Polipéptidos implicados en la biosíntesis de las espiramicinas, secuencias nucelotídicas que codifican estos polipéptidos y sus aplicaciones.

Polinucleótido que codifica un polipéptido implicado en la biosíntesis de las espiramicinas, caracterizado por que la sobreexpresión de dicho polinucleótido permite un aumento de la producción de las espiramicinas y por que la secuencia de dicho polinucleótido es:

(a) una de las secuencias SEC ID n° 111 o 141,

(b) un polinucleótido que presenta al menos el 80%, 85%, 90%, 95% o el 98% de identidad en nucleótidos con el polinucleótido según (a).

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E07019306.

Solicitante: AVENTIS PHARMA S.A..

Nacionalidad solicitante: Francia.

Dirección: 20, AVENUE RAYMOND ARON 92160 ANTONY FRANCIA.

Inventor/es: LACROIX, PATRICIA, PERNODET, JEAN-LUC, BLONDELET-ROUAULT,MARIE-HÉLÈNE, DOMINGUEZ,HÉLÈNE, DARBON-RONGERE,EMMANUELLE, GERBAUD,CLAUDE, GONDRAN,ANNE, KARRAY,FATMA, OESTREICHER-MERMET-BOUVIER,NATHALIE, TUPHILE,KARINE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > C12N9/00 (Enzimas, p. ej. ligasas (6.; Proenzimas; Composiciones que las contienen (preparaciones para la limpieza de los dientes que contienen enzimas A61K 8/66, A61Q 11/00; preparaciones de uso médico que contienen enzimas A61K 38/43; composiciones detergentes que contienen enzimas C11D ); Procesos para preparar, activar, inhibir, separar o purificar enzimas)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/63 (Introducción de material genético extraño utilizando vectores; Vectores; Utilización de huéspedes para ello; Regulación de la expresión)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/21 (modificados por la introducción de material genético extraño)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > SISTEMA DE INDEXACION ASOCIADO A LAS SUBCLASES C12C... > Microorganismos > C12R1/465 (Streptomyces)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/52 (Genes que codifican enzimas o proenzimas)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/62 (teniendo el heterociclo al menos ocho miembros y sólo oxígeno como heteroátomo del ciclo, p. ej. eritromicina, espiramicina, nistatina)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/36 (de Actinomyces; de Streptomyces (G))
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Polipéptidos implicados en la biosíntesis de las espiramicinas, secuencias nucelotídicas que codifican estos polipéptidos y sus aplicaciones La presente invención se refiere al aislamiento y a la identificación de nuevos genes de la ruta de la biosíntesis de las espiramicinas y de nuevos polipéptidos implicados en esta biosíntesis. Se refiere también a la utilización de estos genes con el objetivo de aumentar los porcentajes de producción y la pureza de la espiramicina producida.

Los Streptomyces son unas bacterias filamentosas Gram positivas del suelo. Desempeñan un papel importante en la descomposición y la mineralización de las materias orgánicas gracias a la gran diversidad de las enzimas degradativas que segregan. Presentan unos fenómenos de diferenciaciones morfológicas únicas en los procariotas que se acompañan de una diferenciación metabólica caracterizada por la producción de metabolitos secundarios que presentan una extraordinaria diversidad de estructuras químicas y de actividades biológicas. Entre estos metabolitos, se encuentra las espiramicinas producidas en estado natural por la bacteria Streptomyces ambofaciens.

La espiramicina es un antibiótico de la familia de los macrólidos útil tanto en medicina veterinaria como en medicina humana. Los macrólidos están caracterizados por la presencia de un anillo lactona en el que están injertados uno o varios azúcares. Los Streptomyces ambofaciens producen en estado natural la espiramicina I, II y III (véase la figura 1), sin embargo, la actividad antibiótica de la espiramicina I es claramente superior a la de las espiramicinas II y III (Liu et al., 1999). La molécula de espiramicina I está constituida de un macro-anillo lactónico, denominado platenólido y de tres azúcares: la forosamina, la micaminosa y la micarosa (véase la figura 1). La actividad antibiótica de las espiramicinas se debe a una inhibición de la síntesis proteica en los procariotas por un mecanismo que implica la unión del antibiótico al ribosoma bacteriano.

Algunos compuestos miembros de la familia de los macrólidos y que poseen también un anillo lactona han dado lugar a utilizaciones fuera del campo de los antibióticos. Así, el producto FK506 tiene unos efectos inmunosupresores y ofrece unas perspectivas de aplicación terapéutica en el campo del trasplante de órganos, de la artritis reumatoide y más generalmente en patologías relacionadas a reacciones autoinmunes. Otros macrólidos, como la avermectina, tienen unas actividades insecticidas y antihelmínticas.

Numerosas rutas de biosíntesis, que se refieren a antibióticos que pertenecen a clases variadas, así como otros metabolitos secundarios (como repaso, Chater K. 1990), se han estudiado hoy día en los Stremptomycetes. Sin embargo, el conocimiento de las rutas de biosíntesis de las espiramicinas es en la actualidad sólo parcial.

La biosíntesis de las espiramicinas es un proceso complejo que comprende numerosas etapas y que implica numerosas enzimas (Omura et al., 1979a, Omura et al., 1979b). Las espiramicinas pertenecen a la amplia clase de los policétidos, que agrupan unas moléculas complejas particularmente abundantes en los microorganismos del suelo. Estas moléculas son agrupadas no por analogía de estructura, sino por una cierta similitud a nivel de etapas de su ruta de la biosíntesis. En efecto, los policétidos son producidos por una serie compleja de reacciones, pero tienen en común tener en su ruta de la biosíntesis una serie de reacciones catalizadas por una o más enzimas denominadas "policétidos sintasas" (PKS).

En los Streptomyces ambofaciens, la biosíntesis del macro-anillo lactónico de las espiramicinas (platenólido) se realiza por una serie de ocho módulos codificados por cinco genes PKS diferentes (Kuhstoss S., 1996, patente US 5.945.320). Las espiramicinas se obtienen a partir de este anillo lactona. Sin embargo, las diversas etapas y enzimas implicadas en la síntesis de los azúcares, así como su unión al anillo lactona y la modificación de este anillo para la obtención de las espiramicinas siguen siendo todavía desconocidas hoy en día.

La patente US 5.514.544 describe la clonación de una secuencia denominada srmR en Streptomyces ambofaciens. Se considera en esta patente que el gen srmR codifica una proteína reguladora de la transcripción de los genes implicados en la biosíntesis de los macrólidos.

Epp et al. (Gene 1989, 85(2), 293-301) han descrito una proteína reguladora implicada en la biosíntesis de carbomicina en S. thermotolerans y codificada por el gen acyB2.

En 1987, Richardson y colaboradores (Richardson et al., 1987) han mostrado que la resistencia a la espiramicina de S. ambofaciens está conferida por al menos tres genes, estos últimos se denominaron srmA, srmB y srmC. La patente US 4.886.757 describe más particularmente la caracterización de un fragmento de ADN de S. ambofaciens que contiene el gen srmC. Sin embargo, la secuencia de este gen no se ha divulgado. En 1990, Richardson y colaboradores (Richardson et al., 1990) plantearon la hipótesis de la existencia de tres genes de biosíntesis de la espiramicina similar a srmB. La patente US 5.098.837 se refiere a la clonación de cinco genes potencialmente implicados en la biosíntesis de la espiramicina. Estos genes han sido bautizados srmD, srmE, srmF, srmG y srmH.

Una de las dificultades principales en la producción de compuestos tales como las espiramicinas reside en el hecho de que se necesitan muy grandes volúmenes de fermentación para la producción de una cantidad relativamente baja de producto. Por lo tanto, es deseable poder aumentar la eficacia de producción de tales moléculas a fin de disminuir los costes de producción.

La ruta de la biosíntesis de las espiramicinas es un proceso complejo y sería deseable identificar y suprimir las reacciones parásitas que podrían existir durante este proceso. El objetivo de tal manipulación es obtener un antibiótico más puro y/o una mejora de la productividad. A este respecto, las Streptomyces ambofaciens producen en su estado natural la espiramicina I, II y III (véase la figuras 1), sin embargo, la actividad antibiótica de la espiramicina I es claramente superior a la de las espiramicinas II y III (Liu et al., 1999). Por lo tanto, sería deseable poder disponer de cepas que produzcan sólo la espiramicina I.

Descripción general de la invención

La presente invención resulta de la clonación de genes cuyo producto interviene en la biosíntesis de las espiramicinas.

La invención se refiere en primer lugar a nuevos genes de la ruta de la biosíntesis de las espiramicinas y a nuevos polipéptidos implicados en esta biosíntesis.

Los genes de la ruta de la biosíntesis y las secuencias codificantes asociadas se han clonado y se ha determinado la secuencia de ADN de cada uno. Las secuencias codificantes clonadas se designarán a continuación orf1*c, orf2*c, orf3*c, orf4*c, orf5*, orf6*, orf7*c, orf8* orf9*, orf10*, orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c, orf25c, orf26, orf27, orf28c, orf29, orf30c, orf31, orf32c, orf33 y orf34c. La función de las proteínas codificadas por estas secuencias en la ruta de la biosíntesis de las espiramicinas está desarrollada en la discusión siguiente, que se ilustra mediante las figuras 4, 5, 6 y 8.

La invención tiene por lo tanto por objeto, tal como se enuncia en las reivindicaciones 1 a 19: (1) Un polinucleótido que codifica un polipéptido implicado en la biosíntesis de las espiramicinas caracterizado por que la sobreexpresión de dicho polinucleótido permite un aumento de la producción de las espiramicinas y por que la secuencia de dicho polinucleótido es: (a) una de las secuencias SEC ID nº 111 o 141, (b) un polinucleótido que presenta al menos un 80%, 85%, 90%, 95% o 98% de identidad en nucleótidos con el polinucleótido según (a).

(2) Un polinucleótido tal como se menciona en el punto (1) caracterizado por que es aislado a partir de una bacteria del género Streptomyces.

(3) Un polipéptido implicado en la biosíntesis de las espiramicinas, caracterizado por que su sobreexpresión permite un aumento de la producción de las espiramicinas y por que la secuencia de dicho polipéptido comprende: (a) una de las secuencias SEC ID nº 112 o 142, (b) un polipéptido que presenta al menos un 80%, 85%, 90%, 95% o 98% de identidad en aminoácidos con el polipéptido según (a).

(4) Un polipéptido tal como el mencionado en el punto (3), caracterizado por que su secuencia comprende una de las secuencias SEC ID nº 112 o 142.

(5) Un polipéptido tal como el mencionado en el punto (3) caracterizado por que es aislado a partir de una bacteria del género Streptomyces.

(6) Un vector de expresión, caracterizado por que comprende al menos una secuencia de ácido nucleico que codifica un polipéptido tal como el mencionado en el punto (3), (4) o (5).

(7) Una célula huésped que comprende un vector de expresión apropiado que permite la expresión de uno o varios polipéptidos tales como los mencionados en el punto (3), (4) o (5).

(8) Una célula huésped tal como la mencionada en el punto (7) caracterizada por que se selecciona entre las células huésped procariotas o las células huésped eucariotas.

(9) Una célula huésped tal como la mencionada en el punto (8) caracterizada por que se selecciona entre la bacteria E. coli, las células de insectos, las células de levaduras, las células de mamíferos.

(10) Una célula huésped tal como la mencionada en el punto (7) en la que se ha introducido al menos un polinucleótido tal como el definido en el punto (1) o (2), y/o al menos un vector de expresión tal como el definido en el punto (6).

(11) Un procedimiento de producción de un polipéptido tal como el definido según uno de los puntos (3) a (5), caracterizado por que dicho procedimiento comprende las etapas siguientes: a) insertar al menos un ácido nucleico que codifica dicho polipéptido en un vector apropiado; b) cultivar, en un medio de cultivo apropiado, una célula huésped previamente transformada o transfectada con el vector de la etapa a); c) recuperar el medio de cultivo condicionado o un extracto celular; d) separar y purificar, a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa c), dicho polipéptido; e) llegado el caso, caracterizar el polipéptido recombinante producido.

(12) La utilización de un polinucleótido tal como el definido según uno de los puntos (1) y (2) para mejorar la producción en espiramicina de un microorganismo.

(13) Un microorganismo mutante productor de espiramicina caracterizado por que sobreexpresa al menos una secuencia codificante que comprende una secuencia tal como la definida según uno de los puntos (1) y (2), o una secuencia codificante que codifica un polipéptido tal como el definido según uno de los puntos (3), (4) y (5), siendo la sobreexpresión de la secuencia codificante considerada obtenida transformando un microorganismo productor de espiramicina por un vector de expresión tal como el definid en el punto (6), que permite la sobreexpresión de esta secuencia codificante.

(14) Un microorganismo mutante tal como el definido en el punto (13) caracterizado por que el microorganismo sobreexpresa una o varias secuencias codificantes que comprenden una de las secuencias polinucleotídicas tales como las definidas en el punto (1).

(15) Un microorganismo mutante tal como el definido en el punto (13) o (14) caracterizado por que dicho microorganismo es una bacteria del género Streptomyces.

(16) Un microorganismo mutante tal como el definido en el punto (13), (14) o (15), caracterizado por que dicho microorganismo es una cepa de S. ambofaciens..

(17) Un procedimiento de producción de espiramicina(s), caracterizado por que comprende las etapas siguientes: (a) cultivar, en un medio de cultivo apropiado, un microorganismo tal como el definido según uno de los puntos (13) a (16), (b) recuperar el medio de cultivo condicionado o un extracto celular, (c) separar y purificar, a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en el etapa b), las espiramicinas producidas.

(18) Una cepa de Streptomyces ambofaciens caracterizada por que se trata de la cepa OSC2/pSPM75(2) depositada ante la Collection Nationale de Cultures de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 6 de octubre de 2003 bajo el número de registro 1-3101.

(19) Un procedimiento de producción de espiramicina(s), caracterizado por que comprende las etapas siguientes: (a) cultivar, en un medio de cultivo apropiado, un microorganismo tal como el definido en el punto (18), (b) recuperar el medio de cultivo condicionado o un extracto celular, (c) separar y purificar, a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa b), las espiramicinas.

Definiciones generales

El término "aislado", en el sentido de la presente invención, designa un material biológico (ácido nucleico o proteína) que ha sido sustraído de su entorno original (el entorno en el que se localiza naturalmente).

Por ejemplo, un polinucleótido presente en estado natural en una planta o un animal no está aislado. El mismo polinucleótido separado de los ácidos nucleicos adyacentes dentro de los cuales está naturalmente insertado en el genoma de la planta o del animal se considera como "aislado".

Un polinucleótido de este tipo puede ser incluido en un vector y/o tal polinucleótido puede ser incluido en una composición, y permanecer sin embargo en estado aislado debido a que el vector o la composición no constituyen su entorno natural.

El término "purificado" no necesita que el material esté presente en una forma de pureza absoluta, exclusiva de la presencia de otros compuestos. Se trata más bien de una definición relativa.

Un polinucleótido está en estado "purificado" después de una purificación del material de partida o del material natural de al menos un orden de magnitud, preferentemente 2 o 3, y preferiblemente 4 o 5 órdenes de magnitud.

Para los fines de la presente invención, el término ORF («Open Reading Frame», es decir marco abierto de lectura) se ha empleado para designar en particular la secuencia que codifica un gen.

Para los fines de la presente descripción, la expresión "secuencia nucleotídica" se puede emplear para designar indistintamente un polinucleótido o un ácido nucleico. La expresión "secuencia nucleotídica" engloba el material genético en sí mismo, y por lo tanto no está restringida a la información referente a su secuencia.

Los términos "ácido nucleico", "polinucleótido", "oligonucleótido" o también "secuencia nucleotídica" engloban unas secuencias de ARN, de ADN, de ADNc o también unas secuencias híbridas ARN/ADN además de un nucleótido, indistintamente en forma de cadena simple o en forma de dúplex.

El término "nucleótido" designa al mismo tiempo los nucleótidos naturales (A, T, G, C) así como unos nucleótidos modificados que comprenden al menos una modificación tal como (1) un análogo de una purina, (2) un análogo de una pirimidina, o (3) un azúcar análogo, estando descritos unos ejemplos de tales nucleótidos modificados, por ejemplo, en la solicitud PCT n° WO 95/04 064.

Para los fines de la presente invención, un primer polinucleótido se considera como siendo "complementario" de un segundo polinucleótido cuando cada base del primer polinucleótido está emparejada a la base complementaria del segundo polinucleótido, cuya orientación está invertida. Las bases complementarias son A y T (o A y U), o C y G.

El término "genes de la ruta de la biosíntesis de las espiramicinas" comprende también los genes reguladores y los genes que confieren la resistencia a los microorganismos productores.

Se entenderá por "fragmento" de un ácido nucleico de referencia según la invención una secuencia nucleotídica de longitud reducida con respecto al ácido nucleico de referencia y que comprende, en la parte común, una secuencia en nucleótidos idéntica al ácido nucleico de referencia.

Tal "fragmento" de ácido nucleico según la invención puede, llegado el caso, estar comprendido en un polinucleótido más grande del cual es constitutivo.

Tales fragmentos comprenden, o alternativamente consisten en, unos polinucleótidos de longitudes que van de 8, 10, 12, 15, 18, 20 a 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850 o 1900 nucleótidos consecutivos de un ácido nucleico según la invención.

Por "fragmento" de un polipéptido según la invención, se entenderá un polipéptido cuya secuencia de aminoácidos es más corta que la del polipéptido de referencia y que comprende sobre toda la parte común con estos polipéptidos de referencia, una secuencia en aminoácidos idéntica.

Tales fragmentos pueden, llegado el caso, estar comprendidos dentro de un polipéptido más grande del cual forman parte.

Tales fragmentos de un polipéptido según la invención pueden tener una longitud de 10, 15, 20, 30 a 40, 50, 60, 70, 80, 90,100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620 o 640 aminoácidos.

Por "condiciones de hibridación de alta astringencia" en el sentido de la presente invención, se entenderán unas condiciones de hibridación que desfavorecen la hibridación de hebras de ácidos nucleicos no homólogos. Las condiciones de hibridaciones de alta astringencia pueden ser descritas, por ejemplo, como unas condiciones de hibridación en el tampón descritas por Church & Gilbert (Church & Gilbert, 1984) a una temperatura comprendida entre 55°C y 65°C, de manera preferida, la temperatura de hibridación es de 55°C, de manera aún más preferida la temperatura de hibridación es de 60°C, y de manera muy preferida la temperatura de hibridación es de 65°C, seguida de uno o varios lavados efectuados en tampón 2X SSC (el tampón 1X SSC corresponde a una solución acuosa 0,15M NaCl, 15 mM de citrato de sodio) a una temperatura comprendida entre 55°C y 65°C, de manera preferida esta temperatura es de 55°C, de manera aún más preferida esta temperatura es de 60°C, y de manera muy preferida esta temperatura es de 65°C, seguida de uno o varios lavados en tampón 0.5X SSC a una temperatura comprendida entre 55°C y 65°C, de manera preferida esta temperatura es de 55°C, de manera aún más preferida esta temperatura es de 60°C y de manera muy preferida esta temperatura es de 65°C.

No hace falta decir que las condiciones de hibridación descritas anteriormente pueden ser adaptadas en función de la longitud del ácido nucleico del que se busca la hibridación o del tipo de marcaje seleccionado, según unas técnicas conocidas por el experto en la materia. Las condiciones convenientes de hibridación pueden, por ejemplo, ser adaptadas según la obra de F. Ausubel et al. (2002).

Por "variante" de un ácido nucleico según la invención, se entenderá un ácido nucleico que difiere en una o varias bases con respecto al polinucleótido de referencia. Un ácido nucleico variante puede ser de origen natural, tal como una variante alélica encontrada naturalmente, o puede también ser una variante no natural obtenida por ejemplo mediante técnicas de mutagénesis.

En general, las diferencias entre el ácido nucleico de referencia y el ácido nucleico variante son reducidas, de tal manera que las secuencias nucleotídicas del ácido nucleico de referencia y del ácido nucleico variante son muy parecidas y, en numerosas regiones, idénticas. Las modificaciones de nucleótidos presentes en un ácido nucleico variante pueden ser silenciosas, lo que significa que no alteran las secuencias de aminoácidos codificadas por dicho ácido nucleico variante.

Sin embargo, los cambios de nucleótidos en un ácido nucleico variante pueden también resultar de sustituciones, adiciones, deleciones en el polipéptido codificado por el ácido nucleico variante con respecto a los péptidos codificados por el ácido nucleico de referencia. Además, unas modificaciones de nucleótidos en las regiones codificantes pueden producir unas sustituciones, conservadoras o no conservadoras, en la secuencia de aminoácidos.

Preferentemente, los ácidos nucleicos variantes según la invención codifican unos polipéptidos que conservan sustancialmente la misma función o actividad biológica que el polipéptido del ácido nucleico de referencia o también la capacidad para ser reconocidos por unos anticuerpos dirigidos contra los polipéptidos codificados por el ácido nucleico inicial.

Algunos ácidos nucleicos variantes codificarán así unas formas mutadas de los polipéptidos cuyo estudio sistemático permitirá deducir unas relaciones estructura actividad de las proteínas en cuestión.

Por "variante" de un polipéptido según la invención, se entenderá principalmente un polipéptido cuya secuencia de aminoácidos contiene una o varias sustituciones, adiciones o deleciones de al menos un residuo de aminoácido, con respecto a la secuencia de aminoácidos del polipéptido de referencia, entendiéndose que las sustituciones de aminoácidos pueden ser indistintamente conservadoras o no conservadas.

Preferentemente, los polipéptidos variantes según la invención conservan sustancialmente la misma función o actividad biológica que el polipéptido de referencia o también la capacidad para ser reconocidos por unos anticuerpos dirigidos contra los polipéptidos iniciales.

Por polipéptido que tiene "una actividad similar" a un polipéptido de referencia, en el sentido de la invención, se entiende un polipéptido que tiene una actividad biológica parecida, pero no necesariamente idéntica, a la del polipéptido de referencia, tal como se mide en un ensayo biológico que es conveniente para la medición de la actividad biológica del polipéptido de referencia.

Descripción detallada de la invención

La presente invención tiene más particularmente por objeto nuevos genes de la ruta de la biosíntesis de las espiramicinas y nuevos polipéptidos implicados en esta biosíntesis, tales como los presentados en la descripción detallada a continuación.

Se han clonado los genes de la ruta de la biosíntesis y se ha determinado la secuencia de ADN de estos genes. Las secuencias obtenidas se analizaron gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Se han identificado, entre los marcos de lectura abiertos, los marcos de lectura abiertos que presentan un uso de los codones típicos de

Streptomyces. Este análisis ha mostrado que esta región comprende 44 ORFs, localizadas a ambos lados de cinco genes que codifican la enzima «policétido sintasa» (PKS), y que presentan un uso de los codones típicos de

Streptomyces. A ambos lados de estos cinco genes que codifican la PKS, se han identificado respectivamente 10 y 34 ORFs secuencia abajo y secuencia arriba (estando la secuencia abajo y la secuencia arriba definidas por la orientación de los 5 genes de PKS, todos orientados en el mismo sentido) (véanse las figuras 3 y 37). Así, los 34 marcos de lectura abiertos de este tipo, que ocupan una región de aproximadamente 41,7 kb (véase la SEC ID nº 1 que presenta una primera región de 31 kb que contiene 25 ORFs y SEC ID nº 140 que presenta una región de aproximadamente 12,1 kb de los cuales 1,4 kb solapan la secuencia anterior (SEC ID nº 1) y aproximadamente 10,7 kb corresponden a la continuación de la secuencia, conteniendo esta última parte de aproximadamente 10,7 kb, 9 ORFs suplementarios (incluyendo un ORF de secuencia parcial), véanse también las figuras 3 y 37 y a continuación), se identificaron secuencia arriba de los 5 genes que codifican la PKS y 10 que ocupan una región de aproximadamente 11,1 kb (SEC ID nº 2 y figura 3), se identificaron secuencia debajo de los genes de la PKS. Los 10 genes situados secuencia abajo de los 5 genes PKS se denominaron así orf1*c, orf2*c, orf3*c, orf4*c, orf5*, orf6*, orf7*c, orf8*, orf9*, orf10* (SEC ID nº 3, 5, 7, 9, 11, 13, 15, 17, 19 y 21). Significando la «c» añadida en el nombre del gen para el ORF en cuestión que la secuencia codificante está en la orientación inversa (la hebra codificante es por lo tanto la hebra complementaria de la secuencia dada en la SEC ID nº 2 para estos genes). Utilizando la misma nomenclatura, los 34 ORFs secuencia arriba de los genes de la PKS se denominaron orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14,

orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c, orf25c, orf26, orf27, orf28c, orf29, orf30c, orf31,

orf32c, orf33 y orf34c (SEC ID nº 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 107, 109, 111, 113, 115, 118, 120, 141, 143, 145, 147 y 149) (véanse las figuras 3 y 37).

Las secuencias proteicas deducidas de estos marcos de lectura abiertos se han comparado con los presentes en las diferentes bases de datos gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- search, COGs (Cluster of Orthologous Groups) (estos tres programas están accesibles, en particular, en National Center for Biotechnology Information (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), BEAUTY (Worley K. C. et al., 1995)), (estos dos programas están accesibles, en particular, en el centro de recursos INFOBIOGEN, Evry, Francia). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los susceptibles de estar implicados en la biosíntesis de las espiramicinas.

Genes situados secuencia abajo de los genes que codifican las PKS Una representación esquemática de la organización de la región está presentada en la figura 3. Así como se demuestra a continuación, los 10 genes identificados secuencia abajo de los genes que codifican las PKS 9 parecen implicados en la biosíntesis o la resistencia a las espiramicinas. Se trata de los 9 genes siguientes: orf1*c, orf2*c, orf3*c, orf4*c, orf5*, orf6*, orf7*c, orf8* y orf9*.

En la tabla 1 siguiente, se presentan las referencias a la secuencia en ADN y en aminoácidos de los 10 genes identificados secuencia abajo de los 5 genes PKS.

Tabla 1 Gen Posición en la secuencia SEC ID nº 2 Secuencia de ADN Secuencias polipeptídicas

orf1*c

10882 a 10172 SEC ID nº 3 SEC ID nº 4

orf2*c

10052 a 8781 SEC ID nº 5 SEC ID nº 6

orf3*c

8741 a 7476 SEC ID nº 7 SEC ID nº 8

orf4*c

7459 a 6100 SEC ID nº 9 SEC ID nº 10

orf5*

5302 a 5976 SEC ID nº 11 SEC ID nº 12

orf6*

4061 a 5305 SEC ID nº 13 SEC ID nº 14

orf7*c

3665 a 2817 SEC ID nº 15 SEC ID nº 16

orf8*

1925 a 2755 SEC ID nº 17 SEC ID nº 18

orf9* 1007 a 1888 SEC ID nº 19 SEC ID nº 20

orf10* 710 a 937 SEC ID nº 21 SEC ID nº 22 La «c» añadida en el nombre del gen indica que la secuencia codificante está en la orientación inversa (la hebra codificante es por lo tanto la hebra complementaria de la secuencia dada en la SEC ID nº 2 para estos genes).

Con el objetivo de determinar la función de los polipéptidos identificados, se han llevado a cabo tres tipos de experimentos: la comparación de las secuencias identificadas con unas secuencias de funciones conocidas, unos experimentos de inactivación de genes, que conducen a la construcción de cepas mutantes, y unos análisis de la producción de espiramicinas y de intermedios de biosíntesis de las espiramicinas por estas cepas mutantes.

Las secuencias proteicas deducidas de estos marcos de lectura abiertos se han comparado en primer lugar con las presentes en las diferentes bases de datos gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al.,

1997), CD-search, COGs (Cluster of Orthologous Groups), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W.

R., 1990), BEAUTY (Worley K. C. y ad., 1995)). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los susceptibles de estar implicados en la biosíntesis de espiramicina. La tabla 2 muestra las proteínas que presentan una fuerte similitud con los productos de 10 genes situados secuencia abajo de los 5 genes PKS.

Tabla 2 Producto Proteína que presenta una Número de Puntuación Función señalada de gen similitud significativa acceso GenBank BLAST*

orf1*c

TylMI(orf3*) (S.fradiae) CAA57473 287 N-metiltransferasa

orf2*c

Producto genético dnrQ AAD 15266 153 Desconocida (Streptomyces peucetius)

orf3*c

TylMII(orf2*) (S. fradiae) CAA57472 448 Glicosiltransferasa

orf4*c

Crotonil-CoA reductasa (S.

NP_630556 772 Crotonil-CoA reductasa

coelicolor)

orf5*

MdmC (S. mycarofaciens) B42719 355 O-metiltransferasa

orf6* 3-O-aciltransferasa (S.

Q00718 494 Aciltransferasa

mycarofaciens)

orf7*c

MdmA (S. mycarofaciens) A60725 380 Proteína implicada e la resistencia a la midecamicina

orf8* Transportador ABC (S. griseus) CAC22119 191 Transportador ABC

orf9* Transportador ABC (S. griseus) CAC22118 269 Transportador ABC

orf10*

Proteína hipotética conservada NP_627432 109 Desconocida pequeña putativa (S. coelicolor) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se han realizado unos experimentos de inactivación de genes para confirmar estos resultados. Los métodos utilizados consisten en efectuar una sustitución de gen. El gen diana a interrumpir es sustituido por una copia de este gen interrumpido por un casete que confiere la resistencia a un antibiótico (por ejemplo la apramicina, la geneticina o la higromicina). Los casetes utilizados están bordeados a ambos lados por unos codones de terminación de la traducción en todos los marcos de lectura y por unos terminadores de transcripción activos en Streptomyces. La inserción del casete en el gen diana puede acompañarse o no de una deleción en este gen diana. El tamaño de las regiones que flanquean el casete puede ir de algunos centenares hasta varios millares de pares de bases. Un segundo tipo de casetes puede ser utilizado para la inactivación de genes: unos casetes denominados "casetes excindibles". Estos casetes presentan la ventaja de poder ser escindidos de Streptomyces por un evento de recombinación específica del sitio después de haber sido introducidos en el genoma de S. ambofaciens. El objetivo es inactivar algunos genes en unas cepas de Streptomyces sin dejar en la cepa final ningún marcador de selección o grandes secuencias de ADN que no pertenezcan a la cepa. Después de la escisión, subsiste únicamente una corta secuencia de una treintena de pares de bases (denominado sitio "cicatricial") en el genoma de la cepa (véase la figura 10). La realización de este sistema consiste, en una primera fase, en la sustitución de la copia salvaje del gen diana (gracias a dos eventos de recombinación homólogos, véase la figura 9) por una construcción en la que un casete escindible se ha insertado en este gen diana. La inserción de este casete está acompañada de una deleción en el gen diana (véase la figura 9). En una segunda fase, se provoca la escisión del casete escindible del genoma de la cepa. El casete escindible funciona gracias a un sistema de recombinación específica del sitio y tiene como ventaja permitir la obtención de mutantes de

Streptomyces que no tiene finalmente ningún gen de resistencia. Se libra también de eventuales efectos polares sobre la expresión de los genes situados secuencia abajo del o de los genes inactivados (véase la figura 10). Las cepas así construidas se ensayaron para su producción en espiramicinas.

La inactivación de los genes orf1*c, orf2*c, orf3*c y orf4*c no se ha efectuado ya que los experimentos de comparación de secuencia han permitido determinar que estos genes tenían una similitud relativamente importante con unos genes implicados en la biosíntesis de un antibiótico relativamente similar. Así, el gen orf1*c codifica una proteína que presenta una identidad del 66% (determinada gracias al programa BLAST) con la proteína codificada por el gen tylMI que codifica una N-metiltransferasa implicada en la biosíntesis de tilosina y que cataliza la 3 N-metilación durante la producción de micaminosa en Streptomyces fradiae (Gandecha,A.R. et al., 1997; Número de acceso GenBank: CAA57473; puntuación BLAST: 287). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico relativamente similar y más particularmente en la biosíntesis de la micaminosa, sugiere que el gen orf1*c codifica una N- metiltransferasa responsable de una N-metilación durante la biosíntesis de la forosamina o de la micaminosa (véanse las figuras 5 y 6). Esta hipótesis está apoyada por el hecho de que la proteína codificada por el gen gen orf1*c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 3).

Tabla 3 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* Metiltransferasa (S. antibioticus) CAA05643 277 Metiltransferasa N,N-dimetiltransferasa (S. venezuelae) AAC68678 268 N,N- dimetiltransferasa probable N-metilasa snogX (S. nogalater) T46679 243 N-metiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf2*c codifica una proteína que presenta una fuerte similitud relativa (35% de identidad) con una proteína codificada por el gen tylMIII que codifica una NDP hexosa 3,4 isomerasa implicada en la biosíntesis de la tilosina de

Streptomyces fradiae (Gandecha,A.R., et al., 1997; Número de acceso GenBank: CAA57471; Puntuación BMAST: 130). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar y más particularmente en la biosíntesis de la micaminosa sugiere fuertemente que el gen orf*2c codifica una NDP hexosa 3,4 isomerasa responsable de la isomerización de la biosíntesis de uno de los azúcares de la espiramicina, eventualmente la micaminosa (véanse las figuras 5 y 6).

El gen orf3*c codifica una proteína que presenta una fuerte similitud relativa (59% de identidad) con una proteína codificada por el gen tylMII que codifica una glicosiltransferasa implicada en la biosíntesis de la tilosina de Streptomyces

fradiae (Gandecha, A.R. et al., 1997; Número de acceso GenBank: CAA57472; Puntuación BLAST: 448). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico parecido sugiere fuertemente que el gen orf*3c codifica una glicosiltransferasa. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf3*c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 4).

Tabla 4 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Glicosil transferasa (S. venezuelae) AAC68677 426 Glicosiltransferasa Glicosiltransferasa (S. antibioticus) CAA05642 425 Glicosiltransferasa Glicosiltransferasa (Saccharopolyspora

CAA74710 395 Glicosiltransferasa

erythraea) Glicosiltransferasa (S. antibioticus) CAA05641 394 Glicosiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf4*c codifica una proteína que presenta una fuerte similitud relativa con varias crotonil-CoA reductasas. En particular, la proteína codificada por orf4*c posee una similitud importante con una crotonil CoA reductasa de Streptomyces coelicolor (Redenbach,M et al., 1996; Número de acceso GenBank: NP_630556; Resultado BLAST: 772). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf4*c codifica también una crotonil-CoA reductasa. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf4*c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 5).

Tabla 5 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* trans-2-enoil-CoA reductasa (EC1.3.1.38) (S.

S72400 764 trans-2-enoil-CoA

collinus) reductasa Crotonil CoA reductasa (S.fradiae) CAA57474 757 Crotonil CoA reductasa Crotonil-CoA reductasa (S. cinnamonensis) AAD53915 747 Crotonil-CoA reductasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf6* presenta una cierta similitud con el gen mdmB presente en Streptomyces mycarofaciens (Hara y Hutchisnson, 1992; número de acceso GenBank: A42719; Puntuación BLAST: 489) productor de antibiótico macrólido.

En este productor, el gen está implicado en la acilación del anillo lactona. El gen orf6* codificaría por lo tanto una aciltransferasa. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf6* presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 6).

Tabla 6 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST*

AcyA (Streptomyces thermotolerans) J4001 450 macrólido 3-O- aciltransferasa Midecamicina 4"-O-propionil transferasa (S.

BAA09815 234 Midecamicina 4"-O-propionil

mycarofaciens) transferasa Micarosa O-aciltransferasa (Micromonospora

AAG13909 189 Micarosa O-aciltransferasa

megalomicea sub sp. Nigra) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

La inactivación del gen orf6* se ha realizado mediante una deleción/inserción en fase, y se ha demostrado que la cepa resultante no produce más espiramicina II y III, sino únicamente espiramicina I (véase la figura 1). Esto confirma que el gen orf6* está muy implicado en la síntesis de espiramicina II y III. La enzima codificada por este gen es responsable de la formación de espiramicina II y III por fijación de un grupo acetilo o butirilo sobre el carbono 3. Las cepas que no expresan más la proteína codificada por el gen orf6* son particularmente interesantes ya que no producen más espiramicina II y III, sino sólo espiramicina I. Como ya se ha precisado anteriormente, la actividad antibiótica de la espiramicina I es claramente superior a la de las espiramicinas II y III (Liu et al., 1999).

El gen orf5* codifica una proteína que presenta una fuerte similitud relativa con varias O-metiltransferasa. En particular, la proteína codificada por orf5* posee una similitud importante con una O-metiltransferasa (EC 2.1.1.-) MdmC de Streptomyces mycarofaciens (Hara & Hutchinson, 1992; Número de acceso GenBank: B42719; Puntuación BLAST: 355). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico sugiere fuertemente que el gen orf5* codifica también una O-metiltransferasa. El gen orf5* estaría implicado en la formación de precursores incorporados en el anillo lactona. En efecto, según las comparaciones de secuencias, el producto del gen orf5* es también relativamente similar a FkbG, que es responsable de la metilación del hidroximalonil-ACP siguiente (Wu et al., 2000; Hoffmeister et al., 2000; Número de acceso GenBank: AAF86386; Puntuación BLAST: 247) (véase la figura 8).

Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf5* presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 7).

Tabla 7 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Probable O-metiltransferasa (EC 2.1.1.-) safC T18553 223 O-metiltransferasa (Myxococcus xanthus) 4-O-metiltransferasa (EC 2.1.1.-)-(Streptomyces sp.) JC4004 222 O-metiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Gracias al efecto polar de la inserción de un casete no escindido en el gen orf 6*, se ha podido determinar que el gen orf5* es esencial para la ruta de la biosíntesis de las espiramicinas. En efecto, la inserción del casete escindible en la parte codificante del gen orf6* conlleva una detención total de la producción de espiramicinas. Sin embargo, una vez que el casete insertado se ha escindido (y por lo tanto cuando sólo el gen orf6* está inactivado, véanse los ejemplos 14 y 15), se reencuentra una producción de espiramicina I. Esto muestra que el gen orf5* es esencial para la ruta de la biosíntesis de las espiramicinas ya que su inactivación conlleva una detención total de la producción de espiramicinas.

El gen orf5* codifica una proteína que presenta una fuerte similitud relativa con varias O-metiltransferasa. El gen orf5*

sería una O-metil transferasa implicada o bien directamente en la síntesis del platenólido, o bien en la síntesis de un precursor metilado (metoximalonilo, véase la figura 8) incorporado en el platenólido por la PKS. Para verificar esta hipótesis, se han llevado a cabo unos experimentos de análisis CL/SM y de RMN sobre una cepa de S. ambofaciens de genotipo: orf6*::att1Ωhyg+. En esta cepa, el gen orf5* no está expresado a causa del efecto polar de la inserción, en el gen orf6*, del casete que contiene unos terminadores de transcripción (véase el ejemplo 27). Se ha mostrado que esta cepa produce una molécula cuyo espectro UV tiene una apariencia similar a la de la espiramicina I, pero el espectro de masa muestra un ión molecular en 829. La diferencia de masa de 14 con respecto a la masa de la espiramicina puede explicarse por la ausencia de metilo en el oxígeno portado por el carbono n° 4 del anillo lactona (la estructura de este compuesto se presenta en la figura 39). Los resultados obtenidos por RMN son compatibles con esta hipótesis. La presencia de un compuesto en 829 permite validar la hipótesis del papel de orf5* en la biosíntesis de las espiramicinas.

Además, el producto que corresponde a la espiramicina sin el grupo metilo presenta una muy baja actividad microbiológica (más baja de un factor 10) con respecto a la espiramicina no modificada, cuando se ensaya en el microorganismo Micrococcus luteus.

El gen orf7*c codifica una proteína que presenta una fuerte similitud relativa con una proteína codificada por el gen

mdmA de Streptomyces mycarofaciens, codificando este último una proteína implicada en la resistencia a la midecamicina en este organismo productor (Hara et al., 1990; Número de acceso GenBank: A60725; Puntuación BLAST: 380). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico sugiere fuertemente que el gen orf7*c codifica también una proteína implicada en la resistencia a la espiramicina. Más particularmente, la enzima codificada por el gen orf7*c posee una actividad metiltransferasa y está implicada en la resistencia a la espiramicina en Streptomyces ambofaciens. Se ha demostrado que este gen confiere una resistencia de tipo MLS I, resistencia de la cual se sabe que es debida a la mono-metilación en la posición A2058 del ARN ribosomal 23S (Pernodet et al., 1996). Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf7*c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 8).

Tabla 8 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Resitencia determinante al macrólido-lincosamida- JC5319 238 ARNr 23S estreptogramina B (S. fradiae) metiltransferasa ARN ribosomal 23S metiltransferasa ErmML AAL68827 119 ARNr 23S (Micrococcus luteus) metiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf8* codifica una proteína que presenta una fuerte similitud relativa con una proteína de tipo transportador ABC en Streptomyces griseus (Campelo, 2002, Número de acceso GenBank: CAC22119; Puntuación BLAST: 191). Esta similitud con una proteína de tipo transportador ABC sugiere fuertemente que el gen orf8* codifica también una proteína de tipo transportador ABC que puede estar implicada en la resistencia a la espiramicina. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf8* presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 9).

Tabla 9 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* AcrW (Streptomyces galilaeus) BAB72060 94 Transportador ABC Proteína de transmembrana de resistencia a la P32011 89 Resistencia a la Daunorrubicina (Streptomyces peucetius) daunorrubicina Probable transportador ABC, componente NP_626506 89 Transportador ABC transmembranal (Streptomyces coelicolor) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf9* codifica una proteína que presenta una fuerte similitud relativa con una proteína de tipo transportador ABC en Streptomyces griseus (Campelo, 2002, Número de acceso GenBank: CAC22118; Puntuación BLAST: 269). Esta similitud con una proteína de tipo transportador ABC sugiere fuertemente que el gen orf9* codifica también una proteína de tipo transportador ABC que puede estar implicada en la resistencia a la espiramicina. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf8* presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 10).

Tabla 10 Proteína que presenta una similitud significativa Número de acceso Resultado Función GenBank BLAST* señalada Probable proteína de transporte de tipo ABC, NP_626505 231 Transportador componente de unión a ATP (S. coelicolor) ABC Transportador ABC putativo, componente de unión a ATP NP_627624 228 Transportador (Streptomyces Coelicolor) ABC * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf10* codifica una proteína que presenta una fuerte similitud relativa con una proteína de función desconocida. Sin embargo se encuentran unos genes similares a orf10* en medio de varios grupos de genes implicados en la biosíntesis de antibióticos. Así, un gen similar a orf10* se encuentra en S. coelicolor (Redenbach et al., 1996, número de acceso GenBank: NP_627432, puntuación BLAST: 109). Se encuentra también un gen parecido (CouY) en S. rishiriensis (Wang et al., 2000, número de acceso GenBank: AAG29779, puntuación BLAST 97).

Genes situados secuencia arriba de los genes que codifican las PKS En la secuencia de ADN situada secuencia arriba de los genes que codifican las PKS (estando secuencia abajo y secuencia arriba definidas por la orientación de los 5 genes de PKS orientados todos en el mismo sentido) (véase la figura 3), se han identificado 34 ORFs (véase anteriormente). Así, los 34 marcos de lectura abiertos de este tipo, que ocupan una región de aproximadamente 41,7 kb (véase la SEC ID nº 1 que presenta una primera región de 31 kb que contiene 25 ORFs y SEC ID nº 140 que presenta una región de aproximadamente 12,1 kb de los cuales 1,4 kb solapan la secuencia anterior (SEC ID nº 1) y aproximadamente 10,7 kb corresponden a la continuación de la secuencia), conteniendo esta última parte, de aproximadamente 10,7 kb, 9 ORFs suplementarios (incluyendo un ORF de secuencia parcial), véase también las figuras 3 y 37 y a continuación). Una representacion esquemática de la organización de la región se presenta en las figuras 3 y 37. Los 34 genes identificados se han denominado: orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf1l6, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c, orf25c, orf26, orf27, orf28c, orf29, orf30c, orf31, orf32c, orf33 y orf34c.

En la tabla 11 siguiente, se presentan las referencias a la secuencia en ADN y en aminoácidos de los 34 genes identificados secuencia arriba de los 5 genes PKS.

Tabla 11 Gen1 Posición en la secuencia SEC ID nº 1 Secuencia de ADN Secuencia(s) polipeptídica(s)2

orf1

658 a 1869 SEC ID nº 23 SEC ID nº 24

orf2

1866 a 2405 SEC ID nº 25 SEC ID nº 26 y 27

orf3

2402 a 3568 SEC ID nº 28 SEC ID nº 29

orf4

3565 a 4473 SEC ID nº 30 SEC ID nº 31, 32 y 33

orf5

4457 a 5494 SEC ID nº 34 SEC ID nº 35

orf6

5491 a 6294 SEC ID nº 36 SEC ID nº 37, 38 y 39

orf7

6296 a 7705 SEC ID nº 40 SEC ID nº 41 y 42

orf8

8011 a 9258 SEC ID nº 43 SEC ID nº 44

orf9c

10081 a 9362 SEC ID nº 45 SEC ID nº 46

orf10

10656 a 12623 SEC ID nº 47 SEC ID nº 48

orf11c

14482 a 12734 SEC ID nº 49 SEC ID nº 50, 51 y 52

orf12

14601 a 16031 SEC ID nº 53 SEC ID nº 54, 55, 56, 57, 58 y 59

orf13c

17489 a 16092 SEC ID nº 60 SEC ID nº 61

orf14

17809 a 18852 SEC ID nº 62 SEC ID nº 63

orf15c

20001 a 18961 SEC ID nº 64 SEC ID nº 65

orf16

20314 a 21552 SEC ID nº 66 SEC ID nº 67

orf17

21609 a 22879 SEC ID nº 68 SEC ID nº 69

orf18

22997 a 24175 SEC ID nº 70 SEC ID nº 71

orf19

24177 a 25169 SEC ID nº 72 SEC ID nº 73

orf20

25166 a 26173 SEC ID nº 74 SEC ID nº 75

orf21c

27448 a 26216 SEC ID nº 76 SEC ID nº 77

orf22c

28560 a 27445 SEC ID nº 78 SEC ID nº 79

orf23c

29770 a 28649 SEC ID nº 80 SEC ID nº 81

orf24c

30074 a 29763 SEC ID nº 82 SEC ID nº 83

orf25c

30937 a 30071 SEC ID nº 84 SEC ID nº 85 Gn1 Posición en la secuencia SEC ID nº 140 Secuencia de ADN Secuencia(s) polipeptídica(s)2

orf26

1647 a 2864 SEC ID nº 107 SEC ID nº 108

orf27

2914 a 3534 SEC ID nº 109 SEC ID nº 110

orf28c

4967 a 3804 SEC ID nº 141 SEC ID nº 142

orf29

5656 a 6663 SEC ID nº 113 SEC ID nº 114

orf30c

7723 a 6686 SEC ID nº 115 SEC ID nº 116 y 117 7534 a 6686 SEC ID nº 143 SEC ID nº 144

orf31

7754 a 8728 SEC ID nº 118 SEC ID nº 119

orf32c

10488 a 8977 SEC ID nº 145 SEC ID nº 146 Gen1 Posición en la secuencia SEC ID nº 1 Secuencia de ADN Secuencia(s) polipeptídica(s)2

orf33

10562 a 10837 SEC ID nº 147 SEC ID nº 148

orf34c

12134 a 10899 SEC ID nº 149 SEC ID nº 150 1 La «c» añadida en el nombre del gen indica que la secuencia codificante está en la orientación inversa (la hebra codificante es por lo tanto la hebra complementaria de la secuencia dada en la SEC ID nº 1 o SEC ID nº 140 para estos genes).

2 Cuando varias secuencias proteicas están indicadas para un solo orf, las proteínas correspondientes proceden de varios sitios posibles de inicio de la traducción.Con el objetivo de determinar la función de los polipéptidos identificados en la tabla 11 anterior, se han llevado a cabo tres tipos de experimentos: la comparación de la identidad de las secuencias identificadas con unas secuencias de funciones conocidas, unos experimentos de inactivación de genes y unos análisis de la producción de espiramicinas de estas cepas mutantes.

Se han comparado en primer lugar las secuencias proteicas deducidas de estos marcos de lectura abiertos con los presentes en diferentes bases de datos, gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD-search, COGs (Cluster of Orthologous Groups), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W.

R., 1990), BEAUTY (Worley K. C. et al., 1995)), (véase anteriormente). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los suscpetibles de estar implicados en la biosíntesis de la espiramicina. La tabla 12 muestra las proteínas que presentan una fuerte similitud con los 34 genes situados secuencia arriba de los 5 genes PKS.

Tabla 12 Gen Proteína que presenta una similitud Número de Puntuación Función señalada significativa acceso GenBank BLAST*

orf1

Citocroma P450 tylI (Streptomyces

S49051 530 Citocroma P450

fradiae)

orf2

ORF15x4 (Listonella anguillarum) AAB81630 113 Desconocida

orf3

Proteína similar a la aminotransferasa AAF59939 431 Amino-transferasa (Streptomyces antibioticus)

orf4

alfa-D-glucosa-1-fosfatotimidilil AAC68682 404 alfa-D-glucosa-1-fosfato transferasa (Streptomyces venezuelae) timidililtransferasa

orf5

AprE (Streptomyces tenebrarius) AAG18457 476 dTDP-glucosa 4,6- deshidratasa

orf6

Tioesterasa (Streptomyces avermitilis) BAB69315 234 Tioesterasa

orf7

TylCVI (Streptomyces fradiae) AAF29379 461 dNTP hexosa 2,3- deshidratasa

orf8

probable aminotransferasa AAG23279 465 Aminotransferasa (Saccharopolyspora spinosa)

orf9c

SrmX (Streptomyces ambofaciens) S25204 445 Metiltransferasa

orf10

SrmR (Streptomyces ambofaciens) S25203 1074 Proteína de regulación

orf11c

SrmB (Streptomyces ambofaciens) S25202 955 Resistencia a la espiramicina

orf12

UrdQ (Streptomyces fradiae) AAF72550 634 NDP-hexosa 3,4-deshidratasa

orf13c

SC4H2.17 (Streptomyces coelicolor) T35116 619 Desconocida

orf14

Reductasa putativa (Streptomyces

CAB90862 147 Reductasa

coelicolor)

orf15c

Probable 3-cetorreductasa T51102 285 3-cetorreductasa (Streptomyces antibiotics) Gen Proteína que presenta una similitud Número de Puntuación Función señalada significativa acceso GenBank BLAST*

orf16

NDP hexosa 3,4 isomerasa hipotética CAA57471 209 NDP-hexosa 3,4 isomerasa (Streptomyces fradiae)

orf17

Glicosil transferasa (Streptomyces

AAC68677 400 Glicosiltransferasa

venezuelae)

orf18

Glicosil transferasa (Streptomyces

AAG29785 185 Glicosiltransferasa

rishiriensis)

orf19

NDP-hexosa 4-cetorreductasa TylCIV AAD41822 266 NDP-hexosa 4-cetorreductasa (Streptomyces fradiae)

orf20

EryBII (Saccharopolyspora erythraea) AAB84068 491 aldocetorreductasa

orf21c

TylCIII (Streptomyces fradiae) AAD41823 669 NDP-hexosa 3-C- metiltransferasa

orf22c

FkbH (Streptomyces hygroscopicus) AAF86387 463 Implicada en la biosíntesis del metoximalonilo

orf23c

FkbI (Streptomyces hygroscopicus) AAF86388 387 Acil-CoA deshidrogenasa

orf24c

FkbJ (Streptomyces hygroscopicus) AAF86389 87 Implicada en la biosíntesis del metoximalonilo

orf25c

FkbK (Streptomyces hygroscopicus) AAF86390 268 Acil-CoA deshidrogenasa

orf26

TylCV (Streptomyces fradiae) AAD41824 471 Micarosil-transferasa

orf27

TylCVII (Streptomyces fradiae) AAD41825 243 NDP-hexosa 3,5-(o 5-) epimerasa

orf28c

AcyB2 (Streptomyces thermotolerans) JC2032 451 Proteína reguladora

orf29

Beta-mananasa (Sorangium cellulosum) AAK19890 139 Glicosil-hidrolasa

orf30c

Epimerasa de azúcar-nucleósido- NP 600590 89 Epimerasa de azúcar- difosfato (Corynebacterium glutamicum) nucleósido-difosfato

orf31

Oxidorreductasa (Streptomyces

NP_631148 261 Oxidorreductasa

coelicolor)

orf32c

Proteína reguladora de la familia GntR NP_824604 282 Proteína reguladora (Streptomyces avermitilis)

orf33

Proteína hipotética (Xanthomonas

NP_635564 54 Desconocida

campestris)

orf34c

Arabinofuranosidasa (Streptomyces

NP_630049 654 Arabinofuranosidasa

coelicolor) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se han realizado unos experimentos de inactivación de genes para confirmar estos resultados. Los métodos utilizados consisten en efectuar una sustitución de gen. El gen diana a interrumpir se sustituye por una copia de este gen interrumpido por un casete que confiere la resistencia a un antibiótico (por ejemplo la apramicina o la higromicina). Los casetes utilizados están bordeados a ambos lados por unos codones de terminación de la traducción en todos los marcos de lectura y por unos terminadores de transcripción activos en Streptomyces. La inserción del casete en el gen diana puede acompañarse o no de una deleción en este gen diana. El tamaño de las regiones que flanquean el casete puede ir de algunos centenares a varios millares de pares de bases. Se puede utilizar un segundo tipo de casetes para la inactivación de genes: unos casetes denominados «casetes escindibles» (véase anteriormente). Las cepas así construidas se ensayaron para su producción en espiramicinas.

El gen orf1 codifica una proteína que presenta una fuerte similitud relativa con varias citocromas P450. En particular, la proteína codificada por orf1 posee una similitud importante con la proteína codificada por el gen tylI implicada en la biosíntesis de tilosina de Streptomyces fradiae (Merson-Davies, L.A. et al., 1994; Número de acceso GenBank: S49051; Puntuación BLAST: 530). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf1 codifica también una citocroma P450. Esta hipótesis está apoyada en el hecho de que la proteína codificada por el gen orf1 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 13).

Tabla 13 Proteína que presenta una similitud significativa Número de acceso Resultado Función señalada GenBank BLAST* Putativa citocroma P450 YJIB (Bacillus subtilis)

O34374 248 Citocroma P450 Citocroma P450 113A1 (Saccharopolyspora

P48635 237 Citocroma P450

erythraea) Citocroma P-450 hidroxilasa homóloga AAC46023 208 Citocroma P-450

(Streptomyces caelestis)

hidroxilasa Citocroma P450 monooxigenasa (Streptomyces

AAC64105 206 Citocroma P450 mono-

venezuelae) oxigenasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf2 codifica una proteína que presenta una fuerte similitud relativa con una dTDP-6-desoxi-3,4-ceto-hexulosa isomerasa de Aneurinibacillus thermoaerophilus (Pfoestl, A. et al., 2003, Número de acceso GenBank: AAO06351; Puntuación BLAST: 118). Esta similitud sugiere fuertemente que el gen orf2 codifica una isomerasa responsable de la reacción de isomerización necesaria para la biosíntesis de uno de los azúcares presentes en la molécula de espiramicina, pudiendo este azúcar ser la micarosa (véase la figura 5). Se ha realizado la inactivación del gen orf2. Se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf2 está muy implicado en la biosíntesis de las espiramicinas.

El gen orf3 codifica una proteína que presenta una fuerte similitud relativa con varias aminotransferasas. En particular, la proteína codificada por orf3 posee una similitud importante con una aminotransferasa de Streptomyces antibioticus implicada en la biosíntesis de la oleandomicina (Draeger,G., et al., 1999; Número de acceso GenBank: AAF59939; Puntuación BLAST: 431). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf3 codifica una 3 amino-transferasa responsable de la reacción de transaminación necesaria para la biosíntesis de uno de los azúcares aminados de las espiramicinas (véase la figura 5). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf3 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 15).

Tabla 15 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST*

Aminotransferasa (Streptomyces antibioticus) T51111 429 Aminotransferasa Transaminasa (Streptomyces venezuelae)

AAC68680 419 Transaminase * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha realizado la inactivación del gen orf3. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf3 está muy implicado en la biosíntesis de las espiramicinas. La enzima codificada por este gen es por lo tanto muy responsable de una etapa de bioconversión esencial para la biosíntesis de las espiramicinas. La producción de espiramicinas puede ser complementada por la expresión de la proteína TylB de S. fradiae (véase el ejemplo 23). Esto demuestra que el gen orf3 codifica una 3 amino-transferasa responsable de la reacción de transaminación necesaria para la biosíntesis de micaminosa (véase la figura 5). Como la micaminosa es el primer azúcar a ser fijado sobre el platenólido, se espera que la cepa interrumpida en orf3 (OS49.67) acumule platenólido.

Se han estudiado los intermedios de biosíntesis de la cepa interrumpida en el gen orf3 (véase el ejemplo 20). Estos experimentos han permitido demostrar que esta cepa produce dos formas de platenólido: el platenólido A y el platenólido B, la estructura deducida de estas dos moléculas se presenta en la figura 36. Esta cepa produce también un platenólido A + micarosa y un platenólido B + micarosa (véase el ejemplo 20 y la figura 40). Estos compuestos comprenden un azúcar, pero no comprenden micaminosa. Además, si se les compara con la espiramicina (véase la figura 1), estos compuestos comprenden micarosa en lugar de la micaminosa. Estos resultados son consistentes con la implicación del producto del gen orf3 en la biosíntesis de la micaminosa y su papel como 3 amino-transferasa responsable de la reacción de transaminación necesaria para la biosíntesis de la micaminosa (véase la figura 5). Se puede observar que la especificidad de glicosilación no parece absoluta ya que se encuentran unas moléculas con la micarosa fijada a la posición normalmente ocupada por la micaminosa (véase la figura 40).

El gen orf4 codifica una proteína que presenta una fuerte similitud relativa con varias NDP-glucosa sintetasas. En particular, la proteína codificada por orf4 posee una similitud importante con una alfa-D-glucosa-1-fosfato timidililtransferasa de Streptomyces venezuelae (Xue Y et al., 1998; Número de acceso GenBank: AAC68682; Puntuación BLAST 404). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf4 codifica una NDP-glucosa sintetasa responsable de la síntesis de la NDP-glucosa necesaria para la biosíntesis de los tres azúcares atípicos incorporados en la molécula de espiramicina (véanse las figuras 4, 5 y 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf4 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 16).

Tabla 16 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Glucosa-1-fosfato timidiltransferasa BAA84594 402 Glucosa-1-fosfato

(Streptomyces avermitilis)

timidiltransferasa AclY (Streptomyces galilaeus)

BAB72036 400 dTDP-1-glucosa sintetasa Putativa glucosa-1-fosfato timidiltransferasa AAK83289 399 glucosa-1-fosfato (Saccharopolyspora spinosa) timidiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf5 codifica una proteína que presenta una fuerte similitud relativa con varias glucosa deshidratasas. En particular, la proteína codificada por orf5 posee una similitud importante con una dTDP-glucosa 4,6-deshidratasa de Streptomyces tenebrarius (Li,T.B. et al., 2001; Número de acceso GenBank: AAG18457, Puntuación BLAST: 476). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen

orf5 codifica una NDP glucosa deshidratasa necesaria para la biosíntesis de los tres azúcares atípicos incorporados en la molécula de espiramicina (véanse las figuras 4, 5 y 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf5 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 17).

Tabla 17 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* DTDP-glucosa 4,6-deshidratasa AAK83290 464 DTDP-glucosa 4,6- (Saccharopolyspora spinosa) deshidratasa timidina difosfoglucosa 4,6-deshidratasa AAA68211 445 timidina difosfoglucosa 4,6-

(Saccharopolyspora erythraea)

deshidratasa dTDPglucosa 4,6-deshidratasa (EC 4.2.1.46) - S49054 443 dTDPglucosa 4,6-

(Streptomycesfradiae)

deshidratasa TDP-glucosa-4,6-deshidratasa

(Streptomyces

AAC68681 421 TDP-glucosa-4,6-

venezuelae)

deshidratasa SgcA (Streptomyces globisporus)

AAF13998 418 dNDP-glucosa-4,6- deshidratasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf6 codifica una proteína que presenta una fuerte similitud relativa con varias tioesterasas. En particular, la proteína codificada por orf6 posee una similitud importante con una tioesterasa de Streptomyces avermitilis (Omura,S. et al., 2001; Número de acceso GenBank: BAB69315; Puntuación BLAST: 234). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf6 codifica también una tioesterasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf6 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 18).

Tabla 18 Proteína que presenta una similitud significativa Número de acceso Puntuación Función GenBank BLAST* señalada RifR (Amycolatopsis mediterranei) AAG52991 216 Tioesterasa Tioesterasa - (Streptomyces fradiae) S49055 215 Tioesterasa Tioesterasa (Streptomyces avermitilis) BAB69188 213 Tioesterasa Tioesterasa II (EC 3.1.2.-) - (Streptomyces

T17413 203 Tioesterasa

venezuelae)

Proteína PimI (Streptomyces natalensis)

CAC20922 201 Tioesterasa Tioesterasa (Streptomyces griseus)

CAC22116 200 Tioesterasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf7 codifica una proteína que presenta una fuerte similitud relativa con varias hexosa deshidratasas. En particular, la proteína codificada por orf7 posee una similitud importante con una dNTP hexosa 2,3-deshidratasa (codificada por el gen TylCVI) de Streptomyces fradiae implicada en la biosíntesis de la tilosina (Merson-Davies, L.A. et al., 1994; Número de acceso GenBank: AAF29379; Puntuaicón BLAST: 461). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf7 codifica también una hexosa 2-3 deshidratasa necesaria para la biosíntesis de dos azúcares atípicos incorporados en la molécula de espiramicina (véanse las figuras 4 y 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf7 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 19).

Tabla 19 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* Rif18 (Amycolatopsis mediterranei)

AAG52988 459 Hexosa deshidratasa SimB3 (Streptomyces antibioticus)

AAK06810 444 dNDP-4-ceto-6-desoxi-glucosa-2,3- deshidratasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf8 codifica una proteína que presenta una fuerte similitud relativa con varias aminotransferasas. En particular, la proteína codificada por orf8 posee una similitud importante con una aminotransferasa probablemente implicada en la biosíntesis de la forosamina de Saccharopolyspora spinosa (Waldron,C. et al., 2001; Número de acceso GenBank: AAG23279; puntuación BLAST: 465). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf8 codifica una 4 amino-transferasa responsable de la reacción de transaminación necesaria para la biosíntesis de la forosamina (véase la figura 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf8 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 20).

Tabla 20 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* Proteína de biosíntesis de amino-azúcar CAA07666 213 Proteína implicada en la putativa (Bordetella bronchiseptica) biosíntesis de amino-azúcares * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha realizado la inactivación del gen orf8. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf8 está muy implicado en la biosíntesis de las espiramicinas. La enzima codificada por este gen es por lo tanto muy responsable de una etapa de bioconversión esencial para la biosíntesis de las espiramicinas. La validación de la hipótesis del papel desempeñado por el producto del gen orf8 en la biosíntesis de la forosamina es aportada por el hecho de que un mutante inactivado para el gen orf8 produce forocidina, este mutante está por lo tanto bloqueado en la etapa de la forocidina y no produce neo-espiramicina (véase la figura 7 y el ejemplo 25). Estos resultados son consistentes con una implicación del producto del gen orf8 en la biosíntesis de forosamina (véase la figura 6).

Ya se ha identificado el gen orf9c en Streptomyces ambofaciens y ha sido designad como srmX por Geistlich et al. (Geistlich, M., et al., 1992). La similitud de la proteína codificada por este gen con varias metiltransferasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que el gen or9c codifica una metiltransferasa responsable de la reacción de metilación necesaria para la biosíntesis de la micaminosa o de la forosamina (véanse las figuras 5 y 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf9c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 21).

Tabla 21 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* N,N-dimetiltransferasa

(Streptomyces

AAC68678 240 N,N-

venezuelae)

dimetiltransferasa Metiltransferasa (Streptomyces antibioticus)

CAA05643 232 Metiltransferasa aminometilasa putativa

(Streptomyces

AAF01819 219 Aminometilasa

nogalater) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Ya se ha identificado el gen orf10 de Streptomyces ambofaciens y ha sido designado como srmR por Geistlich et al.

(Geistlich, M., et al., 1992). La proteína codificada por este gen está implicada en la regulación de la ruta de la biosíntesis de las espiramicinas en Streptomyces ambofaciens. Se ha realizado la inactivación del gen orf10. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf10 está muy implicado en la biosíntesis de las espiramicinas. La proteína codificada por este gen es por lo tanto muy esencial para la biosíntesis de las espiramicinas.

Por otro lado, se ha determinado el punto de inicio de la traducción de orf 10 y se ha podido demostrar que la sobreexpresión de este gen provocaba una mejora de la producción de espiramicinas. El sitio de inicio de la traducción corresponde a un ATG situado secuencia arriba del ATG propuesta por Geistlich et al. (Geistlich, M., et al., 1992). Además, se ha demostrado que este extremo 5' es esencial para la función de Orf10, ya que un mensajero truncado en 5' es inactivo (véase el ejemplo 17). Para obtener el efecto buscado en la producción de espiramicinas, es por lo tanto esencial que la sobreexpresión de orf10 se realice teniendo cuidado de no expresar un mensajero truncado en 5' de orf10.

Ya se ha identificado el gen orf11c en Streptomyces ambofaciens y ha sido designado como srmB por Geistlich et al.

(Geistlich, M. et al., 1992) y Schoner et al. (Schoner B et al., 1992). La proteína codificada por este gen está implicada en la resistencia a la espiramicina de Streptomyces ambofaciens y es un transportador de tipo ABC.

El gen orf12 codifica una proteína que presenta una fuerte similitud relativa con varias hexosa deshidratasas. En particular, la proteína codificada por orf12 posee una similitud importante con una NDP-hexosa 3,4-deshidratasa codificada por el gen UrdQ de Streptomyces fradiae e implicada en la biosíntesis de la urdamicina (Hoffmeister, D. et al.,

2000; Número de acceso GenBank: AAF72550; Puntuación BLAST: 634). Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico similar sugiere fuertemente que el gen orf12 codifica una 3,4-deshidratasa responsable de la reacción de deshidratación necesaria para la biosíntesis de la forosamina (véase la figura 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf12 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 22).

Tabla 22 Proteína que presenta una similitud significativa Número de Puntuación Función señalada acceso GenBank BLAST* AknP (Streptomyces galilaeus)

AAF73452 625 3-deshidratasa NDP-hexosa 3,4-deshidratasa homóloga AAD13547 624 NDP-hexosa 3,4-

(Streptomyces cyanogenus) deshidratasa RdmI (Streptomyces purpurascens) AAL24451 608 Hexosa-C-3-deshidratasa Probable CDP-4-ceto-6-desoxiglucosa-3- T46528 602 CDP-4-ceto-6- deshidratasa (E1) (Streptomyces violaceoruber)

desoxiglucosa-3- deshidratasa Probable NDP-hexosa-3,4-deshidratasa AAG23278 582 NDP-hexosa-3,4- (Saccharopolyspora spinosa) deshidratasa dNTP-hexosa deshidratasa (Amycolatopsis

AAC01730 576 dNTP-hexosa deshidratasa

mediterranei) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha realizado la inactivación del gen orf12. Se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf12 está muy implicado en la biosíntesis de la espiramicina. La enzima codificada por este gen es por lo tanto muy responsable de una etapa de bioconversión esencial para la biosíntesis de la espiramicina. La validación de la hipótesis del papel desempeñado por Orf12 en la biosíntesis de la forosamina es aportada por el hecho de que un mutante inactivado para el gen orf12 no produce más forosamina. Produce, sin embargo, una baja cantidad de forocidina. Este mutante está por lo tanto bloqueado en la etapa de la forocidina y no produce neo-espiramicina (véase la figura 7 y el ejemplo 26). Este mutante produce además un compuesto de estructura presentada en la figura 38. Este último compuesto comprende dos azúcares, la micaminosa y la micarosa, pero no comprende forosamina. Además, si se le compara con la estructura de la espiramicina (véase la figura 1), este compuesto comprende el azúcar micarosa en el lugar esperado de la forosamina. Estos resultados son consistentes con la implicación del producto del gen orf12 en la biosíntesis de la forosamina (véase la figura 6). Se puede observar que la especificidad de glicosilación no es absoluta, ya que se observan unas moléculas en las que la micarosa está fijada en la posición normalmente ocupada por la forosamina (véase la figura 38).

El gen orf13c codifica una proteína que presenta una fuerte similitud relativa con una proteína de función desconocida de Streptoinyces coelicolor. Esta proteína se ha denominado SC4H2.17 (número de acceso GeneBank: T35116; Puntuación BLAST: 619). La proteína codificada por el gen orf13c presenta también una fuerte similitud con otras proteínas de otros organismos (véase la tabla 23).

Tabla 23 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Proteína hfIX (Mycobacterium leprae)

S72938 473 Desconocida Posible proteína de union a ATP/GTP NP_301739 470 Proteína fijadora de (Mycobacterium leprae)

ATP/GTP Proteína de union al GTP (Mycobacterium

AAK47114 468 Proteína fijadora de GTP

tuberculosis CDC1551) Proteína de union a ATP/GTP (Streptomyces

T44592 388 Proteína fijadora de

fradiae) ATP/GTP * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

No se ha asignado ninguna función precisa a las proteínas simialres a la codificada por orf13c. La inactivación del gen orf13c se realizó con el objetivo de estudiar la función de este gen en la ruta de la biosíntesis de las espiramicinas de Streptomyces ambofaciens. Se ha podido demostrar que la cepa resultante produce espiramicinas. Esto indica que el gen orf13c no es esencial para la biosíntesis de las espiramicinas y que no es esencial para la supervivencia de la bacteria. La enzima codificada por este gen no es por lo tanto responsable de una etapa de bioconversión esencial para la biosíntesis de las espiramicinas.

El gen orf14 codifica una proteína que presenta una fuerte similitud relativa con una reductasa putativa (Redenbach,M., et al., 1996; Bentley et al., 2002; número de acceso GenBank: CAB90862; Puntuación BLAST: 147).

Se ha realizado la inactivación del gen orf14. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf14 está muy implicado en la biosíntesis de las espiramicinas. La enzima codificada por este gen es por lo tanto muy responsable de una etapa de bioconversión esencial para la biosíntesis de las espiramicinas. Se han estudiado los intermedios de biosíntesis de la cepa interrumpida en el gen orf14 (véase el ejemplo 20). Estos experimentos han permitido demostrar que esta cepa produce platenólido A pero no produce platenólido B (véase la figura 36).

El gen orf15c codifica una proteína que presenta una fuerte similitud relativa con varias cetorreductasas. En particular, la proteína codificada por orf15c posee una similitud importante con una 3-cetorreductasa de Streptomyces antibioticus (Número de acceso GenBak: T51102, Puntuación BLAST: 285). Esta similitud sugiere fuertemente que el gen orf15c codifica una 3 ceto-reductasa responsable de la reacción de reducción necesaria para la biosíntesis de la forosamina (véase la figura 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf15c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 24).

Tabla 24 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* oxidorreductasa homóloga

(Streptomyces

AAD13550 272 Oxidorreductasa

cyanogenus) D-oliosa 4-cetorreductasa (Streptomyces

CAB96550 265 D-oliosa 4-

argillaceus) cetorreductasa AknQ (Streptomyces galilaeus)

AAF73453 263 3-cetorreductasa putative Probable NDP-hexosa-3-cetorreductasa AAG23275 253 NDP-hexosa-3-

(Saccharopolyspora spinosa)

cetorreductasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf16 codifica una proteína que presenta una fuerte similitud relativa con varias isomerasas. En particular, la proteína codificada por orf16 posee una similitud importante con una NDP hexosa 3,4 isomerasa de Streptomyces fradiae (Gandecha et al., 1997; Número de acceso GenBak: CAA57471, Puntuación BLAST: 209). Esta similitud sugiere fuertemente que el gen orf16 codifica una proteína implicada en la biosíntesis de uno de los azúcares de la espiramicina (véanse las figuras 5 y 6). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf16 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 25).

Tabla 25 Proteína que presenta una similitud significativa Número de acceso Resultado Función señalada GenBank BLAST* tautomerasa putativa (Streptomyces venezuelae)

AAC68676 145 Tautomerasa TDP-4-ceto-6-desoxihexosa 3,4-isomerasa AAG13907 112 TDP-4-ceto-6-

(Micromonospora megalomicea subsp. nigra) desoxihexosa 3,4- isomerasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf17 codifica una proteína que presenta una fuerte similitud relativa con varias glicosil transferasas. En particular, la proteína codificada por orf17 posee una similitud importante con una glicosil transferasa de Streptomyces venezuelae (Xue, Y. et al., 1998; Número de acceso GenBank: AAC68677; puntuación BLAST: 400). La similitud de la proteína codificada por el gen orf17 con varias glicosil transferasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica también una glicosil transferasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf17 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 26).

Tabla 26 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Glicosiltransferasa (Streptomyces fradiae) CAA57472 399 Glicosiltransferasa Glicosiltransferasa (Streptomyces antibioticus) CAA05642 378 Glicosiltransferasa Glicosiltransferasa (Streptomyces antibioticus) CAA05641 360 Glicosiltransferasa Glicosiltransferasa (Saccharopolyspora

CAA74710 344 Glicosiltransferasa

erythraea) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf18 codifica una proteína que presenta una fuerte similitud relativa con varias glicosil transferasas. En particular, la proteína codificada por orf18 posee una similitud importante con una glicosil transferasa de Streptomyces rishiriensis (Wang et al., 2000; Número de acceso GenBank: AAG29785; puntuación BLAST: 185). La similitud de la proteína codificada por el gen orf18 con varias glicosil transferasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica también una glicosil transferasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf18 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 27).

Tabla 27 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* NovM (Streptomyces spheroides) AAF67506 184 Glicosiltransferasa probable glicosil transferasa

(Streptomyces

T46519 169 Glicosiltransferasa

violaceoruber) Glicosil transferasa homóloga

(Streptomyces

AAD13553 167 Glicosiltransferasa

cyanogenus) Glicosil transferasa homóloga

(Streptomyces

AAD13555 163 Glicosiltransferasa

cyanogenus) dNTP-hexosa glicosil transferasa (Amycolatopsis

AAC01731 160 Glicosiltransferasa

mediterranei) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf19 codifica una proteína que presenta una fuerte similitud relativa con varias cetorreductasas. En particular, la proteína codificada por orf19 posee una similitud importante con una NDP-hexosa 4-cetorreductasa (TylCIV) de Streptomyces fradiae (Bate et al., 2000; Número de acceso GenBank: AAD41822; puntuación BLAST: 266). La similitud de la proteína codificada por el gen orf19 con esta cetorreductasa implicada en la ruta de la biosíntesis de un antibiótico similar sugiere fuertemente que este gen codifica también una 4-cetorreductasa responsable de la reacción de reducción necesaria para la biosíntesis de la micarosa (véase la figura 4). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf19 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 28).

Tabla 28 Proteína que presenta una similitud significativa Número de Puntuación Función señalada acceso GenBank BLAST* NDP-4-ceto-6-desoxihexosa 4-cetorreductasa AAL14256 251 NDP-4-ceto-6-desoxihexosa

(Streptomyces venezuelae)

4-cetorreductasa EryBIV (Saccharopolyspora erythraea)

AAB84071 249 oxidorreductasa TDP-4-ceto-6-desoxihexosa 4-cetorreductasa AAG13916 218 TDP-4-ceto-6-desoxihexosa (Micromonospora megalomicea subsp. Nigra) 4-cetorreductasa dTDP-4-ceto-6-desoxi-L-hexosa 4-reductasa BAA84595 212 dTDP-4-ceto-6-desoxi-L- (Streptomyces avermitilis) hexosa 4-reductasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf20 codifica una proteína que presenta una fuerte similitud relativa con varias hexosa reductasas. En particular, la proteína codificada por orf20 posee una similitud importante con el gen EryBII de Saccharopolyspora erythraea que codifica una dTDP-4-ceto-L-6-desoxi-hexosa 2,3-reductasa (Summers, R.G., et al., 1997), Número de acceso GenBank: AAB84068; Puntuación BLAST: 491). La similitud de la proteína codificada por el gen orf20 con varias hexosa reductasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica una 2-3 reductasa responsable de la reacción de reducción necesaria para la biosíntesis de la micarosa (véase la figura 4). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf20 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 29).

Tabla 29 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* TylCII (Streptomyces fradiae)

AAD41821 464 NDP-hexosa 2,3-enoil reductasa TDP-4-ceto-6-desoxihexosa 2,3-reductasa AAG13914 446 TDP-4-ceto-6-desoxihexosa (Micromonospora megalomicea subsp. Nigra)

2,3-reductasa dTDP-4-ceto-6-desoxi-L-hexosa 2,3-reductasa BAA84599 377 dTDP-4-ceto-6-desoxi-L-

(Streptomyces avermitilis) hexosa 2,3-reductasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf21c codifica una proteína que presenta una fuerte similitud relativa con varias hexosa metiltransferasas. En particular, la proteína codificada por orf21c posee una similitud importante con el gen TylCIII de Streptomyces fradiae

que codifica una NDP-hexosa 3-C-metiltransferasa (Bate, N et al., 2000; Número de acceso GenBank: AAD41823; Puntuación BLAST: 669). La similitud de la proteína codificada por el gen orf21c con varias hexosa metiltransferasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica una hexosa metiltransferasa responsable de la reacción de metilación necesaria para la biosíntesis de la micarosa (véase la figura 4). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf21c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 30).

Tabla 30 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* EryH (Saccharopolyspora erythraea)

228448 592 Gen de biosíntesis de la eritromicina Metiltransferasa dependiente de S-adenosilo AAK71270 358 Metiltransferasa

(Coxiella burnetii)

NovU (Streptomyces spheroides)

AAF67514 184 C-metiltransferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf22c codifica una proteína que presenta una fuerte similitud relativa con la proteína codificada por el gen fkbH de Streptomyces hygroscopicus var. ascomyceticus que codifica una enzima implicada en la biosíntesis del metoximalonilo (Wu,K. et al., 2000; Número de acceso GenBank: AAF86387; Puntuación BLAST: 463). La similitud de la proteína codificada por el gen orf22c con esta proteína implicada en la ruta de la biosíntesis de otro macrólido similar sugiere fuertemente que este gen codifica también una enzima implicada en la biosíntesis du metoximalonilo en

Streptomyces ambofaciens (véase la figura 8).

El gen orf23c codifica una proteína que presenta una fuerte similitud relativa con la proteína codificada por el gen fkbI de Streptomyces hygroscopicus var. ascomyceticus que codifica una acil CoA deshidrogenasa implicada en la biosíntesis del metoximalonilo (Wu,K. et al., 2000; Número de acceso GenBank: AAF86388; Puntuación BLAST 387). La similitud de la proteína codificada por el gen orf23c con varias acil CoA deshidrogenasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica una acil CoA deshidrogenasa implicada en la biosíntesis du metoximalonilo (véase la figura 8). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf23c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 31).

Tabla 31 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Acil-CoA deshidrogenasa

(Polyangium

AAK19892 171 Acil-CoA

cellulosum)

deshidrogenasa Probable acil-CoA deshidrogenasa - T36802 160 acil-CoA (Streptomyces coelicolor) deshidrogenasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf24c codifica una proteína que presenta una fuerte similitud relativa con la proteína codificada por el gen fkbJ de

Streptomyces hygroscopicus var. ascomyceticus que codificaría la proteína de unión del grupo acilo (Acil Carrier Protein (ACP)) implicada en la biosíntesis del metoximalonilo (Wu,K., et al., 2000; Número de acceso GenBank: AAF86389; Puntuación BLAST: 87). La similitud de la proteína codificada por el gen orf24c con esta proteína implicada en la ruta de la biosíntesis de otro macrólido similar sugiere fuertemente que este gen codifica una proteína implicada en la biosíntesis del metoximalonilo en Streptomyces ambofaciens (véase la figura 8).

El gen orf25c codifica una proteína que presenta una fuerte similitud relativa con la proteína codificada por el gen fkbK de Streptomyces hygroscopicus var. ascomyceticus que codifica una acil CoA deshidrogenasa implicada en la biosíntesis del metoximalonilo (Wu,K., et al., 2000; Número de acceso GenBank: AAF86390; puntuación BLAST: 268). La similitud de la proteína codificada por el gen orf25c con varias acil CoA deshidrogenasas implicadas en la ruta de la biosíntesis de otros antibióticos similares sugiere fuertemente que este gen codifica una acil CoA deshidrogenasa implicada en la biosíntesis del metoximalonilo (véase la figura 8). Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf25c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 32).

Tabla 32 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* Probable 3-Hidroxibutiril-CoA Deshidrogenasa P45856 177 3-Hidroxibutiril-CoA (Bacillus subtilis) deshidrogenasa Proteína 3-hidroxibutiril-CoA deshidrogenasa AAL32270 174 3-Hidroxibutiril-CoA

(Bacillus thuringiensis serovar kurstaki) deshidrogenasa 3-hidroxibutiril-CoA deshidrogenasa (Deinococcus

NP_294792 167 3-Hidroxibutiril-CoA

radiodurans) deshidrogenasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf26 codifica una proteína que presenta una identidad del 65% (determinada gracias al programa BLAST) con la proteína codificada por el gen tylCV que codifica una micarosil transferasa implicada en la biosíntesis de tilosina en Streptomyces fradiae (Bate, N. et al., 2000; Número de acceso GenBank: AAD41824, Puntuación BLAST: 471). Más particularmente, TylCV es una glicosil-transferasa que une la molécula de micarosa durante la síntesis de la tilosina. Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico relativamente similar y más particularmente en la transferencia de la micarosa, sugiere que el gen orf26 codifica una glicosil transferasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf26 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 33).

Tabla 33 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* Glicosil transferasa (Streptomyces avermitilis)

BAA84592 218 Glicosil transferasa CalG4 (Micromonospora echinospora)

AAM70365 217 Glicosil transferasa CalG2 (Micromonospora echinospora) AAM70348 197 Glicosil transferasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El gen orf27 codifica una proteína que presenta una identidad del 70% (determinada gracias al programa BLAST) con la proteína codificada por el gen tylCVII que codifica una NDP-hexosa 3,5- (o 5-) epimerasa implicada en la biosíntesis de tilosina en Streptomyces fradiae (Bate, N. et al., 2000; Número de acceso GenBank: AAD41825, Puntuación BLAST: 243). Más particularmente, TylCVII es una hexosa 3,5- (o 5-) epimerasa implicada en la biosíntesis de la micarosa. Esta similitud con una proteína implicada en la ruta de la biosíntesis de otro antibiótico relativamente similar, y más particularmente en la biosíntesis de la micarosa, sugiere que el gen orf27 codifica una epimerasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf27 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 34). Un análisis de las secuencias similares obtenidas gracias al programa BLAST sugiere fuertemente que el gen orf27 codifica una 5 epimerasa responsable de la reacción de epimerisación necesaria para la biosíntesis de la micarosa (véase la figura 4).

Tabla 34 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* LanZ1 (Streptomyces cyanogenus) AAD13558 172 NDP-hexosa 3,5-epimerasa Epi (Saccharopolyspora spinosa) AAK83288 169 TDP-4-ceto-6-desoxiglucosa 3,5 epimerasa dNTP-hexosa 3,5 epimerasa AAC01732 166 dNTP-hexosa 3,5 epimerasa (Amycolatopsis mediterranei) * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha determinado en primer lugar la secuencia de orf28c de manera parcial, ya que la secuencia de una región de aproximadamente 450 pares de bases se determinó sólo después de la resecuenciación (esta región está simbolizada por unas «N» en la secuecia incompleta SEC ID nº 106). La secuencia parcial de este ORF (SEC ID nº 111) se utilizó no obstante para el análisis con los diferentes programas informáticos, como se ha explicado anteriormente. Se ha podido determinar así que el gen orf28c codifica una proteína que presenta una identidad del 64% sobre la secuencia determinada (SEC ID nº 112, que es la secuencia parcial de la proteína Orf28c) (determinada gracias al programa BLAST) con la proteína codificada por el gen acyB2 que codifica una proteína reguladora implicada en la biosíntesis de carbomicina en Streptomyces thermotolerans (Arisawa,A., et al., 1993; Número de acceso GenBank: JC2032, Puntuación BLAST: 329). Esta similitud con una proteína implicada en la ruta de la biosíntesis de un antibiótico relativamente similar sugiere que el gen orf28c codifica una proteína reguladora implicada en la biosíntesis de las espiramicinas. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf28c presenta también una fuerte similitud con la proteína TylR que es una proteína reguladora implicada en la biosíntesis de tilosina en

Streptomyces fradiae (Bate, N. et al., 1999; Número de acceso GenBank: AAF29380, Puntuación BLAST: 167).

Se ha podido amplificar el gen orf28c gracias a unos oligonucleótidos situados a ambos lados de la secuencia no determinada, y subclonado en un vector de expresión. Así, se ha podido demostrar que la sobreexpresión del gen orf28c aumenta significamente la producción en espiramicinas de la cepa OSC2 (véase el ejemplo 24). Esto demuestra que la sobreexpresión de orf28c conduce a un aumento de la producción en espiramicinas y confirma su papel como regulador de la ruta de la biosíntesis de las espiramicinas.

Se ha completado después la secuencia parcial de orf28c, y se ha determinado la región que falta de aproximadamente 450 pares de bases (véanse la SEC ID nº 140 y SEC ID nº 141). Se ha utilizado la secuencia completa de este ORF (SEC ID nº 141) para el análisis con los diferentes programas informáticos, como se ha explicado anteriormente. Se ha podido determinar así que el gen orf28c codifica una proteína que presenta una identidad del 69% sobre la secuencia determinada (SEC ID nº 142, que es la secuencia completa de la proteína Orf28c) (determinada gracias al programa BLAST) con la proteína codificada por el gen acyB2 que codifica una proteína reguladora implicada en la biosíntesis de carbomicina en Streptomyces thermotolerans (Arisawa, A., et al., 1993; Número de acceso GenBank: JC2032, Puntuacion BLAST: 451). Esta similitud con una proteína implicada en la regulación de la biosíntesis de un antibiótico relativamente similar sugiere que el gen orf28c codifica una proteína reguladora implicada en la biosíntesis de las espiramicinas. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf28c presenta también una fuerte similitud con la proteína TylR, que es una proteína reguladora implicada en la regulación de la biosíntesis de tilosina en Streptomyces fradiae (Bate,N. et al., 1999; Número de acceso GenBank: AAF29380, Puntuación BLAST: 224). Los resultados de la sobreexpresión de este gen (véase el ejemplo 24) confirman su papel como regulador de la ruta de la biosíntesis de las espiramicinas.

Se ha realizado la inactivación del gen orf28c. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf28c está muy implicado en la biosíntesis de las espiramicinas y es esencial para la biosíntesis de las espiramicinas. Estos resultados asociados a los resultados de la sobreexpresión de este gen (véase el ejemplo 24) son consistentes con un papel de activador esencial para la biosíntesis de las espiramicinas de Orf28c.

El gen orf29 codifica una proteína que presenta una identidad del 31% (determinada gracias al programa BLAST) con una probable glicosil hidrolasa localizada en el grupo de genes implicado en la biosíntesis de sorafeno A (un antifúngico de la clase de los policétidos) en Sorangium cellulosum (Ligon, J., et al., 2002; Número de acceso GenBank: AAK19890, Puntuación BLAST: 139). Esta similitud con una proteína implicada en la ruta de la biosíntesis de una molécula relativamente similar sugiere que el gen orf29 codifica una proteína que tiene una actividad glicosil hidrolasa. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf29 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 35). Un análisis de la secuencia de la proteína codificada por orf29 gracias al programa CD-search (véase anteriormente) sugiere también que el gen orf29 codifica una glicosil hidrolasa.

Tabla 35 Proteína que presenta una similitud significativa Número de acceso Puntuación Función señalada GenBank BLAST* ManA (Caldicellulosiruptor saccharolyticus) AAC44232 136 beta-1,4-mananasa ManA (Dictyoglomus thermophilum) AAB82454 129 beta-mananasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

El análisis de la secuencia proteica deducida de orf29 por el programa SignalP (http://www.cbs.dtu.dk/services/SignalP/) (Nielsen, H., et al., 1997) muestra que esta proteína posee una secuencia señal C-terminal con un sitio de escisión predicho entre las posiciones 30 y 31 (QSA/QA). Se puede predecir que esta proteína es extra-celular. Podría, al tiempo que la glicosil-hidrolasa, tener un papel en la reactivación de la espiramicina inactivada por glicosilación por las glicosil- transferasas GimA y/o GimB (Gourmelen et al., 1998).

El gen orf30c codifica una proteína que presenta una identidad del 31% (determinada gracias al programa BLAST) con una epimerasa de azúcar-nucleósido-difosfato de Corynebacterium glutamicum (Número de acceso GenBank: NP_600590, Puntuación BLAST: 89). Esta similitud sugiere que el gen orf30c codifica una epimerasa. Esta hipótesis se apoya en el hecho de que un análisis de la secuencias gracias al programa CD-search (véase anteriormente) sugiere también que el gen orf30c codifica una epimerasa.

El orf30c presenta dos codones de inicio posibles (véase la SEC ID nº 115) que dan dos proteínas posibles de 345 y 282 aminoácidos respectivamente (SEC ID nº 116 y 117). Sin embargo, el uso de codones es típico de Streptomyces sólo a partir del segundo ATG, además, la secuencia proteica deducida de la secuencia entre el primer ATG y el segundo no se alinea con las secuencias similares identificadas, mientras que la secuencia proteica más corta (a partir del 2º ATG: SEC ID nº 144) se alinea bien con el principio de estas proteínas. Por lo tanto, se puede deducir de ello que el segundo ATG es el buen codón de inicio y que la secuencia de este orf es por lo tanto la presentada en la SEC ID nº 143 que, una vez traducida, corresponde a la proteína de la secuencia SEC ID nº 144.

El gen orf31 codifica una proteína que presenta una identidad del 52% (determinada gracias al programa BLAST) con una oxidorreductasa en Streptomyces coelicolor (Número de acceso GenBank: NP_631148, Puntuación BLAST: 261).

Esta similitud sugiere que el gen orf31 codifica una reductasa. Esta hipótesis se apoya en el hecho de que un análisis de la secuencias gracias al programa CD-search (véase anteriormente) sugiere también que el gen orf31 codifica una reductasa. Esta hipótesis se apoya también en el hecho de que la proteína que codificada el gen orf31 presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 36).

Tabla 36 Proteína que presenta una similitud significativa Número de acceso Puntuación Función GenBank BLAST* señalada oxidorreductasa putative (Streptomyces griseus) BAB79295 173 Oxidorreductasa MocA (Xanthomonas axonopodis) NP_640644 171 Oxidorreductasa * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha realizado la inactivación del gen orf31. Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas. Esto confirma que el gen orf31 está muy implicado en la biosíntesis de las espiramicinas. La enzima codificada por este gen es por lo tanto muy responsable de una etapa de bioconversión esencial para la biosíntesis de las espiramicinas.

Se ha determinado en primer lugar la secuencia de orf32c de manera parcial (véase el ejemplo 19), ya que la secuencia codificante en 5' se ha determinado sólo en una segunda etapa. La secuencia parcial de este orf (SEC ID nº 120) se utilizó, no obstante, para el análisis con los diferentes programas informáticos, como se ha explicado anteriormente. Se ha podido determinar así que el gen orf32c codifica una proteína que presenta una identidad del 47% sobre la secuencia determinada (SEC ID nº 121, que es la secuencia parcial de la proteína Orf32c) (determinada gracias al programa BLAST) con una proteína reguladora de la familia GntR en Streptomyces coelicolor (Número de acceso GenBank: NP_625576, Puntuación BLAST: 229). Esta similitud sugiere que el gen orf32c codifica un regulador transcripcional de la familia GntR. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen orf32c presenta una fuerte similitud con otras proteínas de función similar en otros organismos.

Después, se ha completado la secuencia parcial de orf32c y se ha determinado la región que falta (véanse las SEC ID nº 140 y SEC ID nº 145). La secuencia completa de este orf codifica una proteína que presenta una identidad del 44% (determinada gracias al programa BLAST) con una proteína reguladora de la familia GntR en Streptomyces avermitilis

(Número de acceso GenBank: NP_824604, Puntuación BLAST: 282). Esta similitud sugiere que el gen orf32c codifica un regulador transcripcional de la familia GntR. Esta hipótesis se apoya en el hecho de que la proteína codificada por el gen

orf32c presenta una fuerte similitud con otras proteínas de función similar en otros organismos (véase la tabla 37).

Tabla 37 Proteína que presenta una similitud Número de acceso Puntuación Función señalada significativa GenBank BLAST* Proteína reguladora de la familia GntR NP_828241 270 Proteína reguladora de la (Streptomyces avermitilis) familia GntR Proteína reguladora de la familia GntR NP_625576 266 Proteína reguladora de la

Streptomyces coelicolor) familia GntR SC5G8.04 (Streptomyces coelicolor) NP_628991 258 Proteína reguladora de la familia GntR Regulador transcripcional (Streptomyces AAF01064 224 Regulador transcripcional

venezuelae) Proteína reguladora de la familia GntR NP_827432 239 Proteína reguladora de la (Streptomyces avermitilis) familia GntR * una mayor similitud de secuencia está asociada a una puntuación BLAST más elevada (Altschul et al., 1990).

Se ha realizado la inactivación del gen orf32c con el objetivo de estudiar la función de este gen en la ruta de la biosíntesis de las espiramicinas en Streptomyces ambofaciens. Se ha podido demostrar que la cepa resultante produce espiramicinas. Esto indica que el gen orf32c no es esencial para la biosíntesis de las espiramicinas y que no es esencial para la supervivencia de la bacteria.

El gen orf33 codifica una proteína que presenta una identidad del 49% (determinada gracias al programa BLAST) con una proteína hipotética de Xanthomonas campestris (Número de acceso GenBank: NP_635564, Puntuación BLAST: 54).

La secuencia de orf34c es parcial. En efecto, las comparaciones efectuadas entre el producto de este orf y los bancos de datos sugieren que la parte C-terminal de esta proteína no está en el producto deducido de la secuencia nucleotídica y, por lo tanto, que este orf sería más larga y seguiría fuera de la región secuenciada. Sin embargo, la secuencia parcial de este ORF se ha utilizado para el análisis con los diferentes programas informáticos, como se ha explicado anteriormente. Se ha podido determinar así que el gen orf34c codifica una proteína que presenta una identidad del 91% sobre la secuencia determinada (SEC ID nº 150, que es la secuencia parcial de la proteína Orf34c) (determinada gracias al programa BLAST) con una arabinofuranosidasa en Streptomyces coelicolor (Bentley et al., 2002; Número de acceso GenBank: NP_630049, Puntuacion BLAST: 654). En S. coelicolor el gen que codifica esta arabinofuranosidasa no parece implicado en la biosíntesis del metabolito secundario. En S. ambofaciens, este gen no está por lo tanto probablmente implicado en la biosíntesis de espiramicina.

La invención se refiere a un polinucleótido que tiene al menos el 80%, de manera más preferida el 85%, de manera aún más preferida el 90%, de manera todavía más preferida el 95% y de manera muy preferida el 98% de identidad en nucleótidos con un polinucleótido de la SEC ID nº 111 o 141. Preferiblemente, estos dichos polinucleótidos son aislados a partir de una bacteria del género Streptomyces. De manera muy preferida, un polinucleótido según la invención se selecciona del grupo constituido de las secuencias nucleotídicas de las SEC ID nº 111 y 141.

El alineamiento óptimo de las secuencias para la comparación puede realizarse de manera informática con la ayuda de los algoritmos conocidos, por ejemplo los del paquete FASTA (Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), accesible en particular en el centro de recursos INFOBIOGEN, Evry, Francia. A título de ilustración, el porcentaje de identidad de secuencia se podrá determinar con la ayuda del programa LFASTA (Chao K.-M. et al., 1992) o LALIGN (Huang X. y Miller W., 1991). Los programas LFASTA y LALIGN pertenecen al paquete FASTA. LALIGN devuelve los alineamientos locales óptimos: este programa es más riguroso, pero también más lento que LFASTA.

Otro aspecto de la invención se refiere a un polipéptido que resulta de la expresión de una secuencia de ácido nucleico tal como se ha definido anteriormente. Preferiblemente, los polipéptidos según la invención presentan al menos el 80%, de manera más preferida el 85%, de manera aún más preferida el 90%, de manera aún más preferida el 95% y de manera muy preferida el 98% de identidad en aminoácidos con un polipéptido de la SEC ID nº 112 o 142.

Preferiblemente los polipéptidos según la invención están expresados en estado natural por una bacteria del género

Streptomyces. De manera preferida, un polipéptido según la invención se selecciona del grupo constituido de las secuencias polipeptídicas de las SEC ID nº 112 y 142.

El alineamiento óptimo de las secuencias para la comparación se puede realizar de manera informática con la ayuda de algoritmos conocidos, por ejemplo los del paquete FASTA (Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), accesible en particular en el centro de recursos INFOBIOGEN, Evry, Francia. A título de ilustración, el porcentaje de identidad de secuencia se podrá determinar con la ayuda del programa LFASTA (Chao K.-M. et al., 1992) o LALIGN (Huang X. y Miller W., 1991), utilizando los parámetros por defecto tales como se definen por el centro de recursos INFOBIOGEN, Evry, Francia. Los programas LFASTA y LALIGN pertenecen al paquete FASTA. LALIGN devuelve los alineamientos locales óptimos: este programa es más riguroso, pero también más lento que LFASTA.

Otro aspecto de la invención se refiere a un vector. Más preferiblemente, el vector se selecciona entre los bacteriófagos, los plásmidos, los fagémidos, los vectores integrativos, los fósmidos, los cósmidos, los vectores lanzadera, los BAC (Bacterial Artificial Chromosome) o los PAC (P1-derived Artificial Chromosome). A título ilustrativo, se pueden citar como bacteriófagos el fago lambda y el fago M13. Como plásmidos, se pueden citar los plásmidos que se replican en E. coli por ejemplo pBR322 y sus derivados, pUC18 y sus derivados, pUC19 y sus derivados, pGB2 y sus derivados (Churchward G. et al., 1984), pACYC177 (número de acceso GenBank: X06402) y sus derivados, pACYC184 (número de acceso GenBank: X06403) y sus derivados. Se pueden citar también los plásmidos que se replican en Streptomyces como por ejemplo pIJ101 y sus derivados, pSG5 y sus derivados, SLP1 y sus derivados, SCP2* y sus derivados (Kieser et al. 2000). Como fagémidos, se pueden citar, a título ilustrativo, pBluescript II y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, Californie, USA)), pGEM-T y sus derivados (comercializado por la compañía Promega (Madison, Wisconcin, USA)), λZAPII y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, Californie, USA)). Como vectores integrativos se pueden citar a título ilustrativo, los vectores integrativos en Streptomyces como por ejemplo los derivados de SLP1 (Kieser et al., 2000), los derivados de pSAM2 (Kieser et al., 2000), los vectores que utilizan los sistemas de integración de los fagos PhiC31 (Kieser et al., 2000) (por ejemplo pSET152 (Bierman et al., 1992)) o de VWB (Van Mellaert L, et al. 1998), así como los vectores que utilizan el sistema de integración de IS117 (Kieser et al. 2000). Como fósmidos se pueden citar, a título ilustrativo, el fósmido pFOS1 (comercializado por la compañía New England Bioloabs Inc., Beverly, Massachussetts, USA) y sus derivados. Como cósmidos se pueden citar, a título ilustrativo, el cósmido SuperCos y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, California, USA)), el cósmido pWED15 (Wahl et al., 1987) y sus derivados. Como vectores lanzadera se pueden citar, a título ilustrativo, los plásmidos lanzadera de E. coli / Streptomyces como por ejemplo pIJ903 y sus derivados, la serie de plásmidos pUWL, pCAO106, pWHM3, pOJ446 y sus derivados (Kieser et al. 2000), los BAC lanzadera de E. coli / Streptomyces como por ejemplo los descritos en la solicitud de patente WO 01/40497. Como BAC (Bacterial Artificial Chromosome) se puede citar, a título ilustrativo, el BAC pBeloBAC11 (número de acceso GenBank:U51113). Como PAC (P1-derived Artificial Chromosome) se puede citar, a título ilustrativo, el vector pCYPAC6 (número de acceso GenBank: AF133437). De manera muy preferida, un vector según la invención es pSPM75.

Se describe también un sistema de expresión que comprende un vector de expresión apropiado y una célula huésped que permite la expresión de uno o varios polipéptidos tales como los descritos anteriormente en un sistema biológico. Los vectores de expresión según la invención comprenden una secuencia de ácido nucleico que codifica uno o varios polipéptidos tales como los descritos según la invención y pueden estar destinados a la expresión de los diferentes polipéptidos según la invención en diversas células huésped bien conocidas por el experto en la materia. A título de ejemplo, se pueden citar los sistemas de expresión procariota, como los sistemas de expresión en la bacteria E. coli, los sistemas de expresión eucariotas, como el sistema de expresión baculovirus que permite una expresión en unas células de insectos, los sistemas de expresión que permiten una expresión en células de levaduras, los sistemas de expresión que permiten una expresión en células de mamíferos, en particular células humanas. Los vectores de expresión utilisables en tales sistemas son bien conocidos por el experto en la materia, en lo referente a las células procariotas, se pueden citar, a título ilustrativo, los vectores de expresión en E. coli por ejemplo, de la familia pET comercializados por la compañía Stratagene (LaJolla, California, USA), los vectores de la familia GATEWAY comercializados por la compañía Invitrogen (Carlsbad, California, USA), los vectores de la familia pBAD comercializados por la compañía Invitrogen (Carlsbad, California, USA), los vectores de la familia pMAL comercializados por la compañía New England Bioloabs Inc.

(Beverly, Massachussetts, USA), los vectores de expresión inducibles por la ramnosa citados en la publicación Wilms B

et al., 2001 y sus derivados, se pueden citar también los vectores de expresión en Streptomyces como por ejemplo los vectores pIJ4123, pIJ6021, pPM927, pANT849, pANT 850, pANT 851, pANT1200, pANT1201, pANT1202 y sus derivados (Kieser et al., 2000). En lo referente a las células de levaduras, se pueden citar, a título ilustrativo, el vector pESC comercializado por la compañía Stratagene (LaJolla, California, USA). En lo referente al sistema de expresión baculovirus que permite una expresión en células de insectos se pueden citar, a título ilustrativo, el vector BacPAK6 comercializado por la compañía BD Biosciences Clontech, (Palo Alto, California, USA). En lo referente a las células de mamíferos se pueden citar, a título ilustrativo, unos vectores que comprenden el promotor de los genes precoces del virus CMV (Citomegalovirus) (por ejemplo el vector pCMV y sus derivados comercializados por la compañía Stratagene (LaJolla, California, USA), o el promotor de los genes inmediatos (SV40 early promoter) del virus de simio vaculizante SV40 (por ejemplo el vector pSG5 comercializado por la compañía Stratagene (LaJolla, California, USA).

La invención se refiere también a un procedimiento de producción de un polipéptido tal como se describe según la invención, comprendiendo dicho procedimiento las etapas siguientes: a) insertar un ácido nucleico que codifica dicho polipéptido en un vector apropiado; b) cultivar, en un medio de cultivo apropiado, una célula huésped previamente transformada o transfectada con el vector de la etapa a); c) recuperar el medio de cultivo acondicionado o un extracto celular, por ejemplo por sonicación o por choque osmótico; d) separar y purificar dicho polipéptido a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa c); e) llegado el caso, caracterizar el polipéptido recombinante producido.

Un polipéptido recombinante según la invención se puede purificar por el paso sobre una serie apropiada de columnas de cromatografía, según los métodos conocidos por el experto en la técnica y descritos por ejemplo en F. Ausubel et al. (2002). Se puede citar, a título ilustrativo, la técnica del «Tag-Histidina», que consiste en añadir una secuencia corta poli- histidina al polipéptido a producir, pudiendo este último después ser purificado sobre columna de níquel. Un polipéptido según la invención puede ser preparado también mediante las técnicas de síntesis in vitro. A título ilustrativo de tales técnicas, un polipéptido según la invención podrá ser preparado gracias al sistema «rapid translación system (RTS)», comercializado en particular por la compañía Roche Diagnostics France S.A, Meylan, Francia.

Otro aspecto de la invención se refiere a células huésped en las que se ha introducido al menos un polinucleótido y/o al menos un vector de expresión según la invención.

Se describe también un microorganismo que produce la espiramicina I, pero que no produce las espiramicinas II y III. Este microorganismo comprende el conjunto de los genes necesarios para la biosíntesis de la espiramicina I. pero no produce espiramicina II y III por que el gen que comprende la secuencia que corresponde a la SEC ID nº 13 o una de sus variantes, o una de las secuencias derivadas de esta, debido a la degeneración del código genético y que codifica un polipéptido de la secuencia SEC ID nº 14 o una de sus variantes, no está expresado o se ha vuelto inactivo. La inactivación de esta proteína se puede efectuar mediante cualquier método conocido por el experto en la materia, por ejemplo por mutagénesis en el gen que codifica dicha proteína o por la expresión de un ARN anti-sentido complementario del ARN mensajero que codifica dicha proteína, entendiéndose que si la expresión de orf5* está afectada por esta manipulación, será necesario proceder a otra modificación para que el gen orf5* esté correctamente expresado. La mutagénesis se puede efectuar en la secuencia codificante o en una secuencia no codificante, a fin de volver inactiva la proteína codificada o impedir su expresión o su traducción. La mutagénesis se puede efectuar por mutagénesis dirigida, por sustitución del gen o cualquier otro método conocido por el experto en la materia. Las condiciones convenientes de tal mutagénesis pueden, por ejemplo, estar adaptadas según la enseñanza contenida en los trabajos de Kieser, T et al. (2000) y Ausubel et al., 2002. La mutagénesis se puede efectuar in vitro o in situ, por supresión, sustitución, deleción y/o adición de una o varias bases en el gen considerado, o por inactivación génica. El microorganismo se puede obtener también expresando los genes de la ruta de la biosíntesis de la espiramicina sin que estos comprendan el gen que comprende la secuencia SEC ID nº 13 o una de sus variantes o una de las secuencias derivadas de estas, debido a la degeneración del código genético, y que codifica un polipéptido de la secuencia SEC ID nº 14 o una de sus variantes. Preferiblemente, el microorganismo es una bacteria del género Streptomyces. Más preferiblemente, el microorganismo que produce espiramicina I pero que no produce espiramicina II y III se obtiene a partir de un microorganismo de partida que produce las espiramicinas I, II y III. Aún más preferiblemente, el microorganismo se obtiene por mutagénesis en un gen que comprende la secuencia que corresponde a la SEC ID nº 13 o a una de sus variantes o a una de las secuencias derivadas de estas, debido a la degeneración del código genético y que codifica un polipéptido de la secuencia SEC ID nº 14 o una de sus variantes que tenga la misma función. Aún más preferiblemente, esta mutagénesis se efectúa por inactivación génica. De manera preferida el microorganismo se obtiene a partir de una cepa de S. ambofaciens que produce las espiramicinas I, II y III en la que se efectúa una inactivación génica del gen que comprende la secuencia que corresponde a la SEC ID nº 13 o a una de las secuencias derivadas de ésta, debido a la degeneración del código genético. De manera muy preferida, la inactivación génica se efectúa por deleción en fase del gen o de una parte del gen que comprende la secuencia que corresponde a la SEC ID nº 13 o a una de las secuencias derivadas de ésta, debido a la degeneración del código genético. A título ilustrativo, la cepa SPM502 (orf6*::att1, véase el ejemplo 14) se puede citar como un microorganismo que produce la espiramicina I pero que no produce las espiramicinas II y III.

Se describe también un microorganismo qque produce la espiramicina I pero que no produce las espiramicinas II y III tal como se ha descrito anteriormente, caracterizado por que sobreexpresa además: - un gen susceptible de ser obtenido por amplificación en cadena por polimerasa, utilizando el par de cebadores de la secuencia siguiente: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) y 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) y como matriz el cósmido pSPM36 o el ADN total de Streptomyces ambofaciens, más preferiblemente se trata del gen de la secuencia codificante SEC ID nº 141.

Un ejemplo de secuencia de tal gen se da en la SEC ID nº 111 (ADN), sin embargo esta secuencia es parcial ya que no comprende la parte 3' de la secuencia codificante correspondiente. La traducción en proteína de esta parte de secuencia codificante se da en la SEC ID nº 112. El experto en la materia podrá fácilmente completarla, utilizando en particular la enseñanza presentada en el ejemplo 24. La secuencia indeterminada en la SEC ID nº 111 se determinó en una segunda etapa y la secuencia completa de este orf (orf28c) se da en la SEC ID nº 141. La traduccion en proteína de esta secuencia codificante se da en la SEC ID nº 142. Se presenta en el ejemplo 24 un método para clonar el gen orf28c y para fabricar un vector de expresión que permita la expresión de orf28c. Se muestra también en este ejemplo que la sobreexpresión del gen orf28c en la cepa OSC2 conduce a la mejora de la produccion en espiramicinas de esta cepa. La sobreexpresión del gen orf28c se puede obtener aumentando el número de copias de este gen y/o colocando un promotor más activo que el promotor salvaje. De manera preferida, la sobreexpresión de dicho gen se obtiene aportando en el microorganismo una construccion de ADN recombinante, que permita la sobreexpresión de este gen. De manera preferida, esta construcción de ADN recombinante aumenta el número de copias de dicho gen y permite obtener una sobreexpresión de dicho gen. En esta construcción de ADN recombinante, la secuencia codificante del gen puede estar colocada bajo el control de un promotor más activo que el promotor salvaje. Se puede citar a título de ilustración el promotor ptrc activo en Streptomyces ambofaciens (Amann, E. et al., 1988) así como el promotor ermE*. Así, de manera preferida, la o las copias del gen orf28c aportada, están colocadas bajo el control del promotor ermE* como es el caso en la construcción pSPM75 (véase el ejemplo 24).

Otro aspecto de la invención se refiere a la utilización de una secuencia nucleotídica según la invención para mejorar la producción de espiramicina de un microorganismo. Así, la invencion se refiere a un microorganismo mutante productorde espiramicina, caracterizado por que sobreexpresa al menos un gen que comprende una secuencia tal como la definida según la invención. Así, la sobreexpresión del gen considerado se puede obtener aportando en un microorganismo productor de espiramicina una construccion de ADN recombinante según la invención, que permite la sobreexpresión de este gen. En efecto, algunas etapas de la biosíntesis de la espiramicina son limitantes y si se expresan una o varias proteínas más activas o un nivel de expresión más importante de la o de las proteínas salvajes implicadas en estas etapas limitantes, se puede mejorar la producción de la espiramicina. Un aumento de la cantidad de producción de la tilosina se obtuvo, por ejemplo, en Streptomyces fradiae por duplicación del gen que codifica una metil transferasa limitante que convierte la macrocina en tilosina (Baltz R, 1997). Preferiblemente, estos microorganismos mutantes mejorados para su producción en macrólidos son unas bacterias del género Streptomyces. De manera preferida, el microorganismo sobreexpresa el gen que comprende una secuencia que corresponde a la SEC ID nº 111 o 141. La secuencia dada en la SEC ID nº 111 es parcial, sin embargo, el experto en la materia podrá fácilmente completarla en particular utilizando la enseñanza presentada en el ejemplo 24. La secuencia indeterminada en la SEC ID nº 111 se determinó en una segunda etapa y la secuencia completa de este orf (orf28c) se da en la SEC ID nº 141. La traducción en proteína de esta secuencia codificante se da en la SEC ID nº 142. Así, se presenta en el ejemplo 24 un método para clonar el gen orf28c y para fabricar un vector de expresión que permita la expresión de orf28c. Se muestra también en este ejemplo que la sobreexpresión del gen orf28c en la cepa OSC2 conduce a la mejora de la producción en espiramicinas de esta cepa. La sobreexpresión del gen orf28c se puede obtener aumentando el número de copias de este gen y/o colocando un promotor más activo que el promotor salvaje. De manera preferida, la sobreexpresión del gen orf28c se obtiene aportando en el microorganismo un construcción de ADN recombinante, que permita la sobreexpresión de este gen. De manera preferida, esta construcción de ADN recombinante aumenta el número de copias del gen orf28c

y permite obtener una sobreexpresión del gen orf28c. En esta construcción de ADN recombinante, la secuencia codificante de orf28c puede estar colocada bajo el control de un promotor más activo que el promotor salvaje. Se puede citar a título de ilustración el promotor ptrc activo en Streptomyces ambofaciens (Amann, E. et al., 1988) así como el promotor ermE*. Así, de manera preferida, la o las copias del gen orf28c aportada son colocadas bajo el control del promotor ermE*, como es el caso en la construcción pSPM75 (véase el ejemplo 24).

Otro aspecto de la invención se refiere a un procedimiento de producción de espiramicina que utiliza los microorganismos descritos en el párrafo anterior. Este procedimiento consiste en cultivar en un medio de cultivo apropiado un microorganismo definido en el párrafo anterior, recuperar el medio de cultivo condicionado o un extracto celular, separar y purificar dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa anterior, la espiramicina producida. Las condiciones de cultivo de tales microorganismos se podrán determinar según unas técnicas bien conocidas por el experto en la materia. El medio de cultivo podrá, por ejemplo, ser el medio MP5 o el medio SL11 para los Streptomyces y en particular para Streptomyces ambofaciens (Pernodet et al., 1993). El experto en la materia podrá referirse en particular al trabajo de Kieser et al. 2000 en lo que se refiere al cultivo de Streptomyces. La espiramicina producida puede ser recuperada mediante cualquier técnica conocida por el experto en la materia. El experto en la materia podrá referirse, por ejemplo, a las técnicas enseñadas en la patente americana US 3,000,785 y más particularmente a los métodos de extracción de las espiramicinas descritas en esta patente. Preferiblemente, los microorganismos utilizados en tal procedimiento son unas bacterias del género Streptomyces. Más preferiblemente, los microorganismos mutantes mejorados para su produccion en espiramicinas son unas cepas de S. ambofaciens.

Se describe también un ADN recombinante, caracterizado por que comprende: - un polinucleótido susceptible de ser obtenido por amplificación en cadena por polimerasa utilizando el par de cebadores de la secuencia siguiente: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) y 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) y como matriz el cósmido pSPM36 o el ADN total de Streptomyces ambofaciens, más preferiblemente, se trata de un polinucleótido de la secuencia SEC ID nº 141.

Preferiblemente; este ADN recombinante es un vector. Aún más preferiblemente, el vector se selecciona entre los bacteriófagos, los plásmidos, los fagémidos, los vectores integrativos, los fósmidos, los cósmidos, los vectores lanzadera, los BAC (Bacterial Artificial Chromosome) o los PAC (P1-derived Artificial Chromosome). A título ilustrativo, se puede citar como bacteriófagos el fago lambda y el fago M13. Como plásmidos se pueden citar los plásmidos que se replican en E. coli por ejemplo pBR322 y sus derivados, pUC18 y sus derivados, pUC19 y sus derivados, pGB2 y sus derivados (Churchward G. et al., 1984), pACYC177 (número de acceso GenBank: X06402) y sus derivados, pACYC184 (número de acceso GenBank: X06403) y sus derivados. Se pueden citar también los plásmidos que se replican en Streptomyces como por ejemplo pIJ101 y sus derivados, pSG5 y sus derivados, SLP1 y sus derivados, SCP2* y sus derivados (Kieser et al. 2000). Como fagémidos se pueden citar, a título ilustrativo, pBluescript II y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, California, USA)), pGEM-T y sus derivados (comercializado por la compañía Promega (Madison, Wisconcin, USA)), λZAPII y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, California, USA)). Como vectores integrativos se pueden citar, a título ilustrativo, los vectores integrativos en Streptomyces como por ejemplo los derivados de SLP1 (Kieser et al., 2000), los derivados de pSAM2 (Kieser et al., 2000), los vectores que utilizan los sistemas de integración de los fagos PhiC31 (Kieser et al., 2000) (por ejemplo pSET152 (Bierman et al., 1992)) o de VWB (Van Mellaert L, et al., 1998), así como los vectores que utilizan el sistema de integración de IS117 (Kieser et al., 2000). Como fósmidos se pueden citar, a título ilustrativo, el fósmido pFOS1 (comercializado por la compañía New England Bioloabs Inc., Beverly, Massachussetts, USA) y sus derivados. Como cósmidos se pueden citar, a título ilustrativo, el cósmido SuperCos y sus derivados (comercializados en particular por la compañía Stratagene (LaJolla, California, USA)), el cósmido pWED15 (Wahl et al., 1987) y sus derivados. Como vectores lanzadera se pueden citar, a título ilustrativo, los plásmidos lanzadera de E. coli / Streptomyces como por ejemplo pIJ903 y sus derivados, la serie de los plásmidos pUWL, pCAO106, pWHM3, pOJ446 y sus derivados (Kieser et al. 2000), los BAC lanzadera de E. coli / Streptomyces como por ejemplo los descritos en la solicitud de patente WO 01/40497. Como BAC (Bacterial Artificial Chromosome) se puede citar, a título ilustrativo, el BAC pBeloBAC11 (número de acceso GenBank:U51113). Como PAC (P1-derived Artificial Chromosome) se puede citar, a título ilustrativo, el vector pCYPAC6 (número de acceso GenBank: AF133437). Más preferiblemente, este ADN recombinante es un vector de expresión. Los vectores de expresión utilisables en diferentes sistemas de expresión son bien conocidos por el experto en la materia, en lo que se refiere a las células procariotas se pueden citar, a título ilustrativo, los vectores de expresión de E. coli por ejemplo, de la familia pET comercializados por la compañía Stratagene (LaJolla, California, USA), los vectores de la familia GATEWAY comercializados por la compañía Invitrogen (Carlsbad, California, USA), los vectores de la familia pBAD comercializados por la compañía Invitrogen (Carlsbad, California, USA), los vectores de la familia pMAL comercializados por la compañía New England Bioloabs Inc. (Beverly, Massachussetts, USA), los vectores de expresión inducibles por la ramnosa citados en la publicación Wilms B et al., 2001 y sus derivados, se pueden citar también los vectores de expresión de Streptoinyces como por ejemplo los vectores pIJ4123, pIJ6021, pPM927, pANT849, pANT 850, pANT 851, pANT1200, pANT1201, pANT1202 y sus derivados (Kieser et al., 2000). En lo que se refiere a las células de levaduras se puede citar, a título ilustrativo, el vector pESC comercializado por la compañía Stratagene (LaJolla, California, USA). En lo que se refiere al sistema de expresión baculovirus que permite una expresión en células de insectos se puede citar, a título ilustrativo, el vector BacPAK6 comercializado por la compañía BD Biosciences Clontech, (Palo Alto, California, USA). En lo que se refiere a las células de mamíferos se pueden citar, a título ilustrativo, unos vectores que comprenden el promotor de los genes precoces del virus CMV (Citomegalovirus) (por ejemplo el vector pCMV y sus derivados, comercializados por la compañía Stratagene (LaJolla, California, USA), o el promotor de los genes inmediatos (SV40 early promoter) del virus de simio vacuolizante SV40 (por ejemplo el vector pSG5 comercializado por la compañía Stratagene (LaJolla, California, USA). Otro aspecto de la invención se refiere a células huésped en las que se ha introducido un vector de expresión descrito en este párrafo.

Otro aspecto de la invención se refiere a un microorganismo productor de al menos una espiramicina caracterizado por que sobreexpresa: - un gen susceptible de ser obtenido por amplificación en cadena por polimerasa (PCR) utilizando el par de cebadores de la secuencia siguiente: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) y 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) y como matriz el cósmido pSPM36 o el ADN total de Streptomyces ambofaciens, más preferiblemente se trata del gen de la secuencia codificante SEC ID nº 141.

Un ejemplo de secuencia de tal gen se da en la SEC ID nº 111 (ADN), sin embargo esta secuencia es parcial ya que no comprende la parte 3' de la secuencia codificante correspondiente. La traducción en proteína de esta parte de secuencia codificante se da en la SEC ID nº 112. El experto en la materia podrá fácilmente completarla, utilizando en particular la enseñanza presentada en el ejemplo 24. Así, se presenta en este ejemplo un método para clonar el gen orf28c y para fabricar un vector de expresión que permita la expresión de orf28c. Se muestra también en este ejemplo que la sobreexpresión del gen orf28c en la cepa OSC2 conduce a la mejora de la producción de espiramicinas de esta cepa. De manera preferida, el microorganismo que sobreexpresa - un gen susceptible de ser obtenido por amplificación en cadena por polimerasa (PCR) utilizando el par de cebadores de la secuencia siguiente: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) y 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) y como matriz el cósmido pSPM36 o el ADN total de Streptomyces ambofaciens, más preferiblemente se trata del gen de la secuencia codificante SEC ID nº 141 es una bacteria del género Streptomyces, de manera aún más preferida, se trata de una bacteria de la especie Streptomyces ambofaciens. De manera preferida, la sobreexpresión de dicho gen se obtiene por transformación de dicho microorganismo por un vector de expresión, de manera muy preferida, la cepa de microorganismo es la cepa OSC2/pSPM75(2) depositada en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 6 de octubre de 2003 bajo el número de registro 1-3101.

Otro aspecto de la invención se refiere a un procedimiento de producción de espiramicina(s) que utiliza los microorganismos descritos en el párrafo anterior. Este procedimiento consiste en cultivar en un medio de cultivo apropiado un microorganismo definido en el párrafo anterior, recuperar el medio de cultivo condicionado o un extracto celular, separar y purificar a partir de dicho medio de cultivo, o también a partir del extracto celular obtenido en la etapa anterior, la o las espiramicinas producidas. Las condiciones de cultivo de tales microorganismos podrán ser determinadas según unas técnicas bien conocidas por el experto en la materia. El medio de cultivo podrá, por ejemplo, ser el medio MP5 o el medio SL11 para los Streptomyces y en particular para Streptomyces ambofaciens (Pernodet et al., 1993). El experto en la materia podrá referirse en particular al trabajo de Kieser et al. 2000 en lo que se refiere al cultivo de los Streptomyces. La o las espiramicinas producidas pueden ser recuperadas mediante cualquiera de las técnicas conocidas por el experto en la materia. El experto en la materia podrá referirse, por ejemplo, a las técnicas enseñadas en la patente americana US 3,000,785 y más particularmente a los métodos de extracción de las espiramicinas descritos en esta patente. Preferiblemente, los microorganismos utilizados en tal procedimiento son unas bacterias del género Streptonzyces. Más preferiblemente, los microorganismos son unas cepas de S. ambofaciens.

Otro aspecto de la invención se refiere a una cepa de Streptomyces ambofaciens transformada por un vector definido en el párrafo anterior.

Otro aspecto de la invención se refiere a un polipéptido caracterizado por que su secuencia comprende la secuencia SEC ID nº 112. La invención se refiere también a un polipéptido caracterizado por que su secuencia corresponde a la secuencia traducida de la secuencia que codifica: - un gen susceptible de ser obtenido por amplificación en cadena por polimerasa (PCR) utilizando el par de cebadores de la secuencia siguiente: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) y 5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) y como matriz el cósmido pSPM36 o el ADN total de Streptomyces ambofaciens, más preferiblemente se trata del gen de la secuencia codificante SEC ID nº 141.

Preferiblemente, estos polipéptidos son expresados en estado natural por una bacteria del género Streptomyces, más preferiblemente, estos polipéptidos están implicados en la biosíntesis de las espiramicinas.

Otro aspecto de la invención se refiere a un vector de expresión que permite la expresión de un polipéptido tal como se define en el párrafo anterior en Streptomyces ambofaciens. Se han dado anteriormente unos ejemplos de vectores de expresión utilisables en Streptomyces. Preferiblemente, el vector de expresión en cuestión es el plásmido pSPM75.

LISTADO DE FIGURAS Figura 1: Estructura química de las espiramicinas I, II y III.

Figura 2: Cósmidos utilizados para la secuenciación de la región.

Figura 3: Organización de un grupo de genes implicados en la ruta de la biosíntesis de las espiramicinas.

Figura 4: Ruta de la biosíntesis propuesta de la micarosa.

Figura 5: Ruta de la biosíntesis propuesta de la micaminosa.

Figura 6: Ruta de la biosíntesis propuesta de la forosamina.

Figura 7: Orden preferido de adición de los azúcares en la molécula de espiramicina e intermedios.

Figura 8: Ruta de la biosíntesis propuesta del metoximalonilo en S. ambofaciens. Esta ruta es propuesta por analogía con la biosíntesis del metoximalonilo en Streptomyces higroscopicus var. ascomyceticus (Wu,K. et al., 2000).

Figura 9: Etapas que conducen a la inactivación de un gen: A) Clonación del gen diana en un vector que se replica en E. coli pero no en Streptomyces; B) Inserción del casete de resistencia en el gen diana (por clonación o recombinación en secuencias cortas idénticas); C) Introducción del plásmido en Streptomyces ambofaciens (por transformación o conjugación con E. coli) y selección de los clones que han integrado el casete y después cribado de clones que han perdido la parte de vector para tener una sustitución de gen; D) Región del cromosoma de la cepa mutante en la que el gen diana está inactivado por sustitución de gen.

Figura 10: Etapas opcionales que siguen a la inactivación de un gen según el método descrito en la figura 9, que pueden ser llevadas a cabo si se ha utilizado un casete escindible para interrumpir el gen diana: E) Introducción en la cepa mutante del plásmido pOSV508 que lleva los genes xis y int de pSAM2 cuyos productos permitirán la escisión eficaz por recombinación específica de sitios entre las secuencias attL y attR que bordean el casete; F) Obtención de clones que han perdido el casete escindible y sensibles al antibiótico al cual el casete confería resistencia; G) Después del crecimiento y esporulación sobre medio sólido sin antibiótico el plásmido pOSV508 se pierde a alta frecuencia. Se pueden obtener así unos clones sensibles a la tiostreptona, en los que el gen diana contiene una deleción en fase. La secuencia del gen diana suprimida puede ser controlada por amplificación PCR y secuenciación del producto PCR.

Figura 11: Amplificación del casete escindible con el objetivo de utilizarlo para un experimento de recombinación homóloga. Se ha descrito la técnica de recombinación homóloga gracias a secuencias cortas homólogas por (Chaveroche et al., 2000).

Los 39 o 40 desoxi-nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia del gen a inactivar, y los 20 desoxi-nucleótidos situados generalmente en 3' corresponden a la secuencia de uno de los extremos del casete escindiblee. (no forma parte de la invención) Figura 12: Obtención de una construcción para la inactivación de un gen diana gracias a la técnica descrita por (Chaveroche et al., 2000). (no forma parte de la invención) Figura 13: Mapa del plásmido pWHM3. Strepto ori: origen de replicación Streptomyces.

Figura 14: Mapa del plásmido pOSV508.

Figura 15: Ejemplo de estructura de un casete escindible. Esta está constituida del casete Ωhyg (Blondelet-Rouault et al., 1997) bordeado de los sitios attR y attL (Raynal et al., 1998), entre los cuales un evento de recombinación permitirá la escisión del casete, gracias a la expresión de los genes xis y int.

Figura 16: Mapa del plásmido pBXL1111. (no forma parte de la invención) Figura 17: Mapa del plásmido pBXL1112. (no forma parte de la invención) Figura 18: Ensayo microbiológico de producción de espiramicina, basado en la sensibilidad de una cepa de Micrococcus

Luteus en la espiramicina. La cepa de Micrococcus luteus utilizada es una cepa naturalmente sensible a la espiramicina pero resistente a la congocidina. Las diferentes cepas de Streptomyces a ensayar se cultivaron en matraces “erlenmeyers" de 500 ml que contenían 70 ml de medio MP5, inoculados a una concentración inicial de 2.5 106 esporas/ml y se dejaron crecer a 27°C bajo agitación orbital de 250 rpm. Se realizaron unas extracciones de mostos de fermentación después de 48, 72 y 96 horas de cultivo y se centrifugaron. Para el ensayo, se utiliza una dilución a la décima parte de estos sobrenadantes en un medio de cultivo estéril. La cepa indicadora de Micrococcus luteus resistente a la congocidina pero sensible a la espiramicina (Gourmelen et al., 1998) se cultivó en una caja cuadrada de 12x12 cm.

Se empaparon unos discos de papel Whatman AA en 70 µl de la dilución a la décima parte de cada sobrenadante y se depositaron en la superficie de la caja. Unos discos empapados de una solución de espiramicina de diferentes concentraciones (2-4-8 µg/ml en el medio de cultivo MP5) se utilizan como serie estándar. Las cajas se incuban a 37°C durante 24 a 48h. Si el disco contiene espiramicina, ésta se difunde en el ágar e inhibe lel crecimiento de la cepa indicadora de Micrococcus luteus. Esta inhibición crea un «halo» alrededor del disco, reflejando este halo la zona en la que la cepa de Micrococcus luteus no ha crecido. La presencia de este halo es por lo tanto una indicación de la presencia de espiramicina y permite determinar si la cepa de S. ambofaciens en cuestión es productora o no productora de espiramicina. Una comparación con los diámetros de inhibición obtenidos para la serie estándar permite obtener una indicación de la cantidad de espiramicina producida por esta cepa.

Figura 19: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa OSC2.

Figura 20: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa SPM501. (no forma parte de la invención) Figura 21: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa SPM502. (no forma parte de la invención) Figura 22: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa SPM507. (no forma parte de la invención) Figura 23: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa SPM508. (no forma parte de la invención) Figura 24: Cromatograma CLHP del sobrenadante filtrado del medio de cultivo de la cepa SPM509. (no forma parte de la invención) Figura 25: Alineamiento de la proteína Orf3 (SEC ID nº 29) con la proteína TylB (SEC ID nº 87) de S. fradiae realizado gracias al programa FASTA.

Figura 26: Alineamiento de la proteína MdmA de S. mycarofaciens (SEC ID nº 88) con la proteína SrmD (SEC ID nº 16) realizado gracias al programa FASTA.

Figura 27: Ejemplo de secuencias de sitios residuales después de la escisión del casete escindible. En negrita se indica el sitio att26 mínimo tal como se define en Raynal et al., 1998. La secuencia de la fase 1 (att1) de 33 nucleótidos se presenta en la SEC ID nº 104, la secuencia de la fase 2 (att2) de 34 nucleótidos se presenta en la SEC ID nº 105, la secuencia de la fase 3 (att3) de 35 nucleótidos se presenta en la SEC ID nº 95.

Figura 28: Representación esquemática del gen orf10, localización de los cebadores PCR utilizados y construcción obtenida con cada par de cebadores.

Figura 29: Construcción del casete pac-oritT.

Figura 30: Mapa del cósmido pWED2.

Figura 31: Representación esquemática del grupo de genes implicados en la ruta de la biosíntesis de las espiramicinas y de la localización de las tres sondas utilizadas para aislar los cósmidos del banco de ADN genómico de la cepa OSC2 de

Streptomyces ambofaciens en E. coli (véase el ejemplo 19).

Figura 32: Localización de los insertos de los cósmidos aislados del banco de ADN genómico de la cepa OSC2 de

Streptomyces ambofaciens en E. coli (véase el ejemplo 19). Nuevo banco de ADN cosmídico.

Figura 33: Sub-clonación del fragmento PstI-PstI del cósmido pSPM36 (inserto del plásmido (pSPM58), sub-clonación del fragmento StuI-StuI del cósmido pSPM36 (inserto del plásmido pSPM72) y sub-clonación de un fragmento EcoRI- StuI (inserto del plásmido pSPM73).

Figura 34: Localización de los marcos de lectura abiertos identificados en el inserto PstI-PstI del plásmido pSPM58 y en el inserto EcoRI-StuI del plásmido pSPM73.

Figura 35: Superposición de los cromatogramas CLHP del sobrenadante filtrado del medio de cultivo de la cepa OS49.67 realizados a 238 y 280nm (alto) y espectros UV de las moléculas eluidas a 33,4 minutos y 44,8 minutos (bajo). (no forma parte de la invención) Figura 36: Estructura molecular de las moléculas platenólido A y platenólido B.

Figura 37: Organización del grupo de genes implicados en la ruta de la biosíntesis de las espiramicinas.

Figura 38: Estructura molecular de un intermedio de biosíntesis producido por la cepa SPM507.

Figura 39: Estructura de un intermedio de biosynthsèse producido por una cepa de S. ambofaciens de genotipo orf6

*::att1Ωhyg+ obtenida a partir de una cepa que sobreproduce las espiramicinas. La inserción del casete att1Ωhyg+ dans orf6* ejerce un efecto polar que impide la expresión de orf5*.

Figura 40: Estructura molecular de las moléculas platenólido A + micarosa y platenólido B + micarosa producidas por la cepa OS49.67 Figura 41: Sub-clonación de un fragmento PstI-PstI del cósmido pSPM36 (inserto del plásmido (pSPM79)), localización de los marcos de lectura abiertos identificados en el inserto PstI-PstI del plásmido pSPM79 y localización de la secuencia SEC ID nº 140.

La presente invención se ilustra con la ayuda de los ejemplos siguientes, que deben ser considerados como ilustrativos y no limitativos.

En resumen, los genes de la ruta de la biosíntesis de las espiramicinas se aislaron a partir de un banco de ADN genómico de Streptomyces ambofaciens. Este banco se obtuvo mediante digestión parcial del ADN genómico de Streptomyces ambofaciens., por la enzima de restricción BamHI. Se clonaron anchos fragmentos de ADN, de 35 a 45 kb de media, en el cósmido pWED1 (Gourmelen et al., 1998) derivado del cósmido pWED15 (Wahl et al., 1987). Estos cósmidos se han introducido en E. coli gracias a partículas fágicas. El banco así obtenido se hibridó con una sonda (de secuencia SEC ID nº 86) que corresponde a una parte del gen tylB de S. fradiae (Merson-Davies & Cundliffe, 1994, número de acceso GenBank: U08223). Después de la hibridación, se seleccionó más particularmente un cósmido de los 4 que se hibridan en la sonda. Este cósmido, denominado pOS49.1, se ha digerido después por SacI y un fragmento de 3,3 kb que contiene la región que se hibrida con la sonda, se clonó en el vector pUC19 y se secuenció. Se han identificado cuatro marcos de lectura abiertos y uno de ellos codifica una proteína (SEC ID nº 29) que presenta fuertes similitudes de secuencia con la proteína TylB de S. fradiae (SEC ID nº 87) (véase la figura 25). Este gen se ha denominado orf3 (SEC ID nº 28) y se ha inactivado en S. ambofaciens. Se ha podido demostrar que los clones inactivados en el gen orf3 no producen más espiramicinas. Esto muestra la implicación del gen orf3 o de los genes situados secuencia abajo en la biosíntesis de las espiramicinas.

Una vez obtenida esta confirmación, se ha secuenciado una mayor región del cósmido pOS49.1, a ambos lados del fragmento SacI anteriormente estudiado. Así, a partir del cósmido pOS49.1, se ha podido obtener la secuencia de una región que comprende siete marcos de lectura abiertos enteros y otros dos incompletos, situados a ambos lados de estos siete marcos abiertos completos. Gracias a una búsqueda en las bases de datos, se ha podido demostrar que uno de los marcos de lectura abiertos incompleto correspondía al locus srmG (región que codifica una enzima denominada «policétido sintasa» (PKS)). Los genes correspondientes se han clonado por Burgett S. et al. en 1996 (patente americana US 5,945,320). Por otro lado, los otros marcos de lectura abiertos, los siete ORFs enteros denominados: orf1, orf2, orf3, orf4, orf5, orf6, orf7 (SEC ID nº 23, 25, 28, 30, 34, 36, 40) y el principio del octavo ORF denominado orf8 (secuencia SEC ID nº 43) no se han encontrado en las bases de datos.

En una segunda fase, y con el objetivo de clonar otros genes implicados en la biosíntesis de las espiramicinas, se han aislado otros cósmidos que comprenden unos fragmentos del genoma de S. ambofaciens en esta misma región. Para ello, se ha efectuado una nueva serie de hibridaciones sobre colonias utilizando tres sondas. La primera sonda corresponde a un fragmento de ADN de 3,7kb que contiene orf1, orf2 y el principio de orf3, sub-clonado a partir de pOS49.1. La segunda sonda corresponde a un fragmento de 2 kb de ADN que contiene una parte de orf7 y una parte de orf8 y sub-clonado a partir de pOS49.1. Se ha utilizado también una tercera sonda. Esta última corresponde a un fragmento de ADN de 1,8 kb que contiene el gen srmD. El gen srmD es un gen aislado de S. ambofaciens capaz de conferir la resistencia a la espiramicina. En efecto, unos trabajos anteriores han permitido la clonación de varios determinantes de resistencia de S. ambofaciens, confiriendo la resistencia a la espiramicina a una cepa de S. griseofuscus (cepa sensible a la espiramicina) (Pernodet et al., 1993) (Pernodet et al., 1999). Para el aislamiento de genes de resistencia, se realizó un banco cosmídico del ADN genómico de la cepa S. ambofaciens en el cósmido pKC505 (Richardson MA et al., 1987). Este grupo de cósmidos se introdujo en S. griseofuscus, natralmente sensible a la espiramicina. Se obtuvieron así cinco cósmidos capaces de conferir la resistencia a la apramicina y a la espiramicina en

S. griseofuscus. Entre estos 5 cósmidos, un cósmido, denominado pOS44.1, posee en su inserto el gen srmD que codifica una proteína que presenta una cierta similitud con la proteína codificada por el gen mdmA de Streptomyces mycarofaciens e implicada en la resistencia a la midecamicina en este organismo productor (Hara et al., 1990, número de acceso Genbank: A60725) (figura 26). La tercera sonda utilizada para localizar los genes de la biosíntesis de espiramicina fue un inserto de aproximadamente 1,8 kb que comprende el gen srmD.

Estas tres sondas se utilizaron para hibridar el banco de ADN genómico, descrito anteriormente, y han permitido seleccionar dos cósmidos (pSPM7 y pSPM5) susceptibles de contener los insertos más largos y que no tienen bandas comunes. El cósmido pSMP5 hibridaba con la primera y la segunda sonda, pero no hibridaba con la tercera sonda, mientras que el cósmido pSPM7 hibridaba sólo con la tercera sonda. Estos dos cósmidos se secuenciaron totalmente mediante la técnica de secuenciación a ciegas («shotgun sequencing»). Las secuencias de los insertos de estos dos cósmidos: pSPM7 y pSPM5 han podido ser ensamblados ya que a pesar de que no se solapan, cada uno de los insertos comprende una secuencia conocida a uno de sus extremos. En efecto, cada uno de estos insertos comprendía un fragmento de la secuencia de uno de los genes que codifica una enzima denominada «policétido sintasa» (PKS). Estos 5 genes se clonaron por Burgett S. et al. en 1996 (patente americana US 5,945,320) (véase la figura 2). Así, se ha podido determinar una secuencia única de ADN genómico de S. ambofaciens. Una secuencia de 30943 nucleótidos que sale, en 5', de un sitio EcoRI situado en el primer gen PKS y que va hasta un sitio BamHI en 3' se presenta en la SEC ID nº 1. Esta secuencia corresponde a la región secuencia arriba de los genes de la PKS (véase la figura 2 y 3). Una segunda región de 11171 nucleótidos, que sale de un sitio PstI en 5' y que va hasta un sitio BstEII en 3' situado en el quinto gen de la PKS se presenta en la SEC ID nº 2. Esta región es la región secuencia abajo de los genes de la PKS (estando secuencia abajo y secuencia arriba definidos por la orientación de los 5 genes de PKS orientados todos en el mismo sentido) (véanse las figuras 2 y 3).

En una tercera fase, y con el objetivo de clonar otros genes implicados en la biosíntesis de las espiramicinas, se han aislado otros cósmidos que comprenden unos fragmentos del genoma de S. ambofaciens en esta misma región (vénase los ejemplos 18 y 19).

EJEMPLO 1: Construcción de un banco de ADN genómico de la cepa ATCC23877 de Streptomyces ambofaciens en E. coli

1.1. Extracción del ADN genómico de la cepa ATCC23877 de Streptomyces ambofaciens.

La cepa ATCC23877 de Streptomyces ambofaciens. (accesible en particular en American Type Culture Collection (ATCC) (Manassas, Virginie, USA), bajo el número 23877) se cultivó en medio YEME (Yeast Extract-Malt Extract) ((Kieser, T, et al., 2000) y se extrajó el ADN genómico de esta cepa y se purificó según las técnicas estándar de lisis y precipitación (Kieser T. et al., 2000).

1.2. Construcción del banco de ADN genómico El ADN genómico de la cepa ATCC23877 de Streptomyces ambofaciens tal como se ha aislado anteriormente fue digerido parcialmente por la enzima de restricción BamHI a fin de obtener unos fragmentos de ADN de tamaño comprendido entre aproximadamente 35 y 45 kb. Estos fragmentos se clonaron en el cósmido pWED1 (Gourmelen et al.,

1998) digerido previamente por BamHI. El cósmido pWED1 se deriva del cósmido pWE15 (Wahl, et al., 1987) por deleción del fragmento HpaI-HpaI de 4,1 kb que contiene el módulo de expresión activo en los mamíferos (Gourmelen et al., 1998). La mezcla de ligación se encapsidó después in vitro en partículas de fagos lambda gracias al sistema «Packagene® Lambda DNA packaging system» comercializado por la compañía Promega siguiendo las recomendaciones del fabricante. Las partículas fágicas obtenidas se utilizaron para infectar la cepa SURE® de E. coli

comercializada por la compañía Stratagene (LaJolla, California, USA). La selección de los clones se efectuó en un medio LB + ampicilina (50 µg/ml) ya que el cósmido pWED1 confiere la resistencia a la ampicilina.

EJEMPLO 2: Aislamiento y caracterización de los genes implicados en la biosíntesis de espiramicinas en Streptomyces ambofaciens

2.1 Hibridación sobre colonia de clones de E. coli del banco genómico de Streptomyces ambofaciens. ATCC23877 Aproximadamente 2000 clones de E. coli del banco obtenido anteriormente, se trasfirieron en filtro para la hibridación sobre colonias. La sonda utilizada para la hibridación es un fragmento NaeI-NaeI de ADN (SEC ID nº 86) que comprende una parte del gen tylB de Streptomyces fradiae. Este fragmento corresponde a los nucleótidos 2663 a 3702 del fragmento de ADN descrito por Merson-Davies, L.A. & Cundliffe E. (Merson-Davies, L.A. & Cundliffe E., 1994, número de acceso GenBank: U08223), en el que la secuencia que codifica el tylB corresponde a los nucleótidos 2677 a 3843.

El fragmento NaeI-NaeI de ADN que lleva una parte del gen tylB de Streptomyces fradiae (SEC ID nº 86) se marcó con 32P mediante la técnica del «cebado aleatorio» (Kit comercializado por la compañía Roche) y utilizado como sonda para la hibridación de los 2000 clones del banco, transferidos sobre filtro. Las membranas utilizadas son unas membranas de nylon Hybond N comercializadas por la compañía Amersham (Amersham Biosciences, Orsay, France) y la hibridación se efectuó a 55°C en el tampón descrito por Church & Gilbert (Church & Gilbert, 1984). Se efectuó un lavado en 2X SSC a 55°C durante 15 minutos y se efectuaron después dos lavados sucesivos en 0,5X SSC a 55°C, de una duración de 15 minutos cada uno. En estas condiciones de hibridación y de lavado, 4 clones de entre los 2000 hibridados presentaban una fuerte señal de hibridación. Estos 4 clones se cultivaron en medio LB+ ampicilina (50 µg/ml) y se extrajeron los 4 cósmidos correspondientes por lisis alcalina estándar (Sambrook et al., 1989). Después, se verificó que la hibridación se debía realmente a un fragmento de ADN presente en el inserto de estos cuatro cósmidos. Para ello, los cósmidos se digerieron independientemente por varias enzimas (BamHI, PstiI y SacI). Los productos de digestiones se separaron sobre gel de agarosa, se transfiereron sobre membrana de Nylon y se hibridaron por el fragmento NaeI-NaeI de ADN que comprende una parte del gen tylB de Streptomyces fradiae (véase anteriormente) en las mismas condiciones que anteriormente. Se pudieron validar los cuatro cósmidos y se retuvo más particularmente uno de estos cósmidos y se denominó pOS49.1.

2.2 Verificación de la implicación de la región identificada y secuenciación del inserto del cósmido pOS49.1 Se sub-clonaron varios fragmentos del inserto del cósmido pOS49.1 y se determinaron sus secuencias. El cósmido pOS49.1 fue digerido por la enzima SacI y se demostró mediante transferencia Southern, en las condiciones descritas anteriormente, que un fragmento de 3,3 kb contenía la región que se hibrida con la sonda TylB. Este fragmento de 3,3 kb se aisló mediante electroelución a partir de un gel de agarosa al 0,8% después se clonó en el vector pUC19 (número de acceso GenBank M77789) y se secuenció. El plásmido así obtenido se denominó pOS49.11. Cuatro marcos de lectura abiertos que presentan un fago de los codones típico de Streptomyces han podido ser identificados en este fragmento (dos completos y dos truncados), gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Unas comparaciones de secuencias gracias al programa FASTA (véase (Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), acesible en particular en el centro de recursos INFOBIOGEN, Evry, Francia) han permitido mostrar que la proteína deducida de uno de estos 4 marcos de lectura abiertos presenta fuerte similitudes de secuencia con la proteína TylB (SEC ID nº 87; Número de acceso GenBank: U08223) de S. fradiae (véase la figura 25). Esta proteína se denominó Orf3 (SEC ID nº 29).

Con el objetivo de ensayar si el gen correspondiente (el gen orf3 (SEC ID nº 28)) estaba implicado en la biosíntesis de las espiramicinas en S. ambofaciens, se ha interrumpido este gen por un casete Ωhyg (Blondelet-Rouault M-H. et al.,1997, número de acceso GenBank: X99315). Para ello, se ha digerido el plásmido pOS49.11 mediante la enzima XhoI y el fragmento que contiene los cuatro marcos de lectura abiertos (dos completos y dos truncados, de los cuales

orf3 entero) se sub-clonó al nivel del sitio XhoI del vector pBC SK+ comercializado por la compañía Stratagene (LaJolla, California, USA). El plásmido así obtenido se denominó pOS49.12. Con el objetivo de inactivar orf3, un fragmento PmlI- BstEII interno a orf3 se sustituyó por el casete Ωhyg mediante clonado en extremo romo en este último plásmido. Para ello, el plásmido pOS49.12 se ha digerido mediante las enzimas PmlI y BstEII cuyo único sitio se encuentra en la secuencia que codifica el gen orf3. Los extremos del fragmento que corresponden al vector se convirtieron en extremos romos mediante un tratamiento por la enzima de Klenow (fragmento grande de la ADN polimerasa I). El casete Ωhyg se obtuvo por digestión por la enzima BamHI del plásmido pHP45 Ωhyg (Blondelet-Rouault et al., 1997, número de acceso GenBank: X99315). El fragmento que corresponde al casete Ωhyg se recuperó sobre gel de agarosa y sus extremos se convirtieron en romos mediante un tratamiento por la enzima de Klenow. Los dos fragmentos romos así obtenidos (el casete Ωhyg y el plásmido pOS49.12) se ligaron y el producto de la ligación se utilizó para la transformación de las bacterias E. coli. El plásmido así obtenido se denominó pOS49.14 y contiene el gen orf3 interrumpido por el casete Ωhyg.

El inserto del plásmido pOS49.14, en forma de un fragmento XhoI-XhoI cuyos extremos se hicieron no cohesivos mediante un tratamiento por la enzima de Klenow, se clonó a nivel del sitio EcoRV del plásmido pOJ260 (el plásmido pOJ260 es un plásmido conjugativo capaz de replicarse en E. coli pero incapaz de replicarse en S. ambofaciens

(Bierman M et al., 1992). Este plásmido confiere la resistencia a la apramicina en E. coli y Streptomyces). El plásmido obtenido (inserto del plásmido pOS49.14 clonado en el plásmido pOJ260) se denominó pOS49.16. Este último se transfirió en la cepa ATCC23877 de S. ambofaciens por conjugacion con la ayuda de la cepa conjugativa E. coli S17-1, como se describe por Mazodier et al. (Mazodier et al., 1989). La cepa E. coli S17-1 deriva de la cepa E. coli 294 (Simon et al., 1983) (Simon, et al., 1986). Se pudieron obtener unos clones transconjugantes que poseen el marcador de resistencia a la higromicina llevada por el casete Ωhyg y que ha perdido el marcador de resistencia a la apramicina llevada por el vector pOJ260. Para ello, después de la conjugación, los clones se seleccionan por su resistencia a la higromicina. Los clones resistentes a la higromicina son después replicados respectivamente sobre medio con higromicina (antibiótico B) y sobre medio con apramicina (antibiótico A) (véase la figura 9). Los clones resistentes a la higromicina (HygR) y sensibles a la apramicina (ApraS) son, en principio, aquellos en los que se produce un doble evento de recombinación y que poseen por lo tanto el gen orf3 interrumpido por el casete Ωhyg. La sustitución de la copia salvaje de orf3 por la copia interrumpida se verificó mediante dos hibridaciones sucesivas. Así, el ADN total de los clones obtenidos, se digirió por diferentes enzimas, se separó sobre gel de agarosa, se transfirió sobre membrana y se hibridó con una sonda que corresponde al casete Ωhyg (véase anteriormente)) para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se efectuó una segunda hibridación utilizando como sonda el inserto XhoI-

XhoI del plásmido pOS49.11 que contiene los cuatro marcos de lectura abiertos (dos completos y dos truncados, incluyendo orf3 entero). La verificación del genotipo puede también ser realizada mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Uno de los clones orf3::Ωhyg así obtenido y cuyo genotipo se verificó, se seleccionó y se denominó OS49.16.

La producción en espiramicina del clon OS49.16 así obtenido se ensayó gracias al ensayo de producción descrito más adelante (véase el ejemplo 15). Se ha podido demostrar así que esta cepa no produce más espiramicina, lo que confirma la implicación de orf3 y/o de los genes situados secuencia abajo como por ejemplo orf4 en la biosíntesis de las espiramicinas.

Una vez obtenida esta confirmación, se ha secuenciado una mayor región del cósmido pOS49.1, a ambos lados del fragmento SacI anteriormente estudiado. Así, a partir del cósmido pOS49.1, se ha podido obtener la secuencia de una región que comprende siete marcos de lectura abiertos enteros y otros dos incompletos, situados a ambos lados de estos siete marcos abiertos completos. Gracias a una búsqueda en las bases de datos, se ha podido demostrar que uno de los marcos de lectura abiertos incompleto correspondía al locus srmG (región que codifica una enzima denominada «policetido sintasa» (PKS)). Los genes correspondientes se clonaron por Burgett S. et al. en 1996 (Patente americana US 5,945,320). Por otra parte, los otros marcos de lectura abiertos: los siete ORFs enteros denominados: orf1, orf2, orf3, orf4, orf5, orf6, orf7 (SEC ID nº 23, 25, 28, 30, 34, 36 y 40) y el principio de la octava ORF denominada orf8 (la secuencia entera de esta orf se da en la SEC ID nº 43) no se encontraron en las bases de datos.

EJEMPLO 3: Aislamiento y caracterización de otros genes implicados en la biosíntesis de espiramicinas en

Streptomyces ambofaciens (no forma parte de la invención) En una segunda fase y con el objetivo de clonar otros genes implicados en la biosíntesis de las espiramicinas, se aislaron otros cósmidos que comprenden unos fragmentos del genoma de S. ambofaciens en esta misma región. Para ello, se ha procedido a una nueva serie de hibridaciones sobre colonias utilizando tres sondas: - La primera sonda utilizada corresponde a un fragmento de ADN BamHI-PstI de 3,7kb que contiene un fragmento del gen de la PKS (Los genes que corresponden a la PKS se clonaron por Burgett S. et al. en 1996 (Patente americana US 5,945,320)), orf1, orf2 y le principio de orf3, sub-clonado a partir de pOS49.1 y que va de un sitio BamHI de 1300 pares de bases secuencia arriba del sitio EcoRI que define la posición 1 de la SEC ID nº 1, hasta el sitio PstI situado en posición 2472 (SEC ID nº 1). Este fragmento BamHI-PstI se sub-clonó a partir de pOS49.1 en el plásmido pBC SK+, lo que ha permitido obtener el plásmido pOS49.28.

- La segunda sonda utilizada corresponde a un fragmento de ADN PstI-BamHI de aproximadamente 2kb que contiene un fragmento de orf7 y de orf8, sub-clonado a partir de pOS49.1 y que va de un sitio PstI situado en la posición 6693 de la SEC ID nº 1 hasta el sitio BamHI situado en la posición 8714 de la SEC ID nº 1. Este fragmento

PstI-BamHI se sub-clonó a partir de pOS49.1 en el plásmido pBC SK+, lo que ha permitido obtener el plásmido pOS49.76.

- Se ha utilizado también una tercera sonda. Esta última corresponde a un fragmento de ADN de 1,8 kb EcoRI-

HindIII que contiene el gen srmD. El gen srmD es un gen aislado de S. ambofaciens capaz de conferir la resistencia a la espiramicina. En efecto, unos trabajos anteriores permitieron la clonación de varios determinantes de resistencia a S. ambofaciens., confiriendo la resistencia a la espiramicina a una cepa de S. griseofuscus (cepa sensible a la espiramicina) (Pernodet et al., 1993) (Pernodet et al., 1999). Para aislar unos genes de resistencia, se realizó un banco cosmídico del ADN genómico de la cepa S. ambofaciens. ATCC23877 en el cósmido pKC505 (Richardson MA et al., 1987). Para ello, el ADN genómico de la cepa S. ambofaciens. ATCC23877 se había digerido parcialmente por Sau3AI a fin de obtener unos fragmentos de tamaño comprendido entre aproximadamente 30 y 40 kb. El ADN genómico así digerido (3 µg) había sido ligado con 1µg del pKC505 previamente digerido por la enzima

BamHI (Pernodet et al., 1999). La mezcla de ligación se encapsidó después in vitro en partículas fágicas. Las partículas fágicas obtenidas se utilizaron para infectar la cepa de E. coli HB101 (accesible en particular en American Type Culture Collection (ATCC) (Manassas, Virginia, USA), bajo el número 33694). Aproximadamente 20000 clones de E. coli resistentes a la apramicina fueron agrupados y los cósmidos de estos clones fueron extraídos. Esta agrupación de cósmidos se introdujo por transformación de protoplastos en la cepa DSM 10191 de S. griseofuscus (Cox KL & Baltz RH. 1984), naturalmente sensible a la espiramicina (Rao RN et al., 1987, esta cepa está disponible en particular en la German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikro- organismen und Zellkulturen GmbH, DSMZ), (Braunschweig, Alemania), bajo el número DSM 10191). Los transformantes fueron seleccionados sobre un medio que contenía apramicina. Se transfirieron 1300 de los clones que crecen en el medio que contenía apramicina sobre un medio que contenía 5 µg/ml de espiramicina. Varios clones resistentes a la apramicina también crecieron sobre el medio que contenía espiramicina y los cósmidos de estas colonias fueron extraídos y se utilizaron para transformar E. coli y S. griseofuscus (Pernodet et al., 1999).

Cinco cósmidos capaces de conferir la resistencia a la apramicina a E. coli y la co-resistencia a la apramicina y la espiramicina en S. griseofuscus fueron obtenidos de esa manera. Entre estos 5 cósmidos, se determinó que un cósmido denominado pOS44.1 poseía en su inserto un gen (SEC ID nº 15) que codifica una proteína (SEC ID nº 16) que presenta una cierta similitud con una proteína codificada por el gen mdmA de Streptomyces mycarofaciens (SEC ID nº 88), este gen se denominó srmD (véase el alineamiento presentado en la figura 26 realizado gracias al programa FASTA (véase (Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), accesibles en particular en el centro de recursos INFOBIOGEN, Evry, Francia).

Para aislar el determinante de resistencia contenido en el plásmido pOS44.1, éste se ha digerido parcialmente por la enzima de restricción Sau3AI a fin de obtener unos fragmentos de tamaño de aproximadamente 1,5 a 3 kb, estos fragmentos se ligaron en el vector pIJ486 linealizado por enzima BamHI (Ward et al., 1986). Se seleccionó un plásmido por su capacidad para conferir la resistencia a la espiramicina en la cepa DSM 10191 de S. griseofuscus (Rao RN et al., 1987), naturalmente sensible a la espiramicina (véase anteriormente). Para ello, la agrupación de plásmidos que corresponde al fragmento Sau3AI de pOS44.1 ligados en el vector pIJ486 (véase anteriormente), se introdujo por transformación de protoplastos en la cepa DSM 10191 y los transformantes se seleccionaron por su resistencia a la tiostreptona (debido al gen tsr portado por pIJ486). Los clones que crecen en el medio que contiene la tiostreptona se transfirieron sobre un medio que contenía espiramicina. Varios clones resistentes a la tiostreptona también han crecido en el medio que contiene espiramicina y los plásmidos de estas colonias se han extraído. Un plásmido que confiere la resistencia y que contiene un inserto de aproximadamente 1,8 kb se seleccionó y se denominó pOS44.2. Este inserto de 1,8 kb puede ser sacado fácilmente gracias a un sitio HindIII y un sitio EcoRI presentes en el vector a ambos lados del inserto. Este inserto de 1,8 kb HindIII-EcoRI se secuenció y el gen de resistencia que contenía se denominó srmD. Este fragmento que contenía el gen srmD se pudó así fácilmente clonar en el vector pUC19 (número de acceso GenBank M77789) abierto por EcoRI-HindIII, el plásmido obtenido se denominó pOS44.4. El inserto de 1,8 kb HindIII-EcoRI, que contenía el gen srmD, de este plásmido se utilizó como sonda para localizar los genes de biosíntesis de espiramicina (véase a continuación).

Una muestra de una cepa Escherichia Coli DH5α que contiene el plásmido pOS44.4 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro 1-2918.

Aproximadamente 2000 clones del banco, obtenidos anteriormente (véase el ejemplo 1), se transfirieron sobre filtro para hibridación sobre colonias según las técnicas clásicas (Sambrook et al., 1989).

Las tres sondas descritas anteriormente se marcaron con 32P mediante la técnica del «cebado aleatorio» (Kit comercializado por Roche) y utilizada para la hibridación de los 2000 clones del banco, transferidos sobre filtro. La hibridación se efectuó a 65°C en el tampón descrito por Church & Gilbert (Church & Gilbert, 1984). Se efectuó un lavado en 2X SSC a 65°C durante 15 minutos y se efectuaron después dos lavados sucesivos en 0,5X SSC a 65°C, de una duración de 15 minutos cada uno. En estas condiciones de hibridación y de lavado, 16 clones de entre los 2000 hibridados presentaban una fuerte señal de hibridación con al menos una de las sondas. Sin embargo, ningún cósmido se hibridaba con las tres sondas. Los 16 cósmidos se han extraído y digerido por la enzima de restricción BamHI. La comparación de los perfiles de restricción de estos diferentes cósmidos entre sí, ha conducido a seleccionar dos cósmidos susceptibles de contener los insertos más largos de la región y que no tienen bandas comunes. Así, se seleccionaron dos cósmidos, uno denominado pSPM5 y otro pSPM7. El cósmido pSPM5 hibridaba con las sondas orf1 a orf4 y la sonda orf8, pero no hibridaba con la sonda srmD. pSPM7 hibridaba sólo con la sonda srmD y no con las otras dos sondas.

Estos dos cósmidos se secuenciaron en su totalidad mediante la técnica de la secuenciación a ciegas («shotgun sequencing»). Las secuencias de los insertos de estos dos cósmidos: pSPM7 y pSPM5 se pudieron ensamblar ya que, a pesar de que no se solapan, cada uno de los insertos comprendía una secuencia conocida en uno de sus extremos. En efecto, cada uno de estos insertos comprendía un fragmento de la secuencia de uno de los genes que codifica una enzima denominada «policétido sintasa» (PKS). Estos 5 genes se clonaron por Burgett S. et al. en 1996 (Patente americana US 5,945,320) (véase la figura 2). Así, se ha podido determinar una secuencia única de ADN genómico de S. ambofaciens. Una secuencia de 30943 nucleótidos que empieza en 5' de un sitio EcoRI situado en el primer gen PKS y que va hasta un sitio BamHI en 3' se presenta en la SEC ID nº 1. Esta secuencia corresponde a la región secuencia arriba de los genes de la PKS (véase la figura 2 y 3). Una segunda región de 11171 nucleótidos, que parte desde un sitio

PstI en 5' y que va hasta un sitio NcoI en 3' situado en el quinto gen de la PKS se presenta en la SEC ID nº 2. Esta segunda región es la región secuencia abajo de los genes de la PKS (estando secuencia abajo y secuencia arriba definidos por la orientación de los 5 genes de PKS orientados todos en el mismo sentido) (véase la figura 2 y 3).

EJEMPLO 4: Análisis de las secuencias nucleotídicas, determinación de los marcos de lectura abiertos y caracterización de los genes implicados en la biosíntesis de las espiramicinas. (no forma parte de la invención) Las secuencias obtenidas se analizaron gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Esto permitió identificar, entre los marcos de lectura abiertos, los marcos de lectura abiertos que presentan un uso de los codones típico de Streptomyces. Este análisis ha permitido determinar que esta región comprende 35 ORFs localizadas a ambos lados de cinco genes que codifican la enzima «policétido sintasa» (PKS). Respectivamente 10 y 25 ORFs se identificaron secuencia abajo y secuencia arriba de estos genes (estando secuencia abajo y secuencia arriba definidos por la orientación de los 5 genes de PKS orientados todos en el mismo sentido) (véase la figura 3). Así, los 25 marcos de lectura abiertos de este tipo, que ocupan una región de aproximadamente 31 kb (SEC ID nº 1 y figura 3) se identificaron secuencia arriba de los 5 genes que codifican la PKS y 10 que ocupan una región de aproximadamente 11,1 kb (SEC ID nº 2 y figura 3), se identificaron secuencia abajo de los genes de la PKS. Los genes de la región secuencia arriba se denominaron orf1, orf2, orf3, orf4, orf5, orf6, orf7, orf8, orf9c, orf10, orf11c, orf12, orf13c, orf14, orf15c, orf16, orf17, orf18, orf19, orf20, orf21c, orf22c, orf23c, orf24c y orf25c (SEC ID nº 23, 25, 28, 30, 34, 36, 40, 43, 45, 47, 49, 53, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82 y 84). Los genes de la región secuencia abajo se denominaron orf1*c, orf2*c, orf3*c, orf4*c, orf5* orf6*, orf7*c, orf8*, orf9*, orf10* (SEC ID nº 3, 5, 7, 9, 11, 13, 15, 17, 19 y 21). La «c» añadida en el nombre del gen significa para la ORF en cuestión que la secuencia codificante está en la orientación inversa (la hebra codificante es por lo tanto la hebra complementaria de la secuencia dada en la SEC ID nº 1 o SEC ID nº 2 para estos genes) (véase la figura 3).

Las secuencias proteicas deducidas de estos marcos de lectura abiertos se compararon con las presentes en las diferentes bases de datos, gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- search, COGs (Cluster of Orthologous Groups) (estos tres programas están accesible en particular ante la National Center for Biotechnology Información (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990), BEAUTY (Worley K. C. et al., 1995)), (estos dos programas están accesibles en particular en el centro de recursos INFOBIOGEN, Evry, Francia). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los susceptibles de estar implicados en la biosíntesis de espiramicina.

EJEMPLO 5: Inactivación de gen: principio de la construcción de una cepa de Streptomyces ambofaciens interrumpida Los métodos utilizados consisten en efectuar una sustitución de gen. El gen diana a interrumpir es sustituido por una copia de este gen interrumpido por un casete, que confiere la resistencia a un antibiótico (por ejemplo la apramicina o la higromicina), como se ilustra en la figura 9. Los casetes utilizados son bordeados a ambos lados por unos codones de terminación de la traducción, en todos los marcos de lectura y por unos terminadores de transcripción activos en

Streptomyces.

La inserción del casete en el gen diana puede acompañarse o no de una deleción en este gen diana. El tamaño de las regiones que flanquean el casete puede ir desde algunos centenares hasta varios millares de pares de bases.

Las construcciones necesarias a la inactivación del gen por el casete se obtuvieron en E. coli, organismo de referencia para la obtención de construcciones de ADN recombinante. El gen interrumpido se obtuvo en un plásmido que se replica en E. coli pero que no puede replicarse en Streptomyces.

Las construcciones se sub-clonaron después en unos vectores para permitir la transformación y la inactivación del gen deseado en S. ambofaciens. Para ello, se utilizaron dos plásmidos: - pOJ260 (Bierman M. et al., 1992) (véase el ejemplo 2) que confiere la resistencia a la apramicina en E. coli y

Streptomyces y que se empleó cuando el gen diana se interrumpió por un casete que confería la resistencia a la higromicina.

- pOSK1205 (4726pb). Este plásmido deriva del plásmido pBK-CMV (comercializado por la compañía Stratagene (LaJolla, California, USA)) en el que un fragmento AvrII que contenía la secuencia que codifica la resistencia a la Neomicina/Kanamicina se sustituyó por una secuencia que codifica la resistencia a la higromicina, conservando al mismo tiempo el promotor P SV40. Para ello, el plásmido pHP45-Ωhyg (Blondelet-Rouault et al., 1997) se ha digerido mediante las enzimas NotI y PflmI y el fragmento que confiere la resistencia a la higromicina se ha sub- clonado a nivel del sitio AvrII del vector pBK-CMV después de que todos los extremos hayan sido convertidos en extremos romos por tratamiento con la enzima de Klenow. En pOSK1205, el casete que confiere la resistencia a la higromicina está precedido del promotor pSV40. Este plásmido confiere la resistencia a la higromicina en E. coli y

Streptomyces y se empleó cuando el gen diana se interrumpió por un casete que confería la resistencia a la apramicina.

Los casetes se han introducido en el gen diana bien mediante clonación utilizando unos sitios de restricción presentes en el gen diana, o bien por recombinación entre secuencias cortas idénticas, como se describe por ejemplo por Chaveroche

et al. (Chaveroche MK et al., 2000).

El plásmido que lleva el gen interrumpido por el casete se puede introducir en Streptomyces ambofaciens, por ejemplo por conjugación entre E. coli y Streptomyces (Mazodier P, et al., 1989). Esta técnica se utilizó en el caso en el que el vector de base es el vector pOJ260. Se puede utilizar una segunda técnica: la técnica de la transformación de protoplastos después de la desnaturalización por tratamiento alcalino del ADN (Kieser, T et al., 2000), para aumentar la frecuencia de recombinación, como se describe por ejemplo por Oh & Chater (Oh & Chater, 1997). Esta técnica se utilizó en el caso en el que el vector de base es pOJ260 o pOSK1205 (véase a continuación). Los transformantes son después seleccionados con el antibiótico que corresponde al casete presente en el gen diana (véase la figura 9, antibiótico B). Se selecciona así una mezcla de clones entre los cuales hubo integración por un solo o por dos eventos de recombinación. En una segunda fase, se buscan los clones sensibles al antibiótico para el cual el gen de resistencia está presente en el vector (fuera del casete de recombinación) (véase la figura 9, antibiótico A). Se pueden seleccionar así los clones para los cuales hubo en principio dos eventos de recombinación que conducen a la sustitución del gen salvaje por la copia interrumpida por el casete. Estas etapas están esquematizadas en la figura 9.

Se pueden utilizar varios casetes para la interrupción de los genes dianas. Se puede utilizar, por ejemplo, el casete Ωhyg

que confiere la resistencia a la higromicina (Blondelet-Rouault et al., 1997, número de acceso GenBank: X99315).

EJEMPLO 6: Construcción de una cepa de Streptomyces ambofaciens interrumpida en fase en el gen orf3 (no forma parte de la invención) El gen orf3 se interrumpió por el casete Ωhyg (véase el ejemplo 2.2) y se ha podido demostrar que una cepa orf3:: Ωhyg no produce más espiramicina, lo que confirma la implicación de uno o más genes de la región clonada en la biosíntesis de las espiramicinas (véase el ejemplo 2.2). A la vista de su orientación, una co-transcripción de las ORFs 1 a 7 es probable (véase la figura 3) y el fenotipo observado (no productor de espiramicinas) puede deberse a la inactivación de uno o arios de los genes co-transcritos con orf3. Para confirmar la implicación de orf3 en la biosíntesis de las espiramicinas, se efectuó una nueva inactivación del gen orf3, siendo esta última realizada en fase. Para ello, se ha suprimido un fragmento DraIII interno a orf3 de 504 pares de bases. Un fragmento de ADN obtenido a partir de pOS49.1, que va del sitio EcoRI situado en la posición 1 (SEC ID nº 1) hasta el sitio SacI situado en la posición 5274 (SEC ID nº 1) y que comprende una deleción entre los dos sitios DraIII en las posiciones 2563 y 3067 (504 nucleótidos retirados) se clonó en el plásmido pOJ260 (Bierman M. et al., 1992). El plásmido así obtenido se denominó pOS49.67.

El inserto de pOS49.67 está por lo tanto constituido por un fragmento de ADN de S. ambofaciens que contiene los genes

orf1, orf2, orf3 con la deleción en fase, orf4 y una parte de orf5. El vector en el que este inserto se sub-clonó es pOJ260, el plásmido pOS49.67 confiere por lo tanto la resistencia a la apramicina y se introdujo por transformación de protoplastos en la cepa OS49.16 (véase el ejemplo 2). Al ser la cepa OS49.16 resistente a la higromicina, se obtuvieron unos transformantes hygR y apraR. Después de dos pasos de tales clones en un medio no selectivo, se buscaron los clones sensibles a la apramicina y a la higromicina (apraS y hygS). En algunos de estos clones, se espera en efecto que un evento de recombinación entre secuencias homólogas conduzcan a la sustitución de la copia de orf3 interrumpida por el casete Ωhyg (contenido en el genoma de la cepa OS49.16) por la copia de orf3 con la deleción en fase presente en el vector. Los clones que resultan de esta recombinación son esperados como apraS y hygS después de la eliminación de las secuencias del vector. El genotipo de las cepas así obtenidas se puede verificar por hibridación o por PCR y secuenciación del producto de PCR (para verificar que una sola copia de orf3 suprimida en fase está presente en el genoma de los clones obtenidos). Se obtuvieron así unos clones que sólo tienen la copia de orf3 con una deleción en fase y se verificó su genotipo. Se seleccionó más particularmente un clon que presenta las características buscadas y se denominó OS49.67.

Una muestra de la cepa OS49.67 fue depositada en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro 1-2916.

EJEMPLO 7: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf8 (no forma parte de la invención) Para realizar la inactivación del gen orf8, se obtuvo une construcción en la que el casete Ωhyg se introdujo en la secuencia que codifica orf8. Para ello, se ha construido en primer lugar el plásmido pOS49.88. El plásmido pOS49.88 deriva del plásmido pUC19 (número de acceso GenBank M77789) por inserción de un fragmento de 3,7 kb (fragmento PstI-EcoRI obtenido a partir del cósmido pSPM5), que contiene el final de orf7, orf8 y el principio de orf9, clonado en los sitios PstI-EcoRI de pUC19. El casete Ωhyg (en forma de un fragmento BamHI, convertido en extremo romo mediante el tratamiento con la enzima de Klenow) se clonó a nivel del sitio único SalI de pOS49.88 situado en orf8 después de que todos los extremos hayan sido convertidos en extremos romos por tratamiento con la enzima de Klenow.

Al ser el clonado un extremo romo, se obtuvieron dos tipos de plásmidos según el sentido de inserción del casete: pOS49.106 en el que los genes hyg y orf8 están en la misma orientación y pOS49.120 en el que los genes hyg y orf8 están en orientaciones opuestas. El inserto del plásmido pOS49.106 se sub-clonó después en el plásmido pOJ260 para dar pOS49.107. Para ello, el plásmido pOS49.106 se ha digerido por la enzima Asp718I y los extremos se han convertido en extremos romos por tratamiento con la enzima de Klenow, este producto de digestión se ha redigerido por la enzima PstI y el fragmento que contiene el gen orf8 en el que el casete Ωhyg se ha insertado, se ha clonado en el vector pOJ260 (véase anteriormente). Para ello, el vector pOJ260 se ha digerido mediante las enzimas EcoRV y PstI y se ha utilizado para la ligación. Esta manipulación permite por lo tanto obtener una ligación orientada, ya que cada uno de los dos fragmentos es un extremo romo de un lado y PstI del otro. El plásmido obtenido se denominó pOS49.107.

El plásmido pOS49.107 se ha introducido en la cepa ATCC23877 de S. ambofaciens por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación de los protoplastos, los clones se seleccionan por su resistencia a la higromicina. Los clones resistentes a la higromicina son después replicados respectivamente en un medio con higromicina (antibiótico B) y en un medio con apramicina (antibiótico A) (véase la figura 9). Los clones que resisten a la higromicina (HygR) y sensibles a la apramicina (ApraS) son en principio aquellos en los que se ha producido un doble evento de "crossing over", y que poseen el gen orf8 interrumpido por el casete Ωhyg. La sustitución de la copia salvaje de orf8 por la copia interrumpida por el casete Ωhyg se verificó por transferencia Southern. Así, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana e hibridado con una sonda que corresponde al casete Ωhyg para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda el inserto PstI-EcoRI que contiene el final de orf7, orf8 y el principio de orf9 de un tamaño de aproximadamente 3,7 kb del plásmido pOS49.88. La verificación del genotipo se puede realizar mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado un clon orf8::Ωhyg y se ha denominado OS49.107. Una muestra de la cepa OS49.107 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2917.

EJEMPLO 8: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf10 (no forma parte de la invención) Un fragmento de ADN de 1,5 kb interno al gen orf10 se ha obtenido por PCR utilizando como matriz, el ADN genómico de S. ambofaciens y los cebadores siguientes: SRMR1: 5' CTGCCAGTCCTCTCCCAGCAGTACG 3' (SEC ID nº 89) SRMR2: 5' TGAAGCTGGACGTCTCCTACGTCGG 3' (SEC ID nº 90) Este fragmento de ADN procedente de la PCR se ha clonado en el vector pCR2.1 comercializado por la compañía Invitrogen (Carlsbad, California, USA). El plásmido así obtenido se denominó pOS49.32. El casete Ωhyg (en forma de un fragmento BamHI, véase anteriormente) se ha clonado a nivel del sitio único BstEII interno al fragmento del gen orf10,

después de que todos los extremos se hayan convertido en extremos romos por tratamiento con la enzima de Klenow. La clonación es de extremo romo, por lo tanto se han obtenido dos tipos de plásmidos según el sentido de inserción del casete: pOS49.43 en el que los genes hyg y orf10 están en la misma orientación y pOS49.44 en el que los genes hyg y orf10 están en orientaciones opuestas. El inserto del plásmido pOS49.43 se ha transferido (en forma de un fragmento

Asp718I-XbaI cuyos extremos se han convertido en extremos romos por tratamiento con la enzima de Klenow) en el sitio

EcoRV del plásmido pOJ260, lo que ha permitido obtener el plásmido pOS49.50. El plásmido pOS49.50 que contiene el fragmento del gen orf10 interrumpido por el casete Ωhyg se ha introducido en la cepa ATCC23877 de Streptomyces ambofaciens. Después de la transformación, los clones se seleccionan por su resistencia a la higromicina. Los clones que resisten a la higromicina son después replicados respectivamente en un medio con higromicina (antibiótico B) y en un medio con apramicina (antibiótico A) (véase la figura 9). Los clones que resisten a la higromicina (HygR) y sensibles a la apramicina (ApraS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf10 interrumpido por el casete Ωhyg. Se han obtenido así unos clones que poseen el marcador de resistencia a la higromicina llevado por el casete y que han perdido el marcador de resistencia a la apramicina llevado por el vector pOJ260. El evento de sustitución de la copia salvaje de orf10 por la copia interrumpida orf10::Ωhyg se ha verificado por transferencia Southern. Así, el ADN genómico total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana hibridada con una sonda que corresponde al casete Ωhyg para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda el producto PCR de 1,5 kb interno al gen orf10 (véase anteriormente).

Un clon que presenta las características esperadas (orf10::Ωhyg) se ha seleccionado más particularmente y denominado OS49.50. En efecto, se ha podido verificar gracias a las dos hibridaciones que el casete Ωhyg estaba muy presente en el genoma de este clon y que se obtiene bien el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación, del gen salvaje por la copia interrumpida por el casete Ωhyg en el genoma de este clon. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

EJEMPLO 9: Inactivación de genes: principio de la construcción de una cepa de Streptomyces ambofaciens interrumpida según la técnica de los «casetes escindibles» (véase la figura 9 y 10) Se puede utilizar un segundo tipo de casetes para la inactivación de genes: los casetes denominados «casetes escindibles». Estos casetes presentan la ventaja de poder ser escindidos en Streptomyces por un evento de recombinación específica de sitio tras ser introducidos en el genoma de S. ambofaciens. El objetivo es inactivar algunos genes en cepas de Streptomyces sin dejar en la cepa final marcadores de selección o grandes secuencias de ADN que no pertenezcan a la cepa. Después de la escisión, subsiste únicamente una secuencia corta de aproximadamente una treintena de pares de bases (denominado sitio «cicatricial») en el genoma de la cepa (véase la figura 10).

La realización de este sistema consiste, en una primera fase, en la sustitución de la copia salvaje del gen diana (gracias a dos eventos de recombinación homóloga, véase la figura 9) por una construcción en la que un casete escindible se ha insertado en este gen diana. La inserción de este casete está acompañada de una deleción en el gen diana (véase la figura 9). En una segunda fase, se provoca la escisión del casete escindible del genoma de la cepa. El casete escindible funciona gracias a un sistema de recombinación específica del sitio y tiene como ventaja permitir la obtención de mutantes de Streptomyces que no llevan finalmente ningún gen de resistencia. Se libra también de eventuales efectos polares sobre la expresión de los genes situados secuencia abajo del o de los genes inactivados (véase la figura 10).

El uso de casetes escindibles se ha descrito y utilizado en numerosos organismos, incluyendo las células de mamífero, de levaduras y en E. coli (Bayley et al., 1992; Brunelli y Pall, 1993; Camilli et al., 1994; Dale y Ow, 1991; Russell et al., 1992; Lakso et al., 1992). Estos casetes escindibles utilizan todos la recombinasa específica del sitio Cre que actúa sobre los sitios lox. Este sistema de recombinación proviene del bacteriófago P1.

Para la construcción de un sistema de tipo «casete escindible» en Streptomyces, se ha aprovechado el sistema de recombinación específica del sitio descrito para el elemento genético móvil pSAM2 de Streptomyces ambofaciens (Boccard et al., 1989a y b). El sistema desarrollado consiste, en una primera fase, en construir un vector recombinante que comprenda el gen a interrumpir en el que se inserta un casete escindible. La inserción en el gen diana del casete escindible se acompaña de una deleción en el gen diana. Se puede realizar mediante clonación utilizando unos sitios de restricción presentes en el gen diana o por recombinación entre secuencias cortas idénticas, como se describe por ejemplo por Chaveroche et al. (Chaveroche MK et al., 2000). El casete escindible se puede construir utilizando por ejemplo el casete Ωhyg (Blondelet Rouault et al., 1997). Este casete se ha bordeado por unas secuencias attR y attL que flanquean normalmente la copia integrada de pSAM2 (véase la figura 15). Las secuencias attL y attR contienen todas los sitios necesarios para la recombinación sitio-específico que permite la escisión de pSAM2 o de cualquier fragmento de ADN situado entre estas dos regiones (Sezonov et al., 1997, Raynal et al., 1998). La construcción de tal casete no está por supuesto limitada a la utilización de un casete Ωhyg, sino que otros casetes de resistencias pueden servir de base para la construcción de este casete (por ejemplo el casete Ωaac o Ωvph (Blondelet Rouault et al., 1997)).

Después de la obtención de esta construcción, la cepa de Streptomyces se transforma con el plásmido recombinante.

Los transformantes son después seleccionados con el antibiótico que corresponde al casete presente en el gen diana (véase la figura 9, antibiótico B, se trata por ejemplo de una selección por higromicina si el casete escindible deriva del casete Ωhyg). Se selecciona así una mezcla de clones entre los cuales hubo integración por un único o por dos eventos de recombinación. En una segunda fase, se buscan los clones sensibles al antibiótico para los cuales el gen de resistencia está presente en el vector (fuera del casete de recombinación) (véase la figura 9, antibiótico A). Se pueden seleccionar así los clones para los cuales hubo en principio dos eventos de recombinación que conducen a la sustitución del gen salvaje por la copia interrumpida por el casete. Estas etapas están esquematizadas en la figura 9, el genotipo de los clones así obtenidos se verifica mediante transferencia Southern y se selecciona una cepa que presenta las características deseadas (la sustitución del gen salvaje por la copia interrumpida por el casete escindible).

En una segunda fase, la cepa seleccionada anteriormente, se transforma por un plásmido que permite la expresión de los genes xis y int que son ambos necesarios para la recombinación específica entre los sitios attR y attL. Esta recombinación conlleva el inicio del casete escindible del genoma de la cepa, gracias a un evento de recombinación (véase la figura 10) (Raynal et al., 1998). Es interesante seleccionar el vector que tiene los genes xis y int entre los vectores relativamente inestables en Streptomyces (por ejemplo derivado del vector Streptomyces pWHM3, (Vara et al., 1989)), esto permite obtener una cepa que ha perdido este último vector después de algunos ciclos de esporulación en ausencia de presión de selección.

Para escindir el casete, se puede utilizar por ejemplo el plásmido pOSV508 (véase la figura 14) que está introducido por transformación de protoplastos en la cepa de S. ambofaciens que contiene un gen interrumpido por el casete escindible. El plásmido pOSV508 deriva del plásmido pWHM3 (Vara J et al.,1989) (véase la figura 13) en el que se han añadido los genes xis y int de pSAM2 (Boccard F. et al., 1989b) colocados bajo el control del promotor ptrc (Amann, E. et al., 1988).

Los genes xis y int colocados bajo el control del promotor ptrc se han sub-clonado en el plásmido pWHM3 a partir del plásmido pOSint3 (Raynal et al., 1998) (véase la figura 14). La introducción en la cepa mutante del plásmido pOSV508 que lleva los genes xis y int de pSAM2 permitirá la escisión eficaz por recombinación específica del sitio del casete escindible entre los sitios attL y attR que flanquean este casete (Raynal A. et al., 1998) (figura 10). Entre los transformantes, seleccionados por su resistencia a la tiostreptona debida al gen tsr llevado por pOSV508, se seleccionan aquellos que se han vuelto sensibles al antibiótico al que la presencia del casete confiere la resistencia (véase la figura 10). La escisión es eficaz, y se ha observado que más del 90% de los transformantes son de este tipo. Después de uno o varios ciclos de crecimiento y esporulación sobre un medio sólido desprovisto de tiostreptona, se obtienen unos clones que han perdido el plásmido pOSV508. Estos clones se pueden localizar por su sensibilidad a la tiostreptona. La secuencia del gen diana suprimido puede ser verificada por PCR y secuenciación del producto PCR.

Finalmente, la cepa resultante lleva a nivel del gen inactivado (deleción interna por ejemplo) un sitio att «cicatricial» que corresponde al sitio attB mínimo (Raynal et al., 1998), procedente de la recombinación entre los sitios attR y attL. Este sitio attB mínimo que subsiste es parecido al presente naturalmente en las cepas de Streptomyces ambofaciens, Streptomyces pristinaespiralis y Streptomyces lividans (Sezonov et al., 1997).

El gen que se desea inactivar puede ser co-transcrito con otros genes situados secuencia abajo. Para evitar que la inactivación de uno de los genes tenga un efecto polar sobre la expresión de los genes secuencia abajo en el operón, es importante obtener una deleción en fase después de la escisión del casete. El sistema de los casetes escindibles tal como se ha descrito anteriormente permite responder a tal exigencia. El experto en la materia podrá, en efecto, fácilmente construir tres casetes escindibles distintos, dejando estos después de la escisión una secuencia de 33, 34 o 35 nucleótidos respectivamente, sin codón de parada, sea cual sea el marco de lectura. Conociendo la secuencia del gen diana y el tamaño de la deleción asociada a la inserción del casete, es posible seleccionar entre estos tres casetes escindibles de manera que la escisión conduzca a una deleción en fase. En los 33, 34 o 35 nucleótidos vueltos a añadir, 26 corresponden a la secuencia attB mínima (véase la figura 27).

En el caso de la presente solicitud, se han utilizado dos casetes escindibles. Estos dos casetes son los siguientes:

att1Ωhyg+ (SEC ID nº 91) y att3Ωaac- (SEC ID nº 92), estos casetes dejan respectivamente 33 y 35 nucleótidos después de la escisión. Comprenden respectivamente el casete Ωhyg o el casete Ωaac, correspondiendo los signos + y - a la orientación del casete de resistencia. Estos dos casetes se han construido y clonado a nivel del sitio EcoRV del vector pBC SK+ cuyo sitio HindIII se ha suprimido previamente. Los plásmidos obtenidos se denominaron patt1Ωhyg+ y patt3Ωaac- respectivamente. Los casetes escindibles pueden ser sacados fácilmente mediante una digestión del plásmido por EcoRV.

EJEMPLO 10: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf2 (no forma parte de la invención) Se ha realizado la inactivación del gen orf2 gracias a la técnica de los casetes escindibles (véase anteriormente). La cepa de inicio utilizada es la cepa Streptomyces ambofaciens OSC2 que deriva de la cepa ATCC23877. Sin embargo, la cepa OSC2 difiere de la cepa ATCC23877 por que ha perdido el elemento genético móvil pSAM2 (Boccard et al., 1989a y b). Este elemento móvil puede ser perdido de manera espontánea durante la protoplastización (acción del lisozima para digerir la pared bacteriana y fragmentar el micelio (Kieser et al., 2000)) y de la regeneración de los protoplastos de la cepa ATCC23877. Para seleccionar los clones que han perdido el elemento pSAM2, se ha llevado a cabo un cribado, basado en la represión del gen pra por el represor de transcripción KorSA (Sezonov et al., 1995) (Sezonov G. et al., 2000). Para ello, un fragmento de ADN que contiene el promotor del gen pra colocado secuencia arriba del gen aph (que confiere la resistencia a la kanamicina y desprovisto de su propio promotor) se ha clonado en el vector inestable pWHM3Hyg, derivando este último del plásmido pWHM3 (Vara et al., 1989) en el que el gen tsr se ha sustituido por el gen hyg (que confiere la resistencia a la higromicina). El plásmido así obtenido se denominó pOSV510. La cepa ATCC23877 se ha transformado después de la protoplastización por el plásmido pOSV510. El promotor Pra es un promotor reprimido por el represor KorSA, el gen que codifica este último está situado dentro del elemento móvil pSAM2 (Sezonov G. et al., 2000). Después de la transformación por el plásmido pOSV510, las bacterias transformadas se seleccionan por su resistencia a la kanamicina (debida al gen aph llevado por pOSV510). Los clones que han perdido el elemento integrativo pSAM2 han perdido el represor KorSA y el promotor Pra no es por lo tanto reprimido más y permite la expresión del gen de resistencia a la kanamicina aph. Una selección por la kanamicina después de la transformación por el plásmido pOSV510 permite por lo tanto seleccionar los clones que han perdido el elemento integrativo pSAM2 (y por lo tanto KorSA) y que poseen el plásmido pOSV510. El plásmido pOSV510 es inestable, por lo tanto después de algunos ciclos de esporulación sin antibiótico, se replican unos clones aislados en un medio con kanamicina, en un medio con higromicina y en un medio sin antibiótico. Los clones sensibles a la kanamicina y a la higromicina han perdido pOSV510. La pérdida del elemento pSAM2 se ha verificado por hibridación y PCR. Se ha seleccionado un clon que presenta las características deseadas y se ha denominado OSC2.

Una muestra de la cepa OSC2 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2908.

La inactivación del gen orf2 se ha realizado gracias a la técnica de los casetes escindibles (véase anteriormente y figura 10). Para ello, un inserto de 4,5 kb cuya secuencia parte del sitio EcoRI situado en la posición 1 hasta el sitio BamHI situado en la posición 4521 (SEC ID nº 1), se ha sub-clonado a nivel de los sitios EcoRI y BamHI del plásmido pUC19 (número de acceso GenBank M77789) a partir del cósmido pSPM5. El plásmido así obtenido se denominó pOS49.99.

Este plásmido se ha introducido en la cepa E. coli KS272 que contenía ya el plásmido pKOBEG (Chaveroche et al., 2000) (véase la figura 12).

Paralelamente, el casete escindible att3Ωaac- (SEC ID nº 92, véase anteriormente) se ha amplificado por PCR utilizando como matriz el plásmido pOSK1102 (El plásmido pOSK1102 es un plásmido derivado del vector pGP704Not

(Chaveroche et al., 2000) (Miller VL & Mekalanos JJ, 1988) en el que el casete att3Ωaac- se ha clonado como un fragmento EcoRV en el sitio único EcoRV de pGP704Not) y con la ayuda de los cebadores siguientes: ORF2A 5' CCCGCGCGGCAGCCTCTCCGTGATCGAGTCCGGCGTGACCATCGCGCGCGCTTCGTTCGG-3' (SEC ID nº 93) ORF2B 5' GCTCCGTGCGTCATGCAGGAAGGTGTCGTAGTCGCGGTAGATCTGCCTCTTCGTCCCGAA-3' (SEC ID nº 94) Los 40 desoxi-nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen diana (orf2 en el presente caso) y los 20 desoxi-nucleótidos situados generalmente en 3' (representados en negrita anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3Ωaac- (véase la figura 11).

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli que contiene los plásmidos pKOBEG y pOS49.99 como se ha descrito (Chaveroche et al., 2000) (véase la figura 12). Así, las bacterias se han transformado por electroporación y se han seleccionado por su resistencia a la apramicina. Los plásmidos de los clones obtenidos se han extraído y digerido por varias enzimas de restricción, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3Ωaac-) en el gen diana (orf2), es decir si hubo bien una recombinación homóloga entre los extremos del producto PCR y el gen diana (Chaveroche et al., 2000). La verificación de la construcción se puede también realizar mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo plásmido posee el perfil esperado y el plásmido correspondiente se denominó pSPM17. Este plásmido deriva de pOS49.99 en el que orf2 está interrumpido por el casete apramicina (véase la figura 12).

La inserción del casete se acompaña de una deleción en orf2, entre los nucleótidos 211 y 492 de la parte codificante de orf2.

El plásmido pSPM17 se ha digerido por la enzima EcoRI, después los extremos se convirtieron en extremos romos por tratamiento con la enzima de Klenow, este producto de digestión se ha digerido después por la enzima XbaI y el inserto que contiene el gen orf2 deletado se ha clonado en el vector pOSK1205 (véase anteriormente). Para ello, el vector pOSK1205 se ha digerido por la enzima BamHI, después los extremos se convirtieron en extremos romos por tratamiento con la enzima de Klenow, este producto se ha digerido después por la enzima XbaI, y se utilizó para la ligación con el inserto obtenido a partir de pSPM17 como anteriormente. Esta manipulación permite por lo tanto una ligación orientada, ya que cada uno de los dos fragmentos es un extremo romo de un lado y XbaI del otro. El plásmido así obtenido se denominó pSPM21, lleva un gen de resistencia a la higromicina (parte vector) y un inserto en el que el gen orf2 suprimido es sustituido por el casete att3Ωaac-.

El vector pSPM21 se ha introducido en la cepa Streptomyces ambofaciens OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones que resisten a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con higromicina (antibiótico A) (véase la figura 9). Los clones que resisten a la apramicina (ApraR) y sensibles a la higromicina (HygS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf2 interrumpido por el casete att3Ωaac-. Se han seleccionado estos clones y se ha verificado la sustitución de la copia salvaje de orf2 por la copia interrumpida por el casete. La presencia del casete att3Ωaac- se ha verificado por PCR sobre columna. También se ha efectuado una hibridación. Para ello, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana e hibridado con una sonda de 3 kb que corresponde a un fragmento EcoRI-BamHI del inserto del plásmido pOS49.99 (véase anteriormente). Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado un clon que presenta las características esperadas y se ha denominado SPM21. Se ha podido verificar, gracias a la PCR y a la hibridación, que el casete att3Ωaac- estaba muy presente en el genoma de este clon y que se obtenía bien el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación, del gen salvaje por la copia interrumpida por el casete att3Ωaac- en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf2::att3Ωaac-.

Una muestra de la cepa SPM21 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2914.

La cepa SPM21 se ha transformado por el vector pOSV508 por transformación de protoplastos para provocar la escisión del casete (véase la figura 14). El plásmido pOSV508 deriva del plásmido pWHM3 (Vara J et al., 1989) (véase la figura 13) en el que se han añadido los genes xis y int de pSAM2 (Boccard F. et al., 1989b) colocados bajo el control del promotor ptrc (Amann, E. et al., 1988) (véase la figura 14). La introducción en la cepa SPM21 del plásmido pOSV508 que lleva los genes xis y int de pSAM2 permite la escisión eficaz por recombinación específica del sitio del casete escindible entre los sitios attL y attR que flanquean este casete (Raynal A. et al., 1998) (figura 10). Entre los transformantes seleccionados por su resistencia a la tiostreptona debida al gen tsr llevado por pOSV508, se seleccionan aquellos que se han vuelto sensibles a la apramicina cuyo gen de resistencia es llevado por el casete att3Ωaac-, la escisión conlleva en efecto la pérdida de este gen de resistencia (véase la figura 10). El plásmido pOSV508 es inestable y después de dos pasos sucesivos sobre un medio sin antibiótico unos clones aislados son replicados en un medio con tiostreptona y sobre un medio sin tiostreptona. Los clones sensibles a la tiostreptona han perdido pOSV508. Se ha verificado que la escisión del casete conduce correctamente a deleción en fase en el gen orf2 por PCR y la secuenciación del producto PCR, la escisión del casete deja en efecto una secuencia «cicatricial» att3 característica (que es similar al sitio attB de origen después de la recombinación entre los sitios attL y attR): 5' ATCGCGCGCGCTTCGTTCGGGACGAAGAGGTAGAT 3' (SEC ID nº 95).

La cepa así obtenida y que posee el genotipo deseado (orf2::att3) se denominó SPM22.

Una muestra de la cepa SPM22 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2915.

EJEMPLO 11: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf12 (no forma parte de la invención) Para la inactivación de off12, orf13c y orf14 se ha empleado un mismo plásmido de partida (pSPM504), para introducir en diferentes posiciones un casete de tipo «casete escindible». Este plásmido posee un inserto de 15,1 kb que corresponde a la región de orf7 a orf17. Para construir este plásmido, se ha clonado un fragmento BglII de 15,1 kb que proviene de la digestión del cósmido pSPM7 (véase anteriormente) en el plásmido pMBL18 (Nakano et al., 1995) digerido por BamHI. Al ser los extremos BamHI y BglII compatibles, se obtiene después de la ligación el plásmido pSPM502. La totalidad del inserto de pSPM502 se ha sub-clonado después (en forma de un fragmento HindIIII/NheI) en el plásmido pOSK1205 (digerido por HindIIII/NheI) lo que ha permitido obtener el plásmido pSPM504.

Este plásmido se ha introducido en la cepa E. coli KS272 que contenía ya el plásmido pKOBEG (Chaveroche et al., 2000) (véase la figura 12).

En paralelo, se ha amplificado el casete escindible att3Ωaac- por PCR utilizando como matriz el plásmido pOSK1102 (el plásmido pOSK1102 es un plásmido derivado del vector pGP704Not (Chaveroche et al., 2000) (Miller VL & Mekalanos JJ, 1988) en el que el casete att3Ωaac- se ha clonado como un fragmento EcoRV en el sitio único EcoRV de pGP704Not), los cebadores utilizados son los siguientes: EDR8:5' CGGGATGATCGCTTGTCCGGCGGCCGGATGCCTAGCCTCATCGCGCGCGCTTCGTTCGG 3' (SEC ID nº 96) EDR9:5' CCCGATCCAGAACGTCTGGTCGGTGATCAGGTCGCTGTTCATCTGCCTCTTCGTCCCGAA 3' (SEC ID nº 97) Los 40 (sólo 39 para EDR8) desoxi-nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen diana (orf12 en el presente caso) y los 20 desoxi-nucleótidos situados generalmente en 3' (representados en negrita anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3Ωaac- (véase la figura 11).

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli KS272 que contiene los plásmidos pKOBEG y pSPM504 (véase anteriormente), como se describe por Chaveroche et al. (Chaveroche et al., 2000) (véase la figura 12 para el principio, el plásmido pOS49.99 debe ser sustituido por el plásmido pSPM504 y el plásmido obtenido no es ya pSPM17, sino pSPM507). Así, las bacterias se han transformado por electroporación por este producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los plásmidos de los clones obtenidos se han extraído y digerido por varias enzimas de restricción, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3Ωaac-) en el gen diana (orf12), es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana (Chaveroche et al., 2000). La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo plásmido posee el perfil esperado y el plásmido correspondiente se denominó pSPM507. Este plásmido deriva de pSPM504 en el que orf12 está interrumpido por el casete att3Ωaac- (véase la figura 12). La inserción del casete se acompaña de una deleción en el gen orf12, la interrupción empieza a nivel del trigésimo codón de orf12. Después del casete, quedan los 46 últimos codones orf12.

El vector pSPM507 se ha introducido en la cepa Streptomyces ambofaciens OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones que resisten a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con higromicina (antibiótico A) (véase la figura 9). Los clones que resisten a la apramicina (ApraR) y sensibles a la higromicina (HygS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf12 interrumpido por el casete att3Ωaac-. Estos clones se han seleccionado más particularmente y se ha verificado por hibridación la sustitución de la copia salvaje de orf12 por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3Ωaac- para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda un fragmento de ADN obtenido por PCR y que corresponde a una parte muy ancha de la secuencia que codifica el gen orf12.

Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf12::att3Ωaac-) y se ha denominado SPM507. En efecto, se ha podido verificar, gracias a las dos hibridaciones, que el casete att3Ωaac- estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación del gen salvaje por la copia interrumpida por el casete att3Ωaac-

en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf12::att3Ωaac- y se denominó SPM507. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf12, a la vista de la orientación de los genes (véase la figura 3). En efecto, el hecho de que orf13c esté orientado en el sentido opuesto a orf12 muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite no obstante tener la posibilidad de librarse del marcador de selección en cualquier momento, en particular por transformación por el plásmido pOSV508. Se ha depositado una muestra de la cepa SPM507 en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2911.

EJEMPLO 12: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf13c (no forma parte de la invención) Se ha amplificado el casete escindible att3Ωaac- por PCR utilizando como matriz el plásmido pOSK1102 (véase anteriormente) con la ayuda de los cebadores siguientes: EDR3:5' ACCGGGGCGGTCCTCCCCTCCGGGGCGTCACGGCCGCGGAATCTGCCTCTTCGTCCCGAA 3' (SEC ID nº 98) EDR4:5' CACGCAGCGAGCCGACGCACTGATGGACGACACGATGGCCPATCGCGCGCGCTTCGTTCGG 3'

(SEC ID nº 99) Los 40 desoxi-nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen diana (orf13c en el presente caso) y los 20 desoxi-nucleótidos situados generalmente en 3' (representados en negrita anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3Ωaac- (véase la figura 11).

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli KS272 que contiene los plásmidos pKOBEG y pSPM504 (véase anteriormente), como se describe por Chaveroche et al. (Chaveroche et al., 2000) (véase la figura 12 para el principio, el plásmido pOS49.99 debe ser sustituido por el plásmido pSPM504 y el plásmido obtenido no es ya pSPM17, sino pSPM508). Así, las bacterias se han transformado por electroporación por el producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los plásmidos de los clones obtenidos se han extraído y digerido por varias enzimas de restricción, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3Ωaac-) en el gen diana (orf13c), es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana (Chaveroche et al., 2000). La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo plásmido posee el perfil esperado y el plásmido correspondiente se denominó pSPM508. Este plásmido deriva de pSPM504 en el que orf13c está interrumpido por el casete apramicina (véase la figura 12). La inserción del casete se acompaña de una deleción en el gen orf13c, la interrupción empieza a nivel del sexto codón de orf13c. Después del casete, quedan los 3 últimos codones de orf13c.

El vector pSPM508 se ha introducido en la cepa Streptomyces ambofaciens OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones son seleccionados por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con higromicina (antibiótico A) (véase la figura 9). Los clones resistentes a la apramicina (ApraR) y sensibles a la higromicina (HygS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf13c interrumpido por el casete att3Ωaac-. Estos clones fueron seleccionaron más particularmente y se ha verificado por hibridación la sustitución de la copia salvaje de

orf13c por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3Ωaac- para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda un producto de PCR que corresponde a una secuencia desbordante de un centenar de pares de base secuencia arriba y secuencia abajo de la secuencia codificante de orf13c. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (or13c::att3Ωaac-) y denominado SPM508. En efecto, se ha podido verificar gracias a las dos hibridaciones que el casete att3Ωaac- estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación del gen salvaje por la copia interrumpida por el casete att3Ωaac-

en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf13c::att3Ωaac- y se denominó SPM508. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf13c, a la vista de la orientación de los genes (véase la figura 3), el hecho de que orf14 esté orientado en el sentido opuesto a orf13c muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento. Una muestra de la cepa SPM508 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2912.

EJEMPLO 13 Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf14 (no forma parte de la invención) El casete escindible att3Ωaac- se ha amplificado por PCR utilizando como matriz el plásmido pOSK1 102 (véase anteriormente) con la ayuda de los cebadores siguientes: EDR5: 5'GGGCGTGAAGCGGGCGAGTGTGGATGTCATGCGAGTACTCATCGCGCGCGCTTCGTTCGG 3'

(SEC ID nº 100) EDR6: 5'CGGGAAACGGCGTCGCACTCCTCGGGGGCCGCGTCAGCCCATCTGCCTCTTCGTCCCGAA 3' (SEC ID nº 101) Los 40 desoxi-nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen diana (orf14 en el presente caso) y los 20 desoxi-nucleótidos situados generalmente en 3' (representados en negrita anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3Ωaac- (véase la figura 11).

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli KS272 que contiene los plásmidos pKOBEG y pSPM504 (véase anteriormente), como se describe por Chaveroche et al. (Chaveroche et al., 2000) (véase la figura 12 para el principio, el plásmido pOS49.99 debe estar sustituido por el plásmido pSPM504 y el plásmido obtenido no es ya pSPM17, sino pSPM509). Así, las bacterias se han transformado por electroporación por el producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los plásmidos de los clones obtenidos se han extraído y digerido por varias enzimas de restricción, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3Ωaac-) en el gen diana (orf14), es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana (Chaveroche et al., 2000). La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo plásmido posee el perfil esperado y el plásmido correspondiente se denominó pSPM509. Este plásmido deriva de pSPM504 en el que orf14 está interrumpido por el casete apramicina (véase la figura 12). La inserción del casete se acompaña de una deleción en el gen orf14, la interrupción empieza a nivel del cuarto codón de

orf14. Después del casete, permanece el último codón de orf14.

El vector pSPM509 se ha introducido en la cepa Streptomyces ambofaciens. OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, se seleccionan los clones por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con higromicina (antibiótico A) (véase la figura 9). Los clones resistentes a la apramicina (ApraR) y sensibles a la higromicina (HygS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf14 interrumpido por el casete att3Ωaac-. Se han seleccionado más particularmente estos clones y se ha verificado por hibridación la sustitución de la copia salvaje de orf14 por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3Ωaac- para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda un producto de PCR que corresponde a una secuencia desbordante de un centenar de pares de base secuencia arriba y secuencia abajo de la secuencia codificante de orf14. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf14::att3Ωaac-) y denominado SPM509. En efecto, se ha podido verificar gracias a las dos hibridaciones que el casete att3Ωaac- estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación, del gen salvaje por la copia interrumpida por el casete att3Ωaac-

en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf14::att3Ωaac- y se denominó SPM509. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf14, a la vista de la orientación de los genes (véase la figura 3), el hecho de que orf15c esté orientado en el sentido opuesto a orf14 muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento. Una muestra de la cepa SPM509 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2913.

EJEMPLO 14: Construcción de una cepa de Streptomyces ambofaciens interrumpida en el gen orf6* (no forma parte de la invención) Se ha realizado la inactivación del gen orf6* gracias a la técnica de los casetes escindibles (véase anteriormente y figura 10). Para ello, se ha utilizado el cósmido pSPM7 como matriz para amplificar un fragmento del gen orf6* gracias a los oligonucleótidos siguientes: C9583: 5' CTGCAGGTGCTCCAGCGCGTCGATCT 3' (oligo sentido) (SEC ID nº 102) C9584: 5' CTGCAGACGGAGGCGGACCTGCGGCT 3' (oligo antisentido) (SEC ID nº 103) Los 20 desoxi-nucleótidos situados en el extremo 3' de estos oligonucleótidos corresponden a una secuencia situada en la parte codificante del gen orf6* (SEC ID nº 13) y los 6 desoxi-nucleótidos situados generalmente en 5' corresponden a la secuencia de un sitio PstI que permite facilitar la clonación posteriormente. El fragmento de ADN amplificado tiene un tamaño de aproximadamente 1,11 kb. Este producto de PCR se clona en el vector pGEM-T Easy (comercializado por la compañía Promega (Madison, Wisconcin, USA)) lo que ha permitido obtener el plásmido denominado pBXL1111 (véase la figura 16).

Después, se ha introducido el casete escindible att1Ωhyg+ en la secuencia codificante del gen orf6*. Para ello, el plásmido pBXL1111 se ha digerido mediante las enzimas de restricción SmaI y Asp718I y el producto de digestión se ha tratado por la enzima de Klenow. Esta manipulación permite realizar una deleción interna de 120 pb en la secuencia codificante del gen orf6* (véase la figura 15). Además, a ambos lados de los sitios de restricción, quedan respectivamente 511 pb y 485 pb de la secuencia de orf6* que permitirán la recombinación homóloga para la inactivación del gen orf6*. El casete escindible att1Ωhyg+ se ha preparado a partir del plásmido patt1Ωhyg+ (véase anteriormente) por digestión de este plásmido por EcoRV. Esta última se ha sub-clonado después en el vector pBXL1111 previamente preparado como se ha descrito anteriormente (digestión SmaI y Asp718I y después tratamiento con la enzima de Klenow). El plásmido obtenido se denominó pBXL1112 (véase la figura 17). En esta construcción, el gen orf6* comprende una deleción de 120pb y está interrumpido por el casete att1Ωhyg+.

Después, se ha digerido el plásmido pBXL1112 por la enzima PstI (sitio que bordea el casete como se presenta en los oligonucleótidos PCR) y se ha clonado posteriormente el inserto PstI de 3,7 kb, que comprende una parte de orf6* interrumpida por el casete att1Ωhyg+, a nivel del sitio PstI del plásmido pOJ260 (véase anteriormente). El plásmido así obtenido se denominó pBXL1 113.

El vector pBXL1113 se ha introducido en la cepa Streptomyces ambofaciens OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la higromicina. Los clones resistentes a la higromicina son después replicados respectivamente en un medio con higromicina (antibiótico B) y en un medio con apramicina (antibiótico A) (véase la figura 9). Los clones resistentes a la higromicina (HygR) y sensibles a la apramicina (ApraS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf6* interrumpido por el casete att1Ωhyg+. Estos clones fueron seleccionados más particularmente y se ha verificado, mediante la técnica de transferencia Southern, la sustitución de la copia salvaje de orf6* por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana e hibridado con una sonde que corresponde al gen hyg (obtenido por PCR) para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda el inserto PstI-PstI que contiene el gen orf6*, de un tamaño de aproximadamente 1,1 kb y obtenido a partir del plásmido pBXL1111 (véase anteriormente y figura 16). Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf6*::att1Ωhyg+) y denominado SPM501. En efecto, se ha podido verificar gracias a las dos hibridaciones que el casete att1Ωhyg+ estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación, del gen salvaje por la copia interrumpida por el casete

att1Ωhyg+ en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf6*::att1Ωhyg+ y se denominó SPM501. Una muestra de la cepa SPM501 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2909.

La cepa SPM501 se ha transformado por el vector pOSV508 por transformación de protoplastos para provocar la escisión del casete (véase la figura 14). El plásmido pOSV508 deriva del plásmido pWHM3 (Vara J et al.,1989) (véase la figura 13) en el que los genes xis y int de pSAM2 (Boccard F. et al., 1989b) colocados bajo el control del promotor ptrc (Amann, E. et al., 1988) se han añadido (véase la figura 14). La introducción en la cepa SPM501 del plásmido pOSV508 que lleva los genes xis y int de pSAM2 permite la escisión eficaz por recombinación específica del sitio del casete escindible entre los sitios attL y attR que flanquean este casete (Raynal A. et al., 1998) (figura 10). Entre los transformantes, seleccionados por su resistencia a la tiostreptona debida al gen tsr llevado por pOSV508, se seleccionan los que se han vuelto sensibles a la higromicina, en los que el gen de resistencia es llevado por el casete att1Ωhyg+, la escisión conlleva, en efecto, la pérdida de este gen de resistencia (véase la figura 10). El plásmido pOSV508 es inestable y después de dos pasos sucesivos sobre un medio sin antibiótico, unos clones aislados son replicados en un medio con tiostreptona y sobre un medio sin tiostreptona. Los clones sensibles a la tiostreptona han perdido pOSV508.

Se ha verificado que la escisión del casete se ha realizado correctamente en fase en el gen orf6* por PCR y secuenciación del producto PCR. La interrupción empieza en el codón 158º, se suprimen 40 codones (120 pb) y la escisión del casete deja una secuencia «cicatricial» att1 característica de 33 pb: 5' ATCGCGCGCTTCGTTCGGGACGAAGAGGTAGAT 3' (SEC ID nº 104).

La cepa así obtenida y que posee el genotipo deseado (orf6*::att1) se denominó SPM502.

Una muestra de la cepa SPM502 se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 10 de julio de 2002 bajo el número de registro I-2910.

EJEMPLO 15: Análisis de las cepas de Streptomyces ambofaciens interrumpida en los genes orf2, orf3, orf8, orf10, orf12, orf13c, orf14, orf6*

Para ensayar la producción en espiramicina de las diversas cepas obtenidas, se ha llevado a cabo un ensayo microbiológico basado en la sensibilidad de una cepa de Micrococcus luteus (véase (Gourmelen A. et al., 1998)). La cepa de Micrococcus luteus utilizada e suna cepa derivada de la cepa DSM1790 naturalmente sensible a la espiramicina (esta cepa está disponible en particular en la German Collection of Microorganisms and Cell Cultures (Deutsche Sammlung von Mikro-organismen und Zellkulturen GmbH, DSMZ), (Braunschweig, Allemagne), bajo el número DSM1790), la cepa utilizada en el presente ensayo difiere de la cepa DSM1790 por que es resistente a la congocidina. Esta cepa es un mutante espontáneo obtenido por selección sobre medio que contiene unas dosis crecientes de congocidina. Se ha seleccionado tal cepa debido a que Streptomyces ambofaciens produce al mismo tiempo espiramicina y congocidina. Al ser el objetivo determinar la producción en espiramicina de las diversas cepas obtenidas gracias a un ensayo microbiológico basado en la sensibilidad de una cepa de Micrococcus luteus, es necesario disponer de una cepa resistente a la congocidina.

Las diferentes cepas de Streptomyces a ensayar se han cultivado en unos matraces Erlenmeyer con deflectores (erlenmeyers con deflectores) de 500 ml que contienen 70 ml de medio MP5 (Pernodet et al., 1993). Los erlenmeyers con deflectores se inocularon a una concentracion inicial de 2.5 106 esporas/ml de las diferentes cepas de S. ambofaciens y se dejaron crecer a 27°C bajo agitación orbital de 250 rpm. Se han realizado unas extracciones de 2 ml de suspensiones después de 48, 72 y 96 horas de cultivo y se han centrifugado. Después, se han congelado los diferentes sobrenadantes a -20°C. Se utiliza una dilución a la décima parte de estos sobrenadantes en un medio de cultivo estéril para el ensayo (véase la figura 18).

La cepa indicadora de Micrococcus luteus resistente a la congocidina pero sensible a la espiramicina se ha cultivado en un medio 2TY (Sambrook et al., 1989) que contiene congocidina a 5 µg/ml durante 48h a 37°C. Se mide la densidad óptica (DO) del cultivo y se diluye este cultivo a fin de ajustar la densidad óptica a 4. Se diluye 0,4 ml de este pre-cultivo en 40 ml de medio DAM5 (Difco Antibiotic Medium 5, comercializado por la compañía Difco), previamente llevado a una temperatura de aproximadamente 45°C. Después, se vierte este medio en una caja cuadrada de 12x12 cm y se deja reposar a temperatura ambiente.

Una vez enfriado y solificado el medio, se empapan unos discos de papel Whatman AA (véase Gourmelen A. et al., 1998) de 12 mm de diámetro de 70 µl de la dilución a la décima parte de cada sobrenandante y se depositan en la superficie de la caja. Se utilizan unos discos empapados de una solución de espiramicina de diferentes concentraciones (2-4-8 µg/ml en un medio de cultivo MP5) como serie estándar. Las cajas se dejan a 4°C durante 2h a fin de permitir la difusión de los antibióticos en el agar y después se incuban a 37°C durante 24 a 48h.

Si el disco contiene espiramicina, esta se difunde en el agar e inhibe el crecimiento de la cepa indicadora de Micrococcus luteus. Esta inhibición crea un «halo» alrededor del disco, reflejando este halo la zona en la que la cepa de Micrococcus

luteus no ha crecido. La presencia de este halo es por lo tanto una indicación de la presencia de espiramicina y permite determinar si la cepa de S. ambofaciens que corresponde al disco en cuestión es productora o no productora de espiramicina. Una comparación con los diámetros de inhibición obtenidos para la serie estándar permite obtener una indicación de la cantidad de espiramicina producida por esta cepa.

Las diferentes cepas descritas en los ejemplos anteriores se utilizaron en este ensayo para detectar su producción en espiramicina. Los resultados obtenidos se reunen en la Tabla 38.

Tabla 38 Cepa Gen inactivado Ejemplo en el que la cepa está Fenotipo: Productor (+) o no productor (-) descrita de espiramicina ATCC23877 Ninguno 1 (+) OS49.16

orf3::Ωhyg

2 (-) OS49.67

orf3 deleción en fase

6 (-) OS49.107

orf8::Ωhyg

7 (-) OS49.50

orf10:: Ωhyg

8 (-) OSC2 ninguno (+) SPM21

orf2::att3Ωaac-

(-) SPM22

orf2::att3 deleción en (-) fase SPM501

orf6*::att1Ωhyg+ 14 (-) SPM502

orf6*::att1 deleción en 14 (+) fase SPM507

orf12::att3Ωaac-

11 (-) SPM508

orf13c::att3Ωaac-

12 (+) SPM509

orf14::att3Ωaac-

13 (-) Estos resultados permiten sacar un cierto número de conclusiones en lo referente a la función de los diferentes genes implicados en la biosíntesis de la espiramicina. Así, el gen orf3 es esencial para la biosíntesis de la espiramicina. En efecto, una inactivación en fase en este gen conduce a una cepa (OS49.67, (véase el ejemplo 6)) que no produce más espiramicina. La inactivación en fase permite apartar la hipótesis de una eventual influencia del casete introducido sobre la expresión de los genes situados aguas abajo de orf3.

Asimismo, los genes orf8 y orf10 codifican unas proteínas esenciales para la biosíntesis de la espiramicina ya que las cepas OS49.107 y OS49.50 tienen un fenotipo no productor. Además, en estas dos últimas cepas, es correcta la inactivación del gen correspondiente la que es responsable de este fenotipo no productor, ya que a la vista de la orientación de los diferentes orfs (véase la figura 3), la construcción introducida no puede tener un efecto polar.

El estudio de las cepas que poseen un casete escindible permite también sacar un cierto número de conclusiones en lo referente a la función de los genes interrumpidos. La cepa SPM507 posee el genotipo: orf12::att3Ωaac-. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf12, a la vista de la orientación de los genes (véase la figura 3). El hecho de que orf13c esté orientado en el sentido opuesto a orf12 muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento. El fenotipo de la cepa SPM507 es no productor, por lo tanto se puede concluir que el gen orf12 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

La cepa SPM508 posee el genotipo: orf13c::att3Ωaac-. Es inútil proceder a la escisión del casete para el estudio del efecto de la inactivación de orf13c a la vista de la orientación de los genes (véase la figura 3). El hecho de que orf14 esté orientado en el sentido opuesto a orf13c muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento. El fenotipo de la cepa SPM508 es productor, por lo tanto se puede concluir que el gen orf13c no es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

La cepa SPM509 posee el genotipo: orf14::att3Ωaac-. Es inútil proceder a la escisión del casete para el estudio del efecto de la inactivación de orf14 a la vista de la orientación de los genes (véase la figura 3), el hecho de que orf15c esté orientado en el sentido opuesto a orf14 muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento. El fenotipo de la cepa SPM509 es no productor; por lo tanto se puede concluir que el gen orf14 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

La cepa SPM21 posee el genotipo: orf2::att3Ωaac-. El fenotipo de esta cepa es no productor de espiramicinas. Sin embargo, la orientación de los genes orf1 a orf8 (véase la figura 3) hace pensar que estos genes están co-transcritos. Asimismo, el fenotipo observado puede deberse a un efecto polar del casete introducido en orf2 sobre la expresión de los genes situados secuencia abajo en el operón. La cepa SPM22 posee el genotipo orf2::att3 y se ha obtenido después de la escisión en fase del casete introducido. La escisión del casete deja sólo una secuencia «cicatricial» característica (véase el ejemplo 10). Al ser la cepa SPM22 también de fenotipo no productor, se puede concluir que el gen orf2 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens. Se observa aquí únicamente el efecto debido a la inactivación de orf2.

La cepa SPM501 posee el genotipo: orf6*::att1Ωhyg+. El fenotipo de esta cepa es no productor de espiramicinas. Sin embargo, teniendo los genes orf5* y orf6* (véase la figura 3) la misma orientación, el fenotipo observado puede deberse a un efecto polar del casete introducido en orf6* sobre la expresión de orf5*. La disposición de estos genes hace pensar que pueden estar co-transcritos. Para responder a esta cuestión, la cepa SPM502 se ha obtenido después de la escisión en fase del casete introducido. En esta cepa, se observa únicamente el efecto de la inactivación de orf6*. Esta cepa posee el genotipo orf6*::att1 (véase el ejemplo 14). La escisión del casete deja sólo una secuencia «cicatricial» en fase (véase el ejemplo 14). La cepa SPM502 posee un fenotipo productor (esta cepa produce, sin embargo, sólo espiramicina I (véase* el ejemplo 16)). Por lo tanto, se puede concluir que el gen orf5* es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens, ya que su inactivación indirecta en la cepa SPM501 conduce a un fenotipo no productor. Por el contrario, el gen orf6* no es un gen esencial para la biosíntesis de la espiramicina I en S. ambofaciens (por el contrario es esencial para la producción de espiramicina II y III (véase el ejemplo 16)).

EJEMPLO 16. Ensayo de la producción de las espiramicinas I, II y III en las cepas mutantes obtenidas (no forma parte de la invención) Las diferentes cepas a ensayar se cultivaron cada una en 7 erlenmeyers con deflectores de 500 ml que contiene 70 ml de medio MP5 (Pernodet et al., 1993). Los matraces erlenmeyers se inocularon con 2,5 106 esporas/ml de las diferentes cepas de S. ambofaciens y se dejaron crecer a 27°C bajo agitación orbital de 250 rpm durante 72 horas. Los cultivos que corresponden al mismo clon se reúnen, eventualmente se filtran sobre un filtro plisado, y se centrifugan durante 15 min a 7000 rpm. Los diferentes sobrenadantes se almacenaron después a -30°C.

Se efectuan los ensayos por cromoatografía líquida de alto rendimiento (CLHP) por emparejamiento de iones. El análisis CLHP del medio de cultivo permite determinar precisamente la concentración de las tres formas de espiramicina. La columna utilizada (Macherey-Nagel) es rellenada con una fase nucleósilo de silice injertado octilo. La granulometría es de 5µm y el tamaño de los poros 100Å. El diámetro interno de la columna es de 4,6mm y su longitud de 25cm. La fase móvil es una mezcla de tampón H3PO4 (pH2,2) y de acetonitrilo 70/30 (v/v) que contiene 6,25 g/l de perclorato de NaClO4. El análisis se realiza en regímen isocrático con un caudal fijado a 1 ml/min. La columna está termorregulada a 23°C. La detección está asegurada por espectrofotometría UV a 238 nm. La muestra está refgrigerada a +10°C y se determina la cuantificación a partir de la zona de los picos (por calibración externa). En estas condiciones, los tiempos de retención de la espiramicina I, II y III son respectivamente de 17; 21 y 30 minutos, como se ha podido verificar, gracias a una muestra comercial que comprende las tres formas de espiramicina.

La cepa OSC2 posee un fenotipo productor de espiramicina. Es la cepa parental utilizada para la obtención de las cepas que poseen un casete escindible (véase el ejemplo 15). Se ha utilizado por lo tanto esta cepa como control positivo de producción de las tres formas de espiramicina. Esta cepa produce correctamente las tres formas de espiramicinas, como se ha podido verificar por CLHP (véase la figura 19).

El estudio de las cepas que poseen un casete escindible permite sacar un cierto número de conclusiones en lo referente a la función de los genes interrumpidos. La cepa SPM507 posee el genotipo: orf12::att3Ωaac-. El fenotipo de la cepa SPM507 es no productor (véase el ejemplo 15), por lo tanto se puede concluir que el gen orf12 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens. Esta cepa no produce más espiramicinas, como se ha podido verificar por CLHP (véase la figura 22). Este resultado confirma el carácter esencial del gen orf12 en la biosíntesis de la espiramicina.

La cepa SPM508 posee el genotipo: orf13c::att3Ωaac-. El fenotipo de la cepa SPM508 es productor de espiramicina (véase el ejemplo 15), por lo tanto se puede concluir que el gen orf13c no es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens. Esta cepa produce espiramicina I, II y III, como se ha podido verificar por CLHP (véase la figura 23). Este resultado confirma que el gen orf13c no es un gen esencial para la biosíntesis de las espiramicinas I, II y III en S. ambofaciens.

La cepa SPM509 posee el genotipo: orf14::att3Ωaac-. El fenotipo de la cepa SPM509 es no productor, por lo tanto se puede concluir que el gen orf14 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens. Esta cepa no produce más espiramicinas, como se ha podido verificar por CLHP (véase la figura 24). Este resultado confirma la esencialidad del gen orf14 en la biosíntesis de la espiramicina.

La cepa SPM501 posee el genotipo: orf6*::att1Ωhyg+. El fenotipo de esta cepa es no productor de espiramicinas. Esta cepa no produce más espiramicinas, como se ha podido verificar por CLHP (véase la figura 20). Sin embargo, teniendo los genes orf5* y orf6* (véase la figura 3) la misma orientación, el fenotipo observado puede deberse a un efecto polar del casete introducido en orf6* sobre la expresión de orf5* en el operón. Esto sugiere que estos genes están co- transcritos. Para responder a esta cuestión, se ha obtenido la cepa SPM502 por escisión del casete introducido, produciendo una deleción fase en el gen or6* y restaurando la expresión orf5*. Esta cepa posee el genotipo orf6*::att1 (véase el ejemplo 14 y 15). La escisión del casete deja sólo una secuencia att «cicatricial» en fase (véase el ejemplo 14).

La cepa SPM502 posee un fenotipo productor de espiramicina. Sin embargo, como se ha podido demostrar por CLHP, esta cepa produce sólo espiramicina I y no produce espiramicina II y III (véase la figura 21). Por lo tanto, se puede concluir de estos resultados que el gen orf5* es un gen esencial para la biosíntesis de la espiramicina en S.

ambofaciens, ya que su inactivación indirecta en la cepa SPM501 conduce a un fenotipo no productor de espiramicina (véase la figura 20). Por el contrario, el gen orf6* no es un gen esencial para la biosíntesis de la espiramicina I en S. ambofaciens, ya que la inactivación de este gen conduce a un fenotipo productor de espiramicina I (véase la figura 21). Sin embargo, orf6* es esencial para la producción de espiramicina II y III (véase el ejemplo 16)). El gen orf6* codifica por lo tanto correctamente una acil-transferasa responsable de la modificación del platenólido en la posición 3 (véase la figura 1).

EJEMPLO 17: Determinación del punto de inicio de la traducción de orf10 y mejora de la producción en espiramicinas 17.1 Construcción de los plásmidos pSPM523, pSPM524 y pSPM525: Se ha identificado en gen orf10 en Streptomyces ambofaciens y se ha designado srmR por Geistlich et al. (Geistlich, M., et al., 1992). Se ha realizado la inactivación del gen orf10 (véase el ejemplo 8). Así, se ha podido demostrar que la cepa resultante no produce más espiramicinas (véase el ejemplo 15). Esto confirma que el gen orf10 está muy implicado en la biosíntesis de las espiramicinas. La proteína codificada por este gen es por lo tanto muy esencial para la biosíntesis de las espiramicinas. Sin embargo, el análisis de la secuencia muestra que dos codones ATG situados en el mismo marco de lectura pueden ser utilizados para la traducción de orf10 (véase la figura 28). Uno de los dos codones posibles (el codón más secuencia arriba) empieza en la posición 10656 de la secuencia dada en la SEC ID nº 1, mientras que el otro codón posible situado más secuencia abajo empieza en la posición 10809 (véase la SEC ID nº 1). Antes de ensayar un eventual efecto de la sobreexpresión de srmR sobre la producción de espiramicina, es importante determinar en una primera fase el punto de inicio de la traducción.

Con el objetivo de determinar el sitio de inicio de la traducción, se han realizado tres construcciones que comprenden tres formas de orf10. Estas últimas se obtuvieron por PCR utilizando unos oligonucleótidos que comprenden o bien un sitio de restricción HindIII, o bien un sitio de restricción BamHI.

El primer par utilizado para la amplificación corresponde a los oligonucleótidos siguientes: EDR39: 5'CCCAAGCTTGAGAAGGGAGCGGACATTCATGGCCCGCGCCGAACGC3' (SEC ID nº 122) (el sitio HindIII aparece en negrita) EDR42: 5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3' (SEC ID nº 123) (el sitio BamHI aparece en negrita) El par de cebadores EDR39-EDR42 permite la amplificación de un fragmento de orf10 que comprende el ATG situado generalmente en 3' (posición 10809 en la secuencia dada en la SEC ID nº 1) (véase la figura 28). El fragmento obtenido tiene un tamaño de aproximadamente 2 kb y se denominará a continuacion "orf10 corto", no contiene el promotor de orf10. Este fragmento de 2kb se ha clonado en el vector pGEM-T easy para dar lugar al plásmido pSPM520.

El segundo par utilizado para la amplificación corresponde a los oligonucleótidos siguientes: EDR40: 5'CCCAAGCTTGAGAAGGGAGCGGACATTCAATGCTTTGGTAAAGCAC3' (SEC ID nº 124) (el sitio HindIII aparece en negrita) EDR42: 5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3' (SEC ID nº 123) (el sitio BamHI aparece en negrita) El par de cebadores EDR40-EDR42 permite la amplificación de un fragmento de orf10 que comprende el ATG situado generalmente en 5' (posición 10656 en la secuencia dada en la SEC ID nº 1) (véase la figura 28). Este fragmento de 2,2 kb denominado a continuación "orf10 long" se ha clonado en el vector pGEM-T easy para dar lugar al plásmido pSPM521, este plásmido no contiene el promotor de orf10.

El tercer par utilizado para la amplificación corresponde a los oligonucleótidos siguientes: EDR41: 5'-CCCAAGCTTTCAAGGAACGACGGGGTGGTCAGTCAAGT-3' (SEC ID nº 125) (el sitio HindIII aparece en negrita) EDR42: 5'CGGGATCCGGCTGACCATGGGAGACGGGCGCATCGCCGAGTTCAGC3' (SEC ID nº 123) (el sitio BamHI aparece en negrita) El par de cebadores EDR41-EDR42 permite la amplificación del gen orf10 con los dos ATG, así como su propio promotor (véase la figura 28). Este fragmento de 2,8 kb denominado a continuación "orf10 pro" se ha clonado en el vector pGEM-T easy para dar lugar al plásmido pSPM522.

El fragmento "orf10 pro" se obtuvo utilizando como matriz el ADN cromosómico de la cepa OSC2. Los fragmentos "orf10 corto" y "orf10 largo" se obtuvieron, por su parte, utilizando como matriz el ADN del fragmento "orf10 pro" previamente purificado.

Los insertos HindIII-BamHI de los plásmidos pSPM520, pSPM521 y pSPM522 se sub-clonaron después en el vector pUWL201 (plásmido derivado del plásmido pUWL199 (Wehmeier UF, 1995) en el que el fragmento KpnI-BamHI de la región del promotor de ermE (véase Bibb et al., 1985, en particular la figura 2) que lleva una mutación que aumenta la fuerza del promotor (promotor ermE*) (Bibb et al., 1994) se ha introducido (véase Doumith et al., 2000)) previamente digerido por las enzimas HindIII-BamHI. Así, se han obtenido tres plásmidos: pSPM523 (derivado del pUWL201 con la forma "off10 corto" como inserto), pSPM524 (derivado del pUWL201 con la forma "orf10 largo" como inserto) y pSPM525 (derivado del pUWL201 con la forma "orf10 pro") (Figura 28).

17.2 Transformación de la cepa OS49.50 por las construcciones pSPM523. pSPM524 y pSPM525: La cepa OS49.50 (cepa interrumpida en el gen orf10, véase el ejemplo 8) se ha transformado independientemente por transformación de protoplastos (Kieser, T et al., 2000) por cada uno de los plásmidos pSPM523, pSPM524 y pSPM525. Se ha realizado también un control negativo transformando la cepa OS49.50 por el plásmido pUWL201 sin inserto.

Después de la transformación de los protoplastos, los clones se seleccionan por su resistencia a la tiostreptona. La transformación de los clones por cada uno de los plásmidos se verifica mediante extracción de estos plásmidos. Así, se obtuvieron cuatro nuevas cepas: la cepa OSC49.50 pUWL201, procedente de la transformación por el plásmido pUWL201 sin inserto, la cepa OSC49.50 pSPM523, procedente de la transformación por el plásmido pSPM523, la cepa OSC49.50 pSPM524, procedente de la transformación por el plásmido pSPM524 y finalmente la cepa OS49.50 pSPM525, procedente de la transformación por el plásmido pSPM525.

La producción de espiramicinas de cada una de estas cuatro cepas se ensayó por CLHP. Para ello, las diferentes cepas de Streptomyces a ensayar se cultivaron en unos matraces erlenmeyers con deflectores (erlenmeyers con deflectores) de 500 ml que contenían 70 ml de medio MP5 (Pernodet et al., 1993). Cuando la cepa contiene el plásmido pUWL201 o uno de sus derivados, se añaden 5 µg/ml de tiostreptona. Los erlenmeyers con deflectores se inocularon a una concentración inicial de 2,5 106 esporas/ml de las diferentes cepas de S. ambofaciens y los cultivos se incubaron a 27°C bajo agitación orbital de 250 rpm durante 96 horas. Las células se separaron después del medio por centrifugación y se analizó el sobrenadante por CLHP (véase el ejemplo 16) para determinar la cantidad de espiramicina producida. Gracias a una muestra patrón y a la medición de la zona de los picos, fue posible determinar la cantidad de cada una de las espiramicinas producidas por estas cepas. Los resultados de este análisis se presentan en la tabla 39, los datos están expresados en mg por litro de sobrenadante. Los resultados corresponden a la producción total en espiramicinas (obtenida sumando la producción en espiramicina I, II y III).

Tabla 39. Producción en espiramicinas de las cepas derivadas de OS49.50, (resultados expresados en mg/l).

Cepa Produción en Espiramicinas OS49.50 pUWL201 OS49.50 pSPM523 OS49.50 pSPM524 93 OS49.50 pSPM525 149 Como lo muestran los resultados dados en la tabla 39, el control negativo (cepa OS49.50 transformada por el plásmido pUWL201) no produce espiramicina. Cuando el plásmido pSPM523 (que contiene la forma "orf10 corto") es introducido en la cepa OS49.50, no se observa ninguna produccion de espiramicina. Por el contrario, la presencia del plásmido pSPM524 (que contiene la forma "orf10 largo") y del plásmido pSPM525 (que contiene la forma "orf10 pro") restaura la producción de espiramicina en la cepa huésped OS49.50. Así, sólo los fragmentos de orf10 que contienen el ATG más secuencia arriba permiten restaurar la síntesis de espiramicina.

Con el objetivo de confirmar estos resultados, el plásmido pSPM521 (plásmido pGEM-T easy que contiene la forma "orf10 largo") se ha digerido por la enzima de restricción XhoI (esta enzima posee un sitio único en este plásmido, localizado entre los dos ATG (véase la figura 28)). Los extremos XhoI se convirtieron después en extremos romos por tratamiento con la enzima de Klenow. El plásmido se encerró en sí mismo por acción la T4 DNA ligasa para dar lugar al plásmido pSPM527. Si el ATG más secuencia arriba (posición 10656 en la secuencia dada en la SEC ID nº 1) es muy utilizado como sitio de iniciación de la traducción, este tratamiento conllevará una diferencia del marco de lectura a nivel del sitio XhoI y tendrá como efecto la producción de una proteína que no presente ninguna actividad activadora. Por el contrario, si la iniciación de la traducción tiene lugar a nivel del ATG más secuencia abajo (posición 10809 en la secuencia dada en la SEC ID nº 1), este tratamiento debería tener poco o nignún efecto sobre la expresión de Orf10 (teniendo en cuenta la localización del punto de inicio de la transcripción) y y ningún efecto sobre la proteína producida.

El inserto BamHI-HindIII de pSPM527 se sub-clonó después en el vector pUWL201 para dar lugar al plásmido pSPM528. Este plásmido se ha introducido en la cepa OS49.50 y se ha seleccionado más particularmente un clon que posee el plásmido deseado. La producción de espiramicina de la cepa resultante se ensayó después por CLHP (véase el ejemplo 16 y anteriormente). Al contrario de lo que se observó con el plásmido pSPM524 (véase la tabla 39), la presencia del plásmido pSPM528 en la cepa OS49.50 no restablece la producción de espiramicina. Esto confirma que el inicio de la traducción del gen orf10 es el ATG situado más secuencia abajo (ATG 1 véase la figura 28).

17.3 Mejora de la producción en espiramicinas de la cepa OSC2 de S. ambofaciens: Con el fin de ensayar el efecto de la sobreexpresión del gen orf10 sobre la producción de espiramicinas, los plásmidos pSPM523, pSPM524, pSPM525 y pSPM528 se han introducido en la cepa OSC2. Para ello, se han transformado unos protoplastos de la cepa OSC2 (Kieser, T et al., 2000) independientemente por cada uno de los plásmidos pSPM523, pSPM524, pSPM525 y pSPM528. Se ha realizado también un control negativo transformando la cepa OSC2 por el plásmido pUWL201 sin inserto. Después de la transformación de los protoplastos, los clones se seleccionan por su resistencia a la tiostreptona. Así, se han obtenido cinco nuevas cepas: la cepa OSC2 pUWL201, procedente de la transformación por el plásmido pUWL201 sin inserto, la cepa OSC2 pSPM523, procedente de la transformación por el plásmido pSPM523, la cepa OSC2 pSPM524, procedente de la transformación por el plásmido pSPM524, la cepa OSC2 pSPM525, procedente de la transformación por el plásmido pSPM525 y finalmente la cepa OSC2 pSPM528, procedente de la transformación por el plásmido pSPM528. La producción en espiramicinas de estas cepas se ha analizado entonces por CLHP (de la misma manera que en el ejemplo 17.2). El análisis de la producción en espiramicina de la cepa OSC2 también se efectuado en paralelo para comparación. Los resultados de este análisis se presentan en la tabla 40, los datos están expresados mg por litro de sobrenadante. Los resultados corresponden a la producción total en espiramicinas (obtenida sumando la producción en espiramicina I, II y III).

Tabla 40. Producción en espiramicinas de las cepas derivadas OSC2, (resultados expresados en mg/l).

Cepa Producción en espiramicinas OSC2 69 OSC2 pUWL201 103 OSC2 pSPM523 19 OSC2 pSPM524 135 OSC2 pSPM525 278 OSC2 pSPM528 68 Así, se observa que la presencia del plásmido pSPM524 o del plásmido pSPM525 aumenta significativamente la producción en espiramicinas de la cepa OSC2. Esto demuestra bien que la sobreexpresión de Orf10 tiene un efecto positivo sobre la producción en espiramicinas. El plásmido pSPM528 no tiene, por el contrario, ningún efecto sobre la producción en espiramicinas.

Los plásmidos pSPM525 y pUWL201 se han introducido de la misma manera en la cepa SPM502 (véase el ejemplo 14). Así, se han obtenido dos nuevas cepas: la cepa SPM502 pUWL201, procedente de la transformación por el plásmido pUWL201 sin inserto, y la cepa SPM502 pSPM525, procedente de la transformación por el plásmido pSPM525.

Una muestra de la cepa SPM502 pSPM525 (esta cepa contiene el plásmido pSPM525, véase anteriormente) se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 26 de febrero de 2003 bajo el número de registro I-2977.

La producción en espiramicinas de las cepas SPM502 pUWL201 y SPM502 pSPM525 se ha analizado por CLHP (de la misma manera que en el ejemplo 17.2). El análisis de la producción en espiramicinas de la cepa SPM502 también se ha efectuado en paralelo para comparación. Los resultados de este análisis se presentan en la tabla 41, los datos están expresados en mg por litro de sobrenadante. Los resultados corresponden a la producción en espiramicina I. En efecto, ninguna de estas cepas produce espiramicina II y III.

Tabla 41. Producción en espiramicina I de las cepas derivadas de SPM502, (resultados expresados en mg/l).

Cepa Espiramicina I SPM502 47 SPM502 pUWL201 72 SPM502 pSPM525 130 Así, se ha podido observar que la sobreexpresión del gen orf10 en la cepa SPM502 aumenta de manera importante la producción de espiramicina-I.

EJEMPLO 18: Construcción de un banco de ADN genómico de la cepa OSC2 de Streptomyces ambofaciens en E. coli en el cósmido pWED2.

18.1 Construcción del cósmido pWED2: Con el objetivo de facilitar la inactivación de los genes en Streptomyces, se ha construido un cósmido que lleva la secuencia oriT del plásmido RK2 (lo que permite su introducción por conjugación en Streptomyces a partir de una cepa apropiada de E. coli) y que lleva también un gen de resistencia a un antibiótico que contiene un fenotipo localizable en Streptomyces. Tal cósmido, que contiene grandes insertos de ADN genómico de Streptomyces ambofaciens, puede ser utilizado en experimentos de inactivación de los genes.

Para construir este vector, se ha introducido un casete pac-oriT (fragmento EcoRV) en el cósmido pWED1 (Gourmelen et al., 1998), derivado del cósmido pWED15 (Wahl et al., 1987), a nivel del sitio único HpaI. El casete pac-oriT se ha obtenido por PCR. Para ello, el gen pac se ha amplificado por PCR a partir del plásmido pVF 10.4 (Vara et al., 1985; Lacalle

et

al.,

1989) utilizando como primer cebador el cebador A (de secuencia 5'- CCAGTAGATATCCCGCCAACCCGGAGCTGCAC-3' (SEC ID nº 126), se ha subrayado el sitio de restricción EcoRV y la secuencia en negrita de 20 nucleótidos corresponde a una región secuencia arriba del promotor del gen pac) y como segundo cebador el cebador B (de secuencia 5'-GAAAAGATCCGTCATGGGGTCGTGCGCTCCTT-3' (SEC ID nº 127), que comprende en su extremo 5', una secuencia de 12 nucleótidos que corresponde al principio de la secuencia oriT (subrayado doble) y una secuencia de 20 nucleótidos (en negrita) que corresponde al final del gen pac (véase la figura 29, 1ª PCR).

El gen oriT, por su parte, se ha amplificado por PCR a partir del plásmido pPM803 (Mazodier, P. et al., 1989) utilizando como primer cebador, el cebador C (de secuencia 5'-CACGACCCCATGACGGATCTTTTCCGCTGCAT-3' (SEC ID nº 128)), que comprende en su extremo 5' una secuencia de 12 nucleótidos que corresponde a una secuencia más abajo de la secuencia que codifica el gen pac (en negrita) y una secuencia de 20 nucleótidos que corresponde al principio de la secuencia

oriT) y como segundo cebador, el cebador D (de secuencia 5'- GAGCCGGATATCATCGGTCTTGCCTTGCTCGT-3' (SEC ID nº 129)) que comprende el sitio de restricción EcoRV (subrayado simple) y una secuencia de 20 nucleótidos que corresponde al final de la secuencia oriT (subrayado doble) (véase la figura 29, 2ª PCR).

El producto de amplificación obtenido con los cebadores A y B y el obtenido con los cebadores C y D tienen en uno de sus extremos, una secuencia común de 24 nucleótidos. Se ha realizado una tercera PCR mezclando los dos productos de amplificación obtenidos anteriormente y utilizando como cebadores, los cebadores A y D (véase la figura 29, 3ª PCR).

Esto ha permitido obtener un producto de amplificación que corresponde al conjunto pac+oriT. Este fragmento pac-oriT se ha clonado entonces en el vector pGEM-T Easy (comercializado por la compañía Promega (Madison, Wisconcin, USA)), lo que ha permitido obtener el plásmido pGEM-T-pac-oriT. El inserto de este plásmido se ha subclonado después en el cósmido pWED1. Para ello, el plásmido pGEM-pac-oriT se ha digerido por la enzima EcoRV y el inserto EcoRV que contiene el conjunto pac+oriT se ha insertado en el cósmido pWED1 abierto previamente por la enzima HpaI. El cósmido así obtenido se ha denominado pWED2 (véase la figura 30).

Este cósmido permite facilitar la inactivación de genes en Streptomyces. En efecto, lleva la secuencia oriT (lo que permite su introducción por conjugación en Streptomyces a partir de una cepa apropiada de E. coli) pero también un gen de resistencia a un antibiótico que confiere un fenotipo localizable en Streptomyces. Tal cósmido, que contiene grandes insertos de ADN genómico de Streptomyces ambofaciens, se puede utilizar en experimentos de inactivación de genes.

Así, un cósmido derivado de pWED2 que contiene el gen diana podrá, por ejemplo, ser introducido en la cepa de E. coli KS272 que contiene el plásmido pKOBEG (véase Chaveroche et al. 2000) y se insertará un casete en el gen diana según la técnica descrita por Chaveroche et al. 2000. El cósmido obtenido por esta técnica (cósmido en el que dicho gen diana está inactivado), podrá después ser introducido en una cepa de E. coli tal como la cepa S17.1 o cualquier otra cepa que permita transferir por conjugación unos plásmidos que contienen la secuencia oriT hacia Streptomyces.

Después de la conjugación entre E. coli y Streptomyces, se podrán obtener unos clones de Streptomyces en los que la copia salvaje del gen diana habrá sido sustituida por la copia interrumpida, tal como se describe en el ejemplo 2.

El gen de resistencia expresado en Streptomyces presente en este nuevo cósmido es el gen pac de Streptomyces

alboniger (Vara, J et al., 1985; Lacalle et al., 1989) que codifica la puromicina N-acetil transferasa y que confiere la resistencia a la puromicina. Durante experimentos de inactivación del gen, se buscan los clones en los que tenga lugar un doble evento de recombinación. Estos clones habrán eliminado el cósmido pWED2 y se volverán por lo tanto sensibles a la puromicina.

18.2 Construcción de un banco de ADN genómico de la cepa OSC2 de Streptomyces ambofaciens en E. coli en el cósmido pWED2 El ADN genómico de la cepa OSC2 de Streptomyces ambofaciens se ha digerido parcialmente por la enzima de restricción BamHI a fin de obtener unos fragmentos de ADN de tamaño comprendido entre aproximadamente 35 y 45 kb. Estos fragmentos se clonaron después en el cósmido pWED2, habiendo sido este último previamente digerido por

BamHI, después se trataron por la fosfatasa alcalina. La mezcla de ligación se encapsidó después in vitro en partículas de fagos lambda gracias al sistema «Packagene® Lambda DNA packaging system» comercializado por la compañía Promega (Madison, Wisconcin, USA) siguiendo las recomendaciones del fabricante. Se utilizaron las partículas fágicas obtenidas para infectar la cepa SURE® de E. coli comercializada por la compañía Stratagene (LaJolla, California, USA). La selección de los clones se efectuó sobre medio LB + ampicilina (50 µg/ml), confiriendo el cósmido pWED2 la resistencia a la ampicilina.

EJEMPLO 19: Aislamiento de cósmidos del nuevo banco que cubre la región de la ruta de la biosíntesis de las espiramicinas. Sub-clonación y secuenciación de fragmentos de estos cósmidos.

19.1 Hibridación sobre colonias del banco genómico de Streptomyces ambofaciens OSC2: Se han aislado unos cósmidos del nuevo banco de Streptomyces ambofaciens OSC2 (véase el ejemplo 18) que cubren los orf1* a orf10* o una parte o la totalidad de los orf1 a orf25c, o una región más secuencia arriba del orf25c. Para ello, se han realizado unas hibridaciones sucesivas sobre las colopnias de E. coli obtenidas según el ejemplo 18, utilizando las 3 sondas siguientes (véase la figura 31): - La primera sonda utilizada corresponde a un fragmento de ADN de aproximadamente 0,8kb amplificado por PCR utilizando como matriz el cósmido pSPM5 y los cebadores siguientes: ORF23c: 5'-ACGTGCGCGGTGAGTTCGCCGTTGC-3' (SEC ID nº 130) y ORF25c: 5'-CTGAACGACGCCATCGCGGTGGTGC-3' (SEC ID nº 131).

El producto de PCR así obtenido contiene un fragmento del principio del orf23c, el orf24c entero y el final del orf25c (véase la figura 31, sonda I).

- La segunda sonda utilizada corresponde a un fragmento de ADN de aproximadamente 0,7kb amplificado por PCR utilizando como matriz el ADN total de la cepa S. ambofaciens ATCC23877 y los cebadores siguientes: ORF1*c: 5'-GACCACCTCGAACCGTCCGGCGTCA-3' (SEC ID nº 132) y ORF2*c: 5'-GGCCCGGTCCAGCGTGCCGAAGC-3' (SEC ID nº 133).

El producto de PCR así obtenido contiene un fragmento del final del orf1*c y del principio del orf2*c (véase la figura 31, sonda II).

- La tercera sonda utilizada corresponde a un fragmento EcoRI-BamHI de aproximadamente 3kb que contiene los orf1, orf2 y orf3 y obtenido por digestión del plásmido pOS49.99 (véase la figura 31, sonda III).

Se han trasferido aproximadamente 2000 clones del banco obtenido en el ejemplo 18.2 sobre filtro para hibridación sobre colonias según las técnicas clásicas (Sambrook et al., 1989).

La primera sonda (véase la figura 31, sonda I) se ha marcado con 32P mediante la técnica del «cebado aleatorio» (Kit comercializado por la compañía Roche) y utilizada para la hibridación sobre 2000 clones del banco, después de la transferencia sobre filtro. La hibridación se ha efectuado a 65°C en el tampón descrito por Church & Gilbert (Church & Gilbert, 1984). Se han efectuado dos lavados en 2x SSC, 0,1% SDS a 65°C, el primero durante 10 minutos y el segundo durante 20 minutos y se ha efectuado después un tercer lavado de una duración de 30 minutos en 0,2X SSC, 0,1% SDS a 65°C. En estas condiciones de hibridación y de lavado, 20 clones de entre los 2000 hibridados presentaban una fuerte señal de hibridación con la primera sonda. Estos 20 clones se han cultivado en medio LB+ ampicilina (50 µg/ml) y los 20 cósmidos correspondientes se han extraído por lisis alcalina (Sambrook et al., 1989) y después se ha digerido por la enzima de restricción BamHI. Los productos de digestión se han separado después sobre gel de agarosa, transferidos sobre membrana de Nylon e hibridados por la primera sonda (véase anteriormente: el producto de PCR ORF23c- ORF25c, sonda I) en las mismas condiciones que anteriormente. Doce cósmidos poseían un fragmento BamHI que hibrida fuertemente con la sonda utilizada. Estos 12 cósmidos se han denominado pSPM34, pSPM35, pSPM36, pSPM37, pSPM38, pSPM39, pSPM40, pSPM41, pSPM42, pSPM43, pSPM44 y pSPM45. Los perfiles, después de la digestión por BamHI, de estos 12 cósmidos se han comparado entre ellos y con el del cósmido pSPM5. Además, unos experimentos de amplificación por PCR utilizando diferentes cebadores que corresponden a diferentes genes ya identificados en la región orf1-orf25c han permitido posicionar el inserto de algunos de estos cósmidos los unos con respecto a los otros, y determinar también la localización de estos insertos en la región orf1-orf25c ya conocida (véase la figura 32). El cósmido pSPM36 se ha seleccionado más particularmente por que era susceptible de contener una gran región secuencia arriba del orf25c (véanse las figuras 31 y 32).

En una segunda fase, y utilizando las mismas condiciones que las descritas anteriormente, se hibridaron los 2000 clones del banco de Streptomyces ambofaciens. OSC2 con la segunda sonda que corresponde al producto de PCR: ORF1*c- ORF2*c (véase la figura 31, sonda II). Esta hibridación ha permitido aislar unos cósmidos cuyo inserto está situado en la región de orf1*c a orf10*c. En las condiciones de hibridación utilizadas, 16 clones de entre los 2000 hibridados presentaban una fuerte señal de hibridación con esta segunda sonda. Estos 16 clones se cultivaron en medio LB+ ampicilina (50 µg/ml) y los 16 cósmidos correspondientes se han extraído por lisis alcalina (Sambrook et al., 1989) después se han digerido por la enzima de restricción BamHI. Los perfiles de digestión (después de la digestión por BamHI) de estos 16 cósmidos se han comparado entre sí y con el del cósmido pSPM7. Unos experimentos de amplificación por PCR con los cebadores ORF1*c y ORF2*c han permitido elegir entre dos cósmidos que contenían bien los genes orf1*c y orf2*c y cuyos perfiles poseen unas bandas diferentes. Además, otros experimentos de amplificación por PCR utilizando diferentes cebadores que corresponden a diferentes genes ya identificados en la región orf1*c a

orf10*c han permitido posicionar el inserto de estos cósmidos los unos con respecto a los otros, y determinar también la localización de estos insertos en la región orf1*c a orf10*c ya conocida (véase la figura 32). Los dos cósmidos más particularmente seleccionados se denominaron pSPM47 y pSPM48 (véase la figura 32).

Utilizando las mismas condiciones que las descritas anteriormente, se hibridaron también los 2000 clones del banco de

Streptomyces ambofaciens OSC2 con la tercera sonda que corresponde al fragmento de ADN EcoRI-BamHI del plásmido pOS49.99 (véase la figura 31 sonda III). Esta hibridación ha permitido aislar los cósmidos que contienen la región del orf1 hasta el orf3 y susceptibles de contener o bien una gran parte de los genes de PKS, o bien una gran parte de los genes orf1 a orf25c de la ruta de la biosíntesis de las espiramicinas. En estas condiciones de hibridación, 35 clones de entre los 2000 hibridados presentaban una fuerte señal de hibridación con la tercera sonda. Estos 35 clones se han cultivado en medio LB+ ampicilina (50 µg/ml) y los 35 cósmidos correspondientes se han extraído por lisis alcalina (Sambrook et al., 1989) y después se han digerido por la enzima de restricción BamHI. Los perfiles, después de la digestión por BamHI, de estos 35 cósmidos se han comparado entre sí y con el del cósmido pSPM5. Además, unos experimentos de amplificación por PCR utilizando diferentes cebadores que corresponden a diferentes genes ya identificados en la región orf1 a orf25c han permitido verificar que estos cósmidos contenían bien unos insertos que provienen de la región orf1 a orf25c y posicionar los insertos de estos cósmidos los unos con respecto a los otros y con respecto a la región orf1 a orf25c ya conocida (véase la figura 32). Se han seleccionado más particularmente cinco cósmidos, se han denominado pSPM50, pSPM51, pSPM53, pSPM55 y pSPM56 (véase la figura 32).

19.2 Sub-clonación y secuenciación de una parte del inserto del cósmido pSPM36.

La sonda de aproximadamente 0,8 kb obtenida por PCR con los cebadores ORF23c y ORF25c (véase anteriormente y figura 31, sonda I) también se ha utilizado en unos experimentos de transferencia Southern sobre el ADN total de S.

ambofaciens. OSC2 digerido por la enzima PstI. En las condiciones de hibridación descritas anteriormente, esta sonda revela un fragmento único PstI de aproximadamente 6 kb cuando está hibridado en el ADN total de S. ambofaciens OSC2 digerido por la enzima PstI. Existe un sitio PstI a nivel del orf23c (véase la SEC ID nº 80) pero ningún otro sitio PstI hasta el extremo (sitio BamHI) de la secuencia conocida (véase la SEC ID nº 1). Este fragmento PstI-BamHI tiene un tamaño de aproximadamente 1,4 kb. El fragmento PstI de 6 kb hibridado en el ADN total de S. ambofaciens digerido por la enzima PstI contiene por lo tanto una región de aproximadamente 4,6 kb situada secuecia arriba de orf25c. Esta región es susceptible de contener otros genes cuyos productos están implicados en la ruta de la biosíntesis de la espiramicina. Se ha verificado por digestión que el cósmido pSPM36 contenía bien este fragmento PstI de 6 kb. Este fragmento se ha aislado a partir de pSPM36, con el objetivo de determinar la secuencia más secuencia arriba de orf25c. Para ello, el cósmido pSPM36 se ha digrido por la enzima de restricción PstI. El fragmento PstI-PstI de un tamaño de aproximadamente 6kb se ha aislado por electroelución a partir de un gel de agarosa al 0,8% y después se ha clonado en el vector pBK-CMV (4512bp) (comercializado por la compañía Stratagene (La Jolla, California, USA)). El plásmido así obtenido se denominó pSPM58 (véase la figura 33) y se ha determinado la secuencia de su inserto. La secuencia de este inserto está presentada en la SEC ID nº 134. Sin embargo, no se ha determinado toda la secuencia y subsiste un hueco de aproximadamente 450 nucleótidos, la parte de la secuencia no determinada se anotó mediante una sucesión de «N» en la secuencia correspondiente.

19.3 Análisis de las nuevas secuencias nucleotídicas, determinación de los marcos de lectura abiertos y caracterización de los genes implicados en la biosíntesis de las espiramicinas.

La secuencia del inserto del cósmido pSPM58 obtenida se ha analizado gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Esto permitió identificar, entre los marcos de lectura abiertos, los marcos de lectura abiertos que presentan un uso de los codones típico de Streptomyces. Este análisis ha permitido determinar que este inserto comprende 4 nuevos ORFs secuencia arriba del orf25c (véase la figura 34). Estos genes se denominaron orf26 (SEC ID nº 107), orf27 (SEC ID nº 109), orf28c (SEC ID nº 111, la secuencia de este orf no se ha determinado completamente ya que un hueco de aproximadamente 450 nucleótido subsiste durante la secuenciación del inserto de pSPM58, estos 450 nucleótidos aparecen en forma de una serie de «N» en la secuencia SEC ID nº 111) y orf29 (la secuencia de este último orf estaba incompleta en este inserto). La «c» añadida en el nombre del gen significa para el ORF en cuestión que la secuencia codificante está en la orientación inversa (véase la figura 34).

Las secuencias proteicas deducidas de estos marcos de lectura abiertos se han comparado con las presentes en las diferentes bases de datos, gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- search, (estos dos programas están accesibles en particular en National Center for Biotechnology Información (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990) (este programa está accesible en particular en el Centro de Recursos INFOBIOGEN, Evry, Francia). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los susceptibles de estar implicados en la biosíntesis de espiramicinas.

19.4 Sub-clonación y secuenciación de otra parte del inserto del cósmido pSPM36.

La sonda de aproximadamente 0,8 kb obtenida por PCR con los cebadores ORF23c y ORF25c (véase anteriormente y figura 31, sonda I) también se ha utilizado en unos experimentos de transferencia Southern sobre el ADN total de la cepa OSC2 digerida por la enzima StuI. En las condiciones de hibridación descritas anteriormente para esta sonda, esta sonda revela un fragmento único StuI de aproximadamente 10 kb cuando está hibridado sobre el ADN total de la cepa OSC2 digerida por la enzima StuI. Teniendo en cuenta la presencia de un sitio StuI en el orf23c (véase la SEC ID nº 80) y de la localización de este sitio con respecto al sitio PstI, este fragmento de 10 kb incluye la totalidad del fragmento PstI anteriormente estudiado (inserto de pSPM58) y permite acceder a una región todavía no estudiada de aproximadamente 4 kb. (véase la figura 33). Se ha verificado por digestión que el cósmido pSPM36 contenía bien este fragmento StuI de 10 kb. Este fragmento se ha aislado a partir del cósmido pSPM36, con el objetivo de determinar la secuencia del fin de orf29 y de otros genes más secuencia arriba de orf29. Para ello, el cósmido pSPM36 se ha digerido por la enzima de restricción StuI. El fragmento StuI-StuI de un tamaño de aproximadamente 10 kb se ha aislado por electroelución a partir de un gel de agarosa al 0,8% y después se ha clonado en el vector pBK-CMV (4512bp) (comercializado por la compañía Stratagene (La Jolla, California, USA)). El plásmido así obtenido se denominó pSPM72 (véase la figura 33). Este último se ha digerido después por EcoRI (site EcoRI en el inserto de pSPM58) y HindIII (site HindIII en el sitio de clonación múltiple del vector, inmediatamente después del sitio StuI del extremo del inserto) (véase la figura 33). El fragmento de ADN EcoRI-HindIII así obtenido corresponde a un fragmento del inserto del plásmido pSPM72 (véase la figura 33) y se ha sub-clonado en el vector pBC-SK+ (comercializado por la compañía Stratagene (La Jolla, California, USA)) digerido previamente por EcoRI y HindIII. El plásmido así obtenido se denominó pSPM73 y se ha determinado la secuencia de su inserto. La secuencia de este inserto se presenta en la SEC ID nº 135.

Un ensamblaje de las secuencias de los insertos de pSPM58 y pSPM73 se presenta en la SEC ID nº 106. Esta secuencia empieza del sitio PstI a nivel del orf23c (véase la SEC ID nº 80) y va hasta el sitio StuI a nivel del orf32c

(véase la figura 34). Al no estar completa la secuencia del orf28c (SEC ID nº 111) (véase el ejemplo 19.3), una región de aproximadamente 450 nucleótidos no está secuenciada, estos 450 nucleótidos aparecen en forma de una serie de «N» en la secuencia SEC ID nº 106).

19.5 Análisis de las nuevas secuencias nucleotídicas, determinación de los marcos de lectura abiertos y caracterización de los genes implicados en la biosíntesis de las espiramicinas.

La secuencia parcial del inserto del cósmido pSPM73 obtenida se ha analizado gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Esto permitió identificar, entre los marcos de lectura abiertos, los marcos de lectura abiertos que presentan un uso de los codones típico de Streptomyces. Este análisis ha permitido determinar que este inserto comprende 4 ORFs, uno incompleto y tres completos (véase la figura 34). El ORF incompleto corresponde a la parte 3' de la secuencia codificante de orf29 lo que ha permitido completar la secuencia de este gen gracias a la secuencia parcial de este mismo orf obtenida durante la secuenciación del inserto del plásmido pSPM58 (véase el ejemplo 19.2 y 19.3), el conjunto de las dos secuencias ha permitido así obtener la secuencia completa de orf29. Los 4 genes se denominaron así orf29 (SEC ID nº 113), orf30c (SEC ID nº 115), orf31 (SEC ID nº 118) y orf32c (SEC ID nº 120). La «c» añadida en el nombre del gen significa para el ORF en cuestión que la secuencia codificante está en la orientación inversa (véase la figura 34).

Las secuencias proteicas deducidas de estos marcos de lectura abiertos (SEC ID nº 114 para orf29, SEC ID nº 116 y 117 para orf30c, SEC ID nº 119 para orf31 y SEC ID nº 121 para orf32c) se han comparado con las presentes en diferentes bases de datos gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- search, (estos dos programas están accesibles en particular en National Center for Biotechnology Información (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990) (este programa está accesible en particular en el Centro de Recursos INFOBIOGEN, Evry, Francia). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar los susceptibles de estar implicados en la biosíntesis de espiramicinas.

19.6 Sub-clonación y secuenciación de una tercera parte del inserto del cósmido pSPM36.

ES 2 552 912 T3   Una sonda (Fragmento de ADN de 0,8 kb) que corresponde a una secuencia interna a orf32c se ha obtenido por PCR utilizando como matriz el ADN total de la cepa de Streptomyces ambofaciens y los cebadores siguientes

KF36: 5'- TTGCCGTAGCCGAGGACCAGCG-3' (SEC ID nº 151) y

KF37: 5'- CACATGGCCCTGGAGGACCCTG-3' (SEC ID nº 152).

El producto PCR así obtenido representa una secuencia interna del orf32c. Esta sonda se ha utilizado en unos experimentos de transferencia Southern sobre el ADN cromosómico de la cepa OSC2 y sobre el ADN del cósmido pSPM36 digeridos por la enzima PstI. Utilizando las mismas condiciones de hibridación que las descritas anteriormente (véase el ejemplo 19.1), esta sonda revela dos fragmentos PstI de aproximadamente 3,4kb y 2,5kb cuando está hibridada en el ADN total de la cepa OSC2 y sobre el ADN del cósmido pSPM36 digeridos por la enzima PstI. Teniendo en cuenta la presencia de un sitio PstI en la sonda utilizada, se pueden explicar estos resultados. El primer fragmento de ADN que tiene un tamaño de aproximadamente 3,4kb es un fragmento cuya secuencia es ya conocida en su totalidad. La secuencia del fragmento de 2,5 kb se conoce sólo parcialmente, sobre una región de 700 pb. Este fragmento se ha aislado a partir del cósmido pSPM36 con el objetivo de determinar la secuencia del fin del orf32c y de otros genes secuencia arriba de este último. Para ello, el cósmido pSPM36 se ha digerido por la enzima de restricción PstI. El fragmento PstI-PstI de un tamaño de aproximadamente 2,5kb se ha aislado por purificación a partir de un gel de agarosa al 0,8% y después se ha clonado en el vector pBK-CMV (4518bp) (comercializado por la compañía Stratagene (La Jolla, California, USA)). El plásmido así obtenido se denominó pSPM79 (véase la figura 41) y se ha determinado la secuencia de su inserto.

La secuencia del orf28c (SEC ID nº 111) no estaba completa (véase el ejemplo 19.3). En efecto, une región de aproximadamente 450 nucleótidos no ha podido ser determinada, estos 450 nucleótidos aparecen en forma de una serie de «N» en la secuencia SEC ID nº 106. La secuencia de la totalidad de la región que falta se ha determinado por resecuenciación de esta región. La secuencia de los insertos de pSPM58 y pSPM73 se ha determinado por lo tanto totalmente. La secuencia completa de la parte codificante del orf28c se presenta en la SEC ID nº 141 y la proteína deducida de esta secuencia en la SEC ID nº 142. La secuencia del inserto del plásmido pSPM79 se presenta en la SEC ID nº 161.

Un ensamblaje de las secuencias de los insertos de pSPM58, pSPM73 y pSPM79 se presenta en la SEC ID nº 140 (véase la figura 41). Esta secuencia parte del sitio PstI a nivel del orf23c (véase la SEC ID nº 80) y va hasta el sitio PstI a nivel del orf34c (véase la figura 41).

19.7 Análisis de las nuevas secuencias nucleotídicas, determinación de los marcos de lectura abiertos y caracterización de los genes que pueden estar implicados en la biosíntesis de las espiramicinas.

La secuencia del inserto del plásmido pSPM79 obtenida se ha analizado gracias al programa FramePlot (Ishikawa J & Hotta K. 1999). Esto permitió identificar, entre los marcos de lectura abiertos, los marcos de lectura abiertos que presentan un uso de los codones típico de Streptomyces. Este análisis ha permitido determinar que este inserto comprende 3 ORFs, dos incompletos (orf32c y orf34c) y uno completo (orf33) (véase la figura 41).

El primer ORF incompleto corresponde a la parte 5' de la secuencia codificante de orf32c. Esto ha permitido completar la secuencia de este gen gracias a la secuencia parcial de este mismo orf obtenido durante la secuenciación del inserto del plásmido pSPM73 (véase el ejemplo 19.4 y 19.5), el conjunto de las dos secuencias ha permitido así obtener la secuencia completa de orf32c. (SEC ID nº 145). La «c» añadida en el nombre del gen significa para el ORF en cuestión que la secuencia codificante está en la orientación inversa (véase la figura 41). El orf completo se denominó orf33 (SEC ID nº 147). El tercer ORF se denominó orf34c (SEC ID nº 149). La «c» añadida en el nombre del gen significa para el ORF en cuestión que la secuencia codificante está en la orientación inversa (véase la figura 37). Las comparaciones efectuadas entre el producto de este orf y los bancos de datos sugieren que la parte C-terminal de esta proteína no está en el producto deducido de la secuencia nucleotídica y por lo tanto que este orf sería más largo y continuaría fuera de la región secuenciada.

Las secuencias proteicas deducidas de estos marcos de lectura abiertos se han comparado con las presentes en las diferentes bases de datos gracias a diferentes programas: BLAST (Altschul et al., 1990) (Altschul et al., 1997), CD- search, (estos dos programas están accesibles en particular en National Center for Biotechnology Información (NCBI) (Bethesda, Maryland, USA)), FASTA ((Pearson W. R & D. J. Lipman, 1988) y (Pearson W. R., 1990) (este programa está accesible en particular en el Centro de Recursos INFOBIOGEN, Evry, Francia). Estas comparaciones han permitido formular unas hipótesis sobre la función de los productos de estos genes e identificar aquellos susceptibles de estar implicados en la biosíntesis de espiramicinas.

EJEMPLO 20: Análisis de la producción de intermedios de biosíntesis de espiramicinas: (no forma parte de la invención)

ES 2 552 912 T3   20.1 Preparación de las muestras: Las diferentes cepas a ensayar se han cultivado cada una en 7 erlenmeyers con deflectores de 500 ml que contienen 70 ml de medio MP5 (Pernodet et al., 1993). Los matraces erlenmeyers se inocularon con 2,5 106 esporas/ml de las diferentes cepas de S. ambofaciens y se dejaron crecer a 27°C bajo agitación orbital de 250 rpm durante 96 horas. Los cultivos que corresponden al mismo clon se reúnen, eventualmente se filtran sobre un filtro plisado, y se centrifugan durante 15 min a 7000 rpm.

El pH del mosto se ajusta después a 9 con sosa y se extrae el sobrenadante mediante metil iso-butiril cetona (MIBK). La fase orgánica (MIBK) se recupera entonces y se evapora. El extracto seco se recoge después en 1ml de acetonitrilo, y después se diluye al 1/10 (100 µl csp 1ml con agua) antes de ser utilizado para los análisis en cromatografía líquida acoplada con la espectrometría de masas (CL/SM).

20.2 Análisis de las muestras en CL/SM: Las muestras se han analizado en CL/SM con el objetivo de determinar la masa de los diferentes productos sintetizados por las cepas a ensayar.

La columna de cromatografía líquida de alto rendimiento utilizada es una columna Kromasil C8 150*4,6mmm, 5mmm, 100Å.

La fase móvil es un gradiente constituido de una mezcla de acetonitrilo y de una solución acuosa de ácido trifluoroacético al 0,05%, el caudal se fija a 1 ml/min. La temperatura del horno de columna se mantiene a 30°C.

La detection UV en la salida de la columna se ha efectuado a dos longitudes de ondas diferentes: 238 nm y 280 nm.

El espectrómetro de masas acoplado a la columna de cromatografía es un aparato Simple Cuadripolar comercializado por la compañía Agilent, con tensiones de cono a 30 y a 70V.

20.3 Análisis de los intermedios de biosíntesis producidos por la cepa OS49.67: La cepa OS49.67, en la que el gen orf3 está inactivado por una deleción en fase, no produce espiramicinas (véanse los ejemplos 6 y 15).

Se ha preparado una muestra según el método descrito anteriormente (véase párrafo 20.1) y se ha analizado por CL/SM como se ha descrito anteriormente (véase el párrafo 20.2).

Más particularmente, el análisis por cromatografía se ha realizado en gradiente de disolvente con, como fase móvil: 20% de acetonitrilo del tiempo T=0 a 5min y después montada lineal al 30% a T=35 minutos, seguida de un nivel hasta T=50 minutos.

En estas condiciones, se han observado más particularmente dos productos: un absorbente a 238 nm (tiempo de retención de 33,4 min) y un absorbente a 280 nm (tiempo de retención de 44,8 min) (véase la figura 35). La figura 35 muestra la superposición de los cromatogramas CLHP realizados a 238 y 280nm (alto) así como los espectros UV de las moléculas eluidos a 33,4 minutos y 44,8 minutos (bajo).

Las condiciones de análisis en espectrometría de masa acoplada eran las siguientes: el barrido se realiza en modo de exploración, cubriendo un intervalo de masa comprendido entre 100 y 1000 Da. La ganancia del electro-multiplicador era de 1V. En lo referente a la fuente electrospray, la presión del gas de nebulización era de 35 psig, el caudal del gas de secado de 12.0 1.min-1, la temperatura del gas de secado de 350°C, la tension del capilar se llevó a +/- 3000 V. Estos experimentos han permitido determinar la masa de los dos productos separados. Estas masas son respectivamente de 370 g/mol para el producto eluido en primer lugar ([M-H2O]+=353 producto principal) y 368 g/mol para el segundo producto ([M-H2O]+=351 producto principal).

A fin de obtener la estructura, los productos mencionados anteriormente se aislaron y purificaron en las condiciones siguientes: la fase móvil es una mezcla de una solución acuosa de ácido trifluoroacético al 0,05% y de aceonitrilo 70/30 (v/v). La cromatografía se realiza en régimen isocrático con un caudal fijado a 1 ml/min. En estas condiciones, los tiempos de retención de los 2 productos son respectivamente de 8 y 13,3 minutos. Además, en este caso, la muestra preparada (véase párrafo 20.1) no está diluida en agua antes de la inyección de 10µl.

Los 2 productos son recuperados a la salida de la columna cromatográfica y aislados en condiciones siguientes: un cartucho Oasis HLB 1 cc 30mg (Waters) se acondiciona secuencialmente por 1 ml de acetonitrilo, después 1 ml de agua/acetonitrilo (20v/80v) y 1ml de agua/acetonitrilo 80/20. La muestra se introduce después y el cartucho se lava

ES 2 552 912 T3   sucesivamente por 1 ml de agua/acetonitrilo (95/5), 1ml de agua/acetonitrilo deuterado (95/5), y después se eluye con 600µl de agua/acetonitrilo deuterado 40/60. La solucion recuperada se analiza después directamente en RMN.

Los espectros RMN obtenidos para estos dos compuestos son los siguientes: - Primer producto eluido: Platenólido A: (espectro 9646V) - espectro 1H en CD3CN (desplazamientos químicos en ppm): 0,90 (3H, t, J=6Hz), 0,93 (3H, d, J=5Hz), 1,27 (3H, d, J=5Hz), entre 1,27 y 1,40 (3H, m), 1,51 (1H, m), 1,95 (1H, m), 2,12 (1H, m), 2,30 (1H, d, J=12Hz), 2,50 (1H, d, J=11Hz), 2,58 (1H, dd, J=9 y 12 Hz), 2,96 (1H, d, J=7Hz), 3,43 (3H, s), 3,70 (1H, d, J=9Hz), 3,86 (1H, d, J=7Hz), 4,10 (1H, m), 5,08 (1H, m), 5,58 (1H, dt, J=3 y 12Hz), 5,70 (1H, dd, J=8 y 12 Hz), 6,05 (1H, dd, J=9 y 12 Hz), 6,24 (1H, dd, J=9 y 12Hz).

- Segundo producto eluido: Platenólido B: (Spectre 9647V) - espectro 1H en CD3CN (desplazamientos químicos en ppm): 0,81 (3H, t, J=6Hz), 0,89 (1H, m), 1,17 (3H, d, J=5Hz), 1,30 (4H, m), 1,47 (2H, m), 1,61 (1H, t, J=10Hz), 2,20 (1H, m), 2,38 (1H, d, J=13Hz), 2,52 (1H, m), 2,58 (1H, m), 2,68 (1H, dd, J=8 y 13Hz), 3,10 (1H, d, J=7Hz), 3,50 (3H, s), 3,61 (1H, d, J=8Hz), 3,82 (1H, d, J=7Hz), 5,09 (1H, m), 6,20 (1H, m), 6,25 (1H, dd, J=9 y 12 Hz), 6,58 (1H, d, J=12 Hz), 7,19 (1H, dd, J=9 y 12Hz).

Estos experimentos han permitido así determinar la estructura de estos dos compuestos. El primer producto eluido es el platenólido A y el segundo es el platenólido B, la estructura deducida de estas dos moléculas se presenta en la figura 36.

Se ha podido determinar también gracias a la técnica de CL/SM asociada a la RMN, en condiciones ligeramente diferentes de las descritas anteriormente pero cuyo ajuste es bien conocido por el experto en la materia, que la cepa OS49.67 produce además del platenólido A y B un derivado de estos dos compuestos. Se trata del platenólido A+micarosa y del platenólido B+micarosa (la estructura de estos dos compuestos se presenta en la figura 40). Los resultados del análisis del mosto de la cepa OS49.67 se presentan en la tabla 42.

Tabla 42. resultados del análisis CL/SM del mosto de la cepa OS49.67 Identidad [ ] (mg/l) Masa de los iones Max. de absorción Platenólido A 16,1 [M + Na]+ 393,0 231nm Masa exacta =370 [M + K]+ 408,9 Fórmula [M - H2O + H]+ 353,0 Molecular=C20H34O6 [2M + Na]+ 763,2 Platenólido B 1,4 [M - H2O + H]+ 351,0 283nm Masa exacta=368 [M + Na]+ 391,0 Fórmula [M +K]+ 406,9 Molecular=C20H32O6 [2M + Na]+ 759,1 Platenólido A + 'micarosa' 4,27 [M + Na]+ 537,0 230nm Masa exacta=514 [M +K]+ 553,0 Fórmula Molecular=C27H46O9

ES 2 552 912 T3   Identidad [ ] (mg/l) Masa de los iones Max. de absorción Platenólido B + 'micarosa' ND [M + Na]+ 535,0 284nm Masa exacta=512 [M +K]+ 550,9 Fórmula Molecular=C27H44O9 [PlatB - H2O+ H]+350,9 20.4 Análisis de los intermedios de biosíntesis producidos por la cepa SPM509: La cepa SPM509, en la que el gen orf14 está inactivado (orf14::att3Ωaac-) no produce espiramicinas (véase el ejemplo 13, 15 y 16). Una muestra se ha preparado según el método descrito anteriormente (véase párrafo 20.1) y se ha analizado por CL/SM como se describe anteriormente (véase el párrafo 20.2 y 20.3). El análisis de los intermedios de biosíntesis presentes en el sobrenadante de cultivo de la cepa SPM509 cultivada en medio MP5 ha mostrado que esta cepa producía sólo la forma B del platenólido («platenólido B», véase la figura 36) pero no la forma A («platenólido A», véase la figura 36).

EJEMPLO 21: Interrupción del gen orf14 en una cepa interrumpida en el gen orf3 (OS49.67) (no forma parte de la invención) El producto del gen orf14 es indispensable para la biosíntesis de las espiramicinas (véase los ejemplos 13, 15 y 16: la cepa SPM509 en la que este gen está interrumpido no produce más espiramicinas). El análisis de los intermedios de biosíntesis presentes en el sobrenadante de cultivo de la cepa SPM509 cultivada en medio MP5 ha mostrado que esta cepa producía sólo la forma B del platenólido pero no la forma A (véase el ejemplo 20). Una de las hipótesis que puede explicar esta observación es que el producto de orf14 esté implicado en la conversión de la forma B del platenólido en forma A por una etapa enzimática de reducción. Para probar esta hipótesis, el gen orf14 se ha inactivado en un mutante que no produce más espiramicina, pero que produce las formas A y B del platenólido. Es el caso de la cepa OS49.67 (véase el ejemplo 6 y 20) en la que el gen orf3 está inactivado por una deleción en fase (Δorf3). Para inactivar el gen orf14 en esta cepa, el plásmido pSPM509 se ha introducido por transformación de protoplastos de la cepa OS49.67 (Kieser, T et al., 2000). La inactivación del gen orf14 ya se ha descrito en el caso de la cepa OSC2 (véase el ejemplo 13) y se ha procedido de la misma manera para la inactivación del gen orf14 en la cepa OS49.67. Después de la transformación por el plásmido pSPM509, los clones se seleccionan por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina y en un medio con higromicina. Los clones resistentes a la apramicina (ApraR) y sensibles a la higromicina (HygS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y en los que el gen orf14 se ha sustituido por una copia de orf14 interrumpido por el casete att3Ωaac-. Se han seleccionado más particularmente estos clones y se ha verificado por hibridación la sustitución de la copia salvaje de orf14 por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos, se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3Ωaac- para verificar que la sustitución de gen había tenido realmente lugar. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (Δorf3, orf14::att3Ωaac-) y se ha denominado SPM510. En efecto, se ha podido verificar, gracias a las dos hibridaciones, que el casete att3Ωaac- estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación, del gen salvaje orf14 por la copia interrumpida por el casete att3Ωaac- en el genoma de este clon.

EJEMPLO 22: Complementación funcional de la interrupción del gen orf14 (no forma parte de la invención) 22.1 Construcción del plásmido pSPM519: El gen orf14 se ha amplificado por PCR utilizando el par de oligonucleótidos siguiente: EDR31: 5' CCCAAGCTTCTGCGCCCGCGGGCGTGAA 3' (SEC ID nº 136) y EDR37: 5' GCTCTAGAACCGTGTAGCCGCGCCCCGG 3' (SEC ID nº 137) y como matriz el ADN cromosómico de la cepa OSC2.

Los oligonucleótidos EDR31 y EDR37 llevan respectivamente el sitio de restricción HindIII y XbaI (secuencia en negrita). El fragmento de 1,2 kb así obtenido se ha clonado en el vector pGEM-T easy (comercializado por la compañía Promega (Madison, Wisconcin, USA)) para dar lugar al plásmido pSPM515. Este plásmido se ha digerido después por las enzimas

ES 2 552 912 T3   de restricción HindIII y XbaI. El inserto HindIII/XbaI de 1,2 kb obtenido se ha clonado en el vector pUWL201 (véase el ejemplo 17.1) previamente digerido por las mismas enzimas. El plásmido así obtenido se denominó pSPM519.

22.1 Transformación de las cepas SPM509 y SPM510 por el plásmido pSPM519: El plásmido pSPM519 se ha introducido en las cepas SPM509 (véase el ejemplo 13) y SPM510 (véase el ejemplo 17) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la tiostreptona. Los clones son después replicados sobre un medio que contiene tiostreptona.

La cepa SPM509 es una cepa no productora de espiramicina (véase el ejemplo 13, 15 y 16 y figura 24). La producción en espiramicinas de la cepa SPM509 transformada por el vector pSPM519 (cepa denominada SPM509 pSPM519) se ha analizado cultivando esta cepa en un medio MP5 en presencia de tiostreptona. Los sobrenadantes de cultivo se analizaron después por CLHP (véase el ejemplo 16 y 17). Los resultados de este análisis se presentan en la tabla 43, los datos son expresados en mg por litro de sobrenadante. Los resultados corresponden a la producción total en espiramicinas (obtenida sumando la producción en espiramicina I, II y III). Se ha observado que la presencia del vector pSPM519 en la cepa SPM509 restaura la producción de espiramicinas (véase la tabla 43).

Tabla 43. Producción en espiramicinas de la cepa SPM509 transformada por el vector pSPM519, (resultados expresados en mg/l de sobrenadante).

Cepa Producción en espiramicinas SPM509 pSPM519 58 La cepa SPM510 transformada por el plásmido pSPM519 se denominó SPM510 pSPM509.

EJEMPLO 23: Complementación funcional de la interrupción del gen orf3 por el gen tylB de S. fradiae (no forma parte de la invención) 23.1 Construcción del plásmido pOS49.52: El plásmido pOS49.52 corresponde a un plásmido que permite la expresión de la proteína TylB en S. ambofaciens. Para construirlo, la secuencia que codifica gen tylB de S. fradiae (Merson-Davies & Cundliffe, 1994, número de acceso GenBank: U08223 (secuencia de la región), SFU08223 (secuencia ADN) y AA21342 (secuencia proteica)) se ha introducido en el plásmido pKC1218 (Bierman et al., 1992, Kieser et al., 2000, una cepa de E. coli que contiene este plásmido está accesible en particular en ARS (NRRL) Agricultural Research Service Culture Collection) (Peoria, Illinois, USA), bajo el número B-14790). Además, esta secuencia codificante se ha colocado bajo el control del promotor ermE* (véase anteriormente, en particular ejemplo 17.1, Bibb et al., 1985, Bibb et al., 1994).

23.1 Transformación de las cepas OS49.67 por el plásmido pOS49.52: La cepa OS49.67 en la que el gen orf3 está inactivado por una deleción en fase no produce espiramicinas (véase el ejemplo 6 y 15). El plásmido pOS49.52 se ha introducido en la cepa OS49.67 por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones son después replicados sobre un medio que contiene apramicina. Se ha seleccionado más particularmente un clon y se le ha denominado OS49.67 pOS49.52.

Como se ha demostrado anteriormente, la cepa OS49.67 no produce espiramicinas (véase el ejemplo 6 y 15). La producción en espiramicinas de la cepa OS49.67 transformada por el vector pOS49.52 se ha analizado mediante la técnica descrita en el ejemplo 15. Se ha podido demostrar asimismo que esta cepa posee un fenotipo productor de espiramicinas. Así, la proteína TylB permite la complementación funcional de la interrupción del gen orf3.

EJEMPLO 24: Mejora de la producción en espiramicinas por sobreexpresión del gen orf28c

24.1 Construcción del plásmido pSPM75: El gen orf28c se ha amplificado por PCR utilizando un par de oligonucleótidos que comprende un sitio de restricción

HindIII o un sitio de restricción BamHI. Estos cebadores tienen la secuencia siguiente: KF30: 5' AAGCTTGTGTGCCCGGTGTACCTGGGGAGC 3' (SEC ID nº 138) con un sitio de restricción HindIII (que aparece en negrita)

ES 2 552 912 T3   KF31:5' GGATCCCGCGACGGACACGACCGCCGCGCA 3' (SEC ID nº 139) con el sitio de restricción BamHI (que aparece en negrita) Los cebadores KF30 y KF31 llevan respectivamente el sitio de restricción HindIII y BamHI (secuencia en negrita). El par de cebadores KF30 y KF31 permite amplificar un fragmento de ADN de un tamaño de aproximadamente 1,5 kb que contiene el gen orf28c utilizando como matriz el cósmido pSPM36 (véase anteriormente). El fragmento de 1,5 kb así obtenido se ha clonado en el vector pGEM-T easy (comercializado por la compañía Promega (Madison, Wisconcin, USA)) para dar lugar al plásmido pSPM74. El plásmido pSPM74 se ha digerido después por las enzimas de restricción

HindIII y BamHI y el inserto HindIII/BamHI de aproximadamente 1,5 kb obtenido se sub-clonó en el vector pUWL201 (véase el ejemplo 17.1) previamente digerido por las mismas enzimas. El plásmido así obtenido se denominó pSPM75, contiene el conjunto de la secuencia codificante de orf28c colocado bajo el control del promotor ermE*.

24.2 Transformación de la cepa OSC2 por el plásmido pSPM75: El plásmido pSPM75 se ha introducido en las cepas OSC2 por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación de los protoplastos, los clones se seleccionan por su resistencia a la tiostreptona. Los clones son después replicados sobre un medio que contiene tiostreptona y la transformación por el plásmido se verifica por extracción de plásmidos. Se han seleccionado más particularmente dos clones y se han denominado OSC2/pSPM75(1) y OSC2/pSPM75(2).

Una muestra de la cepa OSC2/pSPM75(2) se ha depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 6 de octubre de 2003 bajo el número de registro I-3101.

A fin de ensayar el efecto de la sobreexpresión del gen orf28c sobre la producción de espiramicinas, la producción en espiramicinas de los clones OSC2/pSPM75(1) y OSC2/pSPM75(2) se ha ensayado mediante la técnica descrita en el ejemplo 15. El análisis de la producción en espiramicinas de la cepa OSC2 se ha efectuado también en paralelo para comparación. Se ha podido observar así que la presencia del plásmido pSPM75 aumenta significativamente la producción en espiramicinas de la cepa OSC2. Esto demuestra que la sobreexpresión de orf28c conduce a un aumento de la producción en espiramicinas y confirma su papel como regulador.

La producción en espiramicinas de los clones OSC2/pSPM75(1) y OSC2/pSPM75(2) también se ha analizado por CLHP (de la misma manera que en el ejemplo 17.2). El análisis de la producción en espiramicinas de la cepa OSC2 también se ha efectuado en paralelo para comparación. Los resultados de este análisis se presentan en la tabla 44, los datos son expresados en mg por litro de sobrenadante. Los resultados corresponden a la producción total en espiramicinas (obtenida sumando la producción en espiramicina I, II y III).

Tabla 44. Producción en espiramicinas de las cepas derivadas de OSC2 transformadas por pSPM75, (resultados expresados en mg/l).

Cepa Espiramicinas OSC2 OSC2/pSPM75(1) 120 OSC2/pSPM75(2) 155 Así, se observa que la presencia del plásmido pSPM75 aumenta significativamente la producción en espiramicinas de la cepa OSC2. Esto demuestra bien que la sobreexpresión de orf28c tiene un efecto positivo sobre la producción en espiramicinas.

EJEMPLO 25: Análisis de la producción de intermedios de biosíntesis de espiramicinas de una cepa inactivada en el gen

orf8: (no forma parte de la invención) La cepa OS49.107, en la que el gen orf8 está inactivado por inserción del casete Ωhyg, no produce espiramicinas (véase el ejemplo 7 y 15). El gen orf8 codifica una proteína que presenta una fuerte similitud relativa con varias aminotransferasas y sugiere fuertemente que el gen orf8 codifica una 4 amino-transferasa responsable de la reacción de transaminación necesaria para la biosíntesis de la forosamina (véase la figura 6). Se espera por lo tanto que la biosíntesis de las espiramicinas esté bloqueada en la fase de la forocidina (véase la figura 7). La cepa OS49.107 que es no productora de espiramicina debería por lo tanto producir forocidina.

ES 2 552 912 T3   Una muestra de sobrenadante de la cepa OS49.107 se ha preparado según el método descrito anteriormente (véase el ejemplo 16, sin extracción con MIBK) y se ha analizado por CL/SM como se ha descrito anteriormente (véase el párrafo 20.2 y 20.3). En modo SIM, la masa 558 relativa al ión molecular de la forocidina se ha seleccionado y se han detectado varios picos. La presencia de compuestos de masa 558 es compatible con la hipótesis del papel de orf8 en la síntesis de forosamina.

EJEMPLO 26: Análisis de la producción de intermedios de biosíntesis de espiramicinas de una cepa inactivada en el gen

orf12: (no forma parte de la invención) La cepa SPM507, en la que el gen orf12 está inactivado, no produce espiramicinas (véase el ejemplo 11 y 15). El gen orf12 codificaría una 3,4 deshidratasa responsable de la reacción de deshidratación necesaria para la biosíntesis de la forosamina (véase la figura 6). Se espera por lo tanto que la biosíntesis de las espiramicinas esté bloqueada en la fase de la forocidina (véase figura 7). La cepa SPM507, que es no productora de espiramicina, debería por lo tanto producir forocidina.

Una muestra de sobrenadante de la cepa SPM507 se ha preparado según el método descrito anteriormente (véase el ejemplo 16, sin extracción con MIBK) y se ha analizado por CL/SM como se ha descrito anteriormente (véase el párrafo 20.2 y 20.3). En estas condiciones, el tiempo de retención de la forocidina es de aproximadamente 12,9 minutos. En modo SIM, se ha seleccionado la masa 558 relativa al ión molecular [M+H]+ de la forocidina y se ha detectado un pico.

La presencia de un compuesto a 558 permite validar la hipótesis del papel del producto de orf12 en la biosíntesis de las espiramicinas.

Sin embargo, la forocidina está presente en una cantidad relativamente baja y en estas condiciones, se ha observado más particularmente un producto que absorbe a 238 nm (tiempo de retención de 17,1 min). El análisis en LC/SM ha permitido determinar la masa de este compuesto que es de 744,3 g/mol ([M+H]+=744,3 producto principal).

Con el fin de obtener la estructura, se ha aislado el producto mencionado anteriormente y se ha purificado en las condiciones descritas anteriormente (véase párrafo 20.1)). La fase orgánica (MIBK) es entonces recuperada y evaporada. El extracto seco se recoge con agua y se extrae con heptano. La solución acuosa se extrae después por fijación sobre un cartucho Oasis HLB 1 g (Waters SAS, St-Quentin en-Yvelines, Francia). El compuesto se recupera por elución con una mezcla agua/acetonitrilo 30/70. Esta solución se inyecta después (100 µl) sobre la columna analítica y las fracciones recuperadas sobre cartucho Oasis HLB 1 cc 30mg (Waters). Antes de la utilización, los cartuchos Oasis HLB 1 cc 30mg (Waters) son acondicionados secuencialmente por acetonitrilo, después con una mezcla agua/acetonitrilo (20v/80v) y una mezcla agua/acetonitrilo 80/20.

El cartucho Oasis HLB 1 cc 30mg (Waters) se lava después sucesivamente por 1 ml de agua/acetonitrilo (95/5), 1ml de agua/acetonitrilo deuterado (95/5), y después se eluye con 600 µl de agua/acetonitrilo deuterado 40/60. La solución recuperada se analiza después directamente en RMN.

El espectro RMN obtenido para este compuesto es el siguiente (Espectro RMN 19312V): Espectro 1H en CD3CN/D2O (desplazamientos químicos en ppm): 0,92 (3H, d, J=6Hz), 1,10 (1H, m), 1,14 (3H, s), 1,17 (3H, d, J=6Hz), 1,22 (3H, d, J=6Hz), 1,25 (3H, d, J=6Hz), 1,40 (1H, m), 1,75 (1H, dd, J=12 y 2Hz), 1,81 (1H, m), 1,90 (1H, d, J=12Hz), 2,05 (1H, m), 2,12 (3H, s), 2,15 (1H, m), 2,35 (2H, m), 2,45 (6H, s largo), 2,53 (1H, m), 2,64 (1H, dd, J=12 y 9Hz), 2,80 (1H, dd, J=9 y 16Hz), 2,95 (1H, d, J=8Hz), 3,23 (2H, m), 3,34 (1H, d, J=7Hz), 3,45 (3H, s), 3,49 (1H, m), 3,93 (1H, dd, J=7 y 3Hz), 4,08 (1H, m), 4,37 (1H, d, J=6Hz), 4,88 (1H, m), 5,05 (2H, m), 5,65 (2H, m), 6,08 (1H, dd, J=8 y 12Hz), 6,40 (1H, dd, J=12 y 9Hz), 9,60(1H,s).

Estos experimentos han permitido así determinar la estructura de este compuesto, esta se presenta en la figura 38.

EJEMPLO 27: Análisis de la producción de intermedios de biosíntesis de espiramicinas de una cepa inactivada en el gen orf5*: (no forma parte de la invención) La cepa SPM501 posee el genotipo orf6*::att1Ωhyg+. Gracias al efecto polar de la inserción del casete att1Ωhyg+ en el gen orf 6*, se ha podido determinar que el gen orf 5* es indispensable para la ruta de la biosíntesis de las espiramicinas.

En efecto, la inserción del casete escindible en la parte codificante del gen orf 6* conlleva una detención total de la producción en espiramicinas por efecto polar sobre la expresión del gen orf5*. Sin embargo, una vez que el casete insertado se ha escindido (y por lo tanto cuando sólo gen orf6* está inactivado, véanse los ejemplos 14 y 15), se restaura una producción de espiramicina I. Esto demuestra que el gen orf 5* es indispensable para la biosíntesis de las espiramicinas ya que su inactivación conlleva una detención total de la producción en espiramicinas.

El gen orf5* codifica una proteína que presenta una fuerte similitud relativa con varias O-metiltransferasas. El gen orf5* sería una O-metil transferasa implicada en la biosíntesis del platenólido. Para verificar esta hipótesis, se han llevado a

ES 2 552 912 T3   cabo unos experimentos de análisis CL/SM y de RMN sobre una cepa de S. ambofaciens de genotipo orf6*:: att1Ωhyg+ obtenida a partir de una cepa que sobreproducía las espiramicinas.

Se ha preparado una muestra del sobrenadante de esta cepa según el método descrito anteriormente (véase el ejemplo 16, sin extracción con MIBK) y se ha analizado por CL/SM como se ha descrito anteriormente (véase el párrafo 20.2 y 20.3). Sin embargo, la columna utilizada es una columna X-Terra (Waters SAS, St-Quentin en-Yvelines, France), y la tensión de cono del espectrómetro se ajusta a 380V para obtener la fragmentación del compuesto analizado. En estas condiciones, se observa un producto cuyo tiempo de retención es de aproximadamente 13,1 minutos. El espectro de masa de este compuesto tiene un aspecto parecido al de la espiramicina I pero el ión molecular está a 829. La diferencia de masa de 14 con respecto a la masa de la espiramicina puede explicarse por la ausencia de grupo metilo en el oxígeno llevado por el carbono n°4 del anillo lactona (la estructura de este compuesto se presenta en la figura 39). La presencia de un compuesto a 829 permite validar la hipótesis del papel de orf5* en la biosíntesis de las espiramicinas.

Mediante un ensayo microbiológico efectuado sobre una cepa sensible de M. luteus (véase el ejemplo 15 y figura 18) se ha demostrado que la molécula intermedia (espiramicina menos el grupo metilo cuya estructura se presenta en la figura 39) producida por la cepa orf6*::Ωatthyg+ es mucho menos activa (de un factor 10) que la espiramicina de origen con el grupo metilo en la posición 4.

EJEMPLO 28: Construcción de nuevos «casetes escindibles»: Se han construido nuevos casetes escindibles. Estos casetes son muy parecidos a los casetes escindibles ya descritos en el ejemplo 9. La diferencia principal entre los antiguos y los nuevos casetes es la ausencia en estos últimos de las secuencias que corresponden a los extremos del interposón Ω, secuencias que contienen un terminador de transcripción que proviene del fago T4.

En los casetes sin terminador, el gen que confiere la resistencia a un antibiótico está flanqueado de las secuencias attR y attL que permiten la escisión. El gen de resistencia es el gen aac(3)IV que codifica una acetiltransferasa que confiere la resistencia a la apramicina. Este gen está presente en el casete Ωaac (número de acceso GenBank: X99313, Blondelet- Rouault, M.H. et al., 1997) y se ha amplificado por PCR utilizando como matriz el plásmido pOSK1102 (véase anteriormente) y como cebadores los oligonucleótidos KF42 y KF43 que contienen cada uno el sitio de restricción HindIII (en negrita)(AAGCTT) en 5'.

KF42: 5'-AAGCTTGTACGGCCCACAGAATGATGTCAC 3' (SEC ID nº 153) y KF43: 5'-AAGCTTCGACTACCTTGGTGATCTCGCCTT-3' (SEC ID nº 154).

El producto de PCR obtenido de aproximadamente 1kb se ha clonado en el vector E. coli pGEMT Easy, dando lugar al plásmido pSPM83.

El vector pSPM83 se ha digerido por la enzima de restricción HindIII. El fragmento HindIII-HindIII del inserto se ha aislado por purificación a partir de un gel de agarosa al 0,8% y después se ha clonado en el sitio HindIII situado entre las secuencias attL y attR de los diferentes plásmidos que llevan los diferentes casetes escindibles posibles (véase el ejemplo 9 y la figura 27) a fin de sustituir el fragmento HindIII que corresponde a Ωacc por el fragmento HindIII que corresponde al gen aac solo. Esto ha permitido obtener los casetes att1aac, att2aac y att3aac (según la fase deseada, véase el ejemplo 9). Según la orientación del gen aac con respecto a las secuencias attL y attR, se distinguen att1aac+, att1aac-, att2aac+, att2aac-, att3aac+ y att3aac- (según las mismas convenciones que las adoptadas en el ejemplo 9).

EJEMPLO 29: Construcción de una cepa de S. ambofaciens interrumpida en el gen orf28c: Se ha realizado la inactivación del gen orf28c gracias a la técnica de los casetes escindibles. El casete escindible

att3aac+ (véase el ejemplo 28) se ha amplificado por PCR utilizando como matriz el plásmido pSPM101 (el plásmido pSPM101 es un plásmido derivado del vector pGP704Not (Chaveroche et al., 2000) (Miller VL & Mekalanos JJ, 1988)) en el que el casete att3aac+ se ha clonado como un fragmento EcoRV en el sitio único EcoRV de pGP704Not) y con la ayuda de los cebadores siguientes:

KF32:

y KF33:

ES 2 552 912 T3   Los 39 nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen orf28c y los 26 nucleótidos situados generalmente en 3' (representados en negrita y subrayados anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3aac+.

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli hiper-recombinante DY330 (Yu et al., 2000) (esta cepa contiene los genes exo, bet y gam del fago lambda integrados en su cromosoma, estos genes se expresan a 42°C, se ha utilizado en lugar de la cepa E.coli KS272 (Chaveroche et al., 2000)) que contiene el cósmido pSPM36. Así, las bacterias se han transformado por electroporación por este producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los cósmidos de los clones obtenidos se han extraído y se han digerido por la enzima de restricción BamHI, con el objetivo de verificar que el perfil de digestión obtenido correspondía al perfil esperado si hubo inserción del casete (att3aac+) en el gen orf28c, es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana. La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo cósmido posee el perfil esperado y se ha denominado el cósmido correspondiente pSPM107. Este cósmido es un derivado de pSPM36 en el que orf28c está interrumpido por el casete att3aac+. La inserción del casete se acompaña de una deleción en el gen orf28c, la interrupción empieza a nivel del codón 28º de orf28c. Después del casete, quedan los 137 últimos codones de orf28c.

Se ha introducido en una primera fase el cósmido pSPM107 en la cepa E. coli DH5α y después en la cepa Streptomyces ambofaciens OSC2 por transformación de protoplastos. Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con puromicina (antibiótico A) (véase la figura 9). Los clones resistentes a la apramicina (ApraR) y sensibles a la puromicina (PuroS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf28c interrumpido por el casete att3aac+. Se han seleccionado más particularmente estos clones y se ha verificado por hibridación la sustitución de la copia salvaje de orf28c por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3aac+ para verificar la presencia del casete en el locus esperado en el ADN genómico de los clones obtenidos. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf28c::att3aac+) y se ha denominado SPM107. Este clon posee por lo tanto el genotipo: orf28c::att3aac+ y se denominó SPM107. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf28c, a la vista de la orientación de los genes (véase la figura 3). En efecto, el hecho de que orf29 esté orientado en el sentido opuesto a orf28c muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento, en particular por transformación por el plásmido pOSV508.

A fin de ensayar el efecto de la extinción del gen orf28c sobre la producción de espiramicinas, se ha ensayado la producción en espiramicinas de la cepa SPM107 mediante la técnica descrita en el ejemplo 15. Se ha podido demostrar así que esta cepa posee un fenotipo no productor de espiramicinas. Esto demuestra que el gen orf28c es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

EJEMPLO 30: Construcción de una cepa de S. ambofaciens interrumpida en el gen orf31: (no forma parte de la invención) La inactivación del gen orf31 se ha realizado gracias a la técnica de los casetes escindibles. El casete escindible att3aac+ se ha amplificado por PCR utilizando como matriz el plásmido pSPM101 y los oligonucleótidos EDR71 y EDR72.

EDR71: EDR72:

ES 2 552 912 T3   Los 39 nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen orf31 y los 26 nucleótidos situados generalmente en 3' (representados en negrita y subrayados anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3aac+.

El producto de PCR así obtenido se ha utilizado para transformar la cepa E. coli KS272 que contiene el plásmido pKOBEG y el cósmido pSPM36, como se describe por Chaveroche et al. (Chaveroche et al., 2000) (véase la figura 12 para el principio, el plásmido pOS49.99 debe estar sustituido por el cósmido pSPM36 y el plásmido obtenido no es ya pSPM17, sino pSPM543). Así, las bacterias se han transformado por electroporación por este producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los cósmidos de los clones obtenidos se han extraído y se han digerido por varias enzimas de restricción, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3aac+) en el gen orf31, es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana. La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo cósmido posee el perfil esperado y se ha denominado el cósmido correspondiente pSPM543. Este cósmido es un derivado de pSPM36 en el que orf31 está interrumpido por el casete att3aac+ (véase la figura 12). La inserción del casete se acompaña de una deleción en el gen orf31, la interrupción empieza a nivel del codón 36º de orf31. Después del casete, quedan los 33 úmltimos codones de orf31.

El cósmido pSPM543 se ha introducido en la cepa Streptomyces ambofaciens OSC2 (véase anteriormente) por transformación de protoplastos (Kieser, T et al., 2000). Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con puromicina (antibiótico A) (véase la figura 9). Los clones que resistentes la apramicina (ApraR) y sensibles a la puromicina (PuroS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf31 interrumpido por el casete att3aac+. Se han seleccionado más particularmente estos clones y se ha verificado por hibridación la sustitución de la copia salvaje de orf31 por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete

att3aac+ para verificar la presencia del casete en el locus esperado en el ADN genómico de los clones obtenidos. Se ha efectuado una segunda hibridación utilizando como sonda un fragmento de ADN obtenido por PCR y que corresponde a una parte muy amplia de la secuencia codificante del gen orf31.

Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf31::att3aac+) y se ha denominado SPM543. En efecto, se ha podido verificar gracias a las dos hibridaciones que el casete att3aac+ estaba muy presente en el genoma de este clon y que se obtiene correctamente el perfil de digestión esperado en el caso de una sustitución, tras un doble evento de recombinación del gen salvaje por la copia interrumpida por el casete att3aac+ en el genoma de este clon. Este clon posee por lo tanto el genotipo: orf31::att3aac+ y se denominó SPM543. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf31, a la vista de la orientación de los genes (véase la figura 3). En efecto, el hecho de que orf32c esté orientado en el sentido opuesto a orf31 muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite no obstante tener la posibilidad de librarse del marcador de selección en cualquier momento, en particular por transformación por el plásmido pOSV508.

A fin de ensayar el efecto de extinción del gen orf31 sobre la producción de espiramicinas, se ha ensayado la producción en espiramicinas de la cepa SPM543 mediante la técnica descrita en el ejemplo 15. Se ha podido demostrar así que esta cepa posee un fenotipo no productor de espiramicinas. Esto demuestra que el gen orf31 es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

EJEMPLO 31 Construcción de una cepa de S. ambofaciens interrumpida en el gen orf32c: (no forma parte de la invención) Se ha realizado la inactivación del gen orf32c gracias a la técnica de los casetes escindibles. El casete escindible

att3aac+ se ha amplificado por PCR utilizando como matriz el plásmido pSPM101 y con la ayuda de los cebadores siguientes: KF52:

ES 2 552 912 T3   y KF53: Los 40 nucleótidos situados en el extremo 5' de estos oligonucleótidos comprenden una secuencia que corresponde a una secuencia en el gen orf32c y los 26 nucleótidos situados generalmente en 3' (representados en negrita y subrayados anteriormente) corresponden a la secuencia de uno de los extremos del casete escindible att3aac+.

Se ha utilizado el producto de PCR así obtenido para transformar la cepa E. coli hiper-recombinante DY330 (Yu et al., 2000) que contiene el cósmido pSPM36. Así, las bacterias se han transformado por electroporación por este producto de PCR y los clones se han seleccionado por su resistencia a la apramicina. Los cósmidos de los clones obtenidos se han extraído y se han digerido por la enzimas de restricción BamHI, con el objetivo de verificar que el perfil de digestión obtenido corresponde al perfil esperado si hubo inserción del casete (att3aac+) en el gen orf32c, es decir si hubo buena recombinación homóloga entre los extremos del producto PCR y el gen diana. La verificación de la construcción se puede realizar también mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR. Se ha seleccionado un clon cuyo cósmido posee el perfil esperado y se ha denominado el cósmido correspondiente pSPM106. Este cósmido es un derivado de pSPM36 en el que orf32c está interrumpido por el casete att3aac+. La inserción del casete se acompaña de una deleción en el gen orf32c, la interrupción empieza a nivel del codón 112º de orf32c. Después del casete, quedan los 91 últimos codones de orf32c.

Se ha introducido en una primera fase el cósmido pSPM106 en la cepa E. coli DH5α después en la cepa Streptomyces

ambofaciens OSC2 por transformación. Después de la transformación, los clones se seleccionan por su resistencia a la apramicina. Los clones resistentes a la apramicina son después replicados respectivamente en un medio con apramicina (antibiótico B) y en un medio con puromicina (antibiótico A) (véase la figura 9). Los clones resistentes a la apramicina (ApraR) y sensibles a la puromicina (PuroS) son en principio aquellos en los que se ha producido un doble evento de "crossing over" y que poseen el gen orf32c interrumpido por el casete att3aac+. Se han seleccionado más particularmente estos clones y se ha verificado por hibridación la sustitución de la copia salvaje de orf32c por la copia interrumpida por el casete. Así, el ADN total de los clones obtenidos se ha digerido por varias enzimas, separado sobre gel de agarosa, transferido sobre membrana, e hibridado con una sonda que corresponde al casete att3aac+ para verificar la presencia del casete en el ADN genómico de los clones obtenidos. Se puede realizar también la verificación del genotipo mediante cualquier método conocido por el experto en la materia y en particular por PCR utilizando los oligonucleótidos apropiados y la secuenciación del producto de PCR.

Se ha seleccionado más particularmente un clon que presenta las características esperadas (orf32c::att3aac+). Este clon posee por lo tanto el genotipo: orf32c::att3aac+ y se denominó SPM106. Es inútil proceder a la escisión del casete para el estudio del efecto de inactivación de orf32c, a la vista de la orientación de los genes (véase la figura 3). En efecto, el hecho de que orf33 esté orientado en el sentido opuesto a orf32c muestra que estos genes no están co-transcritos. La utilización de un casete escindible permite, por el contrario, tener la posibilidad de librarse del marcador de selección en cualquier momento, en particular por transformación por el plásmido pOSV508.

A fin de ensayar el efecto de extinción del gen orf32c sobre la producción de espiramicinas, se ha ensayado la producción en espiramicinas de la cepa SPM106 mediante la técnica descrita en el ejemplo 15. Se ha podido demostrar así que esta cepa posee un fenotipo productor de espiramicinas. Esto demuestra que el gen orf32c no es un gen esencial para la biosíntesis de la espiramicina en S. ambofaciens.

Lista de las construcciones descritas en la presente solicitud Lista de las abreviaturas: Am: Ampicilina; Hyg: Higromicina; Sp: Espiramicina; Ts: Tiostreptón; Cm: Cloramfenicol. Kn: Kanamicina, Apra: apramicina.

Nombre de la Marcador de Principales características Referencia construcción selección pWE15 Am (Wahl, et al., 1987)

ES 2 552 912 T3   Nombre de la Marcador de Principales características Referencia construcción selección pWED1 Am pWE15 en el que se ha suprimido un fragmento HpaI-HpaI (Gourmelen

et al., de 4,1 kb 1998) pOJ260 Apra Conjugativo, no replicativo en Streptomyces

(Bierman et al., 1992) pHP45 Ωhyg

Hyg Casete Ωhyg en pHP45.

(Blondelet-Rouault et al., 1997) pKC505 Apra Cósmido (Richardson MA et

al., 1987) pIJ486 Ts Plásmido replicativo multicopias Streptomyces

(Ward et al., 1986) pOSint3 Am

ptrc-xis-int en pTrc99A (Raynal et al., 1998) pWHM3 Am, Ts Vector lanzadera replicativo E. coli/Streptomyces.

(Vara et al., 1989) pKOBEG Cm (Chaveroche et al., 2000) pGP704Not Am (Chaveroche et al., 2000) pMBL18 Am (Nakano et al., 1995) pGEM-T Easy Am vector E. coli para la clonación de productos PCR Mezei et al., 1994 pOS49.1 Am pWED1 con inserto a nivel del sitio BamHI Ejemplo 2 pOS49.11 Am Fragmento SacI de pOS49.1 en pUC 19.

Ejemplo 2 pOSC49.12 Ch Fragmento XhoI de pOS49.11 en pBC SK+ Ejemplo 2 pOS49.14 Cm, Hyg pOSC49.12 con el gen orf3 interrumpido por el casete Ejemplo 2

Ωhyg

pOS49.16 Apra, Hyg Inserto de pOS49.14 en pOJ260 Ejemplo 2 pOS49.28 Cm Fragmento BamHI-PstI de 3,7kb de pOS49.1 en pBC SK+ Ejemplo 3 pOS44.1 Apra, Sp pKC505 que contiene un inserto que confiere la resistencia (Pernodet

et

al.,

a la espiramicina en S. griseofuscus

1999) pOS44.2 Ts, Sp Fragmento Sau3AI de 1,8 kb pOS44.1 en pIJ486 Ejemplo 3 pOS44.4.

Am Inserto de pOS44.2 en pUC 19 Ejemplo 3 pSPM5 Am pWED1 con inserto de ADN de S. ambofaciens a nivel del Ejemplo 3 sitio BamHI pSPM7 Am pWED1 con inserto de ADN de S. ambofaciens a nivel del Ejemplo 3 sitio BamHI pOSK1205 Hyg pBK-CMV en el que hyg sustituye neo

Ejemplo 5 pOS49.67 Apra Fragmento EcoRI-SacI de pOS49.1, que comprende una Ejemplo 6 deleción interna de 504 nucleótidos, en pOJ260 pOS49.88 Am Fragmento de 3,7 kb PstI-EcoRI de pOS49.1 en pUC19 Ejemplo 7 pOS49.106 Am pO49.88 con hyg en orf8 (hyg y orf8 en la misma Ejemplo 7 orientación) pOS49.120 Am pOS49.88 con hyg en orf8 (hyg y orf8 en orientaciones Ejemplo 7 opuestas) pOS49.107 Apra, Hyg Inserto de pOS49.106 en pOJ260 Ejemplo 7 pOS49.32 Am, Kn Fragmento de 1,5 kb interno a orf10 en pCR2.1-TOPO Ejemplo 8

ES 2 552 912 T3   Nombre de la Marcador de Principales características Referencia construcción selección pOS49.43 Am, Kn pOS49.32 con hyg en orf10 (hyg y orf10 en la misma Ejemplo 8 orientación) pOS49.44 Am, Kn pOS49.32 con hyg en orf10 (hyg y orf10 en orientaciones Ejemplo 8 opuestas) pOS49.50 Apra, Hyg Inserto de pOS49.43 en pOJ260 Ejemplo 8 pWHM3Hyg Am, Hyg pWHM3 en el que tsr está sustituido por hyg

Ejemplo 10 pOSV508 Am, Ts ptrc-xis-int en pWHM3 Ejemplo 9 patt1Ωhyg+ Cm, Hyg Casete att1Ωhyg+ en pBC SK+ cuyo sitio HindIII se ha Ejemplo 9 suprimido patt3Ωaac- Cm, Gn Casete att3Ωaac- en pBC SK+ cuyo sitio HindIII se ha Ejemplo 9 suprimido pOSV510 Am, Hyg pro pra-Amh en pWHM3Hyg Ejemplo 10 pOS49.99 Am Fragmento EcoRI-BamHI de 4,5 kb de pSPM5 en pUC19 Ejemplo 10 pOSK1102 Am, Apra pGP704Not que contiene el casete att3Ωaac-

Ejemplo 10 pSPM17 Am, Apra pOS49.99 en el que orf2 está interrumpido por el casete Ejemplo 10

att3Ωaac-

pSPM21 Hyg, Apra pOSK1205 que contiene el inserto EcoRI-XbaI de pSPM17 Ejemplo 10 (en el que orf2 está interrumpido por el casete att3Ωaac-) pSPM502 Am Fragmento BglII de 15,1 kb de pSPM7 en pMBL18 Ejemplo 11 pSPM504 Hyg Inserto de pSPM502 en pOSK1205 Ejemplo 11 pSPM507 Hyg, Apra pSPM504 en el que orf12 está interrumpido por el casete Ejemplo 11

att3Ωaac-

pSPM508 Hyg, Apra pSPM504 en el que orf13c está interrumpido por el casete Ejemplo 12

att3Ωaac-

pSPM509 Hyg, Apra pSPM504 en el que orf14 está interrumpido por el casete Ejemplo 13

att3Ωaac- pBXL1111 Am Fragmento de 1,11 kb que contiene orf6* amplificado por Ejemplo 14 PCR a partir de pSPM7, en el vector pGEM-T Easy pBXL1112 Am, Hyg pBXL1111 en el que el casete att1Ωhyg+ se ha introducido Ejemplo 14 después de la deleción de 120 pb en la secuencia que codifica gen orf6*

pBXL1113 Apra, Hyg Insert PstI de 3,7 kb de pBXL1112 en pOJ260 Ejemplo 14 pSPM520 Am Fragmento de PCR amplificado por los oligonucleótidos Ejemplo 17 EDR39-EDR42 en pGEM-T Easy pSPM521 Am Fragmento de PCR amplificado por los oligonucleótidos Ejemplo 17 EDR40-EDR42 en pGEM-T Easy pSPM522 Am Fragmento de PCR amplificado por los oligonucleótidos Ejemplo 17 EDR41-EDR42 en pGEM-T Easy pUWL201 Am, Ts (Doumith et al., 2000) pSPM523 Am, Ts Fragmento HindIII-BamHI del inserto del plásmido Ejemplo 17 pSPM520 en el vector pUWL201 pSPM524 Am, Ts Fragmento HindIII-BamHI del inserto del plásmido Ejemplo 17 pSPM521 en el vector pUWL201

ES 2 552 912 T3   Nombre de la Marcador de Principales características Referencia construcción selección pSPM525 Am, Ts Fragmento HindIII-BamHI del inserto del plásmido Ejemplo 17 pSPM522 en el vector pUWL201 pSPM527 Am pSPM521 con desplazamiento del marco de lectura a nivel Ejemplo 17 del sitio XhoI pSPM528 Am, Ts Fragmento HindIII-BamHI del inserto del plásmido Ejemplo 17 pSPM527 en el vector pUWL201 pVF 10.4

(Vara et al., 1985; Lacalle et al., 1989) pPM803 Ts (Mazodier,P. et al., 1989) pGEM-T-pac-

Am Casete pac-oriT (amplificado por PCR a partir de pVF 10.4 Ejemplo 18

oriT

y pPM803) en pGEM-T Easy pWED2 Am Casete pac-oriT obtenido a partir de pGEM-T-pac-oriT

Ejemplo 18 insertada en pWED1 pSPM34 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM35 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM36 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM37 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM38 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM39 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM40 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM41 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM42 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM43 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM44 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM45 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM47 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM48 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM50 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM51 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM52 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM53 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM55 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM56 Am pWED2 con inserto a nivel del sitio BamHI Ejemplo 19 pSPM58 Kn Fragmento PstI-PstI de aproximadamente 6kb del inserto Ejemplo 19 de pSPM36 en pBK-CMV pSPM72 Kn Fragmento StuI-StuI de aproximadamente 10 kb del Ejemplo 19 inserto de pSPM36 clonado en pBK-CMV pSPM73 Cm Fragmento EcoRI-HindIII del inserto de pSPM72 en pBC- Ejemplo 19 SK+

ES 2 552 912 T3   Nombre de la Marcador de Principales características Referencia construcción selección pSPM515 Am Fragmento de PCR amplificado por EDR31-EDR37 en Ejemplo 22 pGEM-T easy pSPM519 Am, Ts Insert HindIII/XbaI de pSPM515 en pUWL201 Ejemplo 22 pOS49.52 Apra Secuencia codificante de tylB bajo el control del promotor Ejemplo 23 ermE* en el plásmido pKC1218 pSPM74 Am Fragmento de PCR amplificado por KF30-KF31 en pGEM- Ejemplo 24 T easy pSPM75 Am, Ts Insert HindIII/BamHI de pSPM74 en pUWL201 Ejemplo 24 pSPM79 Kn Fragmento PstI-PstI de aproximadamente 2,5kb del inserto Ejemplo 19 de pSPM36 en pBK-CMV pSPM83 Am Fragmento de PCR amplificado por KF42-KF43 en pGEM- Ejemplo 28 T easy pSPM107 Am, Apra pSPM36 en el que orf28c está interrumpido por el casete Ejemplo 29

att3aac+ pSPM543 Am, Apra pSPM36 en el que orf31 está interrumpido por el casete Ejemplo 30

att3aac+ pSPM106 Am, Apra pSPM36 en el que orf32c está interrumpido por el casete Ejemplo 31

att3aac+ Depósito del material biológico Los organismos siguientes se han depositado el 10 de julio de 2002 en la Colección Nacional de Cultivos de Microorganismos (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, Francia, según las disposiciones del Tratado de Budapest.

- Cepa OSC2 bajo el número de registro I-2908.

- Cepa SPM501 bajo el número de registro I-2909.

- Cepa SPM502 bajo el número de registro I-2910.

- Cepa SPM507 bajo el número de registro I-2911.

- Cepa SPM508 bajo el número de registro I-2912.

- Cepa SPM509 bajo el número de registro I-2913.

- Cepa SPM21 bajo el número de registro I-2914.

- Cepa SPM22 bajo el número de registro I-2915.

- Cepa OS49.67 bajo el número de registro I-2916.

- Cepa OS49.107 bajo el número de registro I-2917.

- Cepa Escherichia coli DH5α que contiene el plásmido pOS44.4 bajo el número de registro I-2918.

Los organismos siguientes se han depositado el 26 de febrero de 2003 en la Colección Nacional de Cultivos de Microorganismos (CNCM), 25 rue du Docteur Roux, 75724 Paris Cedex 15, Franca, según las disposiciones del Tratado de Budapest.

- Cepa SPM502 pSPM525 bajo el número de registro I-2977.

ES 2 552 912 T3   Los organismos siguientes se han depositado en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 6 de octubre de 2003 según las disposiciones del Tratado de Budapest.

- Cepa OSC2/pSPM75(2) bajo el número de registro I-3101.

Todas las publicaciones y patentes citadas están incorporadas a la presente solicitud por referencia.

Bibliografía: - Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. (1990). 215 (3):403-410.

- Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new génération of protein database search programs. Nucleic Acids Res. (1997). 25 (17):3389-402.

- Amann, E., Ochs, B. y Abel, K.J. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli Gene (1988) 69 (2), 301-315.

- Arisawa, A., Kawamura, N., Tsunekawa, H., Okamura, K., Tone, H.y Okamoto,R. Cloning and nucleotide sequences of two genes involved in the 4"-O-acylation of macrolide antibiotics from Streptomyces thermotolerans. Biosci. Biotechnol. Biochem. (1993). 57 (12): 2020-2025.

- Arisawa A, Kawamura N, Takeda K, Tsunekawa H, Okamura K, Okamoto R. Cloning of the macrolide antibiotic biosynthesis gene acyA, which encodes 3-O-acyltransferase, from Streptomyces thermotolerans and its use for direct fermentative production of a hybrid macrolide antibiotic. Appl Environ. Microbiol. (1994). 60 (7):2657-2660.

- August, P.R., Tang, L., Yoon, Y.J., Ning, Streptomyces, Mueller, R., Yu, T.W., Taylor, M., Hoffmann, D., Kim, C.G., Zhang, X., Hutchinson, C.R. y Floss, H.G. Biosynthesis of the ansamycin antibiotic rifamycin: déductions from the molecular analysis of the rif biosynthetic gene cluster of Amycolatopsis mediterranei S699. Chem. Biol. (1998) 5 (2), 69-79.

- Ausubel Fred M., Brent Roger, Kingston Robert E., Moore David D., Seidman J.G., Smith John A., Struhl Kevin (Editores). Current Protocols in Molecular Biology, publicado por John Wiley & Sons Inc. Current Protocols Customer Service, 605 Third Avenue, 9th Floor New York, NY 10158 USA (edición actualizada de marzo de 2002).

- Baltz RH, McHenney MA, Cantwell CA, Queener SW, Solenberg PJ. Applications of transposition mutagenesis in antibiotic producing streptomycetes. Antonie Van Leeuwenhoek. (1997). 71 (1-2): 179-187.

- Bate N, Butler AR, Gandecha AR, Cundliffe E. Multiple regulatory genes in the tylosin biosynthetic cluster of

Streptomyces fradiae. Chem Biol. (1999). 6 (9): 617-624.

- Bate, N., Butler, A.R., Smith, I.P. y Cundliffe, E. The mycarose-biosynthetic genes of Streptomyces fradiae, producer of tylosin. Microbiology (2000). 146 (Pt 1), 139-146.

- Bayley C., Morgan, Dale E. C., Ow D. W. Exchange of gene activity in transgenic plants catalysed by the Cre-lox site specific system. Plant Mol. Biol (1992). 18:353-361.

- Bentley, S.D., Chater, K.F., Cerdeno-Tarraga, A.M., Challis, G.L., Thomson, N.R., James, K.D., Harris, D.E., Quail, M.A., Kieser, H., Harper, D., Bateman, A., Brown, S., Chandra, G., Chen, C.W., Collins, M., Cronin, A., Fraser, A., Goble, A., Hidalgo, J., Hornsby, T., Howarth, S., Huang, C.H., Kieser, T., Larke, L., Murphy, L., Oliver, K., O'Neil, S., Rabbinowitsch, E., Rajandream, M.A., Rutherford, K., Rutter, S., Seeger, K., Saunders, D., Sharp, S., Squares, R., Squares, S., Taylor, K., Warren, T., Wietzorrek, A., Woodward, J., Barrell, B.G., Parkhill, J. y Hopwood,D.A. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature (2002). 417 (6885), 141-147.

- Bibb MJ, Findlay PR, Johnson MW. The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences. Gene. (1984) 30 (1- 3):157-166.

- Bibb MJ, Janssen GR, Ward JM. Cloning and analysis of the promoter région of the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene. (1985). 38 (1-3): 215-26.

ES 2 552 912 T3   - Bibb MJ, White J, Ward JM, Janssen GR. The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site. Mol. Microbiol. (1994). 14 (3): 533-45.

- Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene. 1992;116(1):43-9.

- Blondelet-Rouault M-H., Weiser J., Lebrihi A., Branny P. y Pernodet J-L. Antibiotic resistance gene cassettes derived from the Ω interposon for use in E. coli and Streptomyces. Gene (1997) 190: 315-317.

- Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., y Guérineau M., Structural analysis of loci involved in pSAM2 site-specific intégration in Streptomyces. Plasmid, (1989a). 21: 59-70.

- Boccard F., Smokvina T., J.-L., Pernodet Fridmann A., and Guérineau M.. The integrated conjugative plasmpid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages. EMBOJ. (1989b) 8: 973-980.

- Brunelli J.P., Pall M.L., A series of Yeast/ E. coli lambda expression vectors designed for directional cloning of cDNA and cre/lox mediated plasmid excision. Yeast. (1993) 9: 1309-1318.

- Camilli A., Beattie D. T. y Mekalanos J. J. Use of genetic recombination as a reporter of gene expression. Proc.

Natl. Acad. Sci. USA (1994) 91(7), 2634-2638.

- Campelo, A.B. y Gil, J.A. The candicidin gene cluster from Streptomyces griseus IMRU 3570. Microbiology (2002) 148 (Pt 1), 51-59.

- Carreras C, Frykman S, Ou S, Cadapan L, Zavala S, Woo E, Leaf T, Carney J, Burlingame M, Patel S, Ashley G, Licari P. Saccharopolyspora erythraea-catalyzed bioconversion of 6-deoxyerythronolide B analogs for production of novel erythromycins. J Biotechnol. (2002). 92(3): 217-28.

- Chao K.-M., Pearson W.R., Miller W. Aligning two sequences within a specified diagonal band. Complut. Appl.

Biosci. (1992) 8: 481-487.

- Chater K. F. The improving prospects for yield increase by genetic engineering in antibiotic-producing Streptomycetes. Biotechnology. (1990). 8 (2): 115-121.

- Chaveroche MK, Ghigo JM, d'Enfert C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 2000; 28(22):E97.

- Church GM, Gilbert W. Genomic sequencing. Proc Natl Acad Sci U S A. (1984) 81 (7):1991-5.

- Churchward G, Belin D, Nagamine Y. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. Gene. (1984) 31 (1-3):165-71.

- Comstock, L.E., Coyne, M.J., Tzianabos, A.O. y Kasper, D.L. Interstrain variation of the polysaccharide B biosynthesis locus of Bacteroides fragilis: characterization of the region from strain 638R J. Bacteriol. (1999). 181 (19): 6192-6196.

- Cox KL, Baltz RH. Restriction of bacteriophage plaque formation in Streptomyces spp. J Bacteriol. (1984) 159(2): 499-504.

- Dale E.C., Ow D.W., Gene transfer with subséquent removal of the selection gene from the host genome. Proc. Natl. Acad. Sci. USA (1991). 88: 10558-10562.

- Doumith M, Weingarten P, Wehmeier UF, Salah-Bey K, Benhamou B, Capdevila C, Michel JM, Piepersberg W, Raynal MC. Analysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol Gen Genet. (2000) 264(4): 477-485.

- Draeger, G., Park, Streptomyces-H.H. y Floss, H.G. Mechanism of the 2-deoxygenation step in the biosynthesis of the deoxyhexose moieties of the antibiotics granaticin and oleandomycin J. Am. Chem. Soc. (1999) 121: 2611-2612.

- Gandecha, A.R., Large, S.L. y Cundliffe, E. Analysis of four tylosin biosynthetic genes from the tylLM région of the Streptomyces fradiae genome. Gene. (1997). 184 (2):197-203.

ES 2 552 912 T3   - Geistlich, M., Losick, R., Turner, J.R. y Rao, R.N. Characterization of a novel regulatory gene governing the expression of a polyketide synthase gene in Streptomyces ambofaciens. Mol. Microbiol. (1992). 6 (14): 2019- 2029.

- Gourmelen A, Blondelet-Rouault MH, Pernodet JL. Characterization of a glycosyl transferase inactivating macrolides, encoded by gimA from Streptomyces ambofaciens. Antimicrob Agents Chemother. (1998). 42(10): 2612-9.

- Huang X. y Miller W. A time-efficient, linear-space local similarity algorithin. Adv. Appl. Math. (1991). 12: 337- 357.

- Hara O y Hutchinson CR. Cloning of midecamycin(MLS)-resistance genes from Streptomyces mycarofaciens, Streptomyces lividans and Streptomyces coelicolor A3(2). JAntibiot (Tokyo). (1990). 43 (8):977-991.

- Hara O y Hutchinson CR. A macrolide 3-O-acyltransferase gene from the midecamycin-producing species

Streptomyces mycarofaciens. J Bacteriol. (1992). 174(15):5141-5144.

- Hoffmeister D, Ichinose K, Domann S, Faust B, Trefzer A, Drager G, Kirschning A, Fischer C, Kunzel E, Bearden D, Rohr J y Bechthold A. The NDP-sugar co-substrate concentration and the enzyme expression level influence the substrate specificity of glycosyltransferases: cloning and characterization of deoxysugar biosynthetic genes of the urdamycin biosynthetic gene cluster. Chem Biol. (2000). 7(11):821-831.

- Hopwood, D.A. Future possibilities for the discovery of new antibiotics by genetic engineering. In Beta-lactam antibiotics. Edited by M.R.J. Salton and G.D. Shockman. New York: Academic Press. (1981). 585-598.

- Hopwood D. A., Malpartida F., Kieser H. M., Ikeda H., Duncan J., Fujii I., Rudd A. M., Floss H. G. y Omura S.

Production of 'hybrid' antibiotics by genetic engineering. Nature. (1985a). 314 (6012): 642-644.

- Hopwood D. A., Malpartida F., Kieser H. M., Ikeda H. y Omura S. (1985b) In Microbiology (ed. S. Silver). American Society for Microbiology, Washington D. C., 409-413.

- Houben Weyl, 1974, en Meuthode der Organischen Chemie, E. Wunsch Ed., Volumen 15-I y 15-II, - Hutchinson, C.R. Prospects for the discovery of new (hybrid) antibiotics by genetic engineering of antibiotic- producing bacteria. Med Res Rev. (1988). 8 (4): 557-567.

- Hutchinson C. R., Borell C. W., Otten S. L., Stutzman-Engwall K. J. y Wang Y. Drug discovery and development through the genetic engineering of antibiotic-producing microorganisms J. Med. Chem. (1989) 32 (5): 929-937.

- Ishikawa J, Hotta K. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content. FEMS Microbiol Lett. (1999) 174(2):251-3.

- Kieser, T, Bibb, MJ, Buttner MJ, Chater KF, Hopwood DA. Practical Streptomyces Genetics. 2000. The John Innes Foundation, Norwich UK.

- Kuhstoss et al. Production of a novel polyketide through the construction of a hybrid polyketide synthase. Gene. (1996). 183(1-2): 231-236.

- Lacalle RA, Pulido D, Vara J, Zalacain M, Jimenez A. Molecular analysis of the pac gene encoding a puromycin N-acetyl transferase from Streptomyces alboniger. Gene. (1989). 79(2):375-380.

- Lakso M, Sauer B, Mosinger B Jr, Lee EJ, Manning RW, Yu SH, Mulder KL, Westphal H. Targeted oncogene activation by site-specific recombination in transgenic mice. Proc Natl Acad Sci U S A. (1992) 89 (14):6232-6.

- Li, T.B., Shang, G.D., Xia, H.Z. y Wang, Y.G. Cloning of the sugar related biosynthesis gene cluster from Streptomyces tenebrarius H6. Sheng Wu Gong ChengXue Bao (2001). 17 (3): 329-331.

- Ligon, J., Hill, S., Beck, J., Zirkle, R., Molnar, I., Zawodny, J., Money, S. y Schupp, T. Characterization of the biosynthetic gene cluster for the antifungal polyketide soraphen A from Sorangium cellulosum So ce26. Gene (2002). 285 (1-2), 257-267.

ES 2 552 912 T3   - Liu L, Saevels J, Louis P, Nelis H, Rico S, Dierick K, Guyomard S, Roets E, Hoogmartens J. Interlaboratory study comparing the microbiological potency of spiramycins I, II and III. J Pharm Biomed Anal. (1999). 20 (1- 2):217-24.

- Mazodier P, Petter R, Thompson C. Intergeneric conjugation between Escherichia coli and Streptomyces species. J Bacteriol. (1989). 171 (6):3583-5.

- Merrifield RB, 1965a, Nature, 207(996): 522-523.

- Merrifield RB., 1965b, Science, 150(693): 178-185.

- Merson-Davies,L.A. y Cundliffe,E. Analysis of five tylosin biosynthetic genes from the tyllBA région of the

Streptomyces fradiae genome, Molecular microbiology. (1994). 13 (2): 349-355.

- Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence déterminants in Vibrio cholerae requires toxR. J Bacteriol. (1988) 170(6):2575-83.

- Nakano, Y., Yoshida, Y., Yamashita, Y. & Koga, T. Construction of a series of pACYC-derived plasmid vectors. Gene (1995). 162: 157-8.

- Nielsen H., Engelbrecht J., Brunak S. y von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prédiction of their cleavage sites. Protein Engineering. (1997). 10: 1-6.

- Oh SH, Chater KF. Denaturation of circular or linear DNA facilitates targeted integrative transformation of Streptomyces coelicolor A3(2): possible relevance to other organisms. J Bacteriol. 1997; 179 (1):122-7.

- Olano C, Lomovskaya N, Fonstein L, Roll JT, Hutchinson CR. A two-plasmid system for the. glycosylation of polyketide antibiotics: bioconversion of epsilon-rhodomycinone to rhodomycin D. Chem Biol. (1999). 6 (12):845- 55.

- Omura S, Kitao C, Hamada H, Ikeda H. Bioconversion and biosynthesis of 16-membered macrolide antibiotics. X. Final steps in the biosynthesis of spiramycin, using enzyme inhibitor: cerulenin. Chem Pharm Bull (Tokyo). (1979a). 27(1): 176-82.

- Omura S, Ikeda H, Kitao C. Isolation and properties of spiramycin I 3-hydroxyl acylase from Streptomyces and ambofaciens. J Biochem (Tokyo). (1979b). 86(6): 1753-8.

- Omura, S., Ikeda, H., Ishikawa, J., Hanamoto, A., Takahashi, C., Shinose, M., Takahashi, Y., Horikawa, H., Nakazawa, H., Osonoe, T., Kikuchi, H., Shiba, T., Sakaki, Y. y Hattori, M. Genome sequence of an industrial microorganism Streptomyces avermitilis: Deducing the ability of producing secondary metabolites. Proc. Natl.

Acad. Sci. U.S.A. (2001). 98 (21), 12215-12220.

- Pearson W.R. y D. J. Lipman. Improved Tools for Biological Sequence Analysis. Proc. Natl. Acad. Sci. USA 1988, 85: 2444-2448.

- Pearson W. R. Rapid and Sensitive Sequence Comparison with FASTP and FASTA. Methods in Enzymology.

1990, 183: 63-98.

- Pernodet JL, Simonet JM, Guerineau M. Plasmids in différent strains of Streptomyces ambofaciens: free and integrated form of plasmid pSAM2. Mol Gen Genet. (1984);198 (1):35-41.

- Pernodet JL, Alegre MT, Blondelet-Rouault MH, Guerineau M. Resistance to spiramycin in Streptomyces ambofaciens, the producer organism, involves at least two different mechanisms. J Gen Microbiol. (1993) ; 139 (Pt 5):1003-11.

- Pernodet JL, Fish S, Blondelet-Rouault MH, Cundliffe E. The macrolide-lincosamide-streptogramin B resistance phenotypes characterized by using a specifically deleted, antibiotic-sensitive strain of Streptomyces lividans. Antimicrob Agents Chemother. (1996), 40 (3): 581-5.

- Pernodet JL, Gourmelen A, Blondelet-Rouault MH, Cundliffe E. Dispensable ribosomal resistance to spiramycin conferred by srmA in the spiramycin producer Streptomyces ambofaciens. Microbiology. (1999), 145 (Pt 9):2355-64.

ES 2 552 912 T3   - Pfoestl, A., Hofinger, A., Kosma, P. y Messner, P. Biosynthesis of dTDP-3-acetamido-3,6-dideoxy-alpha-D- galactose in Aneurinibacillus thermoaerophilus L420-91T. J. Biol. Chem. (2003), 278 (29): 26410-26417.

- Rao RN, Richardson MA, Kuhstoss S. Cosmid shuttle vectors for cloning and analysis of Streptomyces DNA.

Methods Enzymol. (1987); 153: 166-98.

- Raynal A, Tuphile K, Gerbaud C, Luther T, Guerineau M, y Pernodet JL. Structure of the chromosomal insertion site for pSAM2: functional analysis in Escherichia coli. Molecular Microbiology (1998) 28 (2) 333-342.

- Redenbach, M., Kieser, H.M., Denapaite, D., Eichner, A., Cullum, J., Kinashi, H. y Hopwood, D.A. A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3(2) chromosome Mol. Microbiol. (1996). 21 (1): 77-96. patrick - Richardson MA, Kuhstoss S, Solenberg P, Schaus NA, Rao RN. A new shuttle cosmid vector, pKC505, for streptomycetes: its use in the cloning of three différent spiramycin-resistance genes from a Streptomyces ambofaciens library. Gene. (1987); 61 (3):231-41.

- Robinson, J.A. Enzymes of Secondary Metabolism in Microorganisms. Chem Soc Rev. (1988). 17:383-452.

- Russell SH, Hoopes JL, Odell JT. Directed excision of a transgene from the plant genome. Mol Gen Genet.

(1992). 234 (1): 49-59.

- Sambrook J, Frisch EF, Maniatis T . Molecular Cloning: a laboratory manual 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York USA (1989).

- Schoner B, Geistlich M, Rosteck P Jr, Rao RN, Seno E, Reynolds P, Cox K, Burgett S et Hershberger C. Sequence similarity between macrolide-resistance déterminants and ATP-binding transport proteins. Gene.

(1992). 115 (1-2), 93-96.

- Sezonov G, Hagege J, Pernodet JL, Friedmann A and Guerineau M. Characterization of pra, a gene for replication control in pSAM2, the integrating element of Streptomyces ambofaciens. Mol Microbiol. (1995). 17(3): 533-44.

- Sezonov G., Blanc V., Bamas-Jacques N., Friedmann A., Pernodet J.L. and M. Guerineau, Complete conversion of antibiotic precursor to pristinamycin IIA by over expression of Streptomyces pristinaespiralis biosynthetic genes, Sature Biotechnology. (1997) 15: 349-353.

- Sezonov G, Possoz C, Friedmann A, Pernodet JL, Guerineau M. KorSA from the Streptomyces integrative element pSAM2 is a central transcriptional repressor: target genes and binding sites. JBacteriol. (2000). 182(5):1243-50.

- Sinon R., Priefer U and Pühler. A broad host range mobilisation system for in vivo genetic engineering transposon mutagenesis in gram négative bacteria. Bio/Technology (1983).1: 784-791.

- Simon, et al., Plasmid vectors for the genetic analysis and manipulation of rhizobia and other gram-negative bacteria, p. 640-659. In A. Weissbach, and H. Weissbach (eds.), Methods in enzymology, vol 118, Academic Press, Inc., Orlando, 1986 - Summers,R.G., Donadio,Streptomyces, Staver,M.J., Wendt-Pienkowski,E., Hutchinson,C.R. et Katz,L. Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamine production. Microbiology (1997). 143 (Pt 10): 3251-3262.

- Van Mellaert L, Mei L, Lammertyn E, Schacht S, Anne J. Site-specific intégration of bacteriophage VWB genome into Streptomyces venezuelae and construction of a VWB-based integrative vector. Microbiology. (1998). 144 (Pt 12): 3351-8.

- Vara J, Lewandowska-Skarbek M, Wang YG, Donadio S, Hutchinson CR.Cloning of genes governing the deoxysugar portion of the erythromycin biosynthesis pathway in Saccharopolyspora erythraea (Streptomyces erythreus). J Bacteriol. (1989). 171(11): 5872-81.

ES 2 552 912 T3   - Vara J, Malpartida F, Hopwood DA, Jimenez A. Cloning and expression of a puromycin N-acetyl transferase gene from Streptomyces alboniger in Streptomyces lividans and Escherichia coli. Gene. (1985). 33(2): 197-206.

- Wahl, G. M., K. A. Lewis, J. C. Ruiz, B. Rothenberg, J. Zhao, and G. A. Evans. Cosmid vectors for rapid genomic walking, restriction mapping, and gene transfer. Ploc. Natl. Acad. Sci. USA (1987). 84: 2160-2164.

- Waldron,C., Matsushima,P., Rosteck,P.R., Broughton,M.C., Turner,J., Madduri,K., Crawford,K.P., Merlo,D.J. et Baltz,R.H. Cloning and analysis of the spinosad biosynthetic gene cluster of Saccharopolyspora spinosa(1) Chem. Biol. (2001) 8 (5): 487-499.

- Walczak RJ, Hines JV, Strohl WR, Priestley ND.Bioconversion of the anthracycline analogue desacetyladriamycin by recombinant DoxA, a P450-monooxygenase from Streptomyces sp. strain C5. Org Lett.

(2001). 3 (15):2277-9.

- Wang,Z.X., Li,S.M. et Heide,L. Identification of the coumermycin A(1) biosynthetic gene cluster of Streptomyces rishiriensis DSM 40489. Antimicrob. Agents Chemother. (2000) 44 (11), 3040-3048.

- Ward, J.M., Janssen, G.R., Kieser, T, Bibb, M.J., Buttner, M.J. & Bibb, M.J. Construction and characterization of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase from Tn5 as indicator. Mol Gen Genet (1986). 203: 468-478.

- Wehmeier UF. New multifunctional Escherichia coli-Streptomyces shuttle vectors allowing blue-white screening on XGal plates. Gene. (1995). 165(1): 149-150.

- Wilms B, Hauck A, Reuss M, Syldatk C, Mattes R, Siemann M, Altenbuchner J. High-cell-density fermentation for production of L-N-carbamoylase using an expression system based on the Escherichia coli rhaBAD promoter. Biotechnol Bioeng. (2001). 73(2):95-103.

- Worley K. C., Wiese B. A., and Smith R. F. BEAUTY: An enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results. Genome Research (1995). 5: 173-184.

- Wu K, Chung L, Revill WP, Katz L et Reeves CD. The FK520 gene cluster of Streptomyces hygroscopicus var.

ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene. (2000). 251 (1): 81-90.

- Xue Y, Zhao L, Liu HW et Sherman DH. A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity. Proc Natl Acad Sci U S A. (1998). 95 (21): 12111-12116.

- Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG et Court DL. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. (2000). 97(11): 5978-83 LISTADO DE SECUENCIAS <110> Aventis Pharma SA CNRS <120> POLIPÉPTIDOS IMPLICADOS EN LA BIOSÍNTESIS DE LAS ESPIRAMICINAS, SECUENCIAS NUCLEOTÍDICAS QUE CODIFICAN ESTOS POLIPÉPTIDOS Y SUS APLICACIONES <130> FRAV2002/0028 <150> FR 0212489 <151> 2002-10-08 <150> FR 0302439 <151> 2003-02-27 <150> US 60/493,490 <151> 2003-08-07

ES 2 552 912 T3   <160> 161 <170> PatentIn version 3.2 <210> 1 <211> 30943 <212> ADN <213> Streptomyces ambofaciens

<400> 1

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 2 <211> 11171 <212> ADN <213> Streptomyces ambofaciens

<400> 2

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 3 <211> 711 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(711) <400> 3

ES 2 552 912 T3   <210> 4 <211> 236 <212> PRT <213> Streptomyces ambofaciens

<400> 4

ES 2 552 912 T3   <210> 5 <211> 1272 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1272) <400> 5

ES 2 552 912 T3  

ES 2 552 912 T3   <212> PRT <213> Streptomyces ambofaciens

<400> 6

ES 2 552 912 T3   <210> 7 <211> 1266 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1266) <400> 7

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 8 <211> 421 <212> PRT <213> Streptomyces ambofaciens

<400> 8

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 9 <211> 1350 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1350) <400> 9

ES 2 552 912 T3   <210> 10

ES 2 552 912 T3   <211> 449 <212> PRT <213> Streptomyces ambofaciens

<400> 10

ES 2 552 912 T3   <210> 11 <211> 675 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(675)

ES 2 552 912 T3   <400> 11 <210> 12 <211> 224 <212> PRT <213> Streptomyces ambofaciens

<400> 12

ES 2 552 912 T3   <210> 13 <211> 1245 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1245) <400> 13

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 14 <211> 414 <212> PRT <213> Streptomyces ambofaciens

<400> 14

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 15 <211> 849 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(849) <400> 15

ES 2 552 912 T3   <210> 16

ES 2 552 912 T3   <211> 282 <212> PRT <213> Streptomyces ambofaciens

<400> 16

ES 2 552 912 T3   <210> 17 <211> 831 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(831) <400> 17

ES 2 552 912 T3   <210> 18

ES 2 552 912 T3   <211> 276 <212> PRT <213> Streptomyces ambofaciens

<400> 18

ES 2 552 912 T3   <210> 19 <211> 882 <212> ADN <213> Streptomyces ambofaciens

<220>

ES 2 552 912 T3   <221> CDS <222> (1)..(882) <400> 19

ES 2 552 912 T3   <210> 20 <211> 293 <212> PRT <213> Streptomyces ambofaciens

<400> 20

ES 2 552 912 T3   <210> 21 <211> 228 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(228) <400> 21 <210> 22 <211> 75

ES 2 552 912 T3   <212> PRT <213> Streptomyces ambofaciens

<400> 22 <210> 23 <211> 1212 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1212) <400> 23

ES 2 552 912 T3  

ES 2 552 912 T3   <212> PRT <213> Streptomyces ambofaciens

<400> 24

ES 2 552 912 T3   <210> 25 <211> 540 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(540) <220> <221> CDS2 <222> (190)..(540) <400> 25

ES 2 552 912 T3   <210> 26 <211> 179 <212> PRT <213> Streptomyces ambofaciens

<400> 26

ES 2 552 912 T3   <210> 27 <211> 116 <212> PRT <213> Streptomyces ambofaciens

<400> 27

ES 2 552 912 T3   <210> 28 <211> 1167 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1167) <400> 28

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 29 <211> 388 <212> PRT <213> Streptomyces ambofaciens

<400> 29

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 30 <211> 909 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(909) <220> <221> CDS2 <222> (10)..(909) <220> <221> CDS3 <222> (28)..(909) <400> 30

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 31 <211> 302 <212> PRT <213> Streptomyces ambofaciens

<400> 31

ES 2 552 912 T3   <210> 32 <211> 299 <212> PRT <213> Streptomyces ambofaciens

<400> 32

ES 2 552 912 T3   <210> 33 <211> 293

ES 2 552 912 T3   <212> PRT <213> Streptomyces ambofaciens

<400> 33

ES 2 552 912 T3   <210> 34 <211> 1038 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1038) <400> 34

ES 2 552 912 T3   <210> 35 <211> 345 <212> PRT <213> Streptomyces ambofaciens

<400> 35

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 36 <211> 804 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(804) <220> <221> CDS2 <222> (7)..(804) <220> <221> CDS3 <222> (22)..(804) <400> 36

ES 2 552 912 T3   <210> 37 <211> 267

ES 2 552 912 T3   <212> PRT <213> Streptomyces ambofaciens

<400> 37

ES 2 552 912 T3   <210> 38 <211> 265 <212> PRT <213> Streptomyces ambofaciens

<400> 38

ES 2 552 912 T3   <210> 39 <211> 260 <212> PRT <213> Streptomyces ambofaciens

<400> 39

ES 2 552 912 T3   <210> 40 <211> 1410 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1410) <220> <221> CDS2 <222> (46)..(1410)

ES 2 552 912 T3   <400> 40

ES 2 552 912 T3   <210> 41 <211> 469 <212> PRT <213> Streptomyces ambofaciens

<400> 41

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 42 <211> 454 <212> PRT <213> Streptomyces ambofaciens

<400> 42

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 43 <211> 1248 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1248) <400> 43

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 44 <211> 415 <212> PRT <213> Streptomyces ambofaciens

<400> 44

ES 2 552 912 T3   <210> 45 <211> 720 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(720) <400> 45

ES 2 552 912 T3   <210> 46 <211> 239 <212> PRT <213> Streptomyces ambofaciens

<400> 46

ES 2 552 912 T3   <210> 47 <211> 1968 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1968) <400> 47

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 48 <211> 655 <212> PRT <213> Streptomyces ambofaciens

<400> 48

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 49 <211> 1749 <212> ADN <213> Streptomyces ambofaciens

<220>

ES 2 552 912 T3   <221> CDS <222> (1)..(1749) <220> <221> CDS2 <222> (76)..(1749) <220> <221> CDS3 <222> (97)..(1749) <400> 49

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 50 <211> 582 <212> PRT <213> Streptomyces ambofaciens

<400> 50

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 51 <211> 557 <212> PRT <213> Streptomyces ambofaciens

<400> 51

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 52 <211> 550 <212> PRT <213> Streptomyces ambofaciens

<400> 52

ES 2 552 912 T3  

ES 2 552 912 T3   <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1431) <220> <221> CDS2 <222> (16)..(1431) <220> <221> CDS3 <222> (37)..(1431) <220> <221> CDS4 <222> (40)..(1431) <220> <221> CDS5 <222> (79)..(1431) <220> <221> CDS6 <222> (130)..(1431) <400> 53

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 54 <211> 476 <212> PRT <213> Streptomyces ambofaciens

<400> 54

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 56 <211> 464 <212> PRT <213> Streptomyces ambofaciens

ES 2 552 912 T3   <400> 56

ES 2 552 912 T3   <210> 57 <211> 463 <212> PRT <213> Streptomyces ambofaciens

<400> 57

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 58 <211> 450 <212> PRT <213> Streptomyces ambofaciens

<400> 58

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 59 <211> 433 <212> PRT <213> Streptomyces ambofaciens

<400> 59

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 60 <211> 1398 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1398) <400> 60

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 61 <211> 465 <212> PRT <213> Streptomyces ambofaciens

<400> 61

ES 2 552 912 T3   <210> 62 <211> 1044 <212> ADN <213> Streptomyces ambofaciens

<220>

ES 2 552 912 T3   <221> CDS <222> (1)..(1044) <400> 62

ES 2 552 912 T3   <210> 63 <211> 347 <212> PRT <213> Streptomyces ambofaciens

<400> 63

ES 2 552 912 T3   <210> 64 <211> 1041 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1041) <400> 64

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 65 <211> 346 <212> PRT <213> Streptomyces ambofaciens

<400> 65

ES 2 552 912 T3   <210> 66 <211> 1239 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1239) <400> 66

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 67 <211> 412 <212> PRT <213> Streptomyces ambofaciens

<400> 67

ES 2 552 912 T3   <210> 68 <211> 1272

ES 2 552 912 T3   <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1272) <400> 68

ES 2 552 912 T3   <210> 69 <211> 423 <212> PRT <213> Streptomyces ambofaciens

<400> 69

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 70 <211> 1179 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1179) <400> 70

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 71 <211> 392 <212> PRT <213> Streptomyces ambofaciens

<400> 71

ES 2 552 912 T3   <210> 72 <211> 993 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(993) <400> 72

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 73 <211> 330 <212> PRT <213> Streptomyces ambofaciens

<400> 73

ES 2 552 912 T3   <210> 74 <211> 1008 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1008) <400> 74

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 75 <211> 335 <212> PRT <213> Streptomyces ambofaciens

<400> 75

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 76 <211> 1233 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1233) <400> 76

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 77 <211> 410 <212> PRT <213> Streptomyces ambofaciens

<400> 77

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 78 <211> 1116 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1116) <400> 78

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 79 <211> 371 <212> PRT <213> Streptomyces ambofaciens

<400> 79

ES 2 552 912 T3   <210> 80 <211> 1122 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1122) <400> 80

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 81 <211> 373 <212> PRT <213> Streptomyces ambofaciens

<400> 81

ES 2 552 912 T3   <210> 82 <211> 312 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(312) <400> 82

ES 2 552 912 T3   <210> 83 <211> 103 <212> PRT <213> Streptomyces ambofaciens

<400> 83 <210> 84 <211> 867

ES 2 552 912 T3   <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(867) <400> 84

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 85 <211> 288 <212> PRT <213> Streptomyces ambofaciens

<400> 85

ES 2 552 912 T3   <210> 86 <211> 1040 <212> ADN <213> Streptomyces fradiae

<400> 86 <210> 87 <211> 388 <212> PRT

ES 2 552 912 T3   <213> Streptomyces fradiae

<400> 87

ES 2 552 912 T3   <210> 88 <211> 271 <212> PRT <213> Streptomyces mycarofaciens

<400> 88

ES 2 552 912 T3   <210> 89 <211> 25 <212> ADN <213> Artificial <220> <223> Oligonucleótido SRMR1 <400> 89 ctgccagtcc tctcccagca gtacg <210> 90 <211> 25 <212> ADN <213> Artificial <220> <223> Oligonucleótido SRMR2 <400> 90

ES 2 552 912 T3   tgaagctgga cgtctcctac gtcgg <210> 91 <211> 2755 <212> ADN <213> Artificial <220> <223> Casete escisable <400> 91

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 92 <211> 2208 <212> ADN <213> Artificial <220> <223> Casete escisable <400> 92

ES 2 552 912 T3   <210> 93 <211> 60 <212> ADN <213> Artificial <220> <223> oligonucleótido ORF2A <400> 93 cccgcgcggc agcctctccg tgatcgagtc cggcgtgacc atcgcgcgcg cttcgttcgg <210> 94 <211> 60 <212> ADN <213> Artificial

ES 2 552 912 T3   <220> <223> Oligonucleótido ORF2B <400> 94 gctccgtgcg tcatgcagga aggtgtcgta gtcgcggtag atctgcctct tcgtcccgaa <210> 95 <211> 35 <212> ADN <213> Artificial <220> <223> Cicatriz att3 <400> 95 atcgcgcgcg cttcgttcgg gacgaagagg tagat <210> 96 <211> 59 <212> ADN <213> Artificial <220> <223> Oligonucleótido EDR8 <400> 96 cgggatgatc gcttgtccgg cggccggatg cctagcctca tcgcgcgcgc ttcgttcgg 59 <210> 97 <211> 60 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR9 <400> 97 cccgatccag aacgtctggt cggtgatcag gtcgctgttc atctgcctct tcgtcccgaa <210> 98 <211> 60 <212> ADN

ES 2 552 912 T3   <213> Artificial <220> <223> oligonucleótido EDR3 <400> 98 accggggcgg tcctcccctc cggggcgtca cggccgcgga atctgcctct tcgtcccgaa 60 <210> 99 <211> 60 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR4 <400> 99 cacgcagcga gccgacgcac tgatggacga cacgatggcc atcgcgcgcg cttcgttcgg 60 <210> 100 <211> 60 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR5 <400> 100 gggcgtgaag cgggcgagtg tggatgtcat gcgagtactc atcgcgcgcg cttcgttcgg <210> 101 <211> 60 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR6 <400> 101 cgggaaacgg cgtcgcactc ctcgggggcc gcgtcagccc atctgcctct tcgtcccgaa 60 <210> 102 <211> 26

ES 2 552 912 T3   <212> ADN <213> Artificial <220> <223> oligonucleótido C9583 <400> 102 ctgcaggtgc tccagcgcgt cgatct 26 <210> 103 <211> 26 <212> ADN <213> Artificial <220> <223> oligonucleótido C9584 <400> 103 ctgcagacgg aggcggacct gcggct 26 <210> 104 <211> 33 <212> ADN <213> Artificial <220> <223> Cicatriz att1 <400> 104 atcgcgcgct tcgttcggga cgaagaggta gat 33 <210> 105 <211> 34 <212> ADN <213> Artificial <220> <223> cicatriz att2 <400> 105 atcggcgcgc ttcgttcggg acgaagaggt agat 34 <210> 106

ES 2 552 912 T3   <211> 10325 <212> ADN <213> Streptomyces ambofaciens

<220> <221> características diversas <222> (3620)..(4069) <223> n es a, c, g, o t <400> 106

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 107 <211> 1218 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1218) <400> 107

ES 2 552 912 T3   <210> 108 <211> 405 <212> PRT <213> Streptomyces ambofaciens

<400> 108

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 109 <211> 621 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(621) <400> 109

ES 2 552 912 T3   <210> 110 <211> 206 <212> PRT <213> Streptomyces ambofaciens

<400> 110

ES 2 552 912 T3   <210> 111 <211> 960 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(903) <220> <221> características diversas <222> (905)..(960) <223> n es a, c, g, o t <400> 111

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 112 <211> 301 <212> PRT <213> Streptomyces ambofaciens

<400> 112

ES 2 552 912 T3   <210> 113 <211> 1008 <212> ADN

ES 2 552 912 T3   <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1008) <400> 113

ES 2 552 912 T3   <210> 114 <211> 335 <212> PRT <213> Streptomyces ambofaciens

<400> 114

ES 2 552 912 T3   <210> 115 <211> 1038 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1038) <220> <221> CDS2 <222> (190)..(1038)

ES 2 552 912 T3   <400> 115

ES 2 552 912 T3   <210> 116 <211> 345 <212> PRT <213> Streptomyces ambofaciens

<400> 116

ES 2 552 912 T3   <210> 117 <211> 282 <212> PRT <213> Streptomyces ambofaciens

<400> 117

ES 2 552 912 T3   <210> 118 <211> 975 <212> ADN <213> Stretomyces ambofaciens

<220> <221> CDS <222> (1)..(975)

ES 2 552 912 T3   <400> 118

ES 2 552 912 T3   <210> 119 <211> 324 <212> PRT <213> Streptomyces ambofaciens

<400> 119

ES 2 552 912 T3   <210> 120 <211> 1227 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1227) <400> 120

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 121 <211> 408 <212> PRT <213> Streptomyces ambofaciens

<400> 121

ES 2 552 912 T3   <210> 122 <211> 46 <212> ADN <213> Artificial <220>

ES 2 552 912 T3   <223> oligonucleótido EDR39 <400> 122 cccaagcttg agaagggagc ggacattcat ggcccgcgcc gaacgc 46 <210> 123 <211> 46 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR42 <400> 123 cgggatccgg ctgaccatgg gagacgggcg catcgccgag ttcagc 46 <210> 124 <211> 46 <212> ADN <213> Artificial <220> <223> Oligonucleótido EDR40 <400> 124 cccaagcttg agaagggagc ggacattcaa tgctttggta aagcac 46 <210> 125 <211> 38 <212> ADN <213> Artificial <220> <223> Oligonucleótido EDR41 <400> 125 cccaagcttt caaggaacga cggggtggtc agtcaagt 38 <210> 126 <211> 32 <212> ADN <213> Artificial

ES 2 552 912 T3   <220> <223> oligonucleótido A <400> 126 ccagtagata tcccgccaac ccggagctgc ac 32 <210> 127 <211> 32 <212> ADN <213> Artificial <220> <223> oligonucleótido B <400> 127 gaaaagatcc gtcatggggt cgtgcgctcc tt 32 <210> 128 <211> 32 <212> ADN <213> Artificial <220> <223> oligonucleótido C <400> 128 cacgàcccca tgacggatct tttccgctgc at 32 <210> 129 <211> 32 <212> ADN <213> Artificial <220> <223> Oligonucleótido D <400> 129 gagccggata tcatcggtct tgccttgctc gt 32 <210> 130 <211> 25 <212> ADN

ES 2 552 912 T3   <213> Artificial <220> <223> Oligonucleótido ORF23c <400> 130 acgtgcgcgg tgagttcgcc gttgc <210> 131 <211> 25 <212> ADN <213> Artificial <220> <223> Oligonucleótido ORF25c <400> 131 ctgaacgacg ccatcgcggt ggtgc <210> 132 <211> 25 <212> ADN <213> Artificial <220> <223> Oligonucleótido ORF1*c <400> 132 gaccacctcg aaccgtccgg cgtca <210> 133 <211> 23 <212> ADN <213> Artificial <220> <223> Oligonucleótido ORF2*c <400> 133 ggcccggtcc agcgtgccga agc 23 <210> 134 <211> 6174

ES 2 552 912 T3   <212> ADN <213> Streptomyces ambofaciens

<220> <221> características diversas <222> (3620)..(4069) <223> n es a, c, g, o t <400> 134

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 135 <211> 4770 <212> ADN <213> Streptomyces ambofaciens

<400> 135

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 136 <211> 28 <212> ADN <213> Artificial <220> <223> oligonucleótido EDR31 <400> 136 cccaagcttc tgcgcccgcg ggcgtgaa 28 <210> 137 <211> 28

ES 2 552 912 T3   <212> ADN <213> Artificial <220> <223> oligonucleótido EDR37 <400> 137 gctctagaac cgtgtagccg cgccccgg 28 <210> 138 <211> 30 <212> ADN <213> Artificial <220> <223> Oligonucleótido KF30 <400> 138 aagcttgtgt gcccggtgta cctggggagc 30 <210> 139 <211> 30 <212> ADN <213> Artificial <220> <223> Oligonucleótido KF31 <400> 139 ggatcccgcg acggacacga ccgccgcgca <210> 140 <211> 12134 <212> ADN <213> Streptomyces ambofaciens

<400> 140

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 141 <211> 1164 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1164) <400> 141

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 142 <211> 387 <212> PRT <213> Streptomyces ambofaciens

<400> 142

ES 2 552 912 T3   <210> 143 <211> 849 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(849) <400> 143

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 144 <211> 282 <212> PRT <213> Streptomyces ambofaciens

<400> 144

ES 2 552 912 T3   <210> 145 <211> 1512 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1512) <400> 145

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 146 <211> 503 <212> PRT <213> Streptomyces ambofaciens

<400> 146

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 147 <211> 276 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(276) <400> 147 <210> 148 <211> 91 <212> PRT <213> Streptomyces ambofaciens

<400> 148

ES 2 552 912 T3   <210> 149 <211> 1236 <212> ADN <213> Streptomyces ambofaciens

<220> <221> CDS <222> (1)..(1236) <400> 149

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 150 <211> 411 <212> PRT <213> Streptomyces ambofaciens

<400> 150

ES 2 552 912 T3  

ES 2 552 912 T3   <210> 151 <211> 22 <212> ADN <213> Artificial <220> <223> Oligonucléot-ide KF36 <400> 151 ttgccgtagc cgaggaccag cg 22 <210> 152 <211> 22 <212> ADN <213> Artificial <220> <223> Oligonucleótido KF37 <400> 152 cacatggccc tggaggaccc tg 22 <210> 153

ES 2 552 912 T3   <211> 30 <212> ADN <213> Artificial <220> <223> oligonucleótido KF42 <400> 153 aagcttgtac ggcccacaga atgatgtcac 30 <210> 154 <211> 30 <212> ADN <213> Artificial <220> <223> Oligonucleótido KF43 <400> 154 aagcttcgac taccttggtg atctcgcctt <210> 155 <211> 65 <212> ADN <213> Artificial <220> <223> oligonucleótido KF32 <400> 155 caaccgcttg agctgctcca tcaactgctg ggccgaggta tcgcgcgcgc ttcgttcggg acgaa 65 <210> 156 <211> 65 <212> ADN <213> Artificial <220> <223> Oligonucleótido KF33 <400> 156

ES 2 552 912 T3   tgggtcccgc cgcgcggcac gacttcgact cgctcgtcta tctgcctctt cgtcccgaag caact <210> 157 <211> 65 <212> ADN <213> Artificial <220> <223> Oligonucleótido EDR71 <400> 157 cgtcatcgac gtgcggggaa gacagaggtg ataccgatga tcgcgcgcgc ttcgttcggg 60 acgaa 65 <210> 158 <211> 65 <212> ADN <213> Artificial <220> <223> Oligonucleótido EDR72 <400> 158 gccagcacct cgtccagctg ctcgacggaa ctcaccccca tctgcctctt cgtcccgaag caact <210> 159 <211> 66 <212> ADN <213> Artificial <220> <223> oligonucleótido KF52 <400> 159 gatccgccag cctcacgtca cgccgcgccg cctccctgac atcgcgcgcg cttcgttcgg gacgaa 66 <210> 160 <211> 66

ES 2 552 912 T3   <212> ADN <213> Artificial <220> <223> Oligonucleótido KF53 <400> 160 gaggcggacg tcggtacgcg gtgggagccg gagttcgaca atctgcctct tcgtcccgaa 60 gcaact 66 <210> 161 <211> 2540 <212> ADN <213> Streptomyces ambofaciens.

<400> 161

ES 2 552 912 T3  

ES 2 552 912 T3  

REIVINDICACIONES

1. Polinucleótido que codifica un polipéptido implicado en la biosíntesis de las espiramicinas, caracterizado por que la sobreexpresión de dicho polinucleótido permite un aumento de la producción de las espiramicinas y por que la secuencia de dicho polinucleótido es: (a) una de las secuencias SEC ID n° 111 o 141, (b) un polinucleótido que presenta al menos el 80%, 85%, 90%, 95% o el 98% de identidad en nucleótidos con el polinucleótido según (a).

2. Polinucleótido según la reivindicación 1, caracterizado por que está aislado a partir de una bacteria del género Streptomyces.

3. Polipéptido implicado en la biosíntesis de las espiramicinas, caracterizado por que su sobreexpresión permite un aumento de la producción de las espiramicinas, y por que la secuencia de dicho polipéptido comprende: (a) una de las secuencias SEC ID n° 112 o 142, (b) un polipéptido que presenta al menos el 80%, 85%, 90%, 95% o el 98% de identidad en aminoácidos con el polipéptido según (a).

4. Polipéptido según la reivindicación 3, caracterizado por que su secuencia comprende una de las secuencias SEC ID n° 112 o 142.

5. Polipéptido según la reivindicación 3, caracterizado por que está aislado a partir de una bacteria del género Streptomyces.

6. Vector de expresión, caracterizado por que comprende al menos una secuencia de ácido nucleico que codifica un polipéptido según la reivindicación 3, 4 o 5.

7. Célula huésped que comprende un vector de expresión apropiado que permite la expresión de uno o varios polipéptidos según la reivindicación 3, 4 o 5.

8. Célula huésped según la reivindicación 7, caracterizada por que se selecciona de entre las células huésped procariotas o las células huésped eucariotas.

9. Célula huésped según la reivindicación 8, caracterizada por que se selecciona de entre la bacteria E. coli, las células de insectos, las células de levaduras, las células de mamíferos.

10. Célula huésped según la reivindicación 7, en la que se ha introducido al menos un polinucleótido tal como se ha definido en la reivindicación 1 o 2, y/o al menos un vector de expresión según la reivindicación 6.

11. Procedimiento de producción de un polipéptido según una de las reivindicaciones 3 a 5, caracterizado por que dicho procedimiento comprende las etapas siguientes a) insertar al menos un ácido nucleico que codifica dicho polipéptido en un vector apropiado; b) cultivar, en un medio de cultivo apropiado, una célula huésped previamente transformada o transfectada con el vector de la étapa a); c) recuperar el medio de cultivo condicionado o un extracto celular; d) separar y purificar a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa c), dicho polipéptido; e) llegado el caso, caracterizar el polipéptido recombinante producido.

12. Utilización de un polinucleótido según una de las reivindicaciones 1 y 2 para mejorar la producción en espiramicina de un microorganismo.

13. Microorganismo mutante productor de espiramicina, caracterizado por que sobreexpresa al menos una secuencia codificante que comprende una secuencia según una de las reivindicaciones 1 y 2, o una secuencia codificante que codifica un polipéptido según una de las reivindicaciones 3, 4 y 5, siendo la sobreexpresión de la secuencia codificante

ES 2 552 912 T3   considerada obtenida transformando un microorganismo productor de espiramicina por un vector de expresión según la reivindicación 6, permitiendo la sobreexpresión de esta secuencia codificante.

14. Microorganismo mutante según la reivindicación 13, caracterizado por que el microorganismo sobreexpresa una o más secuencias codificantes que comprenden unas secuencias polinucleotídicas tales como se definen en la reivindicación 1.

15. Microorganismo mutante según la reivindicación 13 o 14, caracterizado por que dicho microorganismo es una bacteria del género Streptomyces.

16. Microorganismo mutante según la reivindicación 13, 14 o 15, caracterizado por que dicho microorganismo es una cepa de S. ambofaciens.

17. Procedimiento de producción de espiramicina(s), caracterizado por que comprende las etapas siguientes: (a) cultivar, en un medio de cultivo apropiado, un microorganismo según una de las reivindicaciones 13 a 16, (b) recuperar el medio de cultivo condicionado o un extracto celular, (c) separar y purificar a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa b), las espiramicinas producidas.

18. Cepa de Streptomyces ambofaciens, caracterizada por que se trata de la cepa OSC2/pSPM75(2) depositada en la Colección Nacional de Cultivos de Microorganismos (CNCM) Instituto Pasteur, 25, rue du Docteur Roux 75724 Paris Cedex 15, Francia, el 6 de octubre de 2003 bajo el número de registro -3101.

19. Procedimiento de producción de espiramicina(s), caracterizado por que comprende las etapas siguientes: (a) cultivar, en un medio de cultivo apropiado, un microorganismo según la reivindicación 18, (b) recuperar el medio de cultivo condicionado o un extracto celular, (c) separar y purificar a partir de dicho medio de cultivo o también a partir del extracto celular obtenido en la etapa b), las espiramicinas.

ES 2 552 912 T3  

ES 2 552 912 T3  

ES 2 552 912 T3