Inventos patentados en España.

Inventos patentados en España.

Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2013.

PROCEDIMIENTO PARA DETERMINAR EL NUMERO DE COPIAS.

Patente Internacional (Tratado de Cooperación de Patentes). Resumen:

Procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(a) proporcionar una diversidad de alícuota(s) de la muestra, en la que cada alícuota comprende ácido nucleico en una cantidad que es inferior a un genoma por alícuota;

(b) ampliar una o más secuencias de ácido nucleico en cada alícuota(s) en una primera reacción de amplificación;

(c) subdividir uno o más de los productos empleados en alícuotas de la réplica y llevar a cabo una segunda reacción de amplificación para una o más secuencias de ácido nucleico en cada alícuota(s), en la que cada una de las secuencias de ácido nucleico es un marcador de prueba y por lo menos una de las secuencias de ácido nucleico es un marcador de referencia;

(d) calcular el número de copias por comparación en cada una de las alícuotas de la réplica del número de productos amplificados obtenido en el marcador de prueba con el número de productos amplificados obtenidos para el marcador de referencia.

Solicitante: MEDICAL RESEARCH COUNCIL.

Nacionalidad solicitante: Reino Unido.

Dirección: MRC CANCER CELL UNIT HUTCHISON MRC RESEARCH CENTRE HILLS ROAD,CAMBRIDGE CB2 0XZ.

Inventor/es: THANGAVELU,MADEN, DEAR,PAUL, RABBITTS,TERENCE H, DASER,ANGELICA, BANKIER,ALAN THOMAS, KONFORTOV,BERNARD ANRI.

Fecha de Publicación de la Concesión: 21 de Abril de 2010.

Clasificación Internacional de Patentes: C12Q1/68D2C.

Clasificación PCT: C12Q1/68 (.en los que intervienen ácidos nucleicos [3]).

Volver al resumen de la patente.

PROCEDIMIENTO PARA DETERMINAR EL NUMERO DE COPIAS.
Descripción:

Procedimiento para determinar el número de copias.

Campo de la invención

La presente invención se refiere a un procedimiento para la detección de cambios en el número de copias de secuencias de ácido nucleico (tales como el ADN genómico) y varias aplicaciones de este procedimiento. A título de ejemplo, el procedimiento puede utilizarse para la detección de alteraciones genómicas y el diagnóstico de enfermedades, tal como el cáncer. Además, se describe asimismo una transposición no recíproca t(3;5) identificada por el procedimiento de la presente invención.

Antecedentes de la invención

Las alteraciones cromosómicas (por ejemplo anomalías) están asociadas con frecuencia a trastornos genéticos, enfermedades degenerativas y cáncer. La deleción o multiplicación de copias de cromosomas completos y la deleción o las amplificaciones de segmentos cromosómicos o de zonas específicas son sucesos frecuentes en la enfermedad, tal como el cáncer (Breast Cancer Res. Treat. 18: Supl. 1:5-14; Biochim. Biophys. Acta. 1072:33-50). De hecho, las amplificaciones y deleciones de la secuencia de ADN pueden ser causa de enfermedad. Por ejemplo, los protooncogenes y los genes supresores del tumor, respectivamente, son con frecuencia característicos de la tumorigénesis (Cancer Genet. Cytogenet. 49:203-217). Evidentemente, la identificación y clonación de zonas genómicas específicas asociadas a la enfermedad es crucial tanto para el estudio de la enfermedad como para el desarrollo de mejores medios de diagnóstico y pronóstico.

Los procedimientos para determinar el estado de los genomas individuales se requieren después del periodo de secuenciado del genoma para llevar a cabo los objetivos de la medicina personalizada, preventiva y de diagnóstico. Los genomas afectados (por ejemplo de cáncer) presentan muchas anomalías aunque las anomalías cromosómicas hereditarias están asociadas a muchos síndromes complejos y predisposiciones a enfermedades. Realmente, el secuenciado propuesto de una gama de genomas completos de cáncer debe enfocarse mejor en aquellas regiones en las que están situadas las aberraciones, utilizando procedimientos de exploración de genomas para dichos cambios. Los neoplasmas con frecuencia presentan aberraciones citogenéticas complejas que incluyen deleciones, amplificaciones y transposiciones. Aunque las leucemias y los sarcomas por lo general presentan transposiciones cromosómicas recíprocas (2), los tumores epiteliales (que comprenden más del 90% de los cánceres humanos) son mucho más heterogéneos (1). Los episodios principales en los tumores epiteliales son la ganancia o pérdida de cromosomas y las transposiciones desequilibradas. Además de esto, existen pequeñas anomalías citogenéticamente invisibles en tumores, por ejemplo las encontrados a veces en asociación con transposiciones cromosómicas (3). Particularmente bien caracterizadas, las transposiciones cromosómicas no recíprocas son las der3 t(3;5) desequilibradas en el adenocarcinoma renal (4,5). Estas anomalías se asocian específicamente al adenocarcinoma renal no papilar, en el que se produce a una frecuencia de por lo menos el 15% (6). La aclaración de los puntos de inflexión der(3)t(3;5) de estas transposiciones ha sido obstaculizada porque no son recíprocas.

Un enfoque a este problema podría estar basado en el hecho de que las transposiciones no recíprocas producen un cambio en el número de copias de las secuencias genómicas. Están disponibles numerosas técnicas basadas en la hibridación para explorar el número de copias en los genomas. Estos procedimientos utilizan ADN genómico (7) como sonda para las matrices de BACS o PACS (8, 9) u oligonucleótidos (10, 11) que representan la secuencia de referencia humana o utilizan sondas genómicas de representación (ROMA) (12-14) o matrices de SNP (15). Los procedimientos basados en la matriz, sin embargo, carecen de flexibilidad ya que debe crearse una nueva matriz para cada conjunto de dianas que van a examinarse. Además, estos procedimientos no son siempre cuantitativos ya que la señal de hibridación refleja el número de copias de la zona específica del genoma que corresponde a la sonda. Otros enfoques basados en la RCP cuantitativa requieren la optimización para cada locus evaluado.

El documento DE102004036285 da a conocer un procedimiento para determinar el número de copias de un cromosoma proporcionando una muestra que corresponde a una célula, es decir una copia del genoma. Varios segmentos del genoma se amplían utilizando una serie de cebadores, y se amplían en una segunda reacción de amplificación que amplía distintos fragmentos (véase los párrafos 35 y 40-41) cuya presencia se determina (en el ejemplo de DE102004036285 los fragmentos se originan a partir del cromosoma 2). El número de fragmentos amplificados se compara con el número de fragmentos amplificados en una muestra de referencia.

La presente invención se refiere a las mejoras en la detección de un cambio en el número de copias de una o más secuencias de ácido nucleico.

Sumario de la invención

El procedimiento descrito en la presente memoria (al que se hace referencia como Recuento molecular del número de copias o MCC) mide la frecuencia de número de copias analizando la frecuencia con que se produce la amplificación de una secuencia de ácidos nucleicos (tal como un marcador genómico) al limitar la dilución de ADN.

Los procedimientos han sido validados explorando el número de copias que acortan la rama del cromosoma 3 humano en el adenocarcinoma renal para situar el punto de inflexión de una transposición no recíproca en 300 pb, permitiendo que se clone. Esta es la primera vez que se ha clonado el punto de inflexión de una transposición no recíproca de novo en el adenocarcinoma renal.

Aspectos del sumario de la presente invención

En un primer aspecto se proporciona un procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes: (a) proporcionar una diversidad de alícuota(s) de la muestra, en el que cada alícuota comprende ácido nucleico en una cantidad que es inferior a un genoma por alícuota; (b) ampliar una o más secuencias de ácido nucleico en cada alícuota(s) en una primera reacción de amplificación; (c) subdividir uno o más de los productos utilizados en las alícuotas de la réplica y llevar a cabo una segunda reacción de amplificación para una o más secuencias de ácido nucleico en cada alícuota(s), en la que cada una de las secuencias de ácido nucleico es un marcador de prueba y por lo menos una de las secuencias de ácido nucleico es un marcador de referencia; (d) calcular el número de copias por comparación en cada una de las alícuotas de la réplica del número de productos amplificados obtenido en el marcador de prueba con el número de productos amplificados obtenidos para el marcador de referencia.

En un segundo aspecto se proporciona un procedimiento de identificación de una o más alteraciones en una muestra de ácido nucleico, que comprende las etapas siguientes: (a) medir la frecuencia del número de copias de una o más secuencias de ácido nucleico en una primera muestra y una segunda muestra según el procedimiento del primer aspecto de la presente invención; (b) opcionalmente repetir iterativamente el procedimiento a resoluciones progresivamente mayores para cada una de las muestras; y (c) identificar una o más diferencias en la frecuencia del número de copias de una o más secuencias de ácido nucleico en la primera y segunda muestras.

En un tercer aspecto se proporciona un procedimiento para diagnosticar una enfermedad en un paciente, que comprende las etapas siguientes: (a) medir la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra según el procedimiento del primer aspecto de la presente invención; y (b) comparar el número de copias de una o más secuencias de ácido nucleico con el número de copias normales de una o más secuencias de ácido nucleico; en la que una diferencia entre los números de copias de una o más secuencias de ácido nucleico en la muestra y el número normal de copias de una o más secuencias de ácido nucleico es indicativo de que el paciente está padeciendo la enfermedad.

En un cuarto aspecto se proporciona un procedimiento para clonar una o más alteraciones en una muestra de ácido nucleico que comprende las etapas siguientes: (a) identificar una o más alteraciones en una muestra de ácido nucleico según el segundo aspecto de la presente invención; y (b) clonar una o más alteraciones.

Un quinto aspecto se refiere a un ácido nucleico aislado que codifica una transposición no recíproca t(3;5), en la que el cromosoma 5q21.3 para la coordenada 105386443 p.b. se fusiona con al cromosoma 3p13 procedente de la coordenada 74111893 p.b. y en el que el resto de adenina en la unión es de uno de los dos cromosomas.

Un sexto aspecto se refiere a un procedimiento para diagnosticar el cáncer en un paciente que comprende la etapa de determinación de la presencia de la transposición t(3;5) no recíproca según cualquiera de las reivindicaciones 24 a 27, en el que la presencia de la transposición es indicadora de que el paciente padece cáncer.

Formas de realización preferidas

Preferentemente, cada alícuota en la primera reacción de amplificación comprende aproximadamente 01, a 0,9 genomas de ADN por reacción de amplificación.

Preferentemente el número de copias del marcador de la prueba se calcula realizando el recuento manual del número de productos de la amplificación para el marcador de prueba y el marcador de referencia.

Preferentemente, el número de copias del marcador de prueba se calcula utilizando la ecuación:

Np=N(1-e-Z)

en la que N es el número de alícuotas; Z es el número promedio de productos amplificados por alícuota; y Np es el número de alícuotas que cabe esperar que contengan por lo menos una molécula del ácido nucleico según la distribución de Poisson.

Preferentemente, el número de copias del marcador de prueba se calcula utilizando la ecuación:

Z=- ln(1-Np/N)

en la que N es el número de alícuotas del ácido nucleico sometido a prueba para una secuencia dada; Np es el número de alícuotas que puntúan positivo para el ácido nucleico.

Preferentemente, las reacciones de amplificación se llevan a cabo utilizando la RCP.

Preferentemente, la primera reacción de amplificación se lleva a cabo utilizando pares cebadores directo e inverso.

Preferentemente, la segunda reacción de amplificación se lleva a cabo utilizando pares cebadores directo-interno e inverso.

Preferentemente, la muestra procede o es procedente de un grupo constituido por el cromosoma 1, cromosoma 2, cromosoma 3, cromosoma 4, cromosoma 5, cromosoma 6, cromosoma 7, cromosoma 8, cromosoma 9, cromosoma 10, cromosoma 11, cromosoma 12, cromosoma 13, cromosoma 14, cromosoma 15, cromosoma 16, cromosoma 17, cromosoma 18, cromosoma 19, cromosoma 20, cromosoma 21, cromosoma 22, cromosoma X y cromosoma Y.

Preferentemente, la concentración de ácido nucleico en la muestra antes de la división en alícuotas se determina por espectrofotometría UV.

Preferentemente, la concentración de ácido nucleico en la muestra antes de la división en alícuotas se determina por amplificación de uno o más ácidos nucleicos que se cree que están presentes en sólo una copia por genoma haploide en dos o más divisiones diferentes, en la que la proporción de muestras en cada dilución hallada positiva para uno o más ácidos nucleicos se utiliza para mejorar la concentración estimada de ADN y por consiguiente determinar la dilución requerida para el análisis posterior.

Preferentemente, se amplían 4 ácidos nucleicos y se preparan 6 diluciones.

Preferentemente, las muestras son o proceden de pacientes enfermos y sanos.

Preferentemente, se explora inicialmente un cromosoma completo antes de enfocar en un área para posterior estudio.

Preferentemente, el procedimiento se lleva a cabo inicialmente a una resolución de aproximadamente 2 Mb disminuyendo progresivamente hasta aproximadamente 100 pares de bases o menos.

Preferentemente, la alteración es una transposición, una amplificación; una duplicación o una deleción.

Preferentemente, si el número de copias de una o más secuencias de ácido nucleico en la muestra de ácido nucleico del paciente es mayor que el número de copias normales es indicativo de una transposición, una amplificación o una duplicación.

Preferentemente, si el número de copias de una o más secuencias de ácido nucleico en la muestra de ácido nucleico del paciente es menor que el número de copias normales es indicativo de una deleción.

Preferentemente, la enfermedad es el cáncer.

Preferentemente, el cáncer es cáncer de riñón.

Preferentemente, el paciente se selecciona de entre el grupo constituido por: (i) un paciente que está padeciendo o se sospecha que padece la enfermedad; (ii) un paciente que se sabe que está predispuesto a la enfermedad; (iii) un paciente que ha estado expuesto a uno o más agentes o enfermedades que se conoce o se sospecha que producen la enfermedad; (iv) un paciente que está en proceso de desarrollar la enfermedad o se sospecha que desarrolla la enfermedad.

Preferentemente, la alteración se clona utilizando RCP inversa.

Preferentemente, el cromosoma 5q21.3 comprende la secuencia TATACATACATACGGATATATGTATAAAATC.

Preferentemente, el cromosoma 3p13 comprende la secuencia TAGGGAGTGAAGTAGTGGCCAAGAAAACATGCCAG.

Preferentemente, la transposición t(3;5) no recíproca comprende la secuencia TATACATACATACGGATATATGTATAAAATCATAGGGAGTGAAGTAGTGGCCAAGAAAACATGCCAG.

Preferentemente, el cáncer es el adenocarcinoma renal.

Ventajas

La presente invención presenta numerosas ventajas. Estas ventajas se pondrán de manifiesto en la descripción siguiente.

A título de ejemplo la presente invención presenta ventajas ya que el procedimiento proporciona la resolución realmente ilimitada ya que las secuencias pueden examinarse a intervalos por debajo de unos pocos centenares de pares de bases y sería igualmente aplicable a la caracterización de las zonas amplificadas.

A título de ejemplo adicional, la presente invención presenta ventajas ya que solamente necesita una base de datos genómica para su operación y los bancos de cebadores de RCP permiten la rápida exploración de zonas cromosómicas o de genomas completos.

A título de ejemplo adicional, la presente invención presenta ventajas debido a que puede conseguirse cualquier nivel de resolución dependiendo de la densidad de marcadores seleccionada. Por consiguiente, el área de estudio está fácilmente bajo control.

A título de ejemplo adicional, la presente invención presenta ventajas porque a diferencia de otras tecnologías de recuento de ADN, los procedimientos descritos en la presente memoria no requieren la amplificación del genoma total o cualquier etapa de hibridación. Esto obvia algunos problemas que puedan dar lugar a la amplificación del genoma específico de la zona, la supresión incompleta de las secuencias de repetición en la sonda y elimina cualquier riesgo de hibridación cruzada, como puede ocurrir en las oligomatrices cortas o en la amplificación del ADN de E. coli que contamina las BAC/PAC para la matriz CGH (9).

A título de ejemplo, la presente invención presenta ventajas porque los procedimientos son esencialmente digitales (recuento del número de copias molecular) que simplifica la interpretación de resultados mientras que las estrategias de micromatriz pueden requerir calcular por ordenador los algoritmos para su interpretación (23).

A título de ejemplo, la presente invención presenta ventajas porque los procedimientos se prestan a automatización, y son adecuados para alto rendimiento, aunque es también fácilmente aplicable a la operación y por lo tanto no tienen requisitos obligados para el sistema, tales como matriciales.

A título de ejemplo adicional, la presente invención presenta ventajas porque el procedimiento requiere cantidades minúsculas de ADN genómico, que son aplicables al ADN desde tan poco como decenas de centenares de células y el ADN no ha de ser de alto peso molecular. Los procedimientos permitirán estudios impracticables hasta ahora, tales como el análisis detallado del material de biopsia preneoplástica procedente de pacientes, el análisis retrospectivo de muestras de tumorales de archivo o la exploración de la variabilidad genómica a través de diferentes pequeñas regiones de un tumor.

A título de ejemplo adicional, la presente invención presenta ventajas porque los procedimientos descritos en la presente memoria deberían también simplificar el análisis de anomalías cromosómicas hereditarias que afectan al número de copias, si están asociadas a la enfermedad o forman parte de un espectro normal de variación humana.

Descripción de las figuras

Figura 1

Generalidades del procedimiento de recuento molecular del número de copias

El recuento molecular del número de copias (MCC) se basa en la frecuencia de los productos de amplificación por RCP del ADN genómico, correspondiente a los marcadores cromosómicos a lo largo de un segmento de un cromosoma. El MCC es un procedimiento en dos etapas. En esta figura, (A) las células llevan una transposición no recíproca y por consiguiente una secuencia marcadora (representada en verde) está presente en dos veces tantas copias como un segundo marcador (representado en rojo) que une el telomérico del punto de inflexión de la transposición. (B) El ADN se prepara a partir de las células diana y se diluye a menos de un genoma por alícuota. (C) Estas alícuotas se suministran a los pocillos de una placa de 96 pocillos; por simplicidad, solamente se ilustran los marcadores rojo y verde, que muestran el número limitado de pocillos que recibe el ADN genómico del marcador rojo y verde. (D) Una amplificación por RCP múltiple inicial se lleva a cabo para ampliar todos los marcadores mediante una cantidad modesta y se ilustran los supuestos pocillos en los que se amplían los marcadores rojo y verde. (E, F) Los productos de reacción múltiple se cortan y empalman en placas de réplica y se lleva a cabo una ronda adicional de RCP realizada con los cebadores semianidados para cada marcador (E: presenta la distribución hipotética del producto del marcador rojo y F presenta la distribución hipotética del producto del marcador verde). (G, H) Los productos de la RCP de la etapa semianidada se analizan por electroforesis en gel. En esta ilustración, el marcador rojo se encuentra en 24 de los pocillos y el marcador verde en 46 de los pocillos, correspondientes a un aumento del doble del número de copias.

Figura 2

Hibridación in situ de clones de BAC con cromosomas SK-RC-9 para localizar el punto de inflexión de la transposición t(3;5)

La presencia de una transposición cromosómica no recíproca t(3;5) típica del adenocarcinoma renal no papilar se descubrió en las células SK-RC-9 (línea incompletamente tetraploide) utilizando la fotografía del cromosoma 3 y 5 (Figura 1 complementaria en línea). La posición regional de la t(3;5) se determinó utilizando FISH con los clones BAC del cromosoma 3. Los clones BAC definen una zona de aproximadamente 1 Mb de la rama corta del cromosoma 3 (clon RP11-24E1 situado en 7325.358-73419679 pb, panel A y clon RP11-781E19 situado en 74210885-74236089 pb, panel B) eran verdes marcados con fluorescencia para el análisis FISH de extensiones de la metafase de los cromosomas SK-RC-9 en combinación con las fotografías del cromosoma 5 completo (fluorescencia roja). El clon RP11-24E1 por BAC se hibrida con los brazos cortos de dos cromosomas 3 normales (panel A, rodeado en verde), pero no el cromosoma hibrido transpuesto t(3;5) panel A, (en círculo blanco) lo que indica que BAC es telomérico del punto de inflexión de la transposición t(3;5). El clon RP11-781E19 de BAC se hibrida tanto con los cromosomas 3 normales (panel B, rodeado en verde) así como con los cromosomas híbridos t(3;5) (panel B, rodeados en blanco). Por lo tanto, este BAC cartografía el centrómero del punto de inflexión de t(3;5). Estos datos demuestran que el punto de inflexión de la transposición se produce entre o dentro de la zona del cromosoma definida por estos dos clones de BAC.

C. Representación esquemática de los cromosomas 3 normales y t(3;5) híbrido en SK-RC-9 que presenta la zona del cromosoma 3 que contiene el supuesto punto de inflexión de la transposición t(3;5) determinado por FISH. Los cromosomas 3 se representan en verde y los cromosomas 5 en rojo. La zona que contiene el punto de inflexión está representada en blanco y se expande a continuación, comprendiendo aproximadamente la zona del cromosoma 3p13-p12.3

Figura 3

El procedimiento MCC localiza la ruptura de t(3;5) dentro de los 300 p.b. en el cromosoma 3

Cada gráfico presenta el número de copias relativo (ejes verticales) de las secuencias que comprenden el cromosoma 3p (ejes horizontales; orientación telomérica-centromérica es de izquierda a derecha).

Ronda 1: Se seleccionaron secuencias a intervalos de aproximadamente 200 a 500 kb que comprenden ~ 3,7 Mb, comprendidas por 3p13-p12.3 (la posición cromosómica exacta y las distancias junto con las secuencias del cebador se proporcionan en la Tabla 1). Las series de cebador, a saber las series 5 y 7 no pudieron proporcionar producto (indicadas por líneas de puntos). La inspección visual indicó que un desplazamiento del doble en el número de copias entre los marcadores 8 y 9 (mostrados por la casilla blanca). En las anteriores rondas 2, 3 y 4, se seleccionaron nuevas secuencias con distancias progresivamente más cortas en entre los marcadores. La ronda 4 utilizó marcadores de ~ 300 p.b. (50 a 300 pb) aparte y presentaban un desplazamiento del número de copias que representa el punto de inflexión de la transposición t(3;5) no recíproca (indicada por la casilla en blanco) y una segunda anomalía que representa una deleción corta de aproximadamente 700 p.b. en la zona del cromosoma 3 (indicada por la casilla punteada) centromérica de la unión de la transposición.

Figura 4

La hibridación en el filtro del ADN de SK-RC-9 presenta un segmento cambiado de posición y pone de manifiesto una inserción que acompaña una microdeleción

A-C. ADN genómico de SK-RC-9 o SK-RC-12 (carcinoma renal de un der(3;5) proximal al de en SK-RC-9) se digirió con las enzimas de restricción indicadas, se fraccionó y se transfirió a los filtros para la hibridación a las sondas clonadas de RCP de uno de ambos cromosomas 3p (3pA o 3pB) o 5q. Las sondas de cromosoma 3p se localizaron en los datos de MCC en la Figura 3 y se identificó una secuencia genómica sin repetición de esta zona utilizando la base de datos de la secuencia del genoma humano. Asimismo se determinó una sonda procedente del cromosoma 5q en la base de datos de la secuencia del genoma humano después de la clonación y del secuenciado de la unión t(3;5).

D. Cartografías de restricción parcial de las zonas adecuadas de los cromosomas 5q, t(3;5) y 3p que muestran la posición de las sondas de hibridación en una de las dos caras del punto de inflexión de t(3;5) (existían dos sondas para el cromosoma 3p, denominadas 3pA y 3pB). La longitud de la inserción, asociada a la pequeña deleción, no es segura y está indicada por la pequeña zona sombreada en gris que incluye una secuencia de la enzima de restricción BgIII como se muestra mediante las hibridaciones en filtro mostradas en B.

B=BgIII; H=HindIII; N=NcoI; RV=EcoRV; S=SpeI.

C= AND genómico de referencia procedente de SK-RC-12; R9= AND genómico de SK-RC-9.

Figura 5

Secuencia y posición cromosómica de la unión de la transposición no recíproca t(3;5)

La posición de la unión de la transposición t(3;5) en el genoma de SK-RC-9 se situó en 300 p.b. por el procedimiento MCC. La base de datos de la secuencia del genoma humano permitió la identificación de las secuencias de restricción en torno a esta supuesta posición y la RCP inversa se utilizó para clonar la unión. Se digirió el ADN de SK-RC-9 con XbaI, autoligadas a alta dilución para obtener círculos intramoleculares y un producto de RCP obtenido por amplificación con los cebadores F y R (panel A) (véanse los procedimientos para las secuencias del cebador). La secuencia de los productos de la RCP confirmó que la unión de la transposición no recíproca t(3;5) se había clonado y la unión comprendía las secuencias contiguas 5q (panel B, secuencia encasillada en rojo) y 3p (panel B, secuencia encasillada en verde). Debe apreciarse que el residuo A adicional individual en la unión de la secuencia fusionada (posición representada por la flecha) puede haber procedido de uno de los dos cromosomas. La posición de los puntos de inflexión de la transposición se determinó en los cromosomas 5q y 3p utilizando la base de datos Ensembl humana (NCBI liberación 35) y se indica en los paneles C (5q) y D (3p). En cada uno de estos paneles, la línea superior indica las bandas de cromosomas relevantes y las distancias a Mb y debajo se muestran varios genes conocidos o supuestos. La posición de los genes Ensembl se presenta tanto para el cromosoma 5 (C) como para el cromosoma 3 (D). Se muestra una transcripción prevista Genscan (AN038241) a 106,58 Mb en el cromosoma 5 y dos ARNm situados en el cromosoma 3, BC040672 (ADNc de Riken) y HSP90 en 74,10 y 74,2 respectivamente. La transposición t(3;5) de SK-RC-9 no corta ni empalma los genes en el cromosoma 3 ni en el cromosoma 5.

Figura 6

Cartografía por MCC de una deleción del cromosoma 3 en la SK-RC-12

A. Para la cartografía de la ronda 1 de MCC, se utilizó un panel de 35 marcadores para identificar una zona genómica de ~9 Mb) con intervalos de marcador alrededor de 0,25 Mb aparte. Se detectó un desplazamiento del número de copias entre los marcadores 22 y 23. Los resultados se presentan para el panel del marcador en el eje y el número del marcador en el eje x. Las distancias entre los marcadores no reflejan distancias genómicas sino que son numéricas. Las zonas encasilladas representan los desplazamientos de la copia baja y de la copia alta. Basándose en los datos de la ronda 1, se diseñaron una segunda serie de cebadores espaciados a un promedio de 30 kb aparte, demostrando que la variación del número de copias se cartografió entre los marcadores 9 y 13. Posteriormente, se realizaron dos rondas más de MCC utilizando los marcadores a aproximadamente 3 kb (ronda 3) y 400 p.b. aparte (ronda 4). Un desplazamiento del número de copias aparece entre los marcadores 6 y 7 en la ronda 4 definiendo una posición del desplazamiento en 800 p.b. de cromosoma 3.

B. La zona genómica del ADN con SK-RC-12 con este desplazamiento del número de copias se clonó después de la RCP inversa y se puso de manifiesto una deleción crítica del cromosoma 3 en las células SK-RC-12. La secuencia superior (caso superior) se extiende desde el extremo telomérico de la deleción del cromosoma 3p y la secuencia inferior (caso inferior) se extiende desde el extremo centromérico de la deleción del cromosoma 3p mientras que la secuencia media es la fusión hallada en la unión de la deleción en el ADN de SK-RC-12 situado a 81,64 y 81,94 mb.

Figura 7

Cuadro de los cromosomas de la metafase de SK-RC-9

Las imágenes fundidas se presentan en señales de hibridación con el cromosoma 3 (rojo) o 5 (verde) y la tinción con DAPI de la metafase en los cultivos de SK-RC-9 (esta estirpe es incompletamente tetraploide), mostrando la presencia de la transposición cromosómica t(3;5) no recíproca típica del adenocarcinoma renal no papilar. Los cuadros del cromosoma se obtuvieron a partir de Vysis.

Figura 8

Identificación de la microdeleción en el cromosoma t(3;5) de SK-RC-9

Se obtuvieron datos por MCC de la ronda 4 de la RCP (como en la Fig. 3 del texto principal) utilizando SK-RC-9 en experimentos por duplicación o SK-RC-12 como referencia. La transposición y las zonas de microdeleción presentan desplazamientos del número de copias reproducibles, mientras que el ADN de SK-RC-12 de referencia presenta una curva horizontal sin desplazamiento del número de copias en esta zona.

Figura 9

Fraccionamiento con gel de agarosa de los productos de la RCP para la ronda 1 por MCC del ADN de SK-RC-12

Se llevó a cabo la ronda uno por análisis de MCC con ADN de SK-RC-12 utilizando los marcadores que comprenden una zona que comprende aproximadamente 0,25 mb del cromosoma 3p (véase la Fig. 6A, ronda 1) que presenta un desplazamiento del número de copias entre los marcadores 22 y 23. Se presentan los geles analíticos para los productos de la RCP semianidados de los marcadores 21, 22, 24 y 25.

Figura 10

Hibridación en filtro del ADN de SK-RC-12 para confirmar la alteración genómica detectada por MCC

La MCC del ADN del cromosoma 3p de SK-RC-12 identificó un desplazamiento del número de copias en una zona de 400 p.b. (véase la Fig. 6A, ronda 4) indicativo de una alteración genómica. Esto se confirmó por hibridación en el filtro del ADN genómico de SK-RC-12 en comparación con el ADN preparado a partir de una estirpe celular linfoblastoide (LCL) de referencia. Una sonda de 237 p.b. se amplió en el cromosoma 3 y se hibridó a los digestos de restricción indicados. Se observó un fragmento cambiado de posición en cada caso con el ADN de SK-RC-12 en comparación con el de LCL.

Descripción detallada de la invención

Alteración

Tal como se utiliza en la presente memoria, el término "alteración" se refiere a un cambio (tal como un cambio conocido u oculto) que implica la pérdida o ganancia de material genético.

Convenientemente, la alteración es una alteración del número de copias (tal como una alteración del número de copias en estado diploide) que puede determinarse haciendo el recuento de la frecuencia de reiteración del ADN utilizando los procedimientos descritos en la presente memoria.

En una forma de realización, la alteración es una anomalía, tal como una anomalía cromosómica.

En una forma de realización, la alteración se selecciona de entre el grupo constituido por una transposición (por ejemplo una transposición desequilibrada o una transposición no recíproca), una amplificación; o una duplicación o una deleción.

En una forma de realización particularmente preferida, la alteración es una transposición no recíproca, tal como una transposición no recíproca que se detecta en el ácido nucleico de una célula de cáncer o tumor o derivada de la misma.

Número de copias

La expresión "número de copias" significa el número de copias de una secuencia específica de ácido nucleico (por ejemplo locus) en el genoma de un organismo específico, tal como un ser humano.

Marcador de prueba

Tal como se utiliza en la presente memoria, la expresión "marcador de prueba" se refiere a una secuencia de ácido nucleico, cuyo número de copias debe someterse a prueba según los procedimientos de la presente invención.

Marcador de referencia

Tal como se utiliza en la presente memoria, la expresión "marcador de referencia" se refiere a una secuencia de ácido nucleico, cuyo número de copias ya se conoce o se determina para calcular el número de copias del marcador de prueba. Como se describe en la presente memoria, el número de copias del marcador de prueba se calcula comparando el número de productos amplificados para el marcador de prueba con las del marcador de referencia.

El número de copias del marcador de referencia puede determinarse utilizando los procedimientos descritos en la presente memoria o cualquier otro procedimiento que puede utilizarse para determinar el número de copias de un ácido nucleico, tal como la hibridación del genoma comparativa o la hibridación del genoma comparativa de la matriz y similares. Desde luego, el número de copias del marcador de referencia puede incluso determinarse por referencia a la bibliografía ya que su número de copias puede haber sido descrito anteriormente.

En una forma de realización de la presente invención, se amplían el marcador de prueba y/o el marcador de referencia.

Muestra

El término "muestra" tal como se utiliza en la presente memoria se refiere a una muestra que comprende o está constituida por ácido nucleico por lo general ADN (preferentemente ADN genómico) en una forma adecuada para la detección por amplificación tal como se describe en la presente memoria. Las muestras utilizadas en los presentes procedimientos pueden proceder esencialmente de cualquier organismo, tal como un organismo eucariótico, incluyendo, pero sin limitarse a, seres humanos, ratones, ratas, hámsteres, caballos y vacas.

Preferentemente, la muestra es de un ser humano o procede del mismo.

La muestra puede proceder esencialmente de cualquier fuente asociada a un organismo tal como una muestra de tejido y/o fluido extraída de un individuo o de un grupo de individuos. Los ejemplos ilustrativos incluyen piel, plasma, suero, sangre, orina, lágrimas, órganos, fluido espinal, fluido de linfa y tumores. La muestra puede incluso proceder de cultivos de células in vitro, incluyendo el medio de crecimiento, células recombinantes y componentes celulares.

Cuando las muestras se extraen para diagnóstico o el estudio de un tumor, la muestra por lo general se extrae de un tejido tumoral o de un tejido que se sospecha que presenta el inicio de la formación del tumor. En las técnicas de enriquecimiento, la muestra necesaria para la evaluación de la presencia del tumor pueden obtenerse, por ejemplo, enriqueciendo células tumorales o el ADN del plasma.

Por lo tanto, en muchos casos, la muestra será una muestra de tejido o células en las que el ácido nucleico está aislado y/o clonado y/o amplificado. Puede ser, por ejemplo, ADN genómico procedente de un cromosoma específico, o las secuencias seleccionadas (por ejemplo activadores, genes, fragmentos de amplificación o restricción específicos) con alteraciones específicas, tales como amplicones o deleciones.

Los procedimientos para aislar muestras de células y tejidos son bien conocidos por los expertos en la materia e incluyen, pero no se limitan a, aspirados, secciones de tejidos, biopsias con aguja y similares. Frecuentemente la muestra será una "muestra clínica" que es una muestra procedente de un paciente, que incluye secciones o tejidos tales como secciones congeladas o secciones en parafina extraídas con fines histológicos. La muestra puede proceder también de sobrenadantes (de células) o de las propias células de cultivos celulares, células de cultivo tisular y de otros medios en los que puede ser deseable detectar anomalías cromosómicas y/o determinar el número de copias.

Los procedimientos habituales conocidos en la técnica pueden utilizarse para aislar el ácido nucleico requerido procedente de la muestra.

Una aplicación específica de los procedimientos descritos en la presente memoria es para analizar las secuencias de ADN procedentes de la(s) presente(s) célula(s) o de la población o poblaciones celulares, por ejemplo, procedentes de muestras clínicas incluyendo tejidos tumorales y fetales.

Sin embargo, si el ácido nucleico, por ejemplo, el ADN, debe extraerse de un pequeño número de células (por ejemplo de una subzona tumoral específica) o de una sola célula, a veces puede ser necesario ampliar el ácido nucleico, por un procedimiento de reacción en cadena de la polimerasa (RCP) o por un procedimiento de reacción en cadena sin polimerasa (no-RCP). La RCP y los procedimientos de RCP preferidos se describen en la presente memoria. Los procedimientos de no-RCP ilustrativos incluyen la reacción en cadena de la ligasa (RCL) y la amplificación lineal mediante la utilización de cebadores apropiados y su amplificación (cebado aleatorio) tal como se describe en la presente memoria.

Ventajosamente, los ácidos nucleicos de muestras de tejido archivadas, por ejemplo, muestras de patología empapadas en parafina o fijadas en formalina, pueden analizarse por los procedimientos descritos en la presente memoria. El ácido nucleico de dichas muestras puede extraerse por técnicas conocidas tales como las descritas en Anatomic Pathology 95(2); 117-124 (1191) y Cancer Res. 46: 2964-2969 (1986), y si es necesario, amplificadas para análisis. Dicho ácido nucleico puede ampliarse utilizando un procedimiento de reacción en cadena de la polimerasa (RCP) en la que por ejemplo, el ADN procedente de los tejidos empapados en parafina se amplía por RCP.

Un valor específico de analizar dicho ácido nucleico archivado es que dichas muestras están normalmente asociadas a los registros médicos de pacientes de los que se extraen las muestras. Por consiguiente, pueden hacerse asociaciones de diagnóstico/pronóstico valiosas entre el estado puesto de manifiesto del material del ácido nucleico del paciente y los antecedentes médicos del tratamiento y los resultados para estos pacientes. Por ejemplo, la información reunida por los procedimientos descritos en la presente memoria puede utilizarse para predecir la agresividad de un tumor basado en su modelo de amplificación y/o deleción correspondiente a las asociaciones realizadas con patrones similares de los pacientes cuyos resultados se conocen.

Asimismo, otro ácido nucleico que se fija por otros procedimientos - tal como el material arqueológico conservado mediante procedimientos de fijación natural - puede estudiarse también. Las diferencias del número de copias entre las especies proporcionan información del grado de similitud y divergencia de las especies estudiadas. Las conexiones y discrepancias importantes desde el punto de vista de la evolución entre las especies que existen o se han extinguido pueden hacerse por consiguiente utilizando los procedimientos descritos en la presente memoria.

Tal como se describe en la presente memoria, una vez se ha preparado la muestra, puede dividirse en una o más alícuotas (por ejemplo varias alícuotas). En el contexto del número de alícuotas, el término "varias" significan 2 o más, preferentemente 10 o más, preferentemente 20 o más, preferentemente 30 o más, preferentemente 40 o más, preferentemente 60 o más, preferentemente 80 o más, preferentemente 90 o más, o incluso preferentemente, 100, 200, 300, 400, 600, 800 o incluso 1000 o más.

En una forma de realización particularmente preferida, los procedimientos de la presente invención se realizan en una o más placas que contienen varios pocillos. Preferentemente la plaza contiene 96 pocillos o 384 pocillos. Pueden utilizarse también placas de otros tamaños adecuados. Por consiguiente, el número de alícuotas de las muestras que por lo general se correlacionan con el número de pocillos en la placa. Sin embargo, cuando se utilizan dichas placas, la muestra no está necesariamente en alícuotas en cada uno y en todos los pocillos ya que pueden utilizarse uno o más pocillos como referencias. A título de ejemplo, si se realiza un experimento en una o más placas de 96 pocillos, entonces aproximadamente 8 pocillos más o menos de cada placa pueden utilizarse como referencias negativas, que no se ponen en contacto con las alícuotas de la muestra. Así, las referencias negativas carecen de ácido nucleico - tal como ADN genómico - que es o procede de la muestra.

Cada alícuota de la muestra utilizada según la presente invención comprende menos de un genoma para la reacción de amplificación tal como se define para la cartografía HAPPY (22). Preferentemente cada alícuota de la muestra utilizada según la presente invención comprende aproximadamente 0,9, 0,8, 0,7, 0,6, 0,5, 0,4, 0,3, 0,2 ó 0,1 genomas o menos por reacción de amplificación. Más preferentemente, cada alícuota de la muestra utilizada según la presente invención comprende un intervalo que consiste en cualquier punto de partida o final adecuado del número de genomas por reacción de amplificación, tal como aproximadamente 0,1 a 0,9 genomas por reacción de amplificación o como aproximadamente 0,3 a 0,5 genomas por reacción de amplificación. Más preferentemente, cada alícuota de la muestra utilizada según la presente invención comprende aproximadamente 0,3 genomas por reacción de amplificación.

Para determinar la concentración exacta de ADN en la muestra antes de la preparación de alícuotas, pueden realizarse ensayos iniciales utilizando un intervalo de diluciones de ADN que cabe esperar (basándose en la concentración de ADN determinada por espectrometría de UV) que proporcionen entre 0,25 y 8 genomas de ADN por muestra. Pueden analizarse aproximadamente 4 secuencias de ácido nucleico por muestra de ácido nucleico a diferente diluciones (tal como 6 diluciones) para diferentes secuencias de ácido nucleico que se cree que están presentes solamente en una copia por genoma haploide. La proporción de muestras de cada dilución hallada positiva para estos marcadores se utiliza para refinar la concentración estimada de ácido nucleico y por consiguiente determinar la dilución requerida para el análisis posterior.

Amplificación

Tal como se utiliza en la presente memoria, "amplificación" se refiere a cualquier procedimiento para multiplicar las cadenas de ácido nucleico (tal como el ADN genómico) in vitro.

Preferentemente, el procedimiento es enzimático y es lineal o de carácter exponencial.

Las técnicas de amplificación incluyen, pero no se limitan a, los procedimientos ampliamente clasificados como procedimientos de amplificación de ciclación térmica y los procedimientos de amplificación isotérmicos. Los procedimientos de ciclación térmica adecuados incluyen, por ejemplo, la reacción en cadena de la ligasa (Genomics 4:560, (1989); y Science 241: 1077 (1988)). La reacción en cadena de la ligasa utiliza la ADN ligasa y cuatro oligonucleótidos, 2 por cadena diana. Los oligonucleótidos se hibridan con las secuencias adyacentes en el ácido nucleico que debe ampliarse y se unen mediante la ligasa. La reacción se desnaturaliza térmicamente y se repite el ciclo. Los procedimientos de amplificación isotérmicos útiles en la presente invención incluyen, por ejemplo, la amplificación con desplazamiento de cadena (SDA) (Proc. Nat. Acad. Sci. EE.UU. 89:392-396 (1992)), Q-beta-replicasa (Bio/Technology 6:1197-1202 (1988)); amplificación de la secuencia de ácido nucleico (NASBA) (Bio/Technology 13:563-565 (1995)); y la replicación de la secuencia automantenida (Proc. Nat. Acad. Sci. EE.UU. 87:1874-1'878 (1990)).

Un procedimiento de amplificación particularmente preferido es la RCP. Como es bien conocido por los expertos en la materia, este es un procedimiento en el que prácticamente toda la secuencia de ácido nucleico puede ampliarse selectivamente. El procedimiento implica utilizar series emparejadas de oligonucleótidos de la secuencia predeterminada que se hibridan con las cadenas opuestas de ADN y definen los límites de la secuencia que debe ampliarse. Los oligonucleótidos ceban rondas múltiples sucesivas de síntesis de ADN catalizadas por una ADN polimerasa termoestable. Cada ronda de síntesis es separada por lo general por una etapa de fusión y rehibridación, permitiendo que se amplíe una secuencia de ADN dada varias cientos de veces en menos de una hora (Science 239:487, 1988). Como se describe en la presente memoria, más de un ácido nucleico puede ampliarse simultáneamente por RCP múltiple en la que se emplean múltiples cebadores emparejos.

El ácido nucleico puede marcarse en uno o más nucleótidos durante o después de la amplificación.

Tal como se describe en la presente memoria, los procedimientos se realizan utilizando una reacción de amplificación en dos fases.

Primera reacción de amplificación

La primera reacción de amplificación es por lo general una etapa de amplificación con cebadores externos multiplexados con objeto de ampliar una o más, preferentemente dos o más (por ejemplo varias) secuencias de ácido nucleico. Cuando se analizan genes y directos grandes o genes indefinidos, se requieren con frecuencia muchas reacciones de amplificación individuales para identificar las alteraciones. Por lo tanto, para racionalizar el análisis de grandes genes complejos, pueden utilizarse cebadores múltiples para la amplificación simultánea de diferentes secuencias de ácido nucleico en una sola reacción de amplificación. Los procedimientos para la preparación de cebadores múltiples son conocidos en la técnica, como se describe, por ejemplo en la patente US nº 6.207.372.

En una forma de realización, se amplían uno o más marcadores (por ejemplo un marcador de prueba y/o un marcador de referencia).

En otra forma de realización, se amplían dos o más marcadores (por ejemplo un marcador de prueba y/o un marcador de referencia).

En otra forma de realización, se amplían todos los marcadores.

En otra forma de realización, se amplían todas las copias de una o más secuencias o marcadores.

En otra forma de realización, se amplían uno o más marcadores, dos o más marcadores o todos los marcadores en una zona cromosómica o genómica o locus de interés.

Para la primera reacción, se prepara ácido nucleico y se diluye a menos de aproximadamente un genoma por alícuota. Si el procedimiento de amplificación seleccionado es la RCP entonces puede preparase una mezcla maestra que contiene los cebadores de todas las secuencias que deben ampliarse en tampón de RCP (tal como el tampón Gold PCR (Perkin-Elmer)), MgCl2, tal como aproximadamente MgCl2 2 mM, las dNTP, tal como aproximadamente 200 µM de cada dNTP y Taq ADN polimerasa, tal como aproximadamente 0,1 U/µl de Taq Gold ADN polimerasa (Perkin-Elmer).

De manera adecuada, el ácido nucleico se divide en varias alícuotas.

De manera adecuada, el ácido nucleico se divide en varias alícuotas idénticas o sustancialmente idénticas.

De manera adecuada, cada una de las alícuotas que se prepara se suministra a un pocillo o receptáculo. Por consiguiente, en una forma de realización de la presente invención, las reacciones de amplificación se realizarán en paralelo utilizando, por ejemplo, placas de 96 pocillos. De este modo, las alícuotas de la mezcla madre se distribuirán en, por ejemplo, 8 pocillos de las placas de 96 pocillos (referencias negativas), y posteriormente, aproximadamente 0,03 genomas/µl del ADN genómico añadido a la mezcla madre para análisis. Las alícuotas de esta mezcla (conteniendo cada una aproximadamente 0,3 genomas de ADN) se reparten en alícuotas en cada uno de los pocillos restantes y los pocillos de referencia reciben una mezcla equivalente pero que carece de ADN genómico (referencias negativas). Todas las muestras se cubren con aceite mineral (aproximadamente 20 µl).

Una reacción de amplificación inicial puede realizarse para ampliar uno o más marcadores en cada una de las alícuotas. Preferentemente, se amplían todos los marcadores en cada una de las alícuotas.

El ciclo térmico se realiza por lo general con inicio en caliente a aproximadamente 93ºC durante aproximadamente 9 minutos, seguido de aproximadamente 25 ciclos de aproximadamente 20 segundos a aproximadamente 94ºC, aproximadamente 30 segundos y aproximadamente 52ºC y aproximadamente 1 minuto a aproximadamente 72ºC. El experto en la materia apreciará que pueden introducirse variaciones de esta reacción de ciclo térmico.

Cada uno de los productos amplificados se diluyen hasta una cantidad que es suficiente para la segunda reacción de amplificación para ampliar el ácido nucleico contenido en la misma.

En una forma de realización de la presente invención resulta preferido que la primera reacción de amplificación esté automatizada.

Segunda reacción de amplificación

Adecuadamente, uno o más (por ejemplo cada uno) de los productos amplificados de la primera reacción de amplificación se subdividen o se cortan y empalman en una o más muestras de réplica o alícuotas de la réplica.

Adecuadamente, uno o más (por ejemplo cada uno) de los productos amplificados de la primera reacción de amplificación se subdivide, se cortan y empalma o se suministra en uno o más pocillos de réplica o receptáculos de réplica.

Por consiguiente, antes de la segunda reacción de amplificación se preparan uno o más conjuntos de la réplica de los productos amplificados procedentes de la primera reacción de amplificación. Adecuadamente, la serie de productos amplificados de la réplica comprende 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% ó 100% de cada uno de los productos amplificados para la primera reacción de amplificación. Preferentemente, la serie de la réplica de los productos amplificados comprende 90%, 95%, 96%, 97%, 98%, 99% o 100% de cada uno de los productos amplificados procedentes de la primera reacción de amplificación.

Por lo general, una o más (por ejemplo cada una de las) alícuotas procedentes de la primera reacción de amplificación se subdivide o se suministra a un número de muestras de la réplica, alícuotas, pocillos o receptáculos que se correlacionan con el número de marcadores que se amplían. De manera adecuada, un marcador se amplía en cada una de las muestras de la réplica, alícuotas, pocillos o receptáculos. Por lo tanto, a título de ejemplo, si se amplían cuatro marcadores entonces cada alícuota de la primera reacción de amplificación se subdivide, corta o empalma o se suministra en cuatro muestras de la réplica, alícuotas, pocillos o receptáculos. Un primer marcador se ampliará en una primera de las muestras de la réplica, alícuotas, pocillos o receptáculos, un segundo marcador se ampliará en una segunda de las muestras de la réplica, alícuotas, pocillos o receptáculos y así sucesivamente.

En una forma de realización de la presente invención, se amplía uno o más de los productos de amplificación obtenidos o que pueden obtenerse a partir de la primera reacción de amplificación.

Por lo general, la segunda reacción de amplificación se lleva a cabo utilizando una reacción de amplificación semianidada en la que se utiliza el mismo cebador complementario tal como se utiliza en la primera reacción de amplificación en combinación con un cebador directo interno para cada marcador que va a ampliarse.

Si la segunda amplificación se lleva a cabo utilizando la RCP entonces por lo general, la RCP semianidada utiliza MgCl2, tal como aproximadamente MgCl2 1,5 mM y aproximadamente 1 µM de los cebadores directo interno y complementario apropiados. Las otras concentraciones son aproximadamente las mismas que las utilizadas para la primera reacción de amplificación como anteriormente.

En una forma de realización, el ciclo térmico se lleva a cabo a aproximadamente 93ºC durante aproximadamente 9 minutos, seguido de aproximadamente 33 ciclos de aproximadamente 20 segundos a aproximadamente 94ºC, aproximadamente 30 segundos a aproximadamente 52ºC y aproximadamente 1 minuto a aproximadamente 72ºC). El experto en la materia apreciará que pueden introducirse variaciones de esta reacción de ciclo térmico.

Ventajosamente, las reacciones de amplificación de la segunda fase se organizan mediante robots en placas de microvaloración múltiples de 384 pocillos de modo que cada una de las primeras 96 reacciones de amplificación pueden identificarse para cada uno de los diferentes marcadores. Por lo tanto, a título de ejemplo, si se identifican cuatro secuencias de ácido nucleico en la segunda amplificación, entonces puede utilizarse una placa de 384 pocillos proporcionando de este modo 96 pocillos para cada una de las cuatro secuencias de ácido nucleico. Alternativamente, la segunda etapa de amplificación semianidada puede llevarse a cabo en una segunda placa de 96 pocillos si se utiliza una pipeta multicanal para las transferencias, en lugar de un sistema robótico.

En una forma de realización de la presente invención resulta preferido que la segunda reacción de amplificación esté automatizada.

En una forma de realización de la presente invención resulta preferido que la primera y la segunda reacciones de amplificación estén automatizadas.

Ventajosamente, los procedimientos descritos en la presente memoria pueden utilizarse en combinación con otras reacciones de amplificación. A título de ejemplo, los procedimientos descritos en la presente memoria pueden utilizarse en combinación con una o más reacciones RCP que detectan anomalías genéticas, tales como las transposiciones recíprocas.

En un aspecto adicional, se suministra un procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(a) suministrar una variedad de alícuotas de la muestra, en las que cada alícuota comprende ácido nucleico en una cantidad que es inferior a la de un genoma por alícuota; (b) ampliar una o más secuencias de ácido nucleico de cada una de varias alícuotas en una primera reacción de amplificación; (c) ampliar en una segunda reacción de amplificación una o más secuencias de ácido nucleico de cada una de varias alícuotas preparadas según la etapa (b) en la que por lo menos una de las secuencias de ácido nucleico es un marcador de prueba; y (d) calcular el número de copias del marcador de prueba comparando el número de productos amplificados para el marcador de prueba con los de un marcador de referencia.

En un aspecto adicional, se suministra un procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(b) suministrar una variedad de alícuotas de la muestra, en las que cada alícuota comprende ácido nucleico en una cantidad que es inferior a la de un genoma por alícuota; (b) ampliar una o más secuencias de ácido nucleico de cada una de varias alícuotas en una primera reacción de amplificación; (c) ampliar en una segunda reacción de amplificación una o más secuencias de ácido nucleico de cada una de varias alícuotas preparadas según la etapa (b) en la que por lo menos una de las secuencias de ácido nucleico es un marcador de prueba y por lo menos una de las secuencias de ácido nucleico es un marcador de referencia; y (d) calcular el número de copias del marcador de prueba comparando el número de productos amplificados para el marcador de prueba con los de un marcador de referencia.

En un aspecto adicional, se suministra un procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(a) suministrar una o más (por ejemplo una variedad de) alícuota(s) de la muestra, en la que cada alícuota comprende ácido nucleico en una cantidad que es inferior a la de un genoma por alícuota; (b) ampliar uno o más (preferentemente todos) los marcadores de cada alícuota(s) en una primera reacción de amplificación; (c) distribuir cada uno de los productos de amplificación procedentes de la primera reacción de amplificación en la muestras de réplica; (d) ampliar en una segunda reacción de amplificación uno o más marcadores de cada alícuta(s) en las muestras de réplica preparadas según la etapa (c), en la que por lo menos una de las secuencias de ácido nucleico es un marcador de prueba; y (e) calcular el número de copias del marcador de prueba comparando el número de productos amplificados para el marcador de prueba con los de un marcador de referencia.

En un aspecto adicional, se suministra un procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(a) suministrar una o más (por ejemplo una variedad de) alícuota(s) de la muestra, en la que cada alícuota comprende ácido nucleico en una cantidad que es inferior a la de un genoma por alícuota; ampliar uno o más (preferentemente, todos) los marcadores de cada alícuota(s) en una primera reacción de amplificación; (c) distribuir cada uno de los productos de amplificación procedentes de la primera reacción de amplificación en la muestras de réplica; (d) ampliar en una segunda reacción de amplificación dos o más marcadores de cada alícuta(s) en las muestras de réplica preparadas según la etapa (c), en la que por lo menos una de las secuencias de ácido nucleico es un marcador de prueba y por lo menos una de las secuencias de ácido nucleico es un marcador de referencia; y (e) calcular el número de copias del marcador de prueba comparando el número de productos amplificados para el marcador de prueba con los del marcador de referencia.

Cebadores

Los cebadores utilizados en la amplificación se seleccionan de manera que puedan hibridarse con secuencias en las zonas adyacentes de la secuencia de ácido nucleico (por ejemplo locus) que se está ampliando. Los cebadores se seleccionan para que tengan por lo menos complementariedad sustancial con las diferentes cadenas de ácido nucleico que se está ampliando.

El cebador debe tener suficiente longitud de modo que pueda cebar la síntesis de los productos de amplificación en presencia de un agente para la polimerización. La longitud y composición del cebador depende de muchos parámetros, incluyendo, por ejemplo la temperatura a la que se lleva a cabo la reacción de hibridación, la concentración del cebador y la composición específica del ácido nucleico del cebador. Por lo general el cebador incluye de 15 a 30 nucleótidos, preferentemente, de 18 a 20 pb. Para algunas formas de realización de la presente invención, resulta preferido que los cebadores tengan una Tm comprendida entre aproximadamente 52 y 60ºC (basado en el cálculo Tm=2x(A+T)+4x(G+C)). Preferentemente el diseño incluye por lo menos dos bases G o C en el extremo 3' y por lo menos una en el extremo 5'. En general, no se utilizan los cebadores que poseen series de cualquier base individual mayores de 4 bases. La longitud del amplímero interno se diseña para que esté comprendida entre aproximadamente 80 y 150 p.b. y la posición del cebador externo no más de aproximadamente 150 p.b. corriente arriba del cebador directo interno.

La longitud del cebador puede depender más o menos de la complejidad de la zona de unión del cebador y de los factores enumerados a continuación además de los que son conocidos por los expertos en la materia.

Por lo general, los cebadores se hibridan específicamente a una secuencia nucleotídica específica. La expresión "se hibridan específicamente" tal como se utiliza en la presente memoria se refiere a la unión, duplicación o hibridación de un ácido nucleico preferentemente a una secuencia específica en condiciones severas. La expresión "condiciones severas" se refiere a las condiciones bajo las cuales un cebador se hibridará preferentemente con su subsecuencia diana, y en menor medida con, o no completamente con, otras secuencias.

Los cebadores pueden sintetizarse según los procedimientos que son bien conocidos en la técnica.

La selección del cebador puede realizarse utilizando varios procedimientos que son conocidos en la técnica (por ejemplo similares al diseño para utilizaciones convencionales de la RCP) incluyendo, por ejemplo, el diseñador de cebador universal después de enmascarar los elementos repetitivos de la secuencia genómica (Assembly NCBl 35, http://www.ensembl.org) utilizando Repeatmasker (http://www.repeatmasker.org).

En la primera reacción de amplificación descrita anteriormente, se utilizan cebadores por lo general que comprenden un cebador directo e inverso para cada secuencia de ácido nucleico que se amplía. Los pares de cebadores múltiples pueden combinarse en una sola reacción múltiple de modo que en la primera reacción de amplificación, se amplían múltiples secuencias de ácido nucleico (tales como todos los marcadores).

En la segunda reacción de amplificación tal como se describió también anteriormente, unas reacciones de amplificación semianidadas se realizan típicamente para cada secuencia de ácido nucleico específica que debe ampliarse. Los cebadores utilizados son de manera adecuada un cebador complementario tal como se utiliza en la primera reacción de amplificación en combinación con un cebador directo interno. Para algunas formas de realización de la presente invención resulta preferido que los cebadores utilizados sean iguales o sustancialmente iguales a los utilizados en la primera reacción de amplificación. Por lo general se utilizarán aproximadamente 0,15 µM de cada cebador en la primera reacción de amplificación. Por lo general se utilizará aproximadamente 1 µM de los cebadores directo interno y complementario adecuados para la segunda reacción de amplificación.

En una forma de realización de la presente invención, se utilizan varios pares de cebadores cada uno para una reestructuración cromosómica específica en una sola reacción. Cada par de cebadores da como resultado un producto de amplificación que es de diferente longitud y así los productos de la amplificación pueden diferenciarse.

En otra forma de realización de la presente invención, se utilizan cebadores marcados en los que cada par cebador está marcado con una etiqueta diferente y de este modo los productos de la amplificación pueden así diferenciarse.

Ventajosamente, pueden analizarse por consiguiente múltiples cambios de posición cromosómicos.

Determinación del número de copias

Después de la segunda r

Reivindicaciones:

1. Procedimiento de medición de la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra, que comprende las etapas siguientes:

(a) proporcionar una diversidad de alícuota(s) de la muestra, en la que cada alícuota comprende ácido nucleico en una cantidad que es inferior a un genoma por alícuota;
(b) ampliar una o más secuencias de ácido nucleico en cada alícuota(s) en una primera reacción de amplificación;
(c) subdividir uno o más de los productos empleados en alícuotas de la réplica y llevar a cabo una segunda reacción de amplificación para una o más secuencias de ácido nucleico en cada alícuota(s), en la que cada una de las secuencias de ácido nucleico es un marcador de prueba y por lo menos una de las secuencias de ácido nucleico es un marcador de referencia;
(d) calcular el número de copias por comparación en cada una de las alícuotas de la réplica del número de productos amplificados obtenido en el marcador de prueba con el número de productos amplificados obtenidos para el marcador de referencia.

2. Procedimiento según la reivindicación 1, en el que cada alícuota en la primera reacción de amplificación comprende aproximadamente 0,1 a 0,9 genomas de ADN por reacción de amplificación.

3. Procedimiento según la reivindicación 1 ó 2, en el que el número de copias del marcador de prueba se calcula contando manualmente el número de productos de amplificación para el marcador de prueba y el marcador de referencia.

4. Procedimiento según cualquiera de las reivindicaciones anteriores, en el que el número de copias del marcador de prueba se calcula utilizando la ecuación:

Np=N(1-e-z)

en la que N es el número de alícuotas; Z es el número promedio de productos amplificados por alícuota; y Np es el número de alícuotas que cabe esperar que contenga por lo menos una molécula del ácido nucleico según la distribución de Poisson.

5. Procedimiento según cualquiera de las reivindicaciones 1 a 3, en el que el número de copias del marcador de prueba se calcula utilizando la ecuación:

Z=-ln(1-Np/N)

en la que N es el número de alícuotas del ácido nucleico sometido a prueba para una secuencia dada; Np es el número de alícuotas que puntúan positivo para el ácido nucleico (es decir, por lo menos una copia de la secuencia del ácido nucleico está amplificada).

6. Procedimiento según cualquiera de las reivindicaciones anteriores, en el que las reacciones de amplificación se realizan utilizando PCR.

7. Procedimiento según cualquiera de las reivindicaciones anteriores, en el que la primera reacción de amplificación se lleva a cabo utilizando pares cebadores directos e inversos.

8. Procedimiento según cualquiera de las reivindicaciones anteriores, en el que la segunda reacción de amplificación se lleva a cabo utilizando pares cebadores directos-internos e inversos.

9. Procedimiento según cualquiera de las reivindicaciones anteriores, en el que la concentración de ácido nucleico en la muestra antes de la división en alícuotas se determina por amplificación de uno o más ácidos nucleicos que se cree que están presentes en sólo una copia por genoma haploide en dos o más divisiones diferentes, en la que la proporción de muestras en cada dilución hallada positiva para uno o más ácidos nucleicos se utiliza para refinar la estimación de la concentración de ADN y determinar así la dilución requerida para el análisis posterior.

10. Procedimiento de identificación de una o más alteraciones en una muestra de ácido nucleico, que comprende las etapas siguientes:

(a) medir la frecuencia del número de copias de una o más secuencias de ácido nucleico en una primera muestra y una segunda muestra según el procedimiento según cualquiera de las reivindicaciones 1 a 9;
(b) opcionalmente repetir iterativamente el procedimiento a resoluciones progresivamente superiores para cada una de las muestras; y
(c) identificar una o más diferencias en la frecuencia del número de copias de una o más secuencias de ácido nucleico en la primera y la segunda muestras.

11. Procedimiento según la reivindicación 10, en el que las muestras son o proceden de sujetos enfermos y sanos.

12. Procedimiento según la reivindicación 11, en el que la enfermedad es el cáncer.

13. Procedimiento según cualquiera de las reivindicaciones 10 a 12, en el que el procedimiento se realiza inicialmente a una resolución de 2 Mb disminuyendo progresivamente hasta 100 pares de bases o menos.

14. Procedimiento según cualquiera de las reivindicaciones 10 a 13, en el que la alteración es una transposición, una amplificación, una duplicación o una deleción.

15. Procedimiento para diagnosticar una enfermedad en un paciente, que comprende las etapas siguientes:

(a) medir la frecuencia del número de copias de una o más secuencias de ácido nucleico en una muestra según el procedimiento según cualquiera de las reivindicaciones 1 a 9; y
(b) comparar el número de copias de dichas una o más secuencias de ácido nucleico con el número de copias normales de dichas una o más secuencias de ácido nucleico;

en el que una diferencia entre los números de copias de dichas una o más secuencias de ácido nucleico en la muestra y el número de copias normales de dichas una o más secuencias de ácido nucleico es indicativo de que el paciente está padeciendo la enfermedad.

16. Procedimiento según la reivindicación 15, en el que si el número de copias de una o más secuencias de ácido nucleico en la muestra de ácido nucleico del paciente es superior al número de copias normales es indicativo de una transposición, una amplificación o una duplicación.

17. Procedimiento según la reivindicación 15, en el que si el número de copias de una o más secuencias de ácido nucleico en la muestra de ácido nucleico del paciente es inferior al número de copias normales es indicativo de una deleción.

18. Procedimiento para clonar una o más alteraciones en una muestra de ácido nucleico que comprende las etapas siguientes:

(a) identificar una o más alteraciones en una muestra de ácido nucleico según cualquiera de las reivindicaciones 10 a 14; y
(b) clonar dichas una o más alteraciones.

19. Procedimiento según la reivindicación 18, en el que la alteración se clona utilizando clonación por RCP inversa.






Acerca de · Contacto · Patentados.com desde 2007 hasta 2014 // Última actualización: 23/07/2014.