que tiene una molécula de PEG conjugada a un polipéptido de Factor VIIa humano. Debe entenderse que la molécula de PEG puede estar unida a cualquier parte del polipéptido Factor VIIa, con inclusión de cualquier residuo de aminoácido o resto carbohidrato del polipéptido Factor VII. El término "Factor VIIa humano PEGilado a cisteína" significa Factor VIIa que tiene una molécula de PEG conjugada a un grupo sulfhidrilo de una cisteína introducida en Factor VIIa humano.

Ejemplos no limitantes de variantes del Factor VII que tienen sustancialmente la misma o mayor actividad proteolítica comparada con el Factor VIIa humano de tipo salvaje recombinante incluyen S52A-FVIIa, S60A-FVIIa (Lino et al., Arch. Biochem. Biophys. 352: 182-192, 1998); variantes de FVIIa que exhiben estabilidad proteolítica incrementada como se describen en la Patente US No. 5,580,560; el Factor VIIa que se ha escindido proteolíticamente entre los residuos 290 y 291 o entre los residuos 315 y 316 (Mollerup et al., Biotechnol. Bioeng. 48:501-505, 1995); formas oxidadas del Factor VIIa (Kornfelt et al., Arch. Biochem. Biophys. 363:43-54, 1999); variantes de FVII como se describen en PCT/DK02/00189 (correspondiente a WO 02/077218); y variantes de FVII que exhiben estabilidad proteolítica incrementada como se describen en WO 02/38162 (Scripps Research Institute); variantes de VII que tienen un dominio Gla modificado y que exhiben una fijación mejorada a la membrana como se describen en WO 99/20767, patentes US 6017882 y US 6747003, solicitud de patente US 20030100506 (Universidad de Minnesota) y WO 00/66753, solicitudes de patente US 20010018414, US 2004220106, y US 200131005, patentes US 6762286 y US 6693075 (Universidad de Minnesota); y variantes de FVII como se describen en WO 01/58935, patente US 6806063, solicitud de patente US 20030096338 (Maxygen ApS), WO 03/93465 (Maxygen ApS), WO 04/029091 (Maxygen ApS), WO 04/083361 (Maxygen ApS), y WO 04/111242 (Maxygen ApS), así como en WO 04/108763 (Canadian Blood Services).

Ejemplos no limitantes de variantes de FVII que tienen actividad biológica incrementada comparados con FVIIa de tipo salvaje incluyen variantes de FVII como se describen en WO 01/83725, WO 02/22776, WO 02/077218, PCT/DK02/00635 (correspondiente a WO 03/027147), la solicitud de patente danesa PA 2002 01423 (correspondiente a WO 04/029090), la solicitud de patente danesa PA 2001 01627 (correspondiente a WO 03/027147); WO 02/38162 (Scripps Research Institute); y variantes de FVIIa con actividad mejorada como se describe en JP 2001061479 (Chemo-Sero-Therapeutic Res Inst.).

Ejemplos específicos de polipéptidos Factor VII "transformados por ingeniería" interesantes son los descritos en WO 02/077218 A1 (Novo Nordisk A/S) y WO 01/58935 A2 (Maxygen ApS) páginas 21-24.

Ejemplos de posiciones, en las cuales pueden introducirse residuos cisteína incluyen, pero sin carácter limitante, posiciones en o en las proximidades de los sitios de degradación proteolítica. Así, en una realización interesante de la invención, el o los residuos cisteína a introducir, preferiblemente por sustitución, se selecciona (n) del grupo constituido por I30C, K32C, D33C, A34C, T37C, K38C, W41C, Y44C, S45C, D46C, L141C, E142C, K143C, R144C, L288C, D289C, R290C, G291C, A292C, S314C, R315C, K316C, V317C, L390C, M391C, R392C, S393C, E394C, P395C, R396C, P397C, G398C, V399C, L401C, R402C, A403C, P404C y combinaciones de los mismos, seleccionados en particular del grupo constituido por K32C, Y44C, K143C, R290C, R315C, K341C, R392C, R396C, R402C y combinaciones de los mismos. En otra realización interesante de la invención, el o los residuos cisteína se introducen en una posición que en FVII de tipo salvaje está ocupada por un residuo treonina o serina que tiene al menos 25% de su cadena lateral el puesto en la superficie. Por ejemplo, en el polipéptido Factor VII se introduce un residuo cisteína, preferiblemente por sustitución, en al menos una posición seleccionada del grupo constituido por S12, S23, S43, S45, S52, S53, S60, S67, T83, S103, T106, T108, S111, S119, S126, T128, T130, S147, T185, S214, S222, S232, T233, T238, T239, T255, T267, T293, T307, S320, T324, S333, S336, T370 y S393. De modo aún más preferible, el residuo cisteína se introduce en al menos una posición de FVII que contiene un residuo S, seleccionándose la posición del grupo constituido por, S12, S23, S43, S45, S52, S53, S60, S67, S103, S111, S119, S126, S147, S214, S222, S232, S320, S333, S336 y S393. En una realización adicional, el o los residuos cisteína se introduce(n) en una posición que en FVII de tipo salvaje está ocupada por un residuo treonina o serina que tiene al menos 50% de su cadena lateral expuesto en la superficie. Por ejemplo, en el polipéptido FVII se introduce un residuo cisteína, preferiblemente por sustitución, en al menos una posición seleccionada del grupo constituido por S23, S43, S52, S53, S60, S67, T106, T108, S111, S119, S147, S214, T238, T267 y T293, de modo aún más preferible, una posición seleccionada del grupo constituido por S23, S43, S52, S53, S60, S67, S111, S119, S147 y S214. En otra realización adicional, se introduce un residuo cisteína en al menos una posición seleccionada de cualquiera de las posiciones arriba mencionadas, que no está localizada en una región de sitio activo. Preferiblemente, la posición es una ocupada por un residuo T o S. Como ejemplo, el polipéptido Factor VII comprende un residuo cisteína introducido en al menos una posición seleccionada del grupo constituido por S12, S23, S43, S45, S52, S53, S60, S67, T83, S103, T106, T108, S111, S119, S126, T128, T130, S147, T185, S214, S222, T255, T267, T307, S320, S333, S336, T370 y S393 (teniendo más de 25% de su cadena lateral expuesto en la superficie), seleccionada en particular del grupo constituido por S12, S23, S43, S45, S52, S53, S60, S67, S103, S111, S1 19, S 126, S147, S214, S222, S320, S333, S336 y S393 (ocupado por un residuo S) y, más preferiblemente, del grupo constituido por S23, S43, S52, S53, S60, S67, T106, T108, S111, S119, S147, S214 y T267 (que tiene más de 50% de su cadena lateral expuesto en la superficie), en particular del grupo constituido por S23, S43, S52, S53, S60, S67, S111, S119, S147 y S214 (ocupado por un residuo S). En otra realización adicional, se introduce un residuo cisteína en al menos una posición seleccionada de cualquiera de las listas anteriores, que no está localizada en una región de sitio de fijación de factor tisular. Preferiblemente, la posición es una ocupada por un residuo T o S. Como ejemplo, el polipéptido Factor VII comprende un residuo cisteína introducido en al menos una posición seleccionada del grupo constituido por S12, S23, S45, S52, S53, S67, T83, S103, T106, T108, S111, S119, S126, T128, T130, S147, T185, S214, S222, S232, T233, T238, T239, T255, T267, T293, S320, T324, S333, S336, T370 y S393 (que tiene más de 25% de su cadena lateral expuesto en la superficie), seleccionado en particular del grupo constituido por S12, S23, S45, S52, S53, S67, S103, S111, S119, S126, S147, S214, S222, S232, S320, S333, S336 y S393 (ocupado por un residuo S) y, más preferiblemente, del grupo constituido por S23, S52, S53, S67, T106, T108, S111, S119, S147, S214, T238, T267 y T293 (que tiene más de 50% de su cadena lateral expuesto en la superficie, en particular del grupo constituido por S23, S52, S53, S67, S111, S119, S147 y S214 (ocupado por un residuo S). En otra realización adicional, se introduce un residuo cisteína en al menos una posición seleccionada de cualquiera de las listas anteriores, que no está localizada en una región de sitio de fijación de factor tisular ni en una región de sitio activo. Preferiblemente, la posición es una ocupada por un residuo T o S. Como ejemplo, el polipéptido Factor VII comprende un residuo cisteína introducido en al menos una posición seleccionada del grupo constituido por S12, S23, S45, S52, S53, S67, T83, S103, T106, T108, S111, S119, S126, T128, T130, S147, T185, S214, S222, T255, T267, S320, S333, S336, T370 y S393 (que tiene más de 25% de su cadena lateral expuesto en la superficie), seleccionado en particular del grupo constituido por S12, S23, S45, S52, S53, S67, S103, S111, S119, S126, S147, S214, S222, S320, S333, S336 y S393 (ocupado por un residuo S), y, más preferiblemente, del grupo constituido por S23, S52, S53, S67, T106, T108, S111, S119, S147, S214 y T267 (que tiene más de 50% de su cadena lateral expuesta en la superficie), en particular del grupo constituido por S23, S52, S53, S67, S111, S119, S147 y S214 (ocupado por un residuo S).

Otros ejemplos útiles de polipéptido Factor VII incluyen aquéllos en los cuales un aminoácido en una posición seleccionada de 247-260, 393-405 o 406, en particular R396, Q250 o P406, o K157, V158, M298, L305, D334, S336, K337 o F374 ha sido sustituido con una cisteína, o en los cuales se ha introducido una cisteína en el terminal, v.g. Factor VIIa 407C.

Inhibidor de proteínas

En una realización interesante, la mixtura comprende además un inhibidor de la proteína. Por inclusión de un inhibidor de la mixtura, se cree que la conformación de la proteína se estabiliza en cierto grado, por lo cual los enlaces disulfuro intramoleculares tienen menor tendencia a ser reducidos por el tampón redox. Preferiblemente, el inhibidor de la proteína es un inhibidor de sitio activo.

En el caso de que la proteína sea un polipéptido Factor VII, la presencia de un inhibidor del sitio activo que se extiende en la bolsa de fijación S1 podría ser necesaria durante la reacción de reducción selectiva para proteger los enlaces disulfuro internos en la región del sitio activo contra la reducción. Inhibidores útiles para este propósito incluyen benzamidinas, tales como 4-aminobenzamidina, arginina, y otros análogos más potentes, véanse, v.g., los descritos en WO 05/016.365 A3 y los descritos por Aventis en EP 1.162.194 A1; compárense, en particular, los definidos en las reivindicaciones 1-6 y en las secciones [0009]-[0052], y en EP 1.270.551 A1, compárense en particular las reivindicaciones 1 y 2 y las secciones [0010]-[0032].

Conjugación

Un propósito importante de los métodos de reducción selectiva arriba descritos es la liberación de un grupo cisteína que puede utilizarse para fijación (conjugación) de un grupo químico, v.g. un resto no polipeptídico.

Por tanto, en una realización importante, el método comprende además el paso simultáneo y/o subsiguiente de conjugar al menos uno de los restos cisteína reducidos selectivamente (HS-Cys) con un grupo químico.

Debería entenderse que la conjugación del al menos un resto cisteína reducido selectivamente con un grupo químico puede conducirse simultáneamente, es decir, por adición de uno o más reactivos que conducen a la conjugación a la mixtura que comprende el tampón redox, o en un paso subsiguiente, v.g. después de purificación y/o aislamiento de la proteína reducida selectivamente.

En una realización, el grupo químico es un grupo retardador, es decir un grupo que, después de la conjugación a la proteína (v.g. Polipéptido Factor VII) aumenta la semivida de circulación de dicha proteína o polipéptido, cuando se compara con la proteína o polipéptido no modificado. El principio especifico que subyace detrás del efecto retardador puede estar causado por aumento de tamaño, apantallado de las secuencias peptídicas que pueden ser reconocidas por peptidasas o anticuerpos, o enmascaramiento de glucanos de tal manera que los mismos no son reconocidos por receptores específicos de glucanos presentes, v.g. En el hígado o en macrófagos, previniendo o reduciendo así el aclaramiento. El efecto retardante del grupo retardador puede estar causado también, v.g., por fijación a componentes de la sangre tales como albúmina, o adhesión inespecífica a tejido vascular. La glicoproteína conjugada debería conservar sustancialmente su actividad biológica.

En una realización de la invención, el grupo retardador se selecciona del grupo constituido por: (a) Un radical orgánico cargado de peso molecular bajo (15-1000 Da), que puede contener uno o más ácidos carboxílicos, aminas, ácidos sulfónicos, ácidos fosfónicos, o combinación de los mismos.

(b) Una molécula hidrófila neutra de peso molecular bajo (15-1000 Da), tal como ciclodextrina, o una cadena de polietileno que puede estar ramificada opcionalmente.

(c) Una molécula hidrófoba de peso molecular bajo (15-1000 Da) tal como un ácido graso o ácido cólico o derivados de los mismos.

(d) Polietilenglicol con un peso molecular medio de 2.000-60.000 Da.

(e) Un polímero de precisión bien definido tal como un dendrímero con un peso molecular exacto que va desde 700 a 20.000 Da, o de modo más preferible entre 700 y 10.000 Da.

(f) Un polipéptido sustancialmente no inmunógeno tal como albúmina o un anticuerpo o parte de un anticuerpo que contiene opcionalmente un dominio Fc.

(g) Un polímero orgánico de peso molecular alto tal como dextrano.

En otra realización de la invención, el grupo retardador se selecciona del grupo constituido por dendrímeros, poli(óxido de alquileno) (PAO), que incluye polialquilenglicol (PAG), tal como polietilenglicol (PEG), y polipropilenglicol (PPG), PEGs ramificados, poli (alcohol vinílico) (PVA), policarboxilato, polivinilpirrolidona, anhídrido polietileno-co-ácido maleico, anhídrido poliestireno-co-ácido maleico, y dextrano, con inclusión de carboximetil- dextrano. En una realización particularmente interesante de la invención, el grupo retardador es un grupo PEG.

El término "polímero ramificado" o de modo intercambiable "polímero dendrítico", "dendrímero" o "estructura dendrítica" significa un polímero orgánico ensamblado a partir de una selección de bloques de construcción monómeros, alguno de los cuales contiene ramificaciones.

En una realización de la invención, el grupo retardador se selecciona del grupo constituido por ligandos de fijación de proteínas del suero, tales como compuestos que se fijan a albúmina, como ácidos grasos, ácido graso C5-C24, diácido alifático (v.g. C5-C24). Otros ejemplos de grupos retardadores incluyen moléculas orgánicas pequeñas que contienen restos que, en condiciones fisiológicas, alteran las propiedades de carga, tales como ácidos carboxílicos o aminas, o sustituyentes neutros que previenen el reconocimiento específico de glucanos tales como sustituyentes alquilo más pequeños (v.g., alquilo C1-C5). En una realización de la invención, el grupo retardador es albúmina.

En una realización, el grupo químico es un grupo distinto de polipéptido.

En una realización interesante, el grupo químico es un polietilenglicol (PEG) en particular uno que tiene un peso molecular medio en el intervalo de 500-100.000, tal como 1.000-75.000, o 2.000-60.000.

La conjugación puede conducirse como se expone en WO 02/077218 A1 y WO 01/58.935 A2.

Es particularmente interesante el uso de PEG como grupo químico para conjugación con la proteína. El término "polietilenglicol" o "PEG" significa un compuesto de polietilenglicol o un derivado del mismo, con o sin agentes de acoplamiento, restos de acoplamiento o activadores (v.g., con tiol, triflato, tresilato, aziridina, oxirano, piridilditio, vinil- sulfona, haloacetato, o preferiblemente con un resto maleimida). Los compuestos tales como maleimido, monometoxi, PEG, son compuestos de PEG ilustrativos o activados de la invención.

PEG es una molécula polímera adecuada, dado que la misma tiene sólo pocos grupos reactivos susceptibles de reticulación comparada con polisacáridos tales como dextrano. En particular, el PEG monofuncional, v.g.

metoxipolietilenglicol (mPEG), es interesante debido a que su química de acoplamiento es relativamente simple (está disponible sólo un grupo reactivo para conjugación con grupos de fijación en el polipéptido). Por consiguiente, el riesgo de reticulación se elimina, los conjugados de polipéptido resultantes son más homogéneos y la reacción de las moléculas de polímero con el polipéptido es más fácil de controlar.

Para efectuar la fijación covalente de la o las moléculas de polímero con el polipéptido, los grupos terminales hidroxilo de la molécula de polímero se proporcionan en forma activada, es decir con grupos funcionales reactivos. Moléculas de polímero activadas adecuadas están disponibles comercialmente, v.g. de Shearwater Corp., Huntsville, Ala., USA, o de PolyMASC Pharmaceuticals plc, RU. Alternativamente, las moléculas de polímero pueden activarse por métodos convencionales conocidos en la técnica, v.g. como se describen en WO 90/13.540. Ejemplos específicos de moléculas de polímero lineales o ramificadas activadas para uso en la presente invención se describen en los catálogos de 1997 y 2000 de Shearwater Corp. (Functionalized Biocompatible Polymers for Research y pharmaceuticals, Polyethylene Glycol y Derivatives). Ejemplos específicos de polímeros PEG incluyen los siguientes PEGs lineales: NHS-PEG (v.g. SPA-PEG, SSPA-PEG, SBA-PEG, SS-PEG, SSA-PEG, SC-PEG, SG- PEG, y SCM-PEG), y NOR-PEG), BTC-PEG, EPOX-PEG, NCO-PEG, NPC-PEG, CDI-PEG, ALD-PEG, TRES-PEG, VS-PEG, IODO-PEG, y MAL-PEG, y PEGs ramificados tales como PEG2-NHS y los descritos en US Pat. No.

5.932.462 y US Pat. No. 5.643.575. Adicionalmente, las publicaciones siguientes describen moléculas de polímero y/o químicas de PEGilación útiles: US Pat. No. 5.824.778, US Pat. No. 5.476.653, WO 97/32607, EP 229.108, EP 402.378, US Pat. No. 4.902.502, US Pat. No. 5.281.698, US Pat. No. 5.122.614, US Pat. No. 5.219.564, WO 92/16555, WO 94/04193, WO 94/14758, WO 94/17039, WO 94/18247, WO 94/28024, WO 95/00162, WO 95/11924, WO 95/13090, WO 95/33490, WO 96/00080, WO 97/18832, WO 98/41562, WO 98/48837, WO 99/32134, WO 99/32139, WO 99/32140, WO 96/40791, WO 98/32466, WO 95/06058, EP 439 508, WO 97/03106, WO 96/21469, WO 95/13312, EP 921.131, US Pat. No. 5.736.625, WO 98/05363, EP 809.996, US Pat. No. 5.629.384, WO 96/41813, WO 96/07670, US Pat. No. 5.473.034, US Pat. No. 5.516.673, EP 605.963, US Pat. No. 5.382.657, EP 510.356, EP 400.472, EP 183.503 y EP 154.316.

La conjugación del polipéptido y las moléculas de polímero activado se realiza por el uso de cualquier método convencional, v.g. como se describe en las referencias siguientes (que describen también métodos adecuados para activación de moléculas de polímero): R. F. Taylor, (1991), "Protein immobilisation. Fundamental y applications", Marcel Dekker, N.Y.; S. S. Wong, (1992), "Chemistry of Protein Conjugation y Crosslinking", CRC Press, Boca Raton; G. T. Hermanson et al., (1993), "Immobilized Affinity Ligand Techniques", Academic Press, N.Y.). La persona experta se dará cuenta de que el método de activación y/o la química de conjugación a utilizar dependen del grupo o grupos de fijación del polipéptido (ejemplos de los cuales se han dado arriba adicionalmente), así como de los grupos funcionales del polímero (siendo éstos v.g., amina, hidroxilo, carboxilo, aldehído, sulfhidrilo, succinimidilo, maleimida, vinil-sulfona o haloacetato). La PEGilación puede dirigirse hacia la conjugación con todos los grupos de fijación disponibles en el polipéptido (es decir grupos de fijación tales que están expuestos en la superficie del polipéptido) o puede dirigirse hacia uno o más grupos de fijación específicos, v.g. El grupo amino N-terminal (US Pat. No. 5.985.265). Adicionalmente, la conjugación puede realizarse en un solo paso o de manera escalonada (v.g., como se describe en WO 99/55377).

Se comprenderá que la PEGilación está diseñada a fin de producir una molécula óptima con respecto al número de moléculas de PEG unidas, el tamaño y la forma de tales moléculas (v.g. si son lineales o ramificadas), y el punto del polipéptido en el que se fijan tales moléculas en el polipéptido. El peso molecular del polímero a utilizar se seleccionará teniendo en consideración el efecto deseado a alcanzar. Por ejemplo, si el propósito primario de la conjugación es conseguir un conjugado que tenga un peso molecular alto y mayor tamaño (v.g. para reducir el aclaramiento renal), puede seleccionarse conjugar una sola o un número pequeño de moléculas de polímero de peso molecular alto o cierto número de moléculas de polímero con un peso molecular menor para obtener el efecto deseado.

Adicionalmente, se ha encontrado que se obtienen resultados ventajosos cuando el tamaño aparente (al que se hace referencia también como "peso molecular aparente" o "masa aparente") de al menos una parte principal del conjugado de la invención es al menos aproximadamente 50 kDa, tal como al menos aproximadamente 55 kDa, tal como al menos aproximadamente 60 kDa, v.g. al menos aproximadamente 66 kDa. Se cree que esto es debido al hecho de que el aclaramiento renal se elimina sustancialmente para conjugados que tengan un tamaño aparente suficientemente grande. En el presente contexto, el "tamaño aparente" de un conjugado de proteína o polipéptido Factor VII se determina por el método SDS-PAGE.

Adicionalmente, se ha comunicado que una conjugación de polímero excesiva puede conducir a una pérdida de actividad de la proteína (v.g. Polipéptido Factor VII) a la cual está conjugado el grupo químico (v.g. un resto no- polipéptido) (véase adicionalmente más adelante). Este problema puede eliminarse, v.g., por eliminación del grupos de fijación localizados en el sitio funcional o por bloqueo reversible del sitio funcional antes de la conjugación, de tal modo que el sitio funcional de la proteína está bloqueado durante la conjugación. Específicamente, la conjugación entre la proteína y el grupo químico (v.g. resto no polipéptido) puede conducirse en condiciones en las que el sitio funcional de la proteína está bloqueado por una molécula adyuvante, v.g. factor tisular capaz de fijación al sitio funcional de la proteína, o un inhibidor serina-proteasa. Preferiblemente, la molécula adyuvante es una que reconoce específicamente un sitio funcional de la proteína, tal como un receptor, en particular factor tisular, sea de longitud total o una forma convenientemente truncada de factor tisular o dos moléculas, siendo una factor tisular y la otra un péptido o inhibidor peptídico que se fija al área situada alrededor de la triada catalítica, protegiendo así la misma (definida preferiblemente como residuo aminoácido dentro de 10 Å de cualquier átomo en la triada catalítica).

Alternativamente, la molécula adyuvante puede ser un anticuerpo, en particular un anticuerpo monoclonal que reconozca la proteína (v.g. Polipéptido Factor VII). En particular, la molécula adyuvante puede ser un anticuerpo monoclonal neutralizante.

La proteína tiene preferiblemente por objeto interaccionar con la molécula adyuvante antes de efectuar la conjugación. (A menudo es incluso ventajoso utilizar la misma molécula adyuvante (v.g. un inhibidor) que la utilizada en los pasos en que se reducen disulfuros mixtos.) Esto asegura que el sitio funcional de la proteína (v.g. Polipéptido Factor VII) está apantallado o protegido y por consiguiente no está disponible para derivatización por el grupo químico (v.g. resto no polipéptido) tal como un polímero.

A continuación de su elución de la molécula adyuvante, el conjugado del grupo químico y la proteína puede recuperarse con al menos un sitio funcional parcialmente preservado.

Realización preferida

En una realización actualmente preferida, la invención se refiere a un método para reducción selectiva de un polipéptido Factor VII en su conformación activa, comprendiendo dicho polipéptido Factor VII uno o más restos cisteína conjugado(s) a través de un puente disulfuro a un tiol de peso molecular bajo (RS-Cys), no estando implicados dicho resto o restos en puentes S-S intramoleculares (Cys-S-S-Cys) cuando el polipéptido Factor VII está en su forma activa, comprendiendo el método el paso de permitir que el polipéptido FVII conjugado con el tiol de peso molecular bajo reaccione con una mixtura que comprende glutatión reducido y oxidado y una glutarredoxina, y el paso simultáneo y/o subsiguiente de conjugación de al menos uno de los restos cisteína reducidos selectivamente (HS-Cys) con un grupo químico, teniendo lugar cada paso en condiciones no desnaturalizantes.

Parte experimental

Materiales y métodos

Materiales – DL-ditiotreitol (DTT) se adquirió de Sigma. Glutatión reducido y oxidado (GSH y GSSG, respectivamente), cisteína (Cys), DL-homocisteína (hCy), cisteinil-glicina (CG), y γ-glutamilcisteína (γ-GC) se adquirieron de Sigma. Cisteamina (Cya) y ácido 7-fluorobenzofurazan-4-sulfónico, sal de amonio (SBD-f) se obtuvieron de Fluka. Tris(2-carboxietil)fosfina (TCEP) se adquirió de Calbiochem (Merck KGaA, Darmstadt, Alemania). Yodoacetamida se adquirió de Sigma. El sustrato cromógeno S-2288 se obtuvo de Chromogenix (Milano, Italia). PEG5k-maleimida (2E2M0H01), PEG20k-maleimida (2E2M0P01), PEG40k-maleimida (2D3Y0T01), y maleimida-PEG3.4k-maleimida (2E2E0F02) se adquirieron de Nektar Therapeutics (Huntsville, AL). La d-Phe-Phe- Arg-clorometilcetona se adquirió de Bachem. El ácido trifenilfosfina-3,3',3"-trisulfónico se obtuvo de Aldrich. FX y FXa humanos privados de plasma se obtuvieron de Enzyme Research Laboratories Inc. (South Bend, IN). El factor tisular soluble (sTF) 1-219 se preparó conforme a procedimientos publicados (Freskgard et al., 1996). La expresión y purificación de FVIIa recombinante se realizó como se ha descrito previamente (Thim et al., 1988; Persson y Nielsen, 1996). Todos los productos químicos restantes eran de calidad analítica o mejor

Determinación de la concentración - La concentración de GSSG en las soluciones stock se determinó a partir de su absorción a 248 nm utilizando un coeficiente de extinción de 381 M-1cm-1 (Chau y Nelson, 1991). La concentración de GSH, DTT, y otros tioles de peso molecular bajo se determinaron utilizando el reactivo de Ellman (ácido 5,5'- ditiobis(2-nitrobenzoico)) y 14150 M-1cm-1 como el coeficiente de extinción molar del ácido 2-nitro-5-tiobenzoico a 412 nm (Riddles et al., 1979). Cuantificación de GSSG por HPLC - La cuantificación de GSSG se realizó esencialmente como se describe en otro lugar (Takahashi y Creighton, 1996). Resumidamente, se cargaron 50 µl de una muestra extinguida con ácido en una columna C18 de fase inversa (Luna C18(2) 100 A, de tamaño de partícula 3 µm, 4,6x50mm; Phenomenex Inc., Torrance, CA) mantenida a 30°C. Después de 5 minutos de operación isocrática a 100% de eluyente A, ácido trifluoroacético (TFA) (0,1% (v/v) en agua) se eluyó GSSG por un gradiente lineal de 0- 5% de eluyente B, TFA (0,085% (v/v) en acetonitrilo) durante 5 minutos a un caudal de 1 ml/min y se detectó por absorción a 214 nm. La concentración de GSSG se determinó por relación del área de pico calculada (software Millenium32 v4.0, Waters) con una curva estándar construida con cantidades conocidas de GSSG. Se observó linealidad en el intervalo de 2-25 nmol GSSG.

Análisis de FVIIa 407C modificado con tiol por HPLC - Se analizaron especies de FVIIa 407C libre y modificado con tiol por HPLC utilizando una columna C3 de fase inversa (Zorbax 300SB-C3, 2,1x150mm, tamaño de partícula 5-µm; Agilent Technologies, Dinamarca) mantenida a 45 ºC. El caudal era 0, 5 ml/min y las fases móviles consistían en 0,1% (v/v) TFA en agua (eluyente A) y 0,085% (v/v) TFA en acetonitrilo (eluyente B). Después de inyección de 25 µl de muestra extinguida con ácido, el sistema se condujo isocráticamente a 30% de eluyente B durante 5 min seguido por gradientes lineales de 38-41,5% de eluyente B durante 20 min y 41,5-55% de eluyente B durante 20 min. El eluato se monitorizó por fluorescencia (longitudes de onda de excitación y emisión de 280 y 348 nm, respectivamente).

Ejemplos

FVIIa contiene enlaces disulfuro intramoleculares lábiles como se comprobó por incubación en presencia de DTT - La presencia de enlaces disulfuro intramoleculares lábiles en FVIIa se determinó a partir de la pérdida de actividad catalítica después de incubación en presencia de 0, 0,5, 1, ó 5 mM del agente de reducción de disulfuros DTT. La reacción se llevó a cabo a la temperatura ambiente en un tampón de reacción (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, 0,01% Tween 80, pH 7,0) que contenía 300 µM FVIIa, y DTT. A intervalos de tiempo, se transfirieron 20 µl de la reacción a 160 µl de tampón de reacción que contenía 10 mM yodoacetamida para alquilar rápidamente los tioles libres y extinguir la reacción. Subsiguientemente, se midió la actividad amidolítica residual en placas de microtitulación de poliestireno (Nunc, Dinamarca) por adición de 20 µl de sustrato cromógeno S-2288 a una concentración final 1 mM y se monitorizó continuamente la absorbancia a 405 nm durante 10 minutos en un espectrofotómetro de microplacas SpectraMax™ 340 equipado con software SOFTmax PRO (v2.2; Molecular Devices Corp., Sunnyvale, CA). La actividad amidolítica se consignó como la pendiente de las curvas lineales de progreso con relación a la pendiente en ausencia de DTT en el tiempo cero. Véase la tabla 3.

Tabla 3 -Actividad amidolítica relativa de FVIIa en presencia de las concentraciones indicadas de DTT. Las actividades relativas se calcularon como 100×At(muestra)/A0(0mM DTT), donde At designaba la pendiente de la curva lineal de progreso para el tiempo t.

Tiempo

0 mM DTT

0,5 mM DTT

1 mM DTT

5 mM DTT

0 min 100 97 95 75 10 min 103 91 81 36 20 min 102 84 69 16 40 min 106 73 54 6 60 min 111 3 80 min 111 59 2 100 min 119 52 24 2 120 min 122 19 1

Construcción de DNA codificante de FVII 407C mutante - Se construyó un constructo de DNA que codificaba FVIIa 407C como se describe en WO 02/077218 A1

Construcción de DNA codificante de FVII Q250C mutante - Se construyó un constructo de DNA que codificaba FVIIa Q250C como se describe en WO 02/077218 A1

Construcción de DNA codificante de FVII R396C mutante - Se construyó un constructo de DNA que codificaba FVIIa R396C como se describe en WO 02/077218 A1

Expresión y purificación de FVII 407C - Células BHK se transfectaron esencialmente como se ha descrito con anterioridad (Thim et al., 1988; Persson y Nielsen, 1996) para obtener la expresión de la variante FVIIa 407C. El polipéptido Factor VII se purificó como sigue: El medio acondicionado se cargó en una columna de 25 mL de Q Sepharose Fast Flow (Amersham Biosciences, GE Healthcare) después de adición de 5 mM EDTA, 0,1% Triton X-100 y 10 mM Tris, con ajuste del pH a 8,0 y ajuste de la conductividad a 10-11 mS/cm por adición de agua. La elución de la proteína se realizó por un gradiente de 10 mM Tris, 50 mM NaCl, 0,1% Triton X-100, pH 8,0 a 10 mM Tris, 50 mM NaCl, 25 mM CaCl2, 0.1% Triton X-100, pH 7,5.

Las fracciones que contenían FVIIa 407C se agruparon, y se aplicaron a una columna de 25 mL que contenía el anticuerpo monoclonal F1A2 (Novo Nordisk A/S, Bagsværd, Dinamarca) acoplado a Sepharose 4B activada con CNBr (Amersham Biosciences, GE Healthcare). La columna se equilibró con 50 mM HEPES, pH 7,5, que contenía 10 mM CaCl2, 100 mM NaCl y 0,02% Triton X-100. Después de lavado con tampón de equilibración y tampón de equilibración que contenía 2 M NaCl, el material fijado se eluyó con tampón de equilibración que contenía 10 mM EDTA en lugar de CaCl2. Antes del almacenamiento, FVIIa 407C se transfirió a un tampón 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 7,0 por diálisis. El rendimiento de cada paso se siguió por medidas ELISA de Factor VII y la proteína purificada se analizó por SDS-PAGE.

Expresión y purificación de FVII Q250C - Células BHK se transfectaron esencialmente como se ha descrito con anterioridad (Thim et al., 1988; Persson y Nielsen, 1996) para obtener la expresión de la variante FVIIa Q250C. El polipéptido Factor VII se purificó como sigue: El medio acondicionado se cargó en una columna de 25 mL de Q Sepharose Fast Flow (Amersham Biosciences, GE Healthcare) después de adición de 5 mM EDTA, 0,1% Triton X-100 y 10 mM Tris, con ajuste del pH a 8,0 y ajuste de la conductividad a 10-11 mS/cm por adición de agua. La elución de la proteína se realizó por un gradiente de 10 mM Tris, 50 mM NaCl, 0,1% Triton X-100, pH 8,0 a 10 mM Tris, 50 mM NaCl, 25 mM CaCl2, 0.1% Triton X-100, pH 7,5.

Las fracciones que contenían FVIIa 407C se agruparon, y se aplicaron a una columna de 25 mL que contenía el anticuerpo monoclonal F1A2 (Novo Nordisk A/S, Bagsværd, Dinamarca) acoplado a Sepharose 4B activada con CNBr (Amersham Biosciences, GE Healthcare). La columna se equilibró con 50 mM HEPES, pH 7,5, que contenía 10 mM CaCl2, 100 mM NaCl y 0,02% Triton X-100. Después de lavado con tampón de equilibración y tampón de equilibración que contenía 2 M NaCl, el material fijado se eluyó con tampón de equilibración que contenía 10 mM EDTA en lugar de CaCl2. Antes del almacenamiento, FVIIa Q250C se transfirió a un tampón 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 7,0 por diálisis. El rendimiento de cada paso se siguió por medidas ELISA del Factor VII y la proteína purificada se analizó por SDS-PAGE.

Expresión y purificación de FVII R396C – El expresión y purificación de FVII R396C se realizó como se describe en WO 02/077218 A1.

Clonación y expresión de glutarredoxinas -Secuencias de DNA codificante de glutarredoxina 2 (Grx2) de Escherichia coli y glutarredoxina 1 (yGrx1p) de Saccharomyces cerevisiae se amplificaron por PCR utilizando el sistema Expand High Fidelity PCR (Roche Diagnostics Corporation, Indianapolis, IN) conforme a las recomendaciones del fabricante y los pares de cebadores oHOJ98-f/oHOJ98-r y oHOJ11-f/oHOJ11-r, respectivamente, introduciendo los sitios de restricción flanqueantes NdeI y XhoI (las secuencias de los cebadores se enumeran en la Tabla 1).

Tabla 1 - Oligómeros de DNA utilizados para construcción de los plásmidos pHOJ294, 210, y 286 que expresan glutarredoxina 2 (Grx2) de E.coli, glutarredoxina 1 (yGrx1p) de S.cerevisiae, e yGrx1p C30S, respectivamente. Los sitios de restricción NdeI y XhoI se representan en negrita.

Cebador Plásmido

Diana

Secuencia (5'→3')

oHOJ11-f pHOJ210 yGrx1p GGGCCGCCCATATGGTATCTCAAGAAACTATC oHOJ11-r pHOJ210 yGrx1p GCCCGGGCTCGAGATTTGCAAGAATAGGTTCTAAC oHOJ98-f pHOJ294 Grx2 GCCGCCGGCATATGAAGCTATACATTTACGATCACTGCCC oHOJ98-r pHOJ294 Grx2 CCGCCGCCCTCGAGAATCGCCATTGATGATAACAAATTGATTTGTG oHOJ88-f pHOJ286 yGrx1p C30S GTTTAGGGCTGCATGCGAGTATGGACAGTACG oHOJ88-r pHOJ286 yGrx1p C30S CGTACTGTCCATACTCGCATGCAGCCCTAAAC El molde de DNA genómico para las reacciones PCR se preparó a partir de E.coli y S.cerevisiae conforme a procedimientos publicados (Grimberg et al., 1989; Hoffman y Winston, 1987). Los productos PCR purificados se cortaron con NdeI XhoI y se ligaron luego a los sitios correspondientes de pET-24a(+) (Novagen) para dar pHOJ294 y pHOJ210, respectivamente. Dado que los codones de parada estaban proporcionados por el vector, los 2 genes estaban equipados con extensiones derivadas del vector 3' que codificaban marcadores de afinidad LEHHHHHH C- terminales. Se construyó el plásmido pHOJ286 que codificaba yGrx1p Cys30→Ser (yGrx1p C30S) por mutagénesis orientada QuickChange® utilizando cebadores oHOJ88-f/oHOJ88-r y pHOJ210 como molde conforme a las instrucciones del fabricante (Stratagene, La Jolla, CA). La identidad correcta de todas las secuencias clonadas se comprobó por secuenciación del DNA.

Para la expresión, se introdujeron los plásmidos pHOJ210, 286, y 294 en células BL21(DE3) químicamente competentes (Stratagene, La Jolla, CA). Se inocularon transformantes recientes de una noche en 500 mL de caldo genial ((Sambrook et al., 1989)) y 30 µg/ml de kanamicina a una OD600 inicial de 0,02. Los cultivos se desarrollaron a 37°C en matraces provistos de deflectores a 230 rpm hasta la fase logarítmica media (OD600 3-4) en cuyo momento la temperatura se redujo a 25°C y se indujo la expresión de proteína por 0,1 mM isopropil-β-D-tiogalactopiranosido (ITPG). Después de expresión durante una noche, se cosecharon las células por centrifugación, se resuspendieron en 50 ml de tampón de lisis (50 mM fosfato de potasio, 300 mM NaCl, pH 8,0), y se lisaron por 3 ciclos de congelación-descongelación. El lisado aclarado se cargó en una columna de 20-ml Ni-NTA Superflow (Qiagen GmbH, Hilden, Alemania) equilibrada con tampón de lisis a un caudal de 5 ml/min. Después de lavado con tampón de lisis, la proteína fijada se eluyó con un gradiente lineal de 0-200 mM imidazol en tampón de lisis. Las fracciones principales se agruparon, se trataron con ditiotreitol 20 mM durante 20 minutos antes de diálisis prolongada contra 50 mM Tris-HCl, 2 mM EDTA, pH 8,0. Las proteínas se guardaron a -80°C y se consideró que eran >90% puras por SDS-PAGE. Las concentraciones se estimaron por absorbancia a 280 nm utilizando coeficientes de extinción de 5240 M-1cm-1 (yGrx1p e yGrx1p C30S) y 21740 M-1cm-1 (Grx2).

Identificación de tioles de peso molecular bajo acoplados en disulfuros mixtos con FVIIa 407C - La detección por HPLC de tioles de peso molecular bajo derivatizados por SBD fluorescente se realizó como ha sido descrito por Oe et al. (1998) con modificaciones menores. Resumidamente, la reducción del disulfuro y la derivatización subsiguiente de los tioles liberados se realizó por incubación de 25 µl de 10 µM FVIIa 407C (o FVIIa de tipo salvaje) en 160 mM Tris-HCl, 8 mM EDTA, tampón de pH 9,6 con 5 µl de 14 mM TCEP (en agua) y 10 µl de 0,3% SBD-f (en agua) a 60°C durante 60 min. Subsiguientemente la derivatización se terminó por adición de 2 µl de 5 M HCl y se dejaron las muestras a 4°C hasta su análisis ulterior (dentro de 24 horas). El análisis HPLC se realizó por inyección de partes alícuotas de 25 µl de las muestras en una columna de fase inversa C18(2) (Luna, 100 A, tamaño de partícula 3,5 µm, 150x4,6 mm; Phenomenex Inc., Torrance, CA) a un caudal de 1 ml/min. La temperatura de la columna se mantuvo a 30°C. Los tioles derivatizados se separaron por elución isocrática utilizando una fase móvil constituida por 75 mM citrato de sodio, pH 2,90 y 2% metanol y se detectaron por la fluorescencia emitida a 516 nm después de excitación a 386 nm. La identificación de los picos se realizó por comparación de los tiempos de retención con los de una serie de compuestos tiol de peso molecular bajo conocido preparados conforme al procedimiento arriba descrito para FVIIa 407C. Las curvas de calibración para cuantificación de GSH, γ-GC, GC, Cys, Hcy, y Cya se obtuvieron por variación de la concentración de cada tiol desde 0,4 a 3,5 µM en la mezcla de reacción final.

A partir de este análisis puede concluirse que los principales tioles de peso molecular bajo conjugados a FVIIa 407C son glutatión, cisteína, y homocisteína. Los resultados se presentan en la Figura 1.

Titulación redox de FVIIa - Para identificar las condiciones apropiadas para la reducción selectiva de mutantes FVIIa Cys, se evaluó la estabilidad estructural de FVIIa en tampones con potenciales redox definidos obtenidos por variación de las concentraciones de GSH y GSSG esencialmente como se describe en otro lugar (Loferer et al., 1995). Dado que se ha demostrado que la reducción de los dos enlaces disulfuro más lábiles en FVIIa está asociada con una pérdida de actividad amidolítica y fijación de sTF (Higashi et al., 1997), la integridad estructural de FVIIa se monitorizó por su capacidad de hidrolizar el sustrato cromógeno S-2288 en presencia de sTF.

La titulación redox de FVIIa (1 µM) se realizó en 50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, tampón de pH 7,0 (purgado concienzudamente con nitrógeno) que contenía 50 µM GSSG y concentraciones variables de GSH (0 - 34 mM). Adicionalmente, una serie de muestras contenían 25 mM p-aminobenzamidina, un inhibidor del sitio activo de FVIIa que ocupaba la bolsa S1 (Sichler et al., 2002; Persson et al., 2004). Para acortar el tiempo requerido para alcanzar el equilibrio, las reacciones se llevaron a cabo en presencia de 1 µM yGrx1p que actuaba como catalizador redox (Ostergaard et al., 2004). Después de la equilibración de las muestras durante 3,5 horas a 30°C en atmósfera de nitrógeno, se determinó la actividad amidolítica residual como se describe más adelante. Al mismo tiempo, una parte alícuota de la mezcla de reacción se extinguió con un volumen igual de 100 mM HCl, y la concentración de equilibrio de GSSG se determinó por HPLC como se describe en materiales y métodos.

Para la medida de la actividad amidolítica residual, 20 µl de las muestras equilibradas se diluyeron 20 veces en tampón de ensayo (50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, 0,01% Tween 80, pH 7,4) que contenía 10 mM yodoacetamida para alquilar rápidamente los tioles libres y prevenir la oxidación subsiguiente de los tioles. El ensayo de actividad se llevó a cabo en placas de microtitulación de poliestireno (Nunc, Dinamarca) en un volumen final de 200 µl de tampón de ensayo que contenía 80 nM sTF y la muestra se extinguió a una concentración final de 10 nM FVIIa. Después de 15 min de preincubación a la temperatura ambiente, se añadió 1 mM sustrato cromógeno S-2288 y se monitorizó la absorbancia continuamente a 405 nm durante 20 min en un espectrofotómetro de microplaca SpectraMax™ 340 equipado con software SOFTmax PRO (v2.2; Molecular Devices Corp., Sunnyvale, CA). La actividad amidolítica se consignó como la pendiente de las curvas de progreso lineal después de sustracción del blanco.

Los datos se analizaron en términos de la reacción siguiente (Eq. 1), donde FVIIa se convierte en FVIIa desactivado (designado FVIIai) por reducción reversible de un solo enlace disulfuro intramolecular: La constante de equilibrio aparente para la reacción reversible (Kox) puede estimarse a partir de la relación siguiente (Eq. 2) donde f es la actividad amidolítica residual para una ratio [GSH]2/[GSSG] dada, y amax es la actividad amidolítica limitante para [GSH]2/[GSSG] baja.

Por ajuste de los datos de la titulación redox a la Eq. 2 por regresión no lineal de mínimos cuadrados utilizando software Kaleidagraph (v3.6, Synergy Software) se obtuvieron Kox's aparentes de 93±6 mM y 166±16 mM en ausencia o presencia de 25 mM p-aminobenzamidina, respectivamente (Figura 2).

Titulación redox de disulfuro mixto FVIIa 407C-glutatión - La estabilidad del disulfuro mixto entre glutatión y Cys407 se midió por incubación de 13 µM FVIIa 407C en 50 mM HEPES, 100 mM NaCl, 10mM CaCl2, pH 7,0 que contenía 0,5 mM GSH y concentraciones variables de GSSG (5-500 µM). Adicionalmente, todas las muestras contenían 10 µM Grx2 para catalizar la reacción. Después de 5 horas de equilibración a 30°C, se extinguió una parte alícuota de 50 µl con 100 mM HCl y se determinó la concentración de equilibrio de GSSG por HPLC como se describe en materiales y métodos. Para medir la cantidad relativa de FVIIa 407C desprovisto de glutatión, los tioles libres se marcaron con PEG5k por combinación de 20 µl de cada muestra con 15 µl 1,6 mM PEG5k-maleimida. Después de 18 minutos de incubación a la temperatura ambiente, se añadió N-etilmaleimida a una concentración final de 25 mM para suprimir competitivamente la PEGilación ulterior (inespecífica) de la proteína durante el procesamiento subsiguiente. El FVIIa 407C modificado con PEG5k en cada muestra se detectó y se cuantificó por HPLC como se describe en materiales y métodos.

Los datos se analizaron conforme a la reacción siguiente (Eq. 3), en la que el FVIIa 407C desprovisto de glutatión (FVIIa 407C-GSH) reacciona con GSH para dar FVIIa 407C libre y GSSG La constante de equilibrio aparente para la reacción inversa, designada Kscox, puede estimarse a partir de la relación siguiente (Eq. 4) donde A407C-PECSk es el área del pico de FVIIa 407C 5k-PEGylated PEGilado para una ratio [GSH]/[GSSG] dada, y Amax es el área del pico limitante para [GSH]/[GSSG] alta.

Una gráfica de las áreas de pico medidas frente a la ratio [GSH]/[GSSG] en el equilibrio se muestra en la Figura 3. El ajuste de Eq. 4 a los datos por regresión no lineal de mínimos cuadrados utilizando software Kaleidagraph (v3.6, Synergy Software) dio una Kscox aparente de 1,0, muy similar a la medida para una gama de otras proteínas adicionadas de glutatión (Gilbert, 1995).

Identificación de las condiciones óptimas de reducción - Las condiciones redox de glutatión óptimas que soportan la reducción selectiva de los disulfuros mixtos de FVIIa 407C se identificaron a partir de gráficas de los parámetros siguientes en función de [GSSG]: (1) la actividad amidolítica residual en presencia o ausencia de p- aminobenzamidina utilizando la Eq. 2 y valores Kox estimados, y (2) la fracción de proteína reducida selectivamente de Eq. 4 y Kscox. Por razones prácticas, la concentración de GSH se ajustó a 0,5 mM. Como se muestra en la Figura 4, una concentración de GSSG entre aproximadamente 15 y 60 µM en presencia de 0,5 mM GSH da como resultado una actividad residual >90% y >90% Cys407 libre. El intervalo de funcionamiento óptimo de [GSSG] depende de varios parámetros, que incluyen la concentración de GSH (como se ilustra en las Figuras 3-5), los valores de Kox y

Kscox (no representados), y la pérdida tolerada de actividad amidolítica durante la reacción de reducción.

Reducción selectiva y modificación de FVIIa 407C con PEG5k, PEG20k, y PEG40k - La modificación de tioles de FVIIa 407C puede dividirse en tres pasos consecutivos: (A) una reacción de reducción catalizada con glutarredoxina, (B) alquilación específica del tiol, y (C) purificación. Al final de cada paso, se extinguió una pequeña parte alícuota de la mezcla de reacción con 10% (v/v) de ácido fórmico y se analizó por HPLC como se describe en materiales y métodos y se ilustra en la Figura 7.

(A) Se incubó FVIIa 407C (4,8 mg) 4,5 horas a 30°C en un volumen total de 4,4 ml de 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, tampón de pH 7,0 que contenía 0,5 mM GSH, 15 µM GSSG, 25 mM p-aminobenzamidina, y 10 µM Grx2. La concentración inicial de GSSG se encontraba en el límite inferior del intervalo de trabajo óptimo (área sombreada en la Figura 4) para compensar por la formación de GSSG durante la reacción. (B) Subsiguientemente, los tioles libres se modificaron por adición de PEG5k-maleimida, PEG20k-maleimida, o PEG40k-maleimida (disueltas en agua) a una concentración final de 0,8 mM. Se dejó que la alquilación de los tioles transcurriera durante 15 min a la temperatura ambiente después de extinción con 0,5 mM cisteína. (C) Se añadió EDTA en exceso de calcio (concentración final 20 mM) y se cargó todo el contenido en una columna HiTrap Q FF de 1 ml (Amersham Biosciences, GE Healthcare) equilibrada con tampón A (50 mM HEPES, 100 mM NaCl, 1mM EDTA, pH 7,0) para capturar FVIIa 407C. Después de lavado con tampón A, se realizó elución en un solo paso de la proteína fijada con tampón B (10 mM GlyGly, 150 mM NaCl, 10 mM CaCl2, 0,01% Tween 80, pH 7,0) directamente en una columna HiLoad Superdex 200 16/60 pg (Amersham Biosciences) montada delante de la columna HiTrap. Las especies PEGiladas y no PEGiladas se separaron a un caudal de 1 ml/min y se detectaron por absorción a 280 nm.

Reducción selectiva y reticulación con PEG3.4 de FVIIa 407C - (A) Se incubó FVIIa 407C (4,8 mg) 4,5 horas a 30°C en un volumen total de 4,4 ml de 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, tampón de pH 7,0 que contenía 0,5 mM GSH, 10 µM GSSG, 25 mM p-aminobenzamidina, y 10 µM Grx2. La concentración inicial de GSSG se encontraba en el extremo inferior del intervalo de trabajo óptimo (área sombreada en la Figura 4) para compensar por la formación de GSSG durante la reacción. (B) Se añadió EDTA en exceso de calcio (concentración final 20 mM) y el contenido total se cargó en una columna HiTrap Q FF de 1 ml (Amersham Biosciences, GE Healthcare) equilibrada en tampón A (50 mM HEPES, 100 mM NaCl, 1mM EDTA, pH 7,0) para capturar FVIIa 407C. Después de lavado con tampón A para eliminar el tampón de glutatión no fijado y Grx2p, FVIIa 407C se eluyó en un solo paso con tampón B (50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, pH 7,0). La concentración de FVIIa 407C en el eluato se midió por absorbancia a 280 nm utilizando un coeficiente de extinción de 62·103 M-1cm-1. La reticulación se realizó un presencia de aproximadamente 0,6 equivalentes de maleimida-PEG3.4k-maleimida durante 1,5 horas a la temperatura ambiente. (C) Se añadió EDTA en exceso de calcio (concentración final 20 mM) y el contenido total se cargó en una columna HiTrap Q FF de 1 ml (Amersham Biosciences, GE Healthcare) equilibrada en tampón A (50 mM HEPES, 100 mM NaCl, 1mM EDTA, pH 7,0) para capturar FVIIa 407C. Después de lavado con tampón A, se realizó una elución en un solo paso de la proteína fijada con tampón B (10 mM GlyGly, 150 mM NaCl, 10 mM CaCl2, 0,01% Tween 80, pH 7,0) directamente en una columna HiLoad Superdex 200 16/60 pg (Amersham Biosciences) para separar las especies PEGiladas y no PEGiladas. El caudal era 1 ml/min y la proteína se detectó por absorción a 280 nm.

Análisis por SDS-PAGE de FVIIa 407C, FVIIA, 407C-PEG5k, FVIIa 407C-PEG20k, FVIIa 407C-PEG40k, y FVIIa

407C-PEG3.4k-FVIIa 407C - FVIIa 407C y compuestos PEGilados 5k, 20k, 40k, y 3.4k (aprox. 1,5 µg de cada uno) se analizaron por SDS-PAGE reductora y no reductora en un gel 4-12% Bis-Tris NuPAGE® (Invitrogen Life Technologies, Carlsbad, CA) realizada a 200 V durante 35 min en tampón MES (Invitrogen Life Technologies, Carlsbad, CA) conforme a las recomendaciones del fabricante. Los geles se lavaron con agua y se tiñeron con Simply Blue™ SafeStain (Invitrogen Life Technologies, Carlsbad, CA) conforme a las recomendaciones del fabricante. Los geles se muestran en la Figura 8.

Titulación del sitio activo de FVIIa 407C, FVII 407C-PEG5k, FVIIa 407C-PEG20k, FVIIa 407C-PEG40k, y FVIIa 407C-PEG3.4k-FVIIa 407C - Las concentraciones de sitio activo de FVIIa 407C y los compuestos PEGilados se determinaron a partir de la pérdida irreversible de actividad amidolítica después de titulación con niveles sub- estequiométricos de d-Phe-Phe-Arg-clorometilcetona (FFR-cmk) esencialmente como se describe en otro lugar (Bock, 1992). Resumidamente, cada proteína se diluyó en 50 mM HEPES, 100 mM NaCl, 10 mM CaCl2, 0,01% Tween 80, tampón de pH 7,0 a una concentración aproximada de 300 nM utilizando un coeficiente de extinción de 2·103 M-1cm-1 a 280 nm. La proteína diluida (20 µl) se combinó luego con 20 µl de 1,5 µM sTF y 20 µl 0-1,2 µM FFR- cmk (recién preparado en tampón a partir de un stock de FFR-cmk disuelto en DMSO y se guardó a -80°C). Después de incubación durante una noche a la temperatura ambiente, se midió la actividad amidolítica residual.

El ensayo de actividad se llevó a cabo en placas de microtitulación de poliestireno (Nunc, Dinamarca) en un volumen final de 200 µl de tampón de ensayo (50 mM HEPES, 100 mM NaCl, 5 mM CaCl2, 0,01% Tween 80, pH 7,4) que contenía 50 nM sTF y aprox. 10 nM FVIIa, correspondiente a diluciones de 10 veces de las muestras. Después de 15 min de preincubación a la temperatura ambiente, se añadió 1 mM de sustrato cromógeno S-2288 y se monitorizó continuamente la absorbancia a 405 nm durante 20 min en un espectrofotómetro de microplaca SpectraMax™ 340 equipado con software SOFTmax PRO (v2.2; Molecular Devices Corp., Sunnyvale, CA). La actividad amidolítica se expresó como la pendiente de las curvas lineales de progreso después de la sustracción del blanco. Las concentraciones de sitio activo se determinaron por extrapolación, como la concentración mínima de FFR-cmk que anulaba por completo la actividad amidolítica.

En la Tabla 2 se dan las concentraciones medidas de sitio activo con relación a las absorbancias de las proteínas a 280 nm. Los valores están normalizados a 100% para VIIa 407C.

Tabla 2 - Concentraciones específicas de sitio activo de FVIIa 407C y variantes PEGiladas. Las concentraciones específicas de sitio activo se midieron como la concentración de sitio activo por titulación de FFR-cmk con relación a la absorbancia de la proteína a 280 nm. Los valores están normalizados a 100% para VIIa 407C.

Proteína

[Sitio activo]/A280

FVIIa 407C 100% FVIIa 407C-PEG5k 90% FVIIa 407C-PEG20k 86% FVIIa 407C-PEG40k 91% FVIIa 407C-PEG3.4k-FVIIa 407C 95%

Referencias

Bock,P.E. (1992). Active-site-selective labeling of blood coagulation proteinases with fluorescence probes by the use of thioester peptide chloromethyl ketones. I: Specificity of thrombin labeling. J Biol Chem 267, 14963-14973.

Chau,M.H. y Nelson,J.W. (1991). Direct measurement of the equilibrium between glutathione y dithiothreitol by high performance liquid chromatography. FEBS Lett. 291, 296-298.

Fernandes, A.P. y Holmgren, A. (2004) Glutaredoxins: glutathione-dependent redox enzymes with functions far beyond a simple thioredoxin backup system. Antioxid.Redox.Signal., 6, 63-74.

Freskgard,P.O., Olsen,O.H., y Persson,E. (1996). Structural changes in Factor VIIa induced by Ca2+ y tissue Factor studied using circular dichroism spectroscopy. Protein Sci 5, 1531-1540.

Gilbert,H.F. (1995). Thiol/disulfide exchange equilibria y disulfide bond stability. Methods Enzymol. 251, 8-28.

Grant,C. (2001). MicroReview: Role of the glutathione/glutaredoxin y thioredoxin systems in yeast growth y response to stress conditions. Mol. Microbiol. 39, 533-541. Grimberg.J., Maguire,S., y Belluscio,L. (1989). A simple method for the preparation of plasmid y chromosomal E. coli DNA. Nucleic Acids Res 17, 8893.

Higashi,S., Matsumoto,N., y Iwanaga,S. (1997). Confirmation of Factor VIIa stabilized by a labile disulfide bond (Cys- 310-Cys-329) in the protease domain is essential for interaction with tissue Factor. J. Biol. Chem. 272, 25724-25730.

Holmgren,A., Åslund,F. (1995) Glutaredoxin, Method Enzymol. 252, 283-292 Hoffman,C.S. y Winston,F. (1987). A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57, 267-272.

Loferer,H., Wunderlich,M., Hennecke,H., y Glockshuber,R. (1995). A bacterial thioredoxin-like protein that is exposed to the periplasm has redox properties comparable with those of cytoplasmic thioredoxins. J. Biol. Chem. 270, 26178- 26183.

Luikenhuis,S., Perrone,G., Dawes,I.W., y Grant,C.M. (1998). The yeast Saccharomyces cerevisiae contains two glutaredoxin genes that are required for protection against reactive oxygen species. Mol. Biol. Cell 9, 1081-1091.

Lundberg,M., Johansson,C., Chandra,J., Enoksson,M., Jacobsson,G., Ljung,J., Johansson,M., y Holmgren,A. (2001). Cloning y expression of a novel human glutaredoxin (Grx2) with mitochondrial y nuclear isoforms. J Biol Chem 276, 26269-26275 Rodriguez-Manzaneque,M.T., Ros,J., Cabiscol,E., Sorribas,A., y Herrero,E. (1999). Grx5 glutaredoxin plays a central role in protection against protein oxidative damage in Saccharomyces cerevisiae. Mol Cell Biol 19, 8180-8190.

Oe,T., Ohyagi,T., Naganuma,A. (1998) Determination of γ-glutamylglutathione y other low-molecular-mass thiol compounds by isocratic high-performance liquid chromatography with fluorimetric detection. J. Chrom. B, 708, 285- 289.

Ostergaard,H., Tachibana,C., y Winther,J.R. (2004). Monitoring disulfide bond formation in the eukaryotic cytosol. J Cell Biol 166, 337-345.

Padilla,C.A., Martinez-Galisteo,E., Barcena,J.A., Spyrou,G., y Holmgren,A. (1995). Purification from placenta, amino acid sequence, structure comparisons y cDNA cloning of human glutaredoxin. Eur J Biochem 227, 27-34.

Persson,E., Bak,H., Ostergaard,A., y Olsen,O.H. (2004). Augmented intrinsic activity of Factor VIIa by replacement of residues 305, 314, 337 y 374: evidence of two unique mutational mechanisms of activity enhancement. Biochem J 379, 497-503.

Persson,E. y Nielsen,L.S. (1996). Site-directed mutagenesis but not γ-carboxylation of Glu-35 in Factor VIIa affects the association with tissue Factor. FEBS Lett 385, 241-243.

Riddles,P.W., Blakeley,R.L., y Zerner,B. (1979). Ellman's reagent: 5,5'-dithiobis(2-nitrobenzoic acid)--a reexamination. Anal. Biochem. 94, 75-81.

Sambrook,J., Fritsch,E.F., y Maniatis,T. (1989). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory).

Sichler,K., Banner,D.W., D'Arcy,A., Hopfner,K.P., Huber,R., Bode,W., Kresse,G.B., Kopetzki,E., y Brandstetter,H. (2002). Crystal structures of uninhibited Factor VIIa link its coFactor y substrate-assisted activation to specific interactions. J. Mol. Biol. 322, 591-603.

Takahashi,N. y Creighton,T.E. (1996). On the reactivity y ionization of the active site cysteine residues of Escherichia coli thioredoxin. Biochemistry 35, 8342-8353.

Thim,L., Bjoern,S., Christensen,M., Nicolaisen,E.M., Lund-Hansen,T., Pedersen,A.H., y Hedner,U. (1988). Amino acid sequence y posttranslational modifications of human Factor VIIa from plasma y transfected baby hamster kidney cells. Biochemistry 27, 7785-7793.

Wang, E.C.W., Hung, S.-H., Cahoon,M., Hedstrom,L. (1997) The role of Cys191-Cys220 disulfide bond in trypsin: new targets for engineering substrate specificity. Protein Engineering, 10, 405-411.

Yang,Y., Jao,S., Nanduri,S., Starke,D.W., Mieyal,J.J., y Qin,J. (1998). Reactivity of the human thioltransferase (glutaredoxin) C7S, C25S, C78S, C82S mutant y NMR solution structure of its glutathionyl mixed disulfide intermediate reflect catalytic specificity. Biochemistry 37, 17145-17156.

REIVINDICACIONES

1.

Un método para reducción selectiva de una proteína transformada por ingeniería en su conformación activa que comprende al menos una cisteína no nativa, comprendiendo dicha proteína uno o más restos cisteína conjugados a través de un puente disulfuro a un tiol de peso molecular bajo (RS-Cys), no estando implicados dicho resto o restos en puentes S-S intramoleculares (Cys-S-S-Cys) cuando la proteína se encuentra en su forma activa, comprendiendo el método el paso de permitir que la proteína conjugada con el tiol de peso molecular bajo reaccione con una mixtura que comprende un tampón redox en condiciones no desnaturalizantes, en donde el tampón redox es un par redox de glutatión reducido y oxidado, y la concentración del glutatión reducido está dentro del intervalo de 0,01-2 mM, y la concentración del glutatión oxidado está dentro del intervalo de 0,001-0,200 mM, y en donde la proteína es un polipéptido Factor VII (FVII/FVIIa).

2.

El método conforme a la reivindicación 1, en el cual la mixtura comprende adicionalmente un catalizador redox tiol/disulfuro, v.g. una glutarredoxina, tal como una glutarredoxina seleccionada de Grx1, Grx2 o Grx3 de Escherichia coli, Grx1p, Grx2p, Grx3p, Grx4p, y Grx5p de Saccharomyces cerevisiae, Grx1 y Grx2 de Homo sapiens, y variantes de éstas.

3.

El método conforme a la reivindicación 2, en el cual el catalizador redox (en particular una glutarredoxina) se utiliza en una concentración de 0,001-20 µM.

4.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual la mixtura no comprende una proteína disulfuro-isomerasa (PDI).

5.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual la mixtura comprende adicionalmente un inhibidor de la proteína.

6.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual dicha proteína transformada por ingeniería tiene uno o más puentes S-S intramoleculares (Cys-S-S-Cys).

7.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual dicha proteína transformada por ingeniería tiene uno o más puentes S-S intramoleculares (Cys-S-S-Cys) con otra proteína transformada por ingeniería.

8.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual dicha proteína transformada por ingeniería es una proteína con enlaces disulfuro lábiles.

9.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual la proteína transformada por ingeniería se encuentra en su forma activa cuando se lleva a cabo la reacción de reducción selectiva.

10.

El método conforme a una cualquiera de las reivindicaciones anteriores, en el cual el método comprende el paso simultáneo y/o subsiguiente de conjugar al menos uno de los restos cisteína reducidos selectivamente (HS-Cys) con un grupo químico reactivo.

11.

El método conforme a la reivindicación 10, en el cual el grupo químico se selecciona de polietilenglicoles (PEG).

12.

El método conforme a la reivindicación 11, en el cual el grupo químico es un polietilenglicol, en particular uno que tiene un peso molecular medio comprendido en el intervalo de 500-100.000, tal como 1.000- 75.000, o 2.000-60.000.