Procesos para empaquetar oligonucleótidos en partículas de tipo viral de bacteriófagos de ARN.

Proceso para producir una composición de nucleótidos que comprende un oligonucleótido, comprendiendo dichoproceso las etapas de:

(a) disponer un oligonucleótido en la solución I, en el que dicho oligonucleótido comprende, como mínimo, un tramode poli G; y en el que dicha solución I comprende un pH alcalino, en el que, de manera preferente, dicho pH es de 8a 13, de manera más preferente dicho pH es 12;

(b) disgregar dicho oligonucleótido, en el que dicha disgregación comprende las etapas de:

(i) ajustar la temperatura de la solución I a la temperatura I, en la que dicha temperatura I es de 4 a 70ºC, demanera preferente, de 45 a 70ºC, de manera más preferente, aproximadamente 50ºC, y de la manera máspreferente, 50ºC;

(ii) incubar dicho oligonucleótido en dicha solución I a dicha temperatura I, en la que dicha incubación se realizahasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo por encima del 110%; y

(iii) ajustar la temperatura de dicha solución I a la temperatura II, en la que dicha temperatura II es de 0 a 70ºC,en la que, de manera preferente, dicha temperatura II es inferior a la temperatura I, y en la que, de manera máspreferente, la temperatura II es de 0 a 25ºC, de la manera más preferente, de 0 a 2ºC,

(c) ajustar el pH de dicha solución I al pH de 5 a 8, en el que, de manera preferente, dicho ajuste de dicho pH dedicha solución I se realiza hasta que dicho pH es de 6 a 7; y

(d) agregar dicho oligonucleótido, en el que dicha agregación comprende las etapas de:

(i) disponer dicho oligonucleótido en la solución II, en la que dicha solución II comprende un pH de 5 a 8 y,como mínimo, 20 mM de un catión, en la que dicho catión se selecciona del grupo que consiste en Na+, K+25 ,NH4

+, Li+, Ca2+ y Mg2+, y en la que, de manera preferente, dicha solución II comprende de 200 a 275 mM dedicho catión, de manera preferente, 250mM;

(ii) ajustar la temperatura de la solución II a la temperatura III, en la que dicha temperatura III es de 50 a 99ºC,de manera preferente, de 80 a 90ºC, de manera más preferente, aproximadamente 85ºC, y, de la manera máspreferente, 85ºC;

(iii) incubar dicho oligonucleótido en la solución II a la temperatura III, en la que dicha incubación se realizahasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 50 al 110%; y

(iv) ajustar la temperatura de la solución II a la temperatura IV, en la que dicha temperatura IV es inferior a50ºC, en la que, de manera preferente, dicha temperatura IV es de 0 a 25ºC, de manera más preferente, de 0 a2ºC

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2007/005188.

Solicitante: CYTOS BIOTECHNOLOGY AG.

Nacionalidad solicitante: Suiza.

Dirección: WAGISTRASSE 25 8952 ZURICH-SCHLIEREN SUIZA.

Inventor/es: .

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > AZUCARES; SUS DERIVADOS; NUCLEOSIDOS; NUCLEOTIDOS;... > C07H21/00 (Compuestos que contienen al menos dos unidades mononucleótido que tienen cada una grupos fosfato o polifosfato distintos unidos a los radicales sacárido de los grupos nucleósido, p. ej. ácidos nucleicos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Virus, p. ej. bacteriófagos; Composiciones que los... > C12N7/04 (Inactivación o atenuación; Producción de partes elementales de virus)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/117 (Acidos nucleicos que tienen propiedades inmunomoduladoras, p.ej. que contienen motivos CpG)

PDF original: ES-2427994_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Procesos para empaquetar oligonucleótidos en partículas de tipo viral de bacteriófagos de ARN

SECTOR DE LA INVENCIÓN

La presente invención da a conocer procesos para producir composiciones que comprenden (i) una partícula de tipo viral, en las que dicha partícula de tipo viral es una partícula de tipo viral de un bacteriófago de ARN, y (ii) un oligonucleótido, en las que dicho oligonucleótido está empaquetado en dicha partícula de tipo viral. La presente invención da a conocer además procesos para producir composiciones de nucleótidos que comprenden oligonucleótidos adecuados para utilizar en los procesos mencionados anteriormente. El presente documento da a conocer además composiciones de nucleótidos obtenibles por los procesos de la presente invención y utilizaciones de las mismas. El presente documento da a conocer además composiciones que comprenden (i) una partícula de tipo viral, en las que dicha partícula de tipo viral es una partícula de tipo viral de un bacteriófago de ARN, y (ii) un oligonucleótido, en las que dicho oligonucleótido está empaquetado en dicha partícula de tipo viral, en las que dichas composiciones son obtenibles mediante los procesos de la presente invención y en las que dichas composiciones comprenden, de manera preferente, una pureza, como mínimo, del 98%, de la manera más preferente, como mínimo, del 99%.

TÉCNICA RELACIONADA

Las partículas de tipo viral de bacteriófagos de ARN empaquetados con oligonucleótidos son potentes estimuladores del sistema inmunitario (documento W02003/024481A2) y se utilizan ampliamente en los modernos tratamiento de vacunación. Se han dado a conocer, por ejemplo, en los documentos W02003/024481A2, WO2004/000351A1, WO2004/084940A1 y WO2004/007538A2, procesos para producir composiciones que comprenden (i) una partícula de tipo viral, en las que dicha partícula de tipo viral es una partícula de tipo viral de un bacteriófago de ARN, y (ii) un oligonucleótido, en las que dicho oligonucleótido está empaquetado en dicha partícula de tipo viral. De la forma más habitual, se utilizan procesos que se basan en el desensamblaje de una partícula de tipo viral recombinante, la purificación de la proteína de cubierta y el reensamblaje de dicha proteína de cubierta en presencia de ácido nucleico. Los procesos eficaces y escalables para la producción de partículas de tipo viral recombinantes de bacteriófagos de ARN se dan a conocer en el documento WO2005/117963A1. Los procesos para la purificación a gran escala de partículas de tipo viral intactas sin endotoxinas se dan a conocer en el documento WO2007/039552A1. Los procesos para la preparación de proteína de cubierta a partir de partículas de tipo viral producidas de manera recombinante (“desensamblaje”) se dan a conocer, entre otros, en el documento WO2003/024481A2, y en la sección de ejemplos de la presente solicitud. Los procesos para el ensamblaje de la proteína de cubierta en presencia de ácido nucleico (“reensamblaje”) dados a conocer en el estado de la técnica no están optimizados con respecto a la eficacia, escalabilidad y pureza del producto ensamblado. En particular, el estado de la técnica no divulga que la eficacia del proceso de “reensamblaje” se pueda mejorar de manera considerable mediante la utilización de oligonucleótidos agregados que comprendan un cierto tamaño de partícula (caracterizado en presente documento por el tiempo de inicio del pico relativo, véase a continuación) . La presente solicitud da a conocer un proceso de “reensamblaje” con una eficacia aumentada de manera considerable que conduce a un producto empaquetado de una pureza muy elevada. De manera habitual y preferente, el proceso de “reensamblaje” dado a conocer en el presente documento comprende un rendimiento de proteínas y un rendimiento de oligonucleótidos, como mínimo, aproximadamente del 75% y da lugar a un producto (composición que comprende una partícula de tipo viral empaquetada con oligonucleótido) que de manera habitual y preferente es, como mínimo, del 99% de pureza.

CARACTERÍSTICAS DE LA INVENCIÓN

El alcance de la presente invención está definido por las reivindicaciones y cualquier información que no se encuentre dentro de las reivindicaciones se proporciona únicamente como información.

La presente invención se refiere a un proceso para producir una composición de nucleótidos que comprende (i) una partícula de tipo viral, en la que dicha partícula de tipo viral es una partícula de tipo viral de un bacteriófago de ARN, y (ii) un oligonucleótido, en la que dicho oligonucleótido está empaquetado en dicha partícula de tipo viral. Durante dicho proceso, dicha partícula de tipo viral se forma mediante un autoensamblaje de la proteína de cubierta de dicho bacteriófago de ARN en presencia de un oligonucleótido. De manera sorprendente, se ha descubierto que la eficacia del proceso se puede mejorar de manera significativa cuando el autoensamblaje de la proteína de cubierta se realiza en presencia de oligonucleótido agregado. De manera general, los oligonucleótidos que comprenden, como mínimo, un tramo de poli G son capaces de la agregación. El estado de agregación de un oligonucleótido se puede caracterizar mediante el tiempo de inicio del pico relativo en HPLC de exclusión por tamaño utilizando la cápside de dicho bacteriófago de ARN como patrón. Se ha descubierto que el oligonucleótido que comprende un tiempo de inicio del pico relativo del 50 al 110%, de manera preferente del 80 al 95%, es óptimo. Esto corresponde a agregados de oligonucleótidos que comprenden un peso molecular aparente que está en el intervalo del peso molecular aparente de la cápside de dicho bacteriófago de ARN o ligeramente inferior. Se ha descubierto que el oligonucleótido que comprende el tiempo de inicio del pico relativo deseado se puede obtener sometiendo dicho oligonucleótido a un proceso de agregación.

De este modo, un primer aspecto de la presente invención es un proceso para producir una composición de nucleótidos que comprende un oligonucleótido, en la que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 50 al 110%, comprendiendo dicho proceso las etapas de: (a) disponer un oligonucleótido en una solución II, en el que dicho oligonucleótido comprende, como mínimo, un tramo de poli G; y en el que dicha solución II comprende un pH de 5 a 8; y en el que dicha solución II comprende un catión, en el que, de manera preferente, la concentración de dicho catión en dicha solución II es, como mínimo, 20 mM, en el que dicho catión se selecciona, de manera preferente, del grupo que consiste en Na+, K+, NH4+, Li+, Ca2+ y Mg2+; (b) ajustar la temperatura de la solución II a la temperatura III, en el que dicha temperatura III es de 50 a 99ºC; y (c) incubar dicho oligonucleótido en la solución II a la temperatura III, en el que dicha incubación se realiza hasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 50 al 110%; y (d) ajustar la temperatura de la solución II a la temperatura IV, en el que dicha temperatura IV es inferior a 50ºC; en el que dichas etapas se realizan, de manera preferente, en el orden indicado.

El autoensamblaje de dicha proteína de cubierta es más eficaz cuando la preparación de oligonucleótidos comprende agregados que comprenden el tamaño óptimo de partícula y una distribución estrecha de tamaños. Adicionalmente, de manera sorprendente, se ha descubierto que el estado de agregación del oligonucleótido se puede controlar de manera más eficaz y que se obtienen preparaciones de oligonucleótidos con una distribución más estrecha de tamaños, cuando el oligonucleótido se somete a una etapa de disgregación previa a la etapa de... [Seguir leyendo]

 


Reivindicaciones:

1. Proceso para producir una composición de nucleótidos que comprende un oligonucleótido, comprendiendo dicho proceso las etapas de:

(a) disponer un oligonucleótido en la solución I, en el que dicho oligonucleótido comprende, como mínimo, un tramo de poli G; y en el que dicha solución I comprende un pH alcalino, en el que, de manera preferente, dicho pH es de 8 a 13, de manera más preferente dicho pH es 12;

(b) disgregar dicho oligonucleótido, en el que dicha disgregación comprende las etapas de:

(i) ajustar la temperatura de la solución I a la temperatura I, en la que dicha temperatura I es de 4 a 70ºC, de manera preferente, de 45 a 70ºC, de manera más preferente, aproximadamente 50ºC, y de la manera más preferente, 50ºC;

(ii) incubar dicho oligonucleótido en dicha solución I a dicha temperatura I, en la que dicha incubación se realiza hasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo por encima del 110%; y

(iii) ajustar la temperatura de dicha solución I a la temperatura II, en la que dicha temperatura II es de 0 a 70ºC, en la que, de manera preferente, dicha temperatura II es inferior a la temperatura I, y en la que, de manera más preferente, la temperatura II es de 0 a 25ºC, de la manera más preferente, de 0 a 2ºC,

(c) ajustar el pH de dicha solución I al pH de 5 a 8, en el que, de manera preferente, dicho ajuste de dicho pH de dicha solución I se realiza hasta que dicho pH es de 6 a 7; y

(d) agregar dicho oligonucleótido, en el que dicha agregación comprende las etapas de:

(i) disponer dicho oligonucleótido en la solución II, en la que dicha solución II comprende un pH de 5 a 8 y, como mínimo, 20 mM de un catión, en la que dicho catión se selecciona del grupo que consiste en Na+, K+, NH4+, Li+, Ca2+ y Mg2+, y en la que, de manera preferente, dicha solución II comprende de 200 a 275 mM de dicho catión, de manera preferente, 250mM;

(ii) ajustar la temperatura de la solución II a la temperatura III, en la que dicha temperatura III es de 50 a 99ºC, de manera preferente, de 80 a 90ºC, de manera más preferente, aproximadamente 85ºC, y, de la manera más preferente, 85ºC;

(iii) incubar dicho oligonucleótido en la solución II a la temperatura III, en la que dicha incubación se realiza hasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 50 al 110%; y

(iv) ajustar la temperatura de la solución II a la temperatura IV, en la que dicha temperatura IV es inferior a 50ºC, en la que, de manera preferente, dicha temperatura IV es de 0 a 25ºC, de manera más preferente, de 0 a 2ºC.

2. Proceso, según la reivindicación anterior, en el que dicho ajuste de la temperatura de dicha solución I a la temperatura II se realiza con una rampa de temperaturas, como mínimo, de 3, 6°C/min, y/o, en el que dic ho ajuste de la temperatura de la solución II a la temperatura IV se realiza con una rampa de temperaturas, como mínimo, de 3, 6°C/min.

3. Proceso, según cualquiera de las reivindicaciones anteriores, en el que dicha solución I comprende un hidróxido de un metal alcalino, de manera preferente, hidróxido de potasio o hidróxido de sodio, de la manera más preferente, hidróxido de sodio, en el que la concentración de dicho hidróxido es de 10 mM a 200 mM, de manera preferente, aproximadamente 25 mM, de la manera más preferente, 25 mM.

4. Proceso, según cualquiera de las reivindicaciones anteriores, en el que dicho catión es Na+ o K+, en el que, de manera preferente, dicho catión es Na+.

5. Proceso, según cualquiera de las reivindicaciones anteriores, en el que la concentración de dicho oligonucleótido en dicha solución I es de 50 μM a 2 mM, de la manera más preferente, 260 μM y/o en el que la concentración de dicho oligonucleótido en dicha solución II es de 50 μM a 2 mM, de manera preferente, de 100 a 300 μM, de la manera más preferente, 175 μM.

6. Proceso, según cualquiera de las reivindicaciones anteriores, en el que dicha incubación de dicho oligonucleótido en la solución II a la temperatura III se realiza hasta que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 80 al 95%, de manera preferente, del 80 al 90%, de manera aún más preferente, del 83 al 90%, de manera aún más preferente, del 85 al 90% y, de la manera más preferente, del 88%.

7. Proceso, según cualquiera de las reivindicaciones anteriores, en el que dicho oligonucleótido comprende en su extremo 5’, como mínimo, 3 y, como máximo, 15 grupos guanosina y en su extremo 3’, como mínimo, 3 y, como máximo, 15 grupos guanosina, y en el que, de manera preferente, dicho oligonucleótido comprende una secuencia palindrómica, en el que de manera más preferente, dicha secuencia palindrómica es GACGATCGTC (SEC ID NO:1) , y en el que de manera aún más preferente, dicho oligonucleótido comprende una secuencia de ácidos nucleicos seleccionada del grupo que consiste en:

(a) "G4-4" GGGGGACGATCGTCGGGG (SEC ID NO:2) ;

(b) "G5-5" GGGGGGACGATCGTCGGGGG (SEC ID NO:3) ;

(c) "G6-6" GGGGGGGACGATCGTCGGGGGG (SEC ID NO:4) ;

(d) "G7-7" GGGGGGGGACGATCGTCGGGGGGG (SEC ID NO:5) ;

(e) "G8-8" GGGGGGGGGACGATCGTCGGGGGGGG (SEC ID NO:6) ;

(f) "G9-9" GGGGGGGGGGACGATCGTCGGGGGGGGG (SEC ID NO:7) ;

(g) "G10" GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO:8) ;

(h) "G11" GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEC ID NO:9) .

8. Proceso, según cualquiera de las reivindicaciones anteriores, en el que dicho oligonucleótido tiene la secuencia de ácidos nucleicos "G10" GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO:8) .

9. Proceso para producir una composición que comprende (i) una partícula de tipo viral, en la que dicha partícula de tipo viral es una partícula de tipo viral de un bacteriófago de ARN, y (ii) un oligonucleótido, en la que dicho oligonucleótido está empaquetado en dicha partícula de tipo viral, comprendiendo dicho proceso las etapas de:

(a) disponer una proteína de cubierta de dicho bacteriófago de ARN;

(b) disponer de un oligonucleótido,

(i) en el que dicho oligonucleótido comprende, como mínimo, un tramo de poli G; y

(ii) en el que dicho oligonucleótido comprende un tiempo de inicio del pico relativo del 50 al 110%,

(c) generar una mezcla, en la que dicha mezcla comprende:

(i) dicha proteína de cubierta, en la que, de manera preferente, la concentración de dicha proteína de cubierta en dicha mezcla es de 1 a 4 mg/ml, de manera más preferente, 2, 5 mg/ml, y/o, en la que, de manera más preferente, la concentración de dicho oligonucleótido en dicha mezcla es de 25 a 100 μM, de manera más preferente, 62, 5 μM;

(ii) un agente capaz de evitar el autoensamblaje de dicha proteína de cubierta, en el que, de manera preferente, dicho agente comprende un compuesto desnaturalizante seleccionado entre urea y clorhidrato de guanidinio, en el que, de manera más preferente, dicha agente desnaturalizante es urea, y en el que, de manera aún más preferente, la concentración de dicha urea en dicha mezcla es de 0, 25 a 7, 2 M, de manera preferente, 1 M;

(iii) dicho oligonucleótido;

(d) extraer dicho agente de dicha mezcla, en el que, de manera preferente, dicha extracción de dicho agente de dicha mezcla se realiza mediante un primer intercambio de tampón con un primer tampón, en el que, dicho primer tampón comprende cloruro de sodio, en el que, de manera preferente, la concentración de dicho cloruro de sodio en dicho primer tampón es de 0 a 1 M, de manera preferente, de 0 a 550 mM, de manera más preferente de 0 a 350 mM, de manera aún más preferente, de 50 a 350 mM, y de la manera más preferente, 250 mM; y

(e) permitir que dicha proteína de cubierta se autoensamble en una partícula de tipo viral.

10. Proceso, según la reivindicación 9, en el que dicha proteína de cubierta comprende, o de manera alternativa, consiste esencialmente, de manera alternativa, consiste en proteínas recombinantes, o fragmentos de las mismas, de un bacteriófago de ARN, en el que, de manera preferente, dicho bacteriófago de ARN se selecciona del grupo que consiste en:

(a) bacteriófago Qβ;

(b) bacteriófago R17;

(c) bacteriófago fr;

(d) bacteriófago GA;

(d) bacteriófago SP;

(e) bacteriófago MS2;

(f) bacteriófago M11;

(g) bacteriófago MX1;

(h) bacteriófago NL95;

(i) bacteriófago f2;

(j) bacteriófago PP7; y

(k) bacteriófago AP205.

11. Proceso, según la reivindicación 9, en el que dicho bacteriófago de ARN es Qβ.

12. Proceso, según la reivindicación 11, en el que la proporción molar de dicho oligonucleótido y dicha proteína de cubierta en dicha mezcla es de 0, 5 a 1, 2, de la manera más preferente, 0, 7.

13. Proceso, según la reivindicación 9, en el que dicha proteína de cubierta comprende o, de manera preferente,

consiste en la secuencia seleccionada del grupo que consiste en:

(a) SEC ID NO:10 (QβCP) ;

(b) una mezcla de SEC ID NO:10 y SEC ID NO:11 (proteína Qβ A1) ;

(c) SEC ID NO:12 (proteína de cubierta de R17) ;

(d) SEC ID NO:13 (proteína de cubierta de fr) ;

(e) SEC ID NO:14 (proteína de cubierta de GA) ;

(f) SEC ID NO:15 (proteína de cubierta de SP) ;

(g) una mezcla de SEC ID NO:15 y SEC ID NO:16;

(h) SEC ID NO: 17 (proteína de cubierta de MS2) ;

(i) SEC ID NO:18 (proteína de cubierta de M11) ;

(j) SEC ID NO:19 (proteína de cubierta de MX1) ;

(k) SEC ID NO:20 (proteína de cubierta de NL95) ;

(l) SEC ID NO:21 (proteína de cubierta de f2) ;

(m) SEC ID NO:22 (proteína de cubierta de PP7) ; y

(n) SEC ID NO:23 (proteína de cubierta de AP205) .

14. Proceso, según cualquiera de las reivindicaciones 9 a 13, en el que dicho oligonucleótido comprende una secuencia palindrómica, en el que dicha secuencia palindrómica es GACGATCGTC (SEC ID NO:1) , y en el que dicha secuencia palindrómica está flanqueada en su extremo 5’, como mínimo, por 3 y, como máximo, 15 grupos guanosina y en el que dicha secuencia palindrómica está flanqueada en su extremo 3’, como mínimo, por 3 y, como máximo, 15 grupos guanosina, y en el que, de manera preferente, dicho oligonucleótido comprende una secuencia de ácidos nucleicos seleccionada del grupo que consiste en:

(a) "G4-4" GGGGGACGATCGTCGGGG (SEC ID NO:2) ;

(b) "G5-5" GGGGGGACGATCGTCGGGGG (SEC ID NO:3) ;

(c) "G6-6" GGGGGGGACGATCGTCGGGGGG (SEC ID NO:4) ;

(d) "G7-7" GGGGGGGGACGATCGTCGGGGGGG (SEC ID NO:5) ;

(e) "G8-8" GGGGGGGGGACGATCGTCGGGGGGGG (SEC ID NO:6) ;

(f) "G9-9" GGGGGGGGGGACGATCGTCGGGGGGGGG (SEC ID NO:7) ;

(g) "G10" GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEC ID NO:8) ;

(h) "G11" GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEC ID NO:9) .

15. Proceso, según cualquiera de las reivindicaciones 9 a 14, en el que el rendimiento de proteína es, como mínimo, del 75% y/o, en el que el rendimiento de oligonucleótido es, como mínimo, del 75%.