Polipéptidos con actividad de glucoamilasa y codificación de polinucleótidos.

Polipéptido que tiene actividad de glucoamilasa, seleccionado del grupo que consta de:

(a) un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos para los aminoácidos de polipéptido maduro 1 a 556 de la SEC ID nº: 2; o

(a1) un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos para los aminoácidos de polipéptido maduro 1 a 561 de la SEC ID nº: 37;

(b) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3, o (iii) una cadena complementaria de (i) o (ii); o

(b1) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 36, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1737 de la SEC ID nº: 38, o (iii) una cadena complementaria de (i) o (ii).

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2005/046724.

Solicitante: NOVOZYMES A/S.

Nacionalidad solicitante: Dinamarca.

Dirección: Krogshøjvej 36 2880 Bagsvaerd DINAMARCA.

Inventor/es: LIU, JIYIN, FUKUYAMA, SHIRO, ALLAIN,ERIC, LANDVIK,Sara, UDAGAWA,Hiroaki, SOONG,Chee-Leong, IHARA,MICHIKO.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/56 (que actúan sobre compuestos glicosílicos (3.2), p. ej. amilasa, galactosidasa, lisozima)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos orgánicos que contienen... > C12P7/06 (Etanol como producto químico y no como bebida alcohólica)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/14 (preparados por acción de una carbohidrasa, p. ej. por acción de la alfa-amilasa)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN... > Preparación de compuestos que contienen radicales... > C12P19/02 (Monosacáridos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/15 (modificados por la introducción de material genético extraño)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Enzimas, p. ej. ligasas (6.; Proenzimas; Composiciones... > C12N9/30 (de origen fúngico)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Enzimas, p. ej. ligasas (6.; Proenzimas; Composiciones... > C12N9/34 (Glucoamilasa)
google+ twitter facebookPin it
Polipéptidos con actividad de glucoamilasa y codificación de polinucleótidos.

Texto extraído del PDF original:

DESCRIPCIÓN

Polipéptidos con actividad de glucoamilasa y codificación de polinucleótidos Referencia cruzada a un listado de secuencias [0001] Esta solicitud contiene un listado de secuencias en formato legible por ordenador. Antecedentes de la invención Campo de la invención [0002] La presente invención se refiere a polipéptidos con actividad de glucoamilasa y polinucleótidos que codifican los polipéptidos. La invención también se refiere a constructos de ácidos nucleicos, vectores y células huésped que comprenden los polinucleótidos, así como métodos para producir y utilizar los polipéptidos, y al uso de glucoamilasas de la invención para convertir el almidón en productos de fermentación, tales como etanol; y jarabes, tales como glucosa. La invención también se refiere a una composición que comprende una glucoamilasa de la invención.

Descripción de las técnicas relacionadas [0003] La glucoamilasa (1,4-alfa-D-glucano glucohidrolasa, EC 3,2,1,3) es una enzima, que cataliza la liberación de D-glucosa de los extremos no reductores del almidón o de moléculas de oligo- y polisacáridos relacionadas. Las glucoamilasas son producidas por diferentes hongos filamentosos y levadura, siendo los más importantes comercialmente los de Aspergillus. [0004] Comercialmente, las glucoamilasas se utilizan para convertir material amiláceo, que ya ha sido parcialmente hidrolizado mediante una alfa-amilasa, en glucosa. La glucosa puede luego ser convertida directamente o indirectamente en un producto de fermentación usando un organismo fermentador. Ejemplos de productos de fermentación comerciales incluyen alcoholes (por ejemplo, etanol, metanol, butanol, 1,3-propanodiol); ácidos orgánicos (por ejemplo, ácido cítrico, ácido acético, ácido itacónico, ácido láctico, ácido glucónico, gluconato, ácido láctico, ácido succínico, ácido 2,5-diketo-D-glucónico); cetonas (por ejemplo, acetona); aminoácidos (por ejemplo, ácido glutámico); gases (por ejemplo, H2 y CO2); y compuestos más complejos, incluyendo, por ejemplo, antibióticos (por ejemplo, penicilina y tetraciclina); enzimas; vitaminas (por ejemplo, riboflavina, B12, beta-caroteno); hormonas, y otros compuestos que son difíciles de producir sintéticamente. Se usan también comúnmente procesos de fermentación en el alcohol consumible (por ejemplo, cerveza y vino), productos lácteos (por ejemplo, en la producción de yogur y queso), cuero e industrias tabaqueras. [0005] El producto final también puede ser un jarabe. Por ejemplo, el producto final puede ser glucosa, pero también puede ser convertido, por ejemplo, mediante glucosa isomerasa en fructosa o una mezcla compuesta casi a partes iguales de glucosa y fructosa. Esta mezcla, o una mezcla adicionalmente enriquecida con fructosa, es el jarabe de maíz rico en fructosa de uso más común (HFCS), comercializado en todo el mundo. [0006] Nagasaka et al., (1995) Appl. Microbiol. Biotechnol. 44: 451-458, describe una glucoamilasa de Corticium

rolfsii. Zhao et al., (2000), Appl. and Environ. Microbiol. 66: 2531-2535, describe una glucoamilasa de Lentinula edodes. [0007] Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102 describen glucoamilasa G1 o G2 de Aspergillus niger.

[0008] La patente EE.UU. nº 4.727.046 describe una glucoamilasa derivada de Corticium rolfsii que es también denominada Athelia rolfsii. [0009] WO 84/02921 describe una glucoamilasa derivada de Aspergillus awamori.

[0010] WO 99/28248 describe una glucoamilasa derivada de Talaromyces emersonii. [0011] WO 00/75296 describe una glucoamilasa derivada de Thermoascus crustaceus. [0012] Es un objetivo de la presente invención el proporcionar polipéptidos que tienen actividad de glucoamilasa y polinucleótidos que codifican los polipéptidos y que proporcionan un rendimiento elevado en los procesos de producción de productos de fermentación, tales como los procesos de producción de etanol, incluyendo los procesos de fermentación de etanol de una etapa a partir de almidón no gelatinizado crudo (o sin cocer). Resumen de la invención [0013] La presente invención se refiere a polipéptidos con actividad de glucoamilasa seleccionados del grupo que consta de: (a) un polipéptido que tiene una secuencia de aminoácidos que tiene al menos un 90% de identidad con aminoácidos para los aminoácidos del polipéptido maduro 1 a 556 de la SEC ID nº: 2; o (a1) un polipéptido que tiene una secuencia de aminoácidos que tiene al menos un 90% de identidad con aminoácidos para los aminoácidos del polipéptido maduro 1 a 561 de la SEC ID nº: 37; (b) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3, o (iii) una cadena complementaria de (i) o (ii); o (b1) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 36, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1737 de la SEC ID nº: 38, o (iii) una cadena complementaria de (i) o (ii); y [0014] La presente invención también se refiere a polinucleótidos que codifican polipéptidos con actividad de glucoamilasa, seleccionados del grupo que consta de: (a) un polinucleótido que codifica un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos del polipéptido maduro 1 a 556 de la SEC ID nº: 2; (a1) un polinucleótido que codifica un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos del polipéptido maduro 1 a 561 de la SEC ID nº: 37; (b) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 2166 de la SEC ID nº: 1; o (b1) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 2166 de la SEC ID nº: 36; (c) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 1725 de la SEC ID nº: 3; o (c1) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 1737 de la SEC ID nº: 38; (d) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3, o (iii) una cadena complementaria de (i) o (ii), o (d1) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 36, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1737 de la SEC ID nº: 38, o (iii) una cadena complementaria de (i) o (ii).

[0015] La presente invención también se refiere a constructos de ácidos nucleicos, vectores de expresión recombinantes y células huésped recombinantes que comprenden los polinucleótidos de las SEC ID no: 1 o 3 (ADNc), o 36 o 38 (ADNc), respectivamente.

[0016] La presente invención también se refiere a métodos para producir tales polipéptidos con actividad de glucoamilasa que comprenden (a) cultivar una célula huésped recombinante que consta de un constructo de ácidos nucleicos que comprende un polinucleótido que codifica el polipéptido bajo condiciones propicias para la producción del polipéptido; y (b) recuperar el polipéptido.

[0017] La presente invención también se refiere a procesos de producción de un producto de fermentación o jarabe. Definiciones [0018] Actividad de glucoamilasa: el término glucoamilasa (1,4-alfa-D-glucano glucohidrolasa, EC 3,2,1,3) se define como una enzima, que cataliza la liberación de D-glucosa de los extremos no reductores del almidón o de moléculas de oligo- y polisacáridos relacionadas. Para fines de la presente invención, la actividad de glucoamilasa se determina según el procedimiento descrito en la sección 'materiales y métodos' más adelante. [0019] Los polipéptidos de la presente invención tienen al menos un 90%, de la forma más preferible al menos un 95% e incluso de la forma más preferible al menos un 100% de la actividad de glucoamilasa del polipéptido que consiste en la secuencia de aminoácidos mostrada como los aminoácidos 1 a 556 de la SEC ID nº: 2 o los aminoácidos 1 a 561 de la SEC ID nº: 37, respectivamente. [0020] Polipéptido: el término "polipéptido" tal como se usa en este documento se refiere a un polipéptido aislado que es al menos un 20% puro, preferiblemente al menos un 40% puro, más preferiblemente al menos un 60%, puro incluso más preferiblemente al menos un 80% puro, de la forma más preferible al menos un 90% puro e incluso de la forma más preferible al menos un 95% puro, tal como se determina mediante SDS-PAGE. [0021] Polipéptido sustancialmente puro: el término "polipéptido sustancialmente puro" denota en este documento un preparado polipeptídico que contiene como mucho un 10%, preferiblemente como mucho un 8%, más preferiblemente como mucho un 6%, más preferiblemente como mucho un 5%, más preferiblemente como mucho un 4%, como mucho un 3%, incluso más preferiblemente como mucho un 2%, de la forma más preferible como mucho un 1% e incluso de la forma más preferible como mucho un 0,5% en peso de otro material polipeptídico con el cual está originalmente asociado. Se prefiere, por lo tanto, que el polipéptido sustancialmente puro sea al menos un 92% puro, preferiblemente al menos un 94% puro, más preferiblemente al menos un 95% puro, más preferiblemente al menos un 96% puro, más preferiblemente al menos un 96% puro, más preferiblemente al menos un 97% puro, más preferiblemente al menos un 98% puro, incluso más preferiblemente al menos un 99%, de la forma más preferible al menos un 99,5% puro e incluso de la forma más preferible 100% puro en peso del material polipeptídico total presente en el preparado.

[0022] Los polipéptidos de la presente invención están preferiblemente en una forma sustancialmente pura. En particular, se prefiere que los polipéptidos estén en una "forma esencialmente pura", es decir, que el preparado polipeptídico esté esencialmente libre de otro material polipeptídico con el cual esté originalmente asociado. Esto se puede conseguir, por ejemplo, preparando el polipéptido mediante métodos recombinantes bien conocidos o mediante métodos de purificación tradicionales.

[0023] En este documento, el término "polipéptido sustancialmente puro" es sinónimo de los términos "polipéptido aislado" y "polipéptido en forma aislada". [0024] Identidad: la relación entre dos secuencias de aminoácido o entre dos secuencias de nucleótidos es descrita por el parámetro "identidad". [0025] Para fines de la presente invención, el grado de identidad entre dos secuencias de aminoácidos se determina mediante el método Clustal (Higgins, 1989, CABIOS 5: 151-153) utilizando el software LASERGENE™ MEGALIGN™ de (DNASTAR, Inc., Madison, WI) con una tabla de identidad y los siguientes parámetros de alineamiento múltiple: penalización de gap de 10 y penalización de longitud de gap de 10. Los parámetros de alineamiento por parejas son Ktuple=1, penalización de gap=3, ventanas=5 y diagonales=5. [0026] Para fines de la presente invención, el grado de identidad entre dos secuencias de nucleótidos se determina mediante el método Wilbur-Lipman (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) utilizando el software LASERGENE™ MEGALIGN™ (DNASTAR, Inc., Madison, WI) con una tabla de identidad y los siguientes parámetros de alineamiento múltiple: penalización de gap de 10 y penalización de longitud de gap de 10. Los parámetros de alineamiento por parejas son Ktuple=3, penalización de gap=3 y ventanas=20. [0027] Fragmento de polipéptido: el término "fragmento de polipéptido" se define en este documento como un polipéptido que tiene uno o más aminoácidos eliminados del amino- y/o carboxilo-terminal de las SEC ID no: 2 o 37, respectivamente, o secuencias homólogas de las mismas, donde el fragmento tiene actividad de glucoamilasa. [0028] Subsecuencia: el término "subsecuencia" se define en este documento como una secuencia de nucleótidos que tiene uno o más nucleótidos eliminados de los terminales 5' y/o 3' de las SEC ID no: 1, 36 o 38, respectivamente; o las SEC ID no: 4, 39 o 41, o las SEC ID no: 23, 25 o 42, respectivamente, o secuencias homólogas de las mismas, donde la subsecuencia codifica un fragmento de polipéptido con actividad de glucoamilasa. [0029] Variante alélica: el término "variante alélica" denota en este documento cualesquiera dos o más formas alternativas de un gen que ocupa el mismo locus cromosómico. La variación alélica surge naturalmente a través de mutación y puede dar lugar al polimorfismo dentro de poblaciones. Las mutaciones genéticas pueden ser silenciosas (sin cambios en el polipéptido codificado) o pueden codificar polipéptidos con secuencias de aminoácidos alteradas. Una variante alélica de un polipéptido es un polipéptido codificado por una variante alélica de un gen. [0030] Polinucleótido sustancialmente puro: el término "polinucleótido sustancialmente puro" tal y como se usa en este documento se refiere a un preparado de polinucleótidos libre de otros nucleótidos extraños o no deseados y en una forma adecuada para el uso dentro de sistemas de producción de proteínas genéticamente modificadas. De este modo, un polinucleótido sustancialmente puro contiene como mucho un 10%, preferiblemente como mucho un 8%, más preferiblemente como mucho un 6%, más preferiblemente como mucho un 5%, más preferiblemente como mucho un 4%, más preferiblemente como mucho un 3%, incluso más preferiblemente como mucho un 2%, de la forma más preferible como mucho un 1% e incluso de la forma más preferible como mucho un 0,5% en peso de otro material polinucleótido con el cual está asociado originalmente o por recombinación. Un polinucleótido sustancialmente puro puede, no obstante, incluir las regiones no traducidas 5' y 3' de origen natural, tales como promotores y terminadores. Se prefiere que el polinucleótido sustancialmente puro sea al menos un 90% puro, preferiblemente al menos un 92% puro, más preferiblemente al menos un 94% puro, más preferiblemente al menos un 95% puro, más preferiblemente al menos un 96% puro, más preferiblemente al menos un 97% puro, incluso más preferiblemente al menos un 98% puro, de la forma más preferible al menos un 99% e incluso de la forma más preferible al menos un 99,5% puro en peso. Los polinucleótidos de la presente invención están preferiblemente en una forma sustancialmente pura. En particular, se prefiere que los polinucleótidos que se describen en este documento estén en "forma esencialmente pura", es decir, que el preparado de polinucleótidos esté esencialmente libre de otro material de polinucleótidos con el cual está asociado originalmente o por recombinación. En este documento, el término "polinucleótido sustancialmente puro" es sinónimo de los términos " aislado" y " polinucleótido en forma aislada". Los polinucleótidos pueden ser de origen genómico, ADNc, ARN, semisintético, sintético o cualquier combinación de los mismos. [0031] ADNc: el término "ADNc" se define en este documento como una molécula de ADN que se puede preparar mediante transcripción inversa de una molécula de ARNm madura empalmada, obtenida de una célula eucariota. El ADNc carece de secuencias intrónicas que están normalmente presentes en el ADN genómico correspondiente. El transcrito inicial principal de ARN es un precursor de ARNm que se procesa a través de una serie de pasos antes de aparecer como ARNm maduro empalmado. Estos pasos incluyen la eliminación de secuencias intrónicas por un proceso llamado empalme. El ADNc derivado de ARNm carece, por tanto, de cualquier secuencia intrónica.

[0032] Constructo de ácidos nucleicos: el término "constructo de ácidos nucleicos" tal y como se utiliza en este documento se refiere a una molécula de ácidos nucleicos, tanto uni- como bicatenaria, que es aislada de un gen de origen natural o que se modifica para contener segmentos de ácidos nucleicos de manera que de otro modo no existirían en la naturaleza. El término constructo de ácidos nucleicos es sinónimo del término "casete de expresión" cuando el constructo de ácidos nucleicos contiene las secuencias de control requeridas para la expresión de una secuencia codificante de la presente invención. [0033] Secuencia de control: el término "secuencias de control" se define en este documento para incluir todos los componentes, que son necesarios o beneficiosos para la expresión de un polinucleótido que codifica un polipéptido de la presente invención. Cada secuencia de control puede ser nativa o extranjera a la secuencia de nucleótidos que codifica el polipéptido. Tales secuencias de control incluyen, pero no se limitan a, un líder, una secuencia de poliadenilación, una secuencia de propéptido, un promotor, una secuencia de péptido señal y un terminador de transcripción. Como mínimo, las secuencias de control incluyen un promotor y señales de parada transcripcional y traduccional. Se pueden proporcionar enlazadores a las secuencias de control con el objetivo de introducir sitios de restricción específicos que faciliten la unión de las secuencias de control con la región codificante de la secuencia de nucleótidos que codifica un polipéptido. [0034] Operativamente enlazado: el término "operativamente enlazado" denota en este documento una configuración en la que una secuencia de control se coloca en una posición apropiada relativa a la secuencia de codificación de la secuencia de polinucleótidos de manera que la secuencia de control dirige la expresión de la secuencia codificante de un polipéptido. [0035] Secuencia codificante: cuando se usa en este documento, el término "secuencia codificante" significa una secuencia de nucleótidos que especifica directamente la secuencia de aminoácidos de su producto proteínico.

Los límites de la secuencia codificante están generalmente determinados por un marco de lectura abierto, que empieza normalmente con el codón de inicio ATG o codones de inicio alternativos tales como GTG y TTG. La secuencia codificante puede ser una secuencia de nucleótidos de ADN, ADNc o recombinante. [0036] Expresión: término "expresión" incluye cualquier paso involucrado en la producción del polipéptido incluyendo, pero no limitándose a, transcripción, modificación postranscripcional, traducción, modificación postraduccional y secreción. [0037] Vector de expresión: el término "vector de expresión" se define en este documento como una molécula de ADN lineal o circular que comprende un polinucleótido que codifica un polipéptido de la invención y que está operativamente enlazada a nucleótidos adicionales que se ocupan de su expresión. [0038] Célula huésped: el término "célula huésped", tal y como se utiliza en este documento, incluye cualquier tipo de célula que sea susceptible de transformación, transfección, transducción y similares con un constructo de ácidos nucleicos que comprende un polinucleótido de la presente invención.

[0039] Modificación: el término "modificación" significa en este documento cualquier modificación química del polipéptido que consiste en los aminoácidos 1 a 556 de la SEC ID nº: 2 o los aminoácidos 1 a 561 de la SEC ID nº: 37, respectivamente, así como la manipulación genética del ADN que codifica los polipéptidos. La(s) modificación(es) puede(n) ser sustitución(es), deleción(es) y/o inserción(es) de los aminoácidos así como reemplazos de cadenas laterales de aminoácidos.

[0040] Variante Artificial: cuando se usa en este documento, el término "variante artificial" significa un polipéptido que tiene actividad de glucoamilasa producido por un organismo que expresa una secuencia de nucleótidos modificada de las SEC ID no: 1 o 3 (ADNc) o las SEC ID no: 36 o 38. La secuencia de nucleótidos modificada se obtiene a través de intervención humana modificando la secuencia de nucleótidos descrita en las SEC ID no: 1 o 3, o las SEC ID no: 36 o 38, respectivamente. Breve descripción del dibujo [0041] La figura 1 muestra la actividad desramificante en el pululano de glucoamilasa de Trametes cingulata en comparación con glucoamilasas de Athelia rolfsii, Aspergillus niger y Talaromices emersonii. Descripción detallada de la invención Polipéptidos que tienen actividad de glucoamilasa [0042] En un primer aspecto, la presente invención se refiere a polipéptidos que tienen una secuencia de aminoácidos que tiene un grado de identidad con los aminoácidos 1 a 556 de la SEC ID nº: 2, o aminoácidos 1 a 561 de la SEC ID nº: 37 (es decir, el polipéptido maduro), respectivamente.

[0043] En una realización la secuencia de aminoácidos tiene actividad de glucoamilasa y es idéntica al menos en un 90%, preferiblemente al menos en un 95%, más preferido al menos en un 96%, más preferido incluso al menos en un 97%, más preferido incluso al menos en un 98%, incluso más preferiblemente al menos en un 99% a la parte madura de la SEC ID nº: 2 o SEC ID nº: 37 (en adelante "polipéptidos homólogos" ).

[0044] En un aspecto preferido, los polipéptidos homólogos tienen una secuencia de aminoácidos que difiere en diez aminoácidos, preferiblemente en cinco aminoácidos, más preferiblemente en cuatro aminoácidos, incluso más preferiblemente en tres aminoácidos, de la forma más preferible en dos aminoácidos, e incluso de la forma más preferible en un aminoácido de los aminoácidos 1 a 556 de la SEC ID nº: 2, o los aminoácidos 1 a 561 de la SEC ID nº: 37, respectivamente.

[0045] Un polipéptido de la presente invención preferiblemente comprende las secuencias maduras de aminoácidos de las SEC ID nº: 2 o 37, respectivamente; o fragmentos de las mismas que tienen actividad de glucoamilasa, por ejemplo, el dominio catalítico.

Dominio catalítico [0046] En un aspecto, la invención se refiere a polipéptidos que comprenden la región/dominio catalítico de las secuencias de aminoácidos de las SEC ID nº: 2 o 37, respectivamente.

[0047] La región/dominio catalítico de la glucoamilasa de Trametes cingulata se encuentra en los aminoácidos 1 a 455 en SEC ID nº: 2 o en los aminoácidos 1 a 460 de la SEC ID nº: 37. En una realización se puede considerar que la región incluye la región enlazante de los aminoácidos 456 a 465 de la SEC ID nº: 2 o los aminoácidos 461 a 470 de la SEC ID nº: 37, respectivamente, o parte de las mismas. El dominio de unión es codificado por los polinucleótidos 1423 a 1725 en la SEC ID nº: 3 o los polinucleótidos 1774 a 2163 de la SEC ID nº: 36 o los polinucleótidos 1465 a 1737 de la SEC ID nº: 38, respectivamente. [0048] En una realización preferida la invención se refiere a una región catalítica que tiene al menos un 90% de identidad, de la forma más preferible al menos un 95% de identidad, más preferido al menos un 96% de identidad, más preferido incluso al menos un 97% de identidad, más preferido incluso al menos un 98% de identidad, incluso más preferiblemente al menos un 99% identidad y especialmente un 100% identidad con los aminoácidos 1 a 455 de la SEC ID nº: 2 o los aminoácidos 1 a 460 de la SEC ID nº: 37 (Trametes), respectivamente, y que tienen actividad de glucoamilasa (en adelante "polipéptidos homólogos"). En un aspecto preferido, las regiones catalíticas homólogas tienen secuencias de aminoácidos que difieren en diez aminoácidos, preferiblemente en cinco aminoácidos, más preferiblemente en cuatro aminoácidos, incluso más preferiblemente en tres aminoácidos, de la forma más preferible en dos aminoácidos e incluso de la forma más preferible en un aminoácido de los aminoácidos 1 a 455 de la SEC ID nº: 2 o los aminoácidos 1 a 460 de la SEC ID nº: 37 (Trametes cingulata), respectivamente. Dominio de unión [0049] En otro aspecto, la divulgación se refiere a polipéptidos que tienen afinidad de enlace a carbohidratos, preferiblemente afinidad de enlace al almidón. [0050] El dominio de unión en la glucoamilasa de Trametes se ubica en los aminoácidos 466 a 556 de la SEC ID nº: 2 y es codificado por los polinucleótidos 1420 a 1725 de la SEC ID nº: 3 o se ubica en los aminoácidos 471 a 561 de la SEC ID nº: 37 y es codificado por los polinucleótidos 1465 a 1737 de la SEC ID nº: 38.

[0051] En consecuencia, la divulgación se refiere a un polipéptido que tiene afinidad de enlace a carbohidratos, seleccionado del grupo que consta de: (a) i) un polipéptido que comprende una secuencia de aminoácidos que tiene al menos un 60% de identidad con los aminoácidos 466 a 556 de la SEC ID nº: 2 o los aminoácidos 471 a 561 de la SEC ID nº: 37, respectivamente (b) un polipéptido que es codificado por una secuencia de nucleótidos que se hibrida bajo condiciones de astringencia bajas con una sonda polinucleótida seleccionada del grupo que consta de 1. (i) la cadena complementaria de los nucleótidos 1420 a 1725 de la SEC ID nº: 3 o los nucleótidos 1465 a 1737 de la SEC ID nº: 38, respectivamente; 2. (c) un fragmento de (a) o (b) que tiene afinidad de enlace a carbohidratos. [0052] En una realización preferida de la divulgación la afinidad de enlace a carbohidratos es afinidad de enlace al almidón.

[0053] En una realización preferida la divulgación se refiere a un polipéptido con afinidad de enlace a carbohidratos que tiene al menos un 60% de identidad, preferiblemente al menos un 70% de identidad, más preferiblemente al menos un 75% de identidad, más preferiblemente al menos un 80% de identidad, más preferiblemente al menos un 85% de identidad, incluso más preferiblemente al menos un 90% de identidad, de la forma más preferible al menos 95% de identidad, más preferido al menos un 96% de identidad, más preferido incluso al menos un 97% de identidad, incluso más preferido al menos un 98% de identidad, incluso más preferiblemente al menos un 99% de identidad, especialmente un 100% de identidad con los aminoácidos 466 a 556 en SEC ID nº: 2 o los aminoácidos 471 a 561 de la SEC ID nº: 37, (Trametes), respectivamente.

[0054] En un aspecto, los dominios de unión homólogos tienen secuencias de aminoácidos que difieren en diez aminoácidos, preferiblemente en cinco aminoácidos, más preferiblemente en cuatro aminoácidos, incluso más preferiblemente en tres aminoácidos, de la forma más preferible en dos aminoácidos e incluso de la forma más preferible en un aminoácido de los aminoácidos 466 a 556 de la SEC ID nº: 2 o los aminoácidos 471 a 561 de la SEC ID nº: 37 (Trametes cingulata), respectivamente.

[0055] En otra realización la divulgación se refiere a un polipéptido con afinidad de enlace a carbohidratos, seleccionado del grupo que consta de: 1. (a) un polipéptido que es codificado por una secuencia de nucleótidos que se hibrida bajo condiciones de astringencia bajas, preferiblemente bajo condiciones medias, más preferiblemente bajo condiciones de astringencia altas con una sonda polinucleótida seleccionada del grupo que consta de: 1. (i) la cadena complementaria de los nucleótidos 1420 a 1725 de la SEC ID nº: 3 o los nucleótidos 1465 a 1737 en SEC ID nº: 38, respectivamente; 2. (b) un fragmento de (a) que tiene afinidad de enlace a carbohidratos.

Híbridos [0056] Las glucoamilasas o regiones catalíticas de la invención pueden ser enlazadas, a través de una secuencia enlazante o directamente a uno o varios dominios de unión extranjeros (también denominados como módulos de unión (CBM)). Un dominio de unión "extranjero" es un dominio de unión que no es obtenido a partir de las glucoamilasas de tipo salvaje de la invención en cuestión. El dominio de unión es preferiblemente un dominio de enlace a carbohidratos (es decir, que tiene afinidad para unirse a un carbohidrato), especialmente un dominio de unión al almidón o un dominio de unión a la celulosa. Los dominios de unión preferidos son de origen fúngico o bacteriano. Ejemplos de dominios de unión al almidón específicamente contemplados se describen en WO 2005/003311 que se incorpora en este documento por referencia. [0057] En una realización preferida el enlazador en una glucoamilasa de la invención se sustituye por un enlazador más estable, es decir, un enlazador que es más difícil de cortar que el enlazador original. Esto se hace para evitar que el dominio de unión se dividida. Enlazadores estables específicamente contemplados incluyen el enlazador de

Aspergillus kawachii: TTTTTTAAAT STSKATTSSSSSSAAATTSSS (SEC ID nº: 22) [0058] Así, en una realización la divulgación se refiere a una glucoamilasa híbrida que tiene la secuencia de aminoácidos mostrada en las SEC ID nº: 2 o 37, respectivamente, donde el enlazado nativo ubicado en los aminoácidos 456 a 465 de la SEC ID nº: 2 o en los aminoácidos 461 a 470 de la SEC ID nº: 37, respectivamente, o parte de los mismos, se sustituye por el enlazador de Aspergillus kawachii mostrado en la SEC ID nº: 22. [0059] Así, la divulgación también se refiere a híbridos que consisten en una glucoamilasa de la invención o dominio catalítico de la invención que tienen actividad de glucoamilasa fusionados a un enlazador estable (por ejemplo, el enlazador de Aspergillus kawachii) y uno o varios dominios de unión a carbohidratos, por ejemplo, un módulo de unión a carbohidratos (CBM) descrito en WO 2005/003311 en la página 5, línea 30 a la página 8, línea 12. Hibridación [0060] En otro aspecto, la presente invención se refiere a polipéptidos con actividad de glucoamilasa que son codificados por polinucleótidos (i) que se hibridan al menos bajo condiciones de astringencia altas y más preferiblemente condiciones de astringencia muy altas que tienen una secuencia de nucleótidos con los nucleótidos 55 a 2166 de la SEC ID nº: 1 o los nucleótidos 55 a 2166 de la SEC ID nº: 36, respectivamente (ADN genómico de Trametes), o (ii) que se hibridan al menos bajo condiciones de astringencia altas y más preferiblemente condiciones de astringencia muy altas que tienen una secuencia de nucleótidos con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3 o los nucleótidos 55 a 1737 de la SEC ID nº: 38, respectivamente (ADNc de Trametes), o (iii) una subsecuencia de (i) o (ii), o (iv) una cadena complementaria de (i); (ii), o (iii) (J. Sambrook, E.F. Fritsch, y T. Maniatis, 1989, Molecular Cloning, A laboratory Manual, 2ª edición, Cold Spring Harbor, Nueva York ). Una subsecuencia de las SEC ID no: 1 o 3, o las SEC ID no: 36 o 38 (Trametes) contiene como mínimo 100 nucleótidos contiguos o preferiblemente al menos 200 nucleótidos contiguos. Además, la subsecuencia puede codificar un fragmento de polipéptido que tiene actividad de glucoamilasa. [0061] La secuencia de nucleótidos de las SEC ID no: 1, 3, 36 o 38, respectivamente, o una subsecuencia de las mismas, así como la secuencia de aminoácidos de las SEC ID no: 2 o 37, respectivamente, o un fragmento de las mismas, se pueden utilizar para diseñar una sonda de ácidos nucleicos para identificar y clonar ADN que codifica polipéptidos con actividad de glucoamilasa de cepas de diferentes géneros o especies según métodos bien conocido en el técnica. En particular, tales sondas se pueden usar para hibridación con el ADN genómico o el ADNc del género o especie de interés, siguiendo procedimientos estándar de transferencia Southern, para identificar y aislar el gen correspondiente de ellos. Tales sondas pueden ser considerablemente más cortas que toda secuencia, pero deberían ser al menos de 14, preferiblemente al menos de 25, más preferiblemente al menos de 35 y de la forma más preferible al menos de 70 nucleótidos de longitud. Se prefiere, no obstante, la sonda de ácido nucleico sea al menos de 100 nucleótidos de longitud. Por ejemplo, la sonda de ácidos nucleicos puede ser al menos de 200 nucleótidos, preferiblemente al menos de 300 nucleótidos, más preferiblemente al menos de 400 nucleótidos o de la forma más preferible al menos de 500 nucleótidos de longitud. Se pueden utilizar sondas incluso más largas, por ejemplo, sondas de ácidos nucleicos que son al menos de 600 nucleótidos, preferiblemente al menos de 700 nucleótidos, más preferiblemente de 800 nucleótidos o de la forma más preferible al menos de 900 nucleótidos de longitud. Tanto las sondas de ADN como de ARN pueden usarse. Las sondas son típicamente marcadas para la detección del gen correspondiente (por ejemplo, con 32P, 3H, 35S, biotina o avidina). Tales sondas son abarcadas por la presente invención.

[0062] Una biblioteca de ADN genómico o de ADNc obtenida a partir de tales otros organismos puede, por lo tanto, ser seleccionada para ADN que se hibrida con las sondas anteriormente descritas y que codifica un polipéptido que tiene actividad de glucoamilasa. El ADN genómico o de otro tipo de tales otros organismos se puede separar por electroforesis en gel de poliacrilamida o agarosa, u otras técnicas de separación. El ADN de las bibliotecas o el ADN separado pueden ser transferidos para inmovilización en nitrocelulosa u otro material portador adecuado. Para identificar un clon o ADN que es homólogo a las SEC ID nº: 1, 3, 36 o 38, respectivamente, o una subsecuencia de las mismas, el material portador se usa en una transferencia Southern. [0063] Para fines de la presente invención, la hibridación indica que las secuencias de nucleótidos se hibridan con sondas de ácidos nucleicos marcadas que corresponden con la secuencia de nucleótidos mostrado en las SEC ID nº: 1, 3, 36 o 38, respectivamente, sus cadenas complementarias, o subsecuencias de las mismas, bajo condiciones de astringencia de bajas o medias hasta condiciones de astringencia muy altas. Las moléculas a las que la sonda de ácidos nucleicos se hibrida bajo estas condiciones se pueden detectar usando una película radiográfica.

[0064] En una realización preferida, la sonda de ácido nucleico es los nucleótidos 55 a 2166 de la SEC ID nº: 1 o los nucleótidos 55 a 2166 de la SEC ID nº: 36, o los nucleótidos 1 a 1725 de la SEC ID nº: 3 o los nucleótidos 55 a 1737 de la SEC ID nº: 38 (ADNc de Trametes). En otro aspecto preferido, la sonda de ácido nucleico es una secuencia de polinucleótidos que codifica la región catalítica entre los aminoácidos 1 y 455 de la SEC ID nº: 2 o los aminoácidos 1 a 460 de la SEC ID nº: 37 (Trametes).

[0065] En otro aspecto preferido, la sonda de ácidos nucleicos es la región codificante del polipéptido maduro de las SEC ID nº: 1, 3, 36 o 38, respectivamente (Trametes). Para sondas largas de al menos 100 nucleótidos de longitud, condiciones de astringencia de bajas a muy altas se definen como prehibridación e hibridación a 42°C en SSPE 5X, 0,3% SDS, 200 micro g/ml de ADN de esperma de salmón cortado y desnaturalizado, y, o bien un 25% de formamida para astringencias bajas, o bien un 35% de formamida para astringencias medias y medias-altas, o bien un 50% de formamida para astringencias altas y muy altas, siguiendo procedimientos estándar de transferencia Southern durante 12 a 24 horas de manera óptima. [0066] Para sondas largas de al menos 100 nucleótidos de longitud, el material portador es finalmente lavado tres veces, cada una durante 15 minutos usando SSC 2X, 0,2% SDS preferiblemente al menos a 50°C (astringencia baja), más preferiblemente al menos a 55°C (astringencia media), más preferiblemente al menos a 60°C (astringencia media-alta), incluso más preferiblemente al menos a 65°C (astringencia alta) y de la forma más preferible al menos a 70°C (astringencia muy alta). [0067] Para sondas cortas que son desde aproximadamente 15 nucleótidos hasta aproximadamente 70 nucleótidos de longitud, las condiciones de astringencia son definidas como prehibridación, hibridación y post-hibridación de lavado desde aproximadamente 5°C hasta aproximadamente 10°C por debajo de la Tf calculada utilizando el cálculo según Bolton y McCarthy (1962, Proceedings of the National Academy of Science USA 48:1390) en NaCl 0,9 M, Tris-HCl 0,09 M pH 7,6, EDTA 6 mM, NP-40 0,5%, solución de Denhardt 1X, pirofosfato de sodio 1 mM, fosfato 1 mM monobásico de sodio, ATP 0,1 mM y 0,2 mg de ARN de levadura por ml siguiendo procedimientos estándar de transferencia Southern. [0068] Para sondas cortas que son desde aproximadamente 15 nucleótidos hasta aproximadamente 70 nucleótidos de longitud, el material portador se lava una vez en SCC 6X más 0,1% SDS durante 15 minutos y dos veces cada una durante 15 minutos usando SSC 6X de 5°C a 10°C por debajo de la Tf calculada.

[0069] Bajo condiciones de hibridación que contienen sal, la Tf eficaz es lo que controla el grado de identidad requerido entre la sonda y el ADN ligado al filtro para una hibridación exitosa. La Tf eficaz se puede determinar utilizando la fórmula siguiente para determinar el grado de identidad requerido para que dos ADN se hibriden bajo diversas condiciones de astringencia.

(Ver www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm) [0070] El contenido G+C de la SEC ID nº: 1 o los nucleótidos 55 a 2166 de la SEC ID nº: 1 es un 60,5%. El contenido G+C de la SEC ID nº: 3 (ADNc) o los nucleótidos 55 a 1725 de la SEC ID nº: 3 es un 62,3%.

[0071] El contenido G+C de la SEC ID nº: 4 o los nucleótidos 55 a 2189 de la SEC ID nº: 4 es un 60,7%. El contenido G+C de la SEC ID nº: 6 (ADNc) o los nucleótidos 55 a 1725 de la SEC ID nº: 6 es un 63,7%. [0072] Para astringencia media, la formamida es el 35% y la concentración de Na+ para SSPE 5X es 0,75 M.

Aplicando esta fórmula para estos valores, la Tf es 79,0°C. [0073] Otra relación pertinente es que un 1% de error de apareamiento de dos ADN baja la Tf en 1,4°C. Para determinar el grado de identidad requerido para que dos ADN se hibriden bajo condiciones de astringencia media a 42°C, se usa la siguiente fórmula: (Ver www.ndsu.nodak.edu/instruct/mcclean/plsc731/dna/dna6.htm) [0074] Aplicando esta fórmula a los valores, el grado de identidad requerido para que dos ADN se hibriden bajo condiciones de astringencia media a 42°C es 100 - [(79,0 - 42)/1,4] = 51%.

Variantes [0075] En otro aspecto, la presente divulgación se refiere a variantes artificiales que comprenden una sustitución conservadora, eliminación y/o inserción de uno o varios aminoácidos en las SEC ID nº: 2 o 37, respectivamente, o el polipéptido maduro de las mismas. Preferiblemente, los cambios de aminoácidos son de naturaleza menor, es decir, sustituciones conservadoras de aminoácidos o inserciones que no afectan significativamente al plegado y/o actividad de la proteína; deleciones pequeñas, típicamente de uno a aproximadamente 30 aminoácidos; extensiones pequeñas del amino- o carboxilo-terminal, tal como un residuo de metionina del amino-terminal; un péptido enlazador pequeño de hasta aproximadamente 20-25 residuos; o una extensión pequeña que facilita la purificación cambiando la carga neta u otra función, tal como un tracto de polihistidina, un epítopo antigénico o un dominio de unión. [0076] Los ejemplos de sustituciones conservadoras están dentro del grupo de aminoácidos básicos (arginina, lisina e histidina), aminoácidos ácidos (ácido glutámico y ácido aspártico), aminoácidos polares (glutamina y asparagina), aminoácidos hidrofóbicos (leucina, isoleucina y valina), aminoácidos aromáticos (fenilalanina, triptófano y tirosina) y aminoácidos pequeños (glicina, alanina, serina, treonina y metionina). Las sustituciones de aminoácidos que generalmente no alteran la actividad específica son conocidas en la técnica y son descritas, por ejemplo, por H. Neurath y R.L. Hill, 1979, In, The proteins, Academic Press, Nueva York. Los cambios que ocurren más frecuentemente son Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu y Asp/Gly. [0077] Además de los 20 aminoácidos estándar, aminoácidos no estándar (tales como 4- hidroxiprolina, 6-n-metil lisina, ácido 2-aminoisobutírico, isovalina y alfa-metil serina) se pueden sustituir por residuos de aminoácidos de un polipéptido tipo salvaje. Un número limitado de aminoácidos no conservadores, aminoácidos que no son codificados por el código genético y aminoácidos no naturales se pueden sustituir por residuos de aminoácidos. Los "aminoácidos no naturales" han sido modificados después de la síntesis de proteínas y/o tienen una estructura química en su(s) cadena(s) lateral(es) diferente(s) de los aminoácidos estándar. Los aminoácidos no naturales pueden ser químicamente sintetizados y, preferiblemente, están disponibles comercialmente e incluyen ácido pipecólico, ácido tiazolidin-carboxílico, dehidroprolina, 3- y 4-metilprolina y 3,3-dimetilprolina.

[0078] Alternativamente, los cambios en aminoácidos son de tal naturaleza que se alteran las propiedades físico- químicas de los polipéptidos. Por ejemplo, los cambios en aminoácidos pueden mejorar la termoestabilidad del polipéptido, alterar la especificidad de sustrato, cambiar el pH óptimo, y similares. [0079] Los aminoácidos esenciales en los polipéptidos originales se pueden identificar según procedimientos conocidos en la técnica, tales como mutagénesis dirigida o mutagénesis por escaneado de alanina (Cunningham y Wells 1989, Science 244: 1081-1085). En esta última técnica, mutaciones de alanina individuales se introducen en cada residuo en la molécula, y las moléculas mutantes resultantes son examinadas para conocer su actividad biológica (es decir, actividad de glucoamilasa) para identificar residuos de aminoácidos que son críticos para la actividad de la molécula. Ver también, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. El sitio activo de las enzimas u otra interacción biológica también puede ser determinado por análisis físico de la estructura, tal como se determina mediante técnicas tales como resonancia magnética nuclear, cristalografía, difracción de electrones o marcaje por fotoafinidad, conjuntamente con la mutación de aminoácidos de sitios de contacto putativos. Ver, por ejemplo, de Vos et al., 11992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, Lett. FEBS 309:59-64. Las identidades de los aminoácidos esenciales también pueden ser inferidas del análisis de identidades con polipéptidos relacionados con un polipéptido según la invención. [0080] Se pueden hacer y evaluar sustituciones de aminoácidos individuales o múltiples usando métodos conocidos de mutagénesis, recombinación y/o barajado, seguidos de un proceso de selección pertinente, tales como los descritos por Reidhaar-Olson y Sauer, 1988, Science 241: 53-57; Bowie y Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; o WO 95/22625. Otros métodos que se pueden usar incluyen PCR propensa al error, despliegue de fagos (por ejemplo, Lowman et al., 1991, Biochem. 30: 10832-10837; patente EE.UU. nº 5.223.409; WO 92/06204) y mutagénesis dirigida (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127). [0081] Los métodos de mutagénesis/barajado se pueden combinar con métodos de alto rendimiento de selección automatizada para detectar actividad de polipéptidos clonados y mutagenizados expresados por células huésped. Las moléculas de ADN mutagenizadas que codifican polipéptidos activos se pueden recuperar de las células huésped y ser rápidamente secuenciadas usando métodos estándar en la técnica. Estos métodos permiten determinar rápidamente la importancia de los residuos de aminoácidos individuales en un polipéptido de interés y se pueden aplicar a polipéptidos de estructura desconocida.

[0082] El número total de sustituciones, deleciones y/o inserciones de aminoácidos en la posición 1 a 556 de la SEC ID nº: 2 o la posición 1 a 561 de la SEC ID nº: 37 (glucoamilasa de Trametes), respectivamente, es 10, preferiblemente 9, más preferiblemente 8, más preferiblemente 7, más preferiblemente como mucho 6, más preferiblemente como mucho 5, más preferiblemente 4, incluso más preferiblemente 3, de la forma más preferible 2 e incluso de la forma más preferible 1. Fuentes de polipéptidos con actividad de glucoamilasa [0083] Un polipéptido de la presente invención puede ser obtenido de microorganismos de cualquier género. Para fines de la presente invención, el término "obtenido de" tal como se utiliza en este documento en conexión con una fuente significará que el polipéptido codificado por una secuencia de nucleótidos es producido por la fuente o por una cepa en la que se ha insertado la secuencia de nucleótidos de la fuente. En un aspecto preferido, el polipéptido obtenido de una fuente dada es secretado extracelularmente.

[0084] En una realización preferida, la glucoamilasa de la invención se deriva de la clase Basidiomicetes. En una realización más preferida una glucoamilasa de la invención se obtiene de una cepa del género Trametes, más preferiblemente de una cepa de las especies Trametes cingulata. [0085] Se entiende que para las especies anteriormente mencionadas, la invención abarca los estados perfectos e imperfectos y otros equivalentes taxonómicos, por ejemplo, anamorfos, independientemente del nombre de especie por el que son conocidos. Expertos en la técnica reconocerán fácilmente la identidad de los equivalentes apropiados. [0086] La cepa de Trametes cingulata fue recogida en Zimbabwe en el periodo de 1995 a 1997.

[0087] Además, tales polipéptidos pueden ser identificados y obtenidos de otras fuentes incluyendo microorganismos aislados de la naturaleza (por ejemplo, suelos, abonos, agua, etc.) utilizando las sondas mencionadas anteriormente. Las técnicas para aislar microorganismos de hábitats naturales son bien conocidas en la técnica. El polinucleótido puede entonces ser obtenido de forma similar seleccionando de una biblioteca genómica o de ADNc de otro microorganismo. Una vez se ha detectado una secuencia de polinucleótidos que codifica un polipéptido con la(s) sonda(s), el polinucleótido puede ser aislado o clonado utilizando técnicas que son bien conocidas por aquellos expertos en el arte (ver, por ejemplo, Sambrook et al., 1989, supra).

[0088] Los polipéptidos de la presente invención también incluyen polipéptidos fusionados o polipéptidos divisibles de fusión donde otro polipéptido se fusiona al N-terminal o al C-terminal del polipéptido o un fragmento del mismo. Un polipéptido fusionado se produce fusionando una secuencia de nucleótidos (o una parte de la misma) que codifica otro polipéptido a una secuencia de nucleótidos (o una parte de la misma) de la presente invención. Las técnicas para producir polipéptidos de fusión se conocen en la técnica, e incluyen ligar las secuencias codificantes que codifican los polipéptidos de modo que éstas estén en el marco y que la expresión del polipéptido fusionado esté bajo control del(los) mismo(s) promotor(es) y terminador(es).

Polinucleótidos [0089] La presente invención también se refiere a polinucleótidos aislados que tienen una secuencia de nucleótidos que codifican un polipéptido de la presente invención. En un aspecto preferido, la secuencia de nucleótidos es establecida en cualquiera de las SEC ID nº: 1, 3, 36, 38, respectivamente. En otro aspecto preferido, la secuencia de nucleótidos es la región codificante del polipéptido maduro de cualquiera de las SEC ID nº: 1, 3, 36, 38, respectivamente. La presente invención también abarca secuencias de nucleótidos que codifican un polipéptido que tiene la secuencia de aminoácidos de cualquiera de las SEC ID nº: 2, 37, respectivamente, o el polipéptido maduro de las mismas, que difieren de las SEC ID nº: 1, 3, 36, 38, respectivamente, en virtud de la degeneración del código genético. La presente invención también se refiere a subsecuencias de cualquiera de las SEC ID nº: 1, 3, 36, 38, respectivamente, que codifican fragmentos de las SEC ID nº: 2, 37, respectivamente, que tienen actividad de glucoamilasa. [0090] La presente invención también se refiere a polinucleótidos mutantes que comprenden al menos una mutación en la secuencia codificante del polipéptido maduro de cualquiera de las SEC ID nº: 1, 3, 36, 38, respectivamente, donde la secuencia de nucleótidos mutante codifica un polipéptido que consiste en los aminoácidos 1 a 556 de la SEC ID nº: 2 y los aminoácidos 1 a 561 de la SEC ID nº: 37, respectivamente. [0091] Las técnicas usadas para aislar o clonar un polinucleótido que codifica un polipéptido se conocen en la técnica e incluyen aislamiento de ADN genómico, preparación de ADNc o una combinación de los mismos. La clonación de los polinucleótidos de la presente invención de tal ADN genómico puede ser efectuada, por ejemplo, usando la conocida reacción en cadena de polimerasa (PCR) o la selección de anticuerpos de bibliotecas de expresión para detectar fragmentos de ADN clonado con características estructurales compartidas. Ver, por ejemplo, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic press, Nueva York. Otros procedimientos de amplificación de ácido nucleico tales como la reacción en cadena de ligasa (LCR), la transcripción activada ligada (LAT) y la amplificación de nucleótidos basada en secuencias (NASBA) pueden ser utilizados. Los polinucleótidos se pueden clonar de una cepa de los géneros Trametes, Pachykytospora, Leucopaxillus u otros organismos relacionados y así, por ejemplo, pueden ser una variante alélica o de especie del polipéptido que codifica la región de las secuencias de nucleótidos.

[0092] La presente invención también se refiere a polinucleótidos con secuencias de nucleótidos que tienen un grado de identidad con la secuencia codificante del polipéptido maduro de la SEC ID nº: 1 (es decir, los nucleótidos 55 a 2166), o la SEC ID nº: 3 (es decir, los nucleótidos 55 a 1725), o la SEC ID nº: 38 (es decir, los nucleótidos 55 a 1737), respectivamente, de al menos un 90%, más preferiblemente al menos un 95%, incluso más preferiblemente un 96%, incluso más un 97%, incluso más un 98%, y de la forma más preferible al menos un 99% de identidad, los cuales codifican un polipéptido activo. [0093] La modificación de una secuencia de nucleótidos que codifica un polipéptido de la presente invención puede ser necesaria para la síntesis de polipéptidos sustancialmente similares al polipéptido. El término "sustancialmente similar" al polipéptido se refiere a formas no naturales del polipéptido. Estos polipéptidos pueden diferir en alguna forma diseñada del polipéptido que es aislado de su fuente nativa, por ejemplo, variantes artificiales que difieren en actividad específica, termoestabilidad, pH óptimo, o similares. La secuencia variante se puede construir basándose en la secuencia de nucleótidos presentada como la región codificante del polipéptido maduro de cualquiera de las SEC ID nº: 1, 3, 36, 38, respectivamente, por ejemplo, subsecuencias de las mismas, y/o introduciendo sustituciones de nucleótidos, que no dan lugar a otra secuencia de aminoácidos del polipéptido codificado por la secuencia de nucleótidos, pero que corresponden al uso de codón del organismo huésped destinado a la producción de la enzima, o introduciendo sustituciones de nucleótidos que pueden dar lugar a una secuencia de aminoácidos diferente. Para una descripción general de la sustitución de nucleótidos, ver, por ejemplo, Ford et al., 1991, Protein Expression and purification 2: 95-107.

[0094] Será aparente a los expertos en la técnica que tales sustituciones pueden hacerse fuera de las regiones críticas para la función de la molécula y aun así resultar en un polipéptido activo. Residuos de aminoácidos esenciales para la actividad del polipéptido codificados por un polinucleótido aislado de la invención, y por lo tanto preferiblemente no sometidos a sustitución, se pueden identificar según procedimientos conocidos en la técnica, tales como mutagénesis dirigida o mutagénesis por escaneado de alanina (ver, por ejemplo, Cunningham y Wells, 1989, Science 244: 1081-1085). En esta última técnica, las mutaciones se introducen en cada residuo cargado positivamente de la molécula, y las moléculas mutantes resultantes son examinadas con la intención de conocer la actividad de glucoamilasa para identificar los residuos de aminoácidos que son críticos para la actividad de la molécula. Los sitios de interacción enzima-sustrato también pueden ser determinados mediante el análisis de la estructura tridimensional tal como se determina por técnicas tales como el análisis de resonancia magnética nuclear, la cristalografía o el etiquetado por fotoafinidad (ver, por ejemplo, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64). [0095] La presente invención también se refiere a polinucleótidos aislados que codifican un polipéptido de la presente invención, (i) que se hibrida bajo condiciones de astringencia altas, y más preferiblemente condiciones de astringencia muy altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1 o los nucleótidos 55 a 2166 de la SEC ID nº: 36, respectivamente, o (ii) que se hibridan bajo condiciones de astringencia medias, más preferiblemente condiciones de astringencia medias-altas, incluso más preferiblemente condiciones de astringencia altas, y de la forma más preferible condiciones de astringencia muy altas con los nucleótidos de la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3 o los nucleótidos 55 a 1737 de la SEC ID nº: 38, respectivamente, o (iii) una cadena complementaria de (i) o (ii); o variantes alélicas y subsecuencias de las mismas (Sambrook et al., 1989, supra), tal y como se define en este documento. [0096] La presente invención también se refiere a polinucleótidos aislados obtenidos (a) hibridando una población de ADN bajo condiciones de astringencia altas o muy altas con (i) los nucleótidos 55 a 2166 de la SEC ID nº: 1 o los nucleótidos 55 a 2166 de la SEC ID nº: 36, respectivamente, o (ii) hibridando una población de ADN bajo condiciones de astringencia altas o muy altas altísimas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3 o los nucleótidos 55 a 1737 de la SEC ID nº: 38, respectivamente, o (iii) una cadena complementaria de (i) o (ii); y (b) aislando el polinucleótido de hibridación, que codifica un polipéptido que tiene actividad de glucoamilasa.

Constructos de ácidos nucleicos [0097] La presente invención también se refiere a constructos de ácidos nucleicos que comprenden un polinucleótido aislado de la presente invención operativamente enlazado a una o varias secuencias de control que dirigen la expresión de la secuencia codificante en una célula huésped adecuada bajo condiciones compatibles con las secuencias de control. [0098] Un polinucleótido aislado que codifica un polipéptido de la presente invención se puede manipular en una variedad de formas para garantizar la expresión del polipéptido. La manipulación de la secuencia del polinucleótido antes de su inserción en un vector puede ser deseable o necesaria dependiendo del vector de expresión. Las técnicas para modificar secuencias de polinucleótidos que utilizan de métodos de ADN recombinante son bien conocidas en la técnica. [0099] La secuencia de control puede ser una secuencia promotora apropiada, una secuencia de nucleótidos que es reconocida por una célula huésped para la expresión de un polinucleótido que codifica un polipéptido de la presente invención. La secuencia promotora contiene secuencias de control transcripcionales que median en la expresión del polipéptido. El promotor puede ser cualquier secuencia de nucleótidos que muestra actividad transcripcional en la célula huésped de elección incluyendo promotores mutantes, truncados e híbridos, y se pueden obtener de genes que codifican polipéptidos extracelulares o intracelulares tanto homólogos como heterólogos a la célula huésped. Ejemplos de promotores adecuados para dirigir la transcripción de los constructos de ácidos nucleicos de la presente invención en una célula huésped fúngica filamentosa son los promotores obtenidos de los genes para TAKA amilasa de Aspergillus oryzae, proteinasa aspártica de Rhizomucor miehei, alfa-amilasa neutra de Aspergillus niger, alfa-amilasa estable en ácido de Aspergillus niger, glucoamilasa (glaA) de Aspergillus niger o de Aspergillus awamori, lipasa de Rhizomucor miehei, proteasa alcalina de Aspergillus oryzae, triosa fosfato isomerasa de Aspergillus oryzae, acetamidasa de Aspergillus nidulans, glucoamilasa de Fusarium venenatum (WO 00/56900),

Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), proteasa tipo tripsina de Fusarium oxysporum (WO 96/00787), beta-glucosidasa de Trichoderma reesei, celobiohidrolasa I de Trichoderma reesei, endoglucanasa I de Trichoderma reesei, endoglucanasa II de Trichoderma reesei, endoglucanasa III de Trichoderma reesei, endoglucanasa IV de Trichoderma reesei, endoglucanasa V de Trichoderma reesei, xilanasa I de Trichoderma reesei, xilanasa II de Trichoderma reesei, beta-xilosidasa de Trichoderma reesei, así como el promotor NA2-tpi (un híbrido de los promotores de los genes para alfa-amilasa neutra de Aspergillus niger y triosa fosfato isomerasa de Aspergillus oryzae); y promotores mutantes, truncados e híbridos de los mismos. [0100] En un huésped de levadura, los promotores útiles se obtienen de los genes de enolasa (ENO-1) de Saccharomyces cerevisiae, galactoquinasa (GAL1) de Saccharomyces cerevisiae, alcohol deshidrogenasa/gliceraldehído-3-fosfato deshidrogenasa (ADH1,ADH2/GAP) de Saccharomyces cerevisiae, triosa fosfato isomerasa (TPI) de Saccharomyces cerevisiae, metalotionina (CUP1) de Saccharomyces cerevisiae y 3- fosfoglicerato quinasa de Saccharomyces cerevisiae. Otros promotores útiles para células huésped de levadura son descritos por Romanos et al., 1992, Yeast 8: 423-488.

[0101] La secuencia de control también puede ser una secuencia terminadora de transcripción adecuada, una secuencia reconocida por una célula huésped para terminar transcripción. La secuencia terminadora está operativamente enlazada al terminal 3' de la secuencia de nucleótidos que codifica el polipéptido. Cualquier terminador que es funcional en la célula huésped de elección se puede utilizar en la presente invención. [0102] Los terminadores preferidos para células huésped fúngicas filamentosas son obtenidos de los genes para TAKA amilasa de Aspergillus oryzae, glucoamilasa de Aspergillus niger, antranilato sintasa de Aspergillus nidulans, alfa-glucosidasa de Aspergillus niger y proteasa tipo tripsina de Fusarium oxysporum. [0103] Los terminadores preferidos para células huésped de levadura son obtenidos de los genes para enolasa de Saccharomices cerevisiae, citocromo C (CYC1) de Saccharomyces cerevisiae y gliceraldehído-3-fosfato- deshidrogenasa de Saccharomyces cerevisiae. Otros terminadores útiles para las células huésped de levadura son descritos por Romanos et al., 1992, supra. [0104] La secuencia de control también puede ser una secuencia líder adecuada, una región no traducida de un ARNm que es importante para la traducción por la célula huésped. La secuencia líder está operativamente enlazada al terminal 5' de la secuencia de nucleótidos que codifica el polipéptido. Cualquier secuencia líder que sea funcional en la célula huésped de elección se puede utilizar en la presente invención. [0105] Los líderes preferidos para células huésped fúngicas filamentosas son obtenidos de los genes para TAKA amilasa de Aspergillus oryzae y triosa fosfato isomerasa de Aspergillus nidulans.

[0106] Los líderes adecuados para células huésped de levadura son obtenidos de los genes para enolasa (ENO-1) de Saccharomyces cerevisiae, 3-fosfoglicerato quinasa de Saccharomyces cerevisiae, alfa-factor de Saccharomyces cerevisiae y alcohol deshidrogenasa/gliceraldehído-3-fosfato deshidrogenasa (ADH2/GAP) de Saccharomyces cerevisiae.

[0107] La secuencia de control también puede ser una secuencia de poliadenilación, una secuencia operativamente enlazada al terminal 3' de la secuencia de nucleótidos y que, cuando se ha transcrito, es reconocida por la célula huésped como una señal para añadir residuos de poliadenosina al ARNm transcrito. Cualquier secuencia de poliadenilación que es funcional en la célula huésped de elección se puede utilizar en la presente invención.

[0108] Las secuencias de poliadenilación preferidas para células huésped fúngicas filamentosas son obtenidas de los genes para TAKA amilasa de Aspergillus oryzae, glucoamilasa de Aspergillus niger, antranilato sintasa de Aspergillus nidulans, proteasa tipo tripsina de Fusarium oxysporum y alfa-glucosidasa de Aspergillus niger.

[0109] Secuencias de poliadenilación útiles para células huésped de levadura son descritas por Guo y Sherman, 1995, Molecular Cellular Biology 15: 5983-5990. [0110] La secuencia de control también puede ser una región codificante de péptido señal que codifica una secuencia de aminoácidos enlazada al amino-terminal de un polipéptido y que dirige al polipéptido codificado hacia la vía secretora de la célula. El terminal 5' de la secuencia codificante de la secuencia de nucleótidos puede contener intrínsecamente una región codificante de péptido señal naturalmente enlazada en el marco de lectura de traducción con el segmento de la región codificante que codifica el polipéptido segregado. Alternativamente, el terminal 5' de la secuencia codificante puede contener una región codificante del péptido señal que es extranjero a la secuencia codificante. La región codificante del péptido señal extranjera puede ser requerida donde la secuencia codificante no contiene de manera natural una región codificante de péptido señal. Alternativamente, la región codificante de péptido señal extranjera puede simplemente reemplazar la región codificante del péptido señal natural para mejorar la secreción del polipéptido. No obstante, cualquier región codificante de péptido señal que dirige al polipéptido expresado hacia la vía secretora de una célula huésped de elección se puede utilizar en la presente invención. [0111] Regiones codificantes del péptido señal eficaces para células huésped fúngicas filamentosas son las regiones codificantes de péptido señal obtenidas de los genes para TAKA amilasa de Aspergillus oryzae, amilasa neutra de Aspergillus niger, glucoamilasa de Aspergillus niger, proteinasa aspártica de Rhizomucor miehei, celulasa de

Humicola insolens y lipasa Humicola lanuginosa. [0112] Péptidos señal útiles para células huésped de levadura son obtenidos de los genes para alfa-factor de Saccharomices cerevisiae e invertasa de Saccharomyces cerevisiae. Otras regiones codificantes del péptido señal útiles son descritas por Romanos et al., 1992, supra.

[0113] La secuencia de control también puede ser una región codificante de que codifica una secuencia de aminoácidos situada en el amino-terminal de un polipéptido. El polipéptido resultante es conocido como proenzima o propolipéptido (o zimógeno en algunos casos). Un propolipéptido está generalmente inactivo y puede ser convertido en un polipéptido activo maduro por escisión catalítica o autocatalítica del propéptido del propolipéptido. La región codificante de propéptido se puede obtener de los genes para proteasa alcalina (aprE) de Bacillus subtilis, proteasa neutra (nprT) de Bacillus subtilis, alfa-factor de Saccharomyces cerevisiae, proteinasa aspártica de Rhizomucor miehei y lacasa Myceliophthora thermophila (WO 95/33836). [0114] Donde tanto el péptido señal como las regiones de propéptido están presentes en el amino-terminal de un polipéptido, la región de propéptido está situada junto al amino terminal de un polipéptido y la región de péptido señal está situada junto al amino terminal de la región de propéptido. [0115] También puede ser deseable añadir secuencias reguladoras que permitan la regulación de la expresión del polipéptido en relación con el crecimiento de la célula huésped. Ejemplos de sistemas reguladores son aquellos que hacen que la expresión del gen se encienda o se apague en respuesta a un estímulo químico o físico, incluyendo la presencia de un compuesto regulador. En levadura se puede utilizar el sistema ADH2 o el sistema GAL1. En hongos filamentosos, el promotor de TAKA alfa-amilasa, el promotor de glucoamilasa de Aspergillus niger y el promotor de glucoamilasa de Aspergillus oryzae se pueden utilizar como secuencias reguladoras. Otros ejemplos de secuencias reguladoras son aquellos que permiten amplificación génica. En sistemas eucarióticos, estos incluyen el gen de dihidrofolato reductasa que es amplificado en presencia de metotrexato, y los genes de metalotioneína que son amplificados con metales pesados. En estos casos, la secuencia de nucleótidos que codifica el polipéptido estaría operativamente enlazada con la secuencia reguladora. Vectores de expresión [0116] La presente invención también se refiere a vectores de expresión recombinantes que comprenden un polinucleótido de la presente invención, un promotor y señales de parada transcripcional y traduccional. Los diferentes ácidos nucleicos y secuencias de control anteriormente descritos se pueden unir para producir un vector de expresión recombinante que puede incluir uno o varios sitios de restricción convenientes para permitir la inserción o sustitución de la secuencia de nucleótidos que codifica el polipéptido en tales sitios. Alternativamente, una secuencia de nucleótidos de la presente invención se puede expresar insertando la secuencia de nucleótidos o un constructo de ácidos nucleicos que comprenda la secuencia en un vector apropiado para la expresión. En la creación del vector de expresión, la secuencia codificante se localiza en el vector, de modo que la secuencia codificante está operativamente enlazada con las secuencias de control apropiadas para la expresión. [0117] El vector de expresión recombinante puede ser cualquier vector (por ejemplo, un plásmido o un virus) que puede ser convenientemente sometido a procedimientos de ADN recombinante y puede provocar la expresión de la secuencia de nucleótidos. La elección del vector dependerá típicamente de la compatibilidad del vector con la célula huésped en la que el vector va a ser introducido. Los vectores pueden ser plásmidos lineales o circulares cerrados. [0118] El vector puede ser un vector de replicación autónoma, es decir, un vector que existe como una entidad extracromosómica, cuya replicación es independiente de la replicación cromosómica, por ejemplo, un plásmido, un elemento extracromosómico, un minicromosoma o un cromosoma artificial.

El vector puede contener cualquier medio para asegurar la autorreplicación. Alternativamente, el vector puede ser aquel que, cuando se introduce en la célula huésped, es integrado en el genoma y replicado junto con el(los) cromosoma(s) en los que ha sido integrado. Además, se puede utilizar un único vector o plásmido, o dos o más vectores o plásmidos, que juntos contienen el ADN total que va a ser introducido en el genoma de la célula huésped, o un transposón.

[0119] Los vectores de la presente invención preferiblemente contienen uno o varios marcadores seleccionables que permiten la fácil selección de células transformadas. Una etiqueta seleccionable es un gen cuyo producto proporciona resistencia biocida o vírica, resistencia a metales pesados, prototrofia a auxótrofos y similares.

[0120] Ejemplos de marcadores adecuados para células huésped de levadura son ADE2, HIS3, LEU2, LYS2, MET3, TRP1 y URA3. Los marcadores seleccionables para usar en una célula huésped fúngica filamentosa incluyen, pero no se limitan a, amdS (acetamidasa), argB (ornitina-carbamoiltransferasa), bar (fosfonitricina-acetiltransferasa), hph (higromicina-fosfotransferasa), niaD (nitrato-reductasa), pyrG (orotidina-5'-fosfato descarboxilasa), sC (sulfato adeniltransferasa) y trpC (antranilato sintasa), así como equivalentes de las mismas. Se prefieren para usar en una célula de Aspergillus son los genes amdS y pyrG de Aspergillus nidulans o Aspergillus oryzae y el gen bar de Streptomyces hygroscopicus. [0121] Los vectores de la presente invención contienen preferiblemente un(os) elemento(s) que permite(n) la integración del vector en el genoma de la célula huésped o la replicación autónoma del vector en la célula independiente del genoma. [0122] Para la integración en el genoma de la célula huésped, el vector puede depender de la secuencia de polinucleótidos que codifica el polipéptido o cualquier otro elemento del vector para la integración en el genoma mediante recombinación homóloga o no homóloga.

Alternativamente, el vector puede contener secuencias de nucleótidos adicionales para dirigir la integración mediante recombinación homóloga en el genoma de la célula huésped en una(s) ubicación(es) precisa(s) en el(los) cromosoma(s). Para aumentar la probabilidad de integración en una ubicación precisa, los elementos integracionales deberían contener preferiblemente un número suficiente de ácidos nucleicos, como de 100 a 10.000 pares de bases, preferiblemente de 400 a 10.000 pares de bases y de la forma más preferible de 800 a 10.000 pares de bases, que tengan un alto grado de identidad con la secuencia diana correspondiente para mejorar la probabilidad de recombinación homóloga. Los elementos integracionales pueden ser cualquier secuencia homóloga a la secuencia diana en el genoma de la célula huésped. Además, los elementos integracionales pueden ser secuencias de nucleótidos codificantes o no codificantes. Por otro lado, el vector se puede integrar en el genoma de la célula huésped mediante recombinación no homóloga. [0123] Para la replicación autónoma, el vector puede comprender adicionalmente un origen de replicación que habilita al vector para replicarse de manera autónoma en la célula huésped en cuestión. El origen de replicación puede ser cualquier replicador del plásmido que media en la replicación autónoma que funciona en una célula. El término "origen de replicación" o "replicador del plásmido" se define en este documento como una secuencia de nucleótidos que habilita a un plásmido o vector para replicarse in vivo. [0124] Ejemplos de orígenes de replicación para usar en una célula huésped de levadura son el origen de replicación de 2 micras, ARS1, ARS4, la combinación de ARS1 y CEN3, y la combinación de ARS4 y CEN6.

[0125] Ejemplos de orígenes de replicación útiles en una célula fúngica filamentosa son AMA1 y ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15: 9163-9175; WO 00/24883). Se puede lograr el aislamiento del gen AMA1 y la construcción de plásmidos o vectores que comprenden el gen según los métodos descritos en WO 00/24883.

[0126] Se puede insertar más de una copia de un polinucleótido de la presente invención en la célula huésped para aumentar la producción del producto génico. Un aumento en el número de copias del polinucleótido puede ser obtenido integrando al menos una copia adicional de la secuencia en el genoma de la célula huésped o incluyendo un gen marcador seleccionable amplificable con el polinucleótido donde las células que contienen copias amplificadas del gen marcador seleccionable, y por ello copias adicionales del polinucleótido, se pueden seleccionar cultivando las células en presencia del agente seleccionable apropiado. [0127] Los procedimientos usados para enlazar los elementos anteriormente descritos para construir los vectores de expresión recombinantes de la presente invención son conocidos para los expertos en la técnica (ver, por ejemplo, Sambrook et al., 1989, supra). Células huésped [0128] La presente invención se refiere también a células huésped recombinantes, que comprenden un polinucleótido de la presente invención, las cuales se usan favorablemente en la producción recombinante de polipéptidos. Un vector que comprende un polinucleótido de la presente invención se introduce en una célula huésped de modo que el vector se mantiene como un integrante cromosómico o como un vector extracromosomal autorreplicante tal y como se ha descrito anteriormente. El término "célula huésped" abarca cualquier descendiente de una célula madre que no es idéntica a la célula madre debido a mutaciones que ocurren durante la replicación.La elección de una célula huésped dependerá en gran parte del gen que codifica el polipéptido y su fuente. [0129] La célula huésped puede ser un eucariota, tal como una célula de mamífero, insecto, planta o fúngica. [0130] En un aspecto preferido, la célula huésped es una célula fúngica. "Hongos" tal como se utiliza en este documento incluye los fila Ascomycota, Basidiomycota, Chytridiomycota y Zigomycota (según es definido por Hawkswort et al., In, Ainswort and Bisby´s Dictionary of Fungi, 8ª edición, 1995, CAB international, University Press, Cambridge, UK) así como los Oomycota (como se cita en Hawkswort et al., 1995, supra, página 171) y todos los hongos mitospóricos (Hawkswort et al., 1995, supra).

[0131] En un aspecto más preferido, la célula huésped fúngica es una célula de levadura. "Levadura" como se utiliza en este documento incluye levadura ascoesporógena (Endomycetales), levadura basidiosporógena y levadura perteneciente a los Fungi Imperfecti (Blastomycetes). Ya que la clasificación de levadura puede cambiar en el futuro, a efectos de esta invención, la levadura debe ser definida como se describe en Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M. y Davenport, R.R., eds, Soc. App. Bacteriol. Symposium Series n°. 9,1980).

[0132] Incluso en un aspecto más preferido, la célula huésped de levadura es una célula de Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces o Yarrowia. [0133] En un aspecto más preferido, la célula huésped de levadura es una célula de Saccharomyces carlsbergensis,

Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis o Saccharomyces oviformis. En otro aspecto más preferido, la célula huésped de levadura es una célula de Kluyveromyces lactis. En otro aspecto más preferido, la célula huésped de levadura es una célula de Yarrowia lipolytica. [0134] En otro aspecto más preferido, la célula huésped fúngica es una célula fúngica filamentosa. "Fúngica filamentosa" incluye todas las formas filamentosas de la subdivisión Eumycota y Oomycota (según es definido por Hawkswort et al., 1995, supra). Los hongos filamentosos se caracterizan generalmente por una pared micelial compuesta por quitina, celulosa, glucano, quitosano, manano y otros polisacáridos complejos. El crecimiento vegetativo es mediante alargamiento hifal y el catabolismo de carbono es estrictamente aeróbico. En cambio, el crecimiento vegetativo por levaduras tales como Saccharomyces cerevisiae es mediante injerto de un talo unicelular y el catabolismo de carbono puede ser fermentativo. [0135] En un aspecto incluso más preferido, la célula huésped fúngica filamentosa es una célula de Acremonium, Aspergillus, Aureobasidium, ceripoandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filiobasidium,

Fusarium, Humicola,

Magnaporthe, Mucor,

Myceliophthora,

Neocallimastix,

Neurospora,

Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolipocladium, Trametes o Trichoderma. [0136] En un aspecto más preferido, la célula huésped fúngica filamentosa es una célula de Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger o

Aspergillus oryzae. En otro aspecto más preferido, la célula huésped fúngica filamentosa es una célula de Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides o Fusarium venenatum. En otro aspecto más preferido, la célula huésped fúngica filamentosa es una célula de cepa de Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, o Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum,

Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei o Trichoderma viride. [0137] Las células fúngicas se pueden transformar por un proceso que implica formación de protoplastos, transformación de los protoplastos y regeneración de la pared celular de una manera conocida per se. Procedimientos adecuados para la transformación de células huésped de Aspergillus y Trichoderma se describen en EP 238 023 y Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Métodos Adecuados para transformar especies de Fusarium son descritos por Malardier et al., 1989, Gene 78: 147-156 y WO 96/00787. La levadura se puede transformar utilizando los procedimientos descritos por Becker y Guarente, en Abelson, J.N. y Simon, M.I., editores, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, volumen 194, págs 182-187, Academic Press, Inc., Nueva York; Ito et al., 1983, Journal of Bacteriology 153: 163; y Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920. Métodos de producción [0138] La presente invención también se refiere a métodos para producir un polipéptido de la presente invención, que comprenden (a) cultivar una célula, que en su forma tipo salvaje es capaz de producir el polipéptido, bajo condiciones propicias para la producción del polipéptido; y (b) recuperar el polipéptido. Preferiblemente, la célula es del género Trametes, preferiblemente Trametes cingulata. [0139] La presente invención también se refiere a métodos para producir un polipéptido de la presente invención, que comprenden (a) cultivar una célula huésped bajo condiciones propicias para la producción del polipéptido; y (b) recuperar el polipéptido. [0140] La presente invención también se refiere a métodos para producir un polipéptido de la presente invención, que comprenden (a) cultivar una célula huésped bajo condiciones propicias para la producción del polipéptido, donde la célula huésped comprende una secuencia de nucleótidos que tiene la región codificante del polipéptido maduro de las SEC ID nº: 1, 3, 36, 38, respectivamente, donde la secuencia de nucleótidos codifica un polipéptido que consiste en los aminoácidos 1 a 556 de la SEC ID nº: 2 o aminoácidos 1 a 561 de la SEC ID nº: 37, respectivamente, y (b) recuperar el polipéptido.

[0141] En los métodos de producción de la presente invención, las células se cultivan en un medio nutritivo adecuado para la producción del polipéptido usando métodos bien conocidos en la técnica. Por ejemplo, la célula se puede cultivar mediante cultivo en matraz de agitación, y fermentación a pequeña escala o a gran escala (incluyendo fermentación continua, por lote, lote alimentado o de estado sólido) en fermentadores de laboratorio o industriales realizadas en un medio adecuado y bajo condiciones que permitan al polipéptido ser expresado y/o aislado. El cultivo tiene lugar en un medio nutritivo adecuado que comprende fuentes de nitrógeno y carbono y sales inorgánicas, usando procedimientos conocidos en la técnica. Los medios adecuados están disponibles en proveedores comerciales o se pueden preparar según composiciones publicadas (por ejemplo, en los catálogos de la American Type Culture Collection). Si el polipéptido se segrega en el medio nutritivo, el polipéptido puede ser recuperado directamente del medio. Si el polipéptido no es segregado, puede ser recuperado de lisados celulares.

[0142] Los polipéptidos se pueden detectar usando métodos conocidos en la técnica que son específicos para los polipéptidos. Estos métodos de detección pueden incluir uso de anticuerpos específicos, formación de un producto enzimático, o desaparición de un sustrato enzimático. Por ejemplo, un ensayo enzimático se puede utilizar para determinar la actividad del polipéptido tal y como se describe en este documento.

[0143] El polipéptido resultante se puede recuperar usando métodos conocidos en la técnica. Por ejemplo, el polipéptido se puede recuperar del medio nutritivo por procedimientos convencionales incluyendo, pero no limitándose a, centrifugado, filtración, extracción, secado por pulverización, evaporación o precipitación. [0144] Los polipéptidos de la presente invención pueden ser purificados mediante una variedad de procedimientos conocidos en la técnica incluyendo, pero no limitándose a, cromatografía (por ejemplo, intercambio iónico, afinidad, hidrofóbica cromatoenfoque y exclusión de tamaño), procedimientos electroforéticos (por ejemplo, isoelectroenfoque preparativo), solubilidad diferencial (por ejemplo, precipitación de sulfato amónico), SDS-PAGE, o extracción (ver, por ejemplo, Protein Purification, J.-C. Janson y Lars Ryden, Editors, VCH Publishers, Nueva York, 1989).

Composiciones [0145] La presente invención también se refiere a composiciones que comprenden un polipéptido de la presente invención. Preferiblemente, las composiciones son enriquecidas con tal polipéptido. El término "enriquecidas" indica que la actividad de glucoamilasa de la composición ha sido aumentada, por ejemplo, por un factor de enriquecimiento de 1,1. [0146] La composición puede comprender un polipéptido de la presente invención como componente enzimático principal, por ejemplo, una composición monocomponente. Alternativamente, la composición puede comprender múltiples actividades enzimáticas, tales como aminopeptidasa, amilasa, carbohidrasa, carboxipeptidasa, catalasa, celulasa, quitinasa, cutinasa, ciclodextrina glucosiltransferasa, desoxirribonucleasa, esterasa, alfa-galactosidasa, beta-galactosidasa, glucoamilasa, alfa-glucosidasa, beta-glucosidasa, haloperoxidasa, invertasa, lacasa, lipasa, manosidasa, oxidasa, enzima pectinolítica, peptidoglutaminasa, peroxidasa, fitasa, polifenoloxidasa, enzima proteolítica, ribonucleasa, transglutaminasa o xilanasa. La(s) enzima(s) adicional(es) puede(n) ser producida(s), por ejemplo, por un microorganismo del género Aspergillus, preferiblemente Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger o Aspergillus oryzae; Fusarium, preferiblemente Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium toruloseum, Fusarium trichothecioides o Fusarium venenatum; Humicola, preferiblemente Humicola insolens o Humicola lanuginosa; o Trichoderma, preferiblemente Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei o Trichoderma viride. [0147] Las composiciones de polipéptido pueden ser preparadas conforme a métodos conocidos en la técnica y pueden estar en forma de composición líquida o seca. Por ejemplo, la composición polipeptídica puede estar en forma de un granulado o un microgranulado. El polipéptido que va a ser incluido en la composición puede ser estabilizado conforme a métodos conocidos en la técnica. Una combinación de glucoamilasa y alfa-amilasa ácida [0148] Según este aspecto de la invención una glucoamilasa de la invención se puede combinar con una alfa- amilasa ácida en una proporción de entre 0,3 y 5,0 AFAU/AGU. Más preferiblemente la proporción entre la actividad de alfa-amilasa ácida y la actividad de glucoamilasa es al menos 0,35, al menos 0,40, al menos 0,50, al menos 0,60, al menos 0,7, al menos 0,8, al menos 0,9, al menos 1,0, al menos 1,1, al menos 1,2, al menos 1,3, al menos 1,4, al menos 1,5, al menos 1,6, al menos 1,7, al menos 1,8, al menos 1,85, o incluso al menos 1,9 AFAU/AGU. No obstante, la proporción entre la actividad de alfa-amilasa ácida y la actividad de glucoamilasa debería preferiblemente ser menor que 4,5, menor que 4,0, menor que 3,5, menor que 3,0, menor que 2,5 o incluso menor que 2,25 AFAU/AGU. En AUU/AGI las actividades de alfa-amilasa ácida y glucoamilasa están preferiblemente presentes en una proporción de entre 0,4 y 6,5 AUU/AGI. Más preferiblemente la proporción entre actividad de alfa- amilasa ácida y actividad de glucoamilasa es al menos 0,45, al menos 0,50, al menos 0,60, al menos 0,7, al menos 0,8, al menos 0,9, al menos 1,0, al menos 1,1, al menos 1,2, al menos 1,3, al menos 1,4, al menos 1,5, al menos 1,6, al menos 1,7, al menos 1,8, al menos 1,9, al menos 2,0, al menos 2,1, al menos 2,2, al menos 2,3, al menos 2,4 o incluso al menos 2,5 AUU/AGI. No obstante, la proporción entre la actividad de alfa-amilasa ácida y la actividad de glucoamilasa es preferiblemente menor que 6,0, menor que 5,5, menor que 4,5, menor que 4,0, menor que 3,5 o incluso menor que 3.0 AUU/AGI.

[0149] La composición anterior es adecuada para usarse en un proceso de conversión de almidón mencionado más adelante para producir jarabe y productos de fermentación tales como el etanol. [0150] Más adelante se dan ejemplos de usos preferidos para las composiciones de polipéptido de la invención. La dosificación de la composición de polipéptido de la invención y otras condiciones bajo las que se usa la composición pueden ser determinadas basándose en métodos conocidos en la técnica. Combinación de glucoamilasa de Trametes cingulata con otra glucoamilasa y una alfa-amilasa ácida [0151] Se ha descubierto que la glucoamilasa de Trametes cingulata de la invención tiene de 4-7 veces mayor actividad desramificante de alfa-1,6 que otras glucoamilasas, tales como Athelia rolfsii, Aspergillus niger y Talaromyces emersonii (véase ejemplo 12). [0152] Por lo tanto, según la invención, la glucoamilasa de Trametes cingulata se puede combinar con alfa-amilasa ácida y además otra glucoamilasa. Tal combinación de enzimas sería adecuada en procesos que comprenden conversión de almidón, incluyen producción de etanol, incluyendo procesos de fermentación en una etapa. [0153] La alfa-amilasa puede ser cualquier alfa-amilasa. En una realización preferida la alfa-amilasa es cualquiera de las enumeradas en la sección "alfa-amilasa" más adelante. En una realización preferida la alfa-amilasa es una alfa- amilasa fúngica, especialmente aquellas descritas más adelante en la sección "alfa-amilasas fúngicas", especialmente la alfa-amilasa de Aspergillus kawachii. Se prefiere también alfa-amilasas híbridas descritas más adelante en la sección "alfa-amilasas fúngicas híbridas", incluyendo híbridos descritos en la publicación de patente EE.UU. nº 2005/0054071 (se contemplan especialmente los híbridos enumerados en la tabla 3), y además los híbridos descritos en la solicitud co-pendiente EE.UU. nº 60/638.614, incluyendo especialmente la variante de fungamil con dominio catalítico JA118 y SBD de Athelia rolfsii (SEC ID nº: 28 en este documento y SEC ID nº: 100 en EE.UU. 60/638,614); la alfa-amilasa de Rhizomucor pusillus con el enlazador AMG y SBD de Athelia rolfsii (SEC ID nº: 29 en este documento y SEC ID nº: 101 en la solicitud EE.UU. nº 60/638,614); y alfa-amilasa de Meripilus giganteus con enlazador de glucoamilasa y SBD de Athelia rolfsii (SEC ID nº: 30 en este documento y SEC ID nº: 102 en la solicitud EE.UU. nº 60/638,614).

[0154] La glucoamilasa puede ser cualquier glucoamilasa, incluyendo glucoamilasas de origen fúngico o bacteriano seleccionadas del grupo que consiste en glucoamilasas de Aspergillus, en particular glucoamilasas de A. niger G1 o G2 (Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102), o variantes de las mismas, tales como las descritas en WO 92/00381, WO 00/04136 y WO 01/04273 (de Novozymes, Dinamarca); la glucoamilasa de A. awamori (WO 84/02921), A. oryzae (Agric. Biol. Chem. (1991), 55 (4), p. 941-949), o variantes o fragmentos de las mismas. Otras variantes de glucoamilasa de Aspergillus incluyen variantes para mejorar la termoestabilidad: G137A y G139A (Chen et al. (1996), Prot. Eng. 9,499- 505); D257E y D293E/Q (Chen et al. (1995), Prot. Eng. 8,575-582); N182 (Chen et al. (1994), Biochem. J. 301,275-281); enlaces de disulfuro, A246C (Fierobe et al. (1996), Biochemistry, 35,8698- 8704); e introducción de Pro residuos en las posiciones A435 y S436 (Li et al. (1997), Protein Eng. 10,1199-1204. Otras glucoamilasas incluyen la glucoamilasa de Corticium rolfsii (patente EE.UU. nº 4.727.046) también denominada glucoamilasa de Athelia rolfsii, Talaromyces, en particular, obtenidas de Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (patente EE.UU. nº Re. 32.153),Talaromyces duponti, Talaromyces thermophilus (patente EE.UU. nº 4.587.215), Rhizopus nivius (por ejemplo la enzima disponible por Shin Nihon Chemicals, Japón, bajo el nombre comercial "CU CONC",) Humicola grisea var. thermoidea (por ejemplo ATCC 16453, NRRL 15222, NRRL 15223, NRRL 15224, NRRL 15225).

[0155] Las glucoamilasas bacterianas contempladas incluyen glucoamilasas del género Clostridium, en particular C. thermoamylolyticum (EP 135,138) y C. thermohydrosulfuricum (WO 86/01831). [0156] Ejemplos de composiciones disponibles comercialmente que comprenden otra glucoamilasa incluyen AMG 200L; AMG 300 L; SAN™ SUPER, SAN™ EXTRA L, SPIRIZYME™ PLUS, SPIRIZYME™ FUEL, SPIRIZYME™ B4U y AMG™ E (de Novozymes A/S); OPTIDEX™ 300 (de Genencor Int.); AMIGASE™ y AMIGASE™ PLUS (de DSM); G-ZYME™ G900, g- ZYME™ y G990 ZR (de Genencor Int.). [0157] En una realización específica la glucoamilasa de Trametes cingulata de la invención se combina con una glucoamilasa obtenida de una de las alfa-amilasas de Aspergillus niger, Athelia rolfsii, o Talaromyces emersonii y Rhizomucor pusillus con el enlazador AMG de Athelia rolfsii y SBD (SEC ID nº: 29 en este documento y SEC ID nº: 101 en la solicitud EE.UU. nº 60/638.614). Usos [0158] La presente invención es también destinada a procesos/métodos para usar los polipéptidos que tienen actividad de glucoamilasa de la invención. [0159] Los usos según la invención incluyen la conversión de almidón en, por ejemplo, jarabe y productos de fermentación, incluyendo etanol y bebidas. Los ejemplos de procesos donde se puede usar una glucoamilasa de la invención incluyen aquellos descritos en: WO 2004/081193, WO 2004/080923, WO 2003/66816, WO 2003/66826, y WO 92/20777. Elaboración de productos de fermentación Procesos para elaborar productos de fermentación a partir de material gelatinizado que contiene almidón [0160] En este aspecto la presente invención se refiere a un procedimiento para generar un producto de fermentación, especialmente etanol, de un material que contiene almidón, que incluye un paso de licuefacción y sacarificación realizada separada o simultáneamente y paso(s) de fermentación.

[0161] La invención se refiere a un procedimiento para generar un producto de fermentación de un material que contiene almidón que incluye las etapas de: 1. (a) licuefacción del material que contiene almidón en presencia de una alfa-amilasa; 2. (b) sacarificación del material licuado obtenido en el paso (a) utilizando una glucoamilasa de la invención; 3. (c) fermentación del material sacarificado usando un organismo fermentador. [0162] El producto de fermentación, especialmente como el etanol, puede opcionalmente ser recuperado después de la fermentación, por ejemplo, mediante destilación. Materias primas adecuadas que contienen almidón se enumeran en la sección "Materiales que contienen almidón" más adelante. Las enzimas que se contemplan son enumeradas en la sección "Enzimas" más adelante. La fermentación es llevada a cabo preferiblemente en presencia de levadura, preferiblemente una cepa de Saccharomyces. Organismos de fermentación adecuados se enumeran en la sección "Organismos de fermentación" más adelante. En una realización preferida los pasos (b) y (c) se realizan simultáneamente (proceso SSF). [0163] En una realización particular, el proceso de la invención comprende además, antes del paso (a), los pasos de: X) reducir el tamaño de partícula del material que contiene almidón, preferiblemente mediante molienda; Y) formar una pasta que incluya el material que contiene almidón y agua. [0164] La pasta acuosa puede contener de 10-40 % en peso, preferiblemente de 25-35 % en peso del material que contiene almidón. La pasta es calentada por encima de la temperatura de gelatinización y se puede añadir alfa- amilasa, preferiblemente alfa-amilasa bacteriana y/o ácida fúngica, para iniciar la licuefacción (aclarado). La pasta puede, en una realización, ser cocida a chorro para gelatinizarla más antes de ser sometida a una alfa-amilasa en el paso (a) de la invención. [0165] Más específicamente la licuefacción se puede realizar como un proceso de pasta caliente de tres pasos. La pasta se calienta hasta 60-95°C, preferiblemente de 80-85°C, y se añade alfa-amilasa para iniciar la licuefacción (aclarado). Luego la pasta se puede cocer a chorro a una temperatura entre 95-140°C, Preferiblemente 105-125°C, durante 1-15 minutos, preferiblemente durante 3-10 minutos, especialmente alrededor de 5 minutos. La pasta se enfría hasta 60-95°C y se añade más alfa-amilasa para finalizar hidrólisis (licuefacción secundaria). El proceso de licuefacción se realiza normalmente a pH 4,5-6,5, en particular a un pH entre 5 y 6. Los granos enteros molidos y licuados se conocen como masa. [0166] La sacarificación en el paso (b) se puede llevar a cabo usando condiciones bien conocidas en la técnica. Por ejemplo, un proceso de sacarificación completo puede llegar a durar aproximadamente de 24 a 72 horas, no obstante, es común hacer solo una pre-sacarificación de típicamente 40-90 minutos a una temperatura entre 30- 65°C, típicamente alrededor de 60°C, seguida de sacarificación completa durante la fermentación en un proceso de sacarificación y fermentación simultáneas (SSF). La sacarificación se lleva a cabo típicamente a temperaturas de 30- 65°C, típicamente alrededor de 60°C, y a un pH entre 4 y 5, normalmente alrededor de pH 4,5. [0167] El proceso más ampliamente usado en la producción de etanol es el proceso de sacarificación y fermentación simultáneas (SSF), donde no hay etapa de retención para la sacarificación, lo que significa que el organismo fermentador, tal como la levadura, y la(s) enzima(s) se pueden mezclar. Cuando se hace SSF es común introducir un paso de pre-sacarificación a una temperatura por encima de 50°C, justo antes de la fermentación. [0168] Conforme a la presente invención el paso de fermentación (c) incluye, sin limitación, procesos de fermentación usados a producir alcoholes (por ejemplo, etanol, metanol, butanol); ácidos orgánicos (por ejemplo, ácido cítrico, ácido acético, ácido itacónico, ácido láctico, ácido glucónico); cetonas (por ejemplo, acetona); aminoácidos (por ejemplo, ácido glutámico); gases (por ejemplo, H2 y CO2); antibióticos (por ejemplo, penicilina y tetraciclina); enzimas; vitaminas (por ejemplo, riboflavina, B12, beta-caroteno); y hormonas. Los procesos de fermentación preferidos incluyen procesos de fermentación alcohólicos, puesto que son bien conocidos en la técnica. Los procesos de fermentación preferidos son procesos de fermentación anaeróbicos, puesto que son bien conocidos en la técnica.

Procesos para elaborar productos de fermentación a partir de materiales no gelatinizados que contienen almidón [0169] En este aspecto la invención se refiere a procesos para elaborar un producto de fermentación a partir de material que contiene almidón sin gelatinización del mismo. En una realización solo una glucoamilasa de la invención se usa durante la sacarificación y la fermentación. Según la invención, el producto de fermentación deseado, tal como el etanol, se puede producir sin licuefacción de la pasta acuosa que incorpora el material que contiene almidón. En una realización, un proceso de la invención incluye material sacarificante molido por debajo de la temperatura de gelatinización en presencia de una glucoamilasa de la invención para producir azúcares que pueden ser fermentadas por un organismo fermentador adecuado para obtener el producto de fermentación deseado. [0170] Los ejemplos 7 y 8 más adelante describen la producción de etanol a partir maíz molido (sin cocinar) no gelatinizado usando glucoamilasas de la invención derivadas de Trametes cingulata y Pachykytospora papyracea.

Ambas glucoamilasas muestran cantidades de etanol significativamente más altas en comparación con los procesos correspondientes llevados a cabo usando glucoamilasas obtenidas de Aspergillus niger o Talaromyces emersonii, respectivamente. [0171] Por consiguiente, en este aspecto la invención se refiere a un procedimiento para elaborar un producto de fermentación a partir de un material que contiene almidón, que comprende: 1. (a) sacarificar un material que contiene almidón con una glucoamilasa que tiene 1. i) la secuencia que se muestra como los aminoácidos 1 a 556 en la SEC ID nº: 2 o los aminoácidos 1 a 561 en la SEC ID nº: 37, o una glucoamilasa con al menos un 90% de identidad con ellas, a una temperatura inferior a la temperatura de gelatinización inicial de dicho material que contiene almidón, 2. (b) fermentar utilizando un organismo fermentador. [0172] Los pasos (a) y (b) del proceso de la invención se puede realizar consecutivamente o simultáneamente.

[0173] El término "temperatura de gelatinización inicial" designa la temperatura mínima a la que comienza la gelatinización del almidón. El almidón calentado en agua empieza a gelatinizarse entre 50°C y 75°C; la temperatura exacta de gelatinización depende del almidón específico y puede ser fácilmente determinada por aquel que sea experto en la materia. Así, la temperatura de gelatinización inicial puede variar según la especie de la planta, la variedad particular de la especie de la planta así como las condiciones de crecimiento. En el contexto de esta invención la temperatura de gelatinización inicial de un material dado que contiene almidón es la temperatura a la que la birrefringencia se pierde en el 5% de los gránulos de almidón usando el método descrito por Gorinstein. S. y Lii. C., Starch/stärke, Vol. 44 (12) págs. 461-466 (1992). [0174] Antes del paso (a) se puede preparar una pasta del material que contiene almidón, tal como el almidón granulado, que tiene un 20-55 % en peso sólido seco, preferiblemente un 25-40 % en peso sólido seco, más preferiblemente un 30-35% sólido seco de material que contiene almidón. La pasta puede incluir agua y/o aguas de proceso, tal como vinaza (agua de proceso), agua de lavado, condensado de evaporador o destilado, agua de decapante lateral de destilación, u otra agua de proceso de una planta de producto de fermentación. Debido a que el proceso de la invención se realiza una temperatura por debajo de la de gelatinización y por tanto no tiene lugar ningún aumento de viscosidad significativo, se pueden usar niveles altos de vinaza si se desea. En una realización la pasta acuosa contiene de aproximadamente el 1 a aproximadamente el 70 % en volumen de vinaza, preferiblemente 15-60% en volumen de vinaza, especialmente de aproximadamente 30 a 50 % en volumen de vinaza. [0175] El material que contiene almidón se puede preparar reduciendo el tamaño de partícula, preferiblemente por molienda, de 0,05 a 3,0 mm, preferiblemente de 0,1-0,5 mm. Después de ser sometido a un proceso de la invención al menos un 85%, al menos un 86%, al menos un 87%, al menos un 88%, al menos un 89%, al menos un 90%, al menos un 91%, al menos un 92%, al menos un 93%, al menos un 94%, al menos un 95%, al menos un 96%, al menos un 97%, al menos un 98%, o preferiblemente al menos un 99% de los sólidos secos del material que contiene almidón se convierte en un hidrolizado de almidón soluble.

[0176] El proceso de la invención es conducido a una temperatura inferior a la temperatura de gelatinización inicial. Preferiblemente la temperatura a la que el paso (a) se realiza está entre 30- 75°C, preferiblemente entre 45-60°C. [0177] En una realización preferida el paso (a) y el paso (b) se realizan como un proceso de sacarificación y fermentación simultáneas. En tal realización preferida el proceso es típicamente conducido a una temperatura entre 28°C y 36°C, tal como entre 29°C y 35°C, tal como entre 30°C y 34°C o tal como alrededor de 32°C. Según la invención la temperatura se puede ajustar subiéndola o bajándola durante la fermentación. [0178] En una realización se lleva a cabo sacarificación y fermentación simultáneas de modo que el nivel de azúcar, tal como el nivel de glucosa, se mantiene a un nivel bajo, tanto como por debajo del 6 % en peso, preferiblemente por debajo de aproximadamente el 3 % en peso, preferiblemente por debajo de aproximadamente el 2 % en peso, más preferido por debajo de aproximadamente el 1 % en peso, más preferido incluso por debajo de aproximadamente el 0,5%, o más preferido incluso el 0,25% en peso, tal como por debajo de aproximadamente el 0,1 % en peso. Bajos niveles de azúcar tales como estos se pueden lograr simplemente utilizando cantidades ajustadas de enzima y organismo fermentador. Un experto en la técnica puede fácilmente determinar qué cantidades de enzima y organismo fermentador hay que usar. Las cantidades empleadas de enzima y organismo fermentador también se pueden seleccionar para mantener concentraciones bajas de maltosa en el caldo de fermentación. Por ejemplo, el nivel de maltosa se puede mantener por debajo de aproximadamente un 0,5 % en peso o por debajo de aproximadamente un 0,2 % en peso.

[0179] El proceso de la invención puede ser llevado a cabo con un pH en el rango entre 3 y 7, preferiblemente pH entre 3,5 y 6, o más preferiblemente pH entre 4 y 5. Materiales que contienen almidón [0180] Cualquier materia prima adecuada que contiene almidón, incluyendo almidón granulado, se puede utilizar según la presente invención. La materia prima es generalmente seleccionada basándose en el producto de fermentación deseado. Ejemplos de materias primas que contienen almidón, adecuados para usar en un proceso de la presente invención, incluyen tubérculos, raíces, tallos, granos enteros, granos de maíz, mazorcas, trigo, cebada, centeno, sorgo, sagú, mandioca, tapioca, sorgo, guisantes, arroz, alubias, o patatas dulces, o mezclas de las mismas, o cereales, materias primas que contienen azúcar, tales como melaza, materiales de fruta, azúcar de caña o remolacha azucarera, patatas, y materiales que contienen celulosa, tales como madera o residuos de plantas, o mezclas de los mismos. Se contemplan maíz y cebada tanto de tipo ceroso como no ceroso. [0181] El término "almidón granular" significa almidón crudo sin cocinar, es decir, almidón en su forma natural encontrado en cereales, tubérculos o granos. El almidón se forma dentro de células vegetales como pequeños gránulos insolubles en agua. Cuando se ponen en agua fría, los gránulos de almidón pueden absorber una pequeña cantidad del líquido e hincharse. A temperaturas hasta 50°C a 75°C la inflamación puede ser reversible. No obstante, con temperaturas más altas empieza una inflamación irreversible llamada "gelatinization". El almidón granulado que va a ser procesado puede tener una calidad altamente refinada de almidón, preferiblemente al menos un 90%, al menos un 95%, al menos un 97% o al menos un 99,5% puro, o puede ser un almidón más crudo con material que comprende grano entero molido incluyendo fracciones no amiláceos tales como residuos de gérmenes y fibras. La materia prima, como por ejemplo el grano entero, se muele en orden para descubrir la estructura y permitir procesado adicional. Se prefieren dos procesos de molienda según la invención: molienda en húmedo y en seco. En la molienda en seco se muelen y se usan granos enteros. La molienda en húmedo da lugar a una buena separación entre los gérmenes y la comida (gránulos de almidón y proteína) y se aplica con frecuencia en sitios donde el hidrolizado de almidón es usado para la producción de jarabes. La molienda tanto en húmedo como en seco es bien conocida en la técnica del procesado de almidón y se contempla igualmente para el proceso de la invención.

[0182] El material que contiene almidón se reduce en tamaño, preferiblemente mediante molienda, para exponer más área de superficie. En una realización el tamaño de partícula está entre 0,05 y 3,0 mm, preferiblemente 0,1-0,5 mm o de modo que al menos un 30%, preferiblemente al menos un 50%, más preferiblemente al menos un 70%, incluso más preferiblemente al menos un 90% del material de molienda que contiene almidón molido pase a través de un tamiz con 0,05 a 3,0 mm de tamaño de selección, preferiblemente 0,1-0,5 mm de tamaño de selección.

Productos de fermentación [0183] El término "producto de fermentación" significa un producto elaborado mediante un proceso que incluye un paso de fermentación que utiliza un organismo fermentador. Los productos de fermentación contemplados según la invención incluyen alcoholes (por ejemplo, etanol, metanol, butanol); ácidos orgánicos (por ejemplo, ácido cítrico, ácido acético, ácido itacónico, ácido láctico, ácido glucónico); cetonas (por ejemplo, acetona); aminoácidos (por ejemplo, ácido glutámico); gases (por ejemplo, H2 y CO2); antibióticos (por ejemplo, penicilina y tetraciclina); enzimas; vitaminas (por ejemplo, riboflavina, B12, beta-caroteno); y hormonas. En una realización preferida el producto de fermentación es etanol, por ejemplo, etanol combustible; etanol para bebidas, es decir, licores neutros potables; o etanol industrial o productos usados en la industria del alcohol consumible (por ejemplo, cerveza y vino), industria lechera (por ejemplo, productos lácteos fermentados), industria del cuero e industria del tabaco. Los tipos preferidos de cerveza comprenden cerveza inglesa de malta, cerveza negra, cerveza porter, cerveza rubia, amarga, licores de malta, cerveza happoushu, cerveza de alta graduación, cerveza de baja graduación, cerveza baja en calorías o cerveza sin alcohol. Los procesos de fermentación preferidos usados incluyen procesos de fermentación alcohólicos, puesto que son bien conocidos en la técnica. Los procesos de fermentación preferidos son procesos de fermentación anaeróbicos, puesto que se conocen bien en la técnica. Organismos de fermentación [0184] "Organismo de fermentación" se refiere a cualquier organismo, incluyendo organismos bacterianos y fúngicos, adecuado para usar en un proceso de fermentación y capaz de producir un producto de fermentación deseado. Los organismos de fermentación especialmente adecuados son capaces de fermentar, es decir, convertir azúcares, tales como glucosa o maltosa, directa o indirectamente en el producto de fermentación deseado. Los ejemplos de organismos de fermentación incluyen organismos fúngicos, tales como levadura. La levadura preferida incluye cepas de Saccharomyces spp., en particular, Saccharomyces cerevisiae. La levadura disponible comercialmente incluye, por ejemplo, Red Star™/Lesaffre etanol rojo (disponible en Red Star/Lesaffre, EE.UU.) FALI (disponible en Fleischmann's Yeast, una división de Burns Philp Food Inc., EE.UU.), SUPERSTART (disponible en Alltech), GERT STRAND (disponible en Gert Strand, AB Suecia) y FERMIOL (disponible en DSM Specialties). Enzimas Glucoamilasa [0185] La glucoamilasa es preferiblemente una glucoamilasa de la invención. No obstante, como se ha mencionado anteriormente una glucoamilasa de la invención también se puede combinar con otras glucoamilasas.

[0186] La glucoamilasa puede ser añadida en una cantidad de 0,001 a 10 AGU/g DS, preferiblemente de 0,01 a 5 AGU/g DS, tales como alrededor de 0,1, 0,3, 0,5, 1 o 2 AGU/g DS, especialmente 0,1 a 0,5 AGU/g DS o 0,02-20 AGU/g DS, preferiblemente 0,1-10 AGU/g DS.

Alfa-amilasa [0187] La alfa-amilasa puede según la invención ser de cualquier origen. Se prefieren alfa amilasas de origen fúngico o bacteriano.

[0188] En una realización preferida la alfa-amilasa es una alfa-amilasa ácida, por ejemplo, alfa-amilasa ácida fúngica o alfa-amilasa ácida bacteriana. El término "alfa-amilasa ácida" significa una alfa-amilasa (E.C. 3.2.1.1) que agregada en una cantidad eficaz tiene una actividad óptima a un pH en el rango de 3 a 7, preferiblemente de 3,5 a 6 o más preferiblemente de 4-5.

Alfa-amilasas bacterianas [0189] Según la invención, una alfa-amilasa bacteriana puede ser preferiblemente derivada del género Bacillus. [0190] En una realización preferida la alfa-amilasa de Bacillus es derivada de una cepa de B.licheniformis, B.

amyloliquefaciens, B. subtilis o B. stearothermophilus, pero también puede ser derivada de otros Bacillus sp. Ejemplos específicos de las alfa-amilasas contempladas incluyen la alfa-amilasa de Bacillus licheniformis (BLA) mostrada en la SEC ID nº: 4 en WO 99/19467, la alfa-amilasa de Bacillus amyloliquefaciens (BAN) mostrada en la SEC ID nº: 5 en WO 99/19467 y la alfa-amilasa de Bacillus stearothermophilus (BSG) mostrada en la SEC ID nº: 3 en WO 99/19467. En una realización de la invención la alfa-amilasa es una enzima con un grado de identidad de al menos un 60%, preferiblemente al menos un 70%, más preferido al menos un 80%, más preferido incluso al menos un 90%, tal como al menos un 95%, al menos un 96%, al menos un 97%, al menos un 98% o al menos un 99% de identidad con cualquiera de las secuencias mostradas como las SEC ID nº: 1, 2, 3, 4 o 5, respectivamente, en WO 99/19467.

[0191] La alfa-amilasa de Bacillus también puede ser una variante y/o híbrido, especialmente aquella descrita en cualquiera de las patentes WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059 y WO 02/10355. Variantes de alfa-amilasa específicamente contempladas se describen en las patentes EE.UU. nº 6.093.562, 6.297.038 o nº 6.187.576 e incluyen variantes de alfa-amilasa de Bacillus stearothermophilus (alfa- amilasa BSG) que tienen una deleción de uno o dos aminoácidos en las posiciones 179 a 182, preferiblemente una deleción doble descrita en WO 1996/023873 (ver por ejemplo, página 20, líneas 1-10), preferiblemente que corresponde a delta(181-182), en comparación con la secuencia de aminoácidos de la alfa-amilasa BSG de tipo salvaje establecida en la SEC ID nº: 3 descrita en WO 99/19467 o la deleción de los aminoácidos 179 y 180 usando la SEC ID nº: 3 en WO 99/19467 para numeración. Más preferidas incluso son las alfa-amilasas de Bacillus, especialmente la alfa-amilasa de Bacillus stearothermophilus, que tiene una deleción doble que corresponde a delta(181-182) y que además comprende una sustitución N193F (también denominada I181* + G182* + N193F) en comparación con la secuencia de aminoácidos de la alfa-amilasa BSG de tipo salvaje establecida en la SEC ID nº: 3 descrita en WO 99/19467.

[0192] La alfa-amilasa también puede ser una alfa-amilasa maltogénica. Una "alfa-amilasa maltogénica" (glucano 1,4-alfa-maltohidrolasa, E.C. 3.2.1.133) es capaz de hidrolizar amilosa y amilopectina para producir maltosa en configuración alfa. Una alfa-amilasa maltogénica de la cepa de Bacillus stearothermophilus NCIB 11837 está comercialmente disponible en Novozymes A/S, Dinamarca. La alfa-amilasa maltogénica se describe en las Patentes EE.UU. nº 4.598.048, 4.604.355 y 6.162.628.

Alfa-amilasas de híbrido bacteriano [0193] Una alfa-amilasa híbrida específicamente contemplada comprende 445 residuos de aminoácidos del C- terminal de la alfa-amilasa de Bacillus licheniformis (mostrada como la SEC ID nº: 4 en WO 99/19467) y 37 residuos de aminoácidos del N-terminal de la alfa-amilasa derivada de Bacillus amyloliquefaciens (mostrada como la SEC ID nº: 3 en WO 99/194676), con uno o varios, especialmente todos, los de la siguiente sustitución: G48A+T491+G107A+H156Y+A181T+N190F+1201F+A209V+Q264S (utilizando la numeración de Bacillus licheniformis). También se prefieren variantes que tienen una o varias de las siguientes mutaciones (o mutaciones correspondientes en otros esqueletos de alfa-amilasa de Bacillus): H154Y, A181T, N190F, A209V y Q264S, y/o deleción de dos residuos entre las posiciones 176 y 179, preferiblemente deleción de E178 y G179 (utilizando la numeración de la SEC ID nº: 5 de WO 99/19467). [0194] La alfa-amilasa bacteriana se puede añadir en cantidades según se conoce bien en la técnica. Cuando se mide en unidades KNU (descrito más adelante en la sección "Materiales y Métodos") la actividad de alfa-amilasa está preferiblemente presente en una cantidad de 0,5-5,000 NU/g de DS, en una cantidad de 1-500 NU/g de DS, o más preferiblemente en una cantidad de 5-1,000 NU/g de DS, tal como 10-100 NU/g DS. Alfa-amilasas fúngicas [0195] Las alfa-amilasas ácidas fúngicas incluyen alfa-amilasas ácidas derivadas de una cepa del género Aspergillus, tal como alfa-amilasa de Aspergillus oryzae, Aspergillus niger y Aspergillus kawachii. [0196] Una alfa-amilasa ácida fúngica preferida es una alfa-amilasa tipo Fungamyl que se deriva preferiblemente de una cepa de Aspergillus oryzae. En la presente divulgación, el término "alfa-amilasa tipo Fungamyl" indica una alfa- amilasa que muestra una identidad alta, es decir más de un 70%, más de un 75%, más de un 80%, más de un 85% más de un 90%, más de un 95%, más de un 96%, más de un 97%, más de un 98%, más de un 99% o incluso un 100% de identidad con la parte madura de la secuencia de aminoácidos mostrada en la SEC ID nº: 10 en WO 96/23874.

[0197] Otra alfa-amilasa ácida preferida se deriva de una cepa de Aspergillus niger. En una realización preferida la alfa-amilasa ácida fúngica es la de A. niger descrita como "AMYA_ASPNG" en la base de datos Swiss-prot/TeEMBL bajo el número principal de acceso P56271 y descrita con más detalle en WO 89/01969 (ejemplo 3). La alfa-amilasa ácida de Aspergillus niger se muestra también como la SEC ID nº: 1 en WO 2004/080923 (Novozymes). También se contemplan variantes de dicha amilasa ácida fúngica con al menos un 70% identidad, tal como al menos un 80% o incluso al menos un 90% de identidad, tal como al menos un 95%, al menos un 96%, al menos un 97%, al menos un 98% o al menos un 99% de identidad con la SEC ID nº: 1 en WO 2004/080923. Una alfa-amilasa ácido fúngica adecuada disponible comercialmente derivada de Aspergillus niger es SP288 (disponible en Novozymes A/S, Dinamarca).

[0198] En una realización preferida la alfa-amilasa se deriva de Aspergillus kawachii y es descrita por Kaneko et al. J. Ferment. Bioeng. 81:292-298(1996) "Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acid-stable alpha-amylase from Aspergillus kawachii."; y adcionalmente como EMBL:#AB008370. [0199] La alfa-amilasa ácida fúngica también puede ser una enzima de tipo salvaje que comprenda un módulo de unión a carbohidratos (CBM) y un dominio catalítico de alfa-amilasa (es decir, no híbrido), o una variante del mismo. En una realización la alfa-amilasa ácida de tipo salvaje se deriva de una cepa de Aspergillus kawachii. Alfa-amilasas fúngicas híbridas [0200] En una realización preferida la alfa-amilasa ácida fúngica es una alfa-amilasa híbrida. Los ejemplos preferidos de alfa-amilasas fúngicas híbridas incluyen aquellos descritos en WO 2005/003311 o en la publicación de patente EE.UU. nº 2005/0054071 (Novozymes) o en la solicitud de patente EE.UU. nº 60/638.614 (Novozymes). Una alfa- amilasa híbrida puede comprender un dominio catalítico (CD) de alfa-amilasa y un dominio/módulo de unión a carbohidratos (CBM), y opcionalmente un enlazador.

[0201] Los ejemplos específicos de alfa-amilasas híbridas contempladas incluyen aquellos descritos en la solicitud de patente EE.UU. nº 60/638,614 que incluyen la variante Fungamyl con dominio catalítico JA118 y SBD de Atelia rolfsii (SEC ID nº: 28 en este documento y SEC ID nº: 100 en la solicitud EE.UU. nº 60/638.614), alfa-amilasa de Rhizomucor pusillus con enlazador AMG y SBD de Athelia rolfsii (SEC ID nº: 29 en este documento y SEC ID nº: 101 en la solicitud EE.UU. nº 60/638.614) y alfa-amilasa de Meripilus giganteus con enlazador y SBD de glucoamilasa de Athelia rolfsii (SEC ID nº: 30 en este documento y SEC ID nº: 102 en la solicitud EE.UU. nº 60/638.614). [0202] Otros ejemplos específicos contemplados de alfa-amilasas híbridas incluyen aquellos descritos en la publicación de patente EE.UU. nº 2005/0054071, incluyendo aquellos descritos en la tabla 3 de la página 15, tal como alfa-amilasa de Aspergillus niger con enlazador de Aspergillus kawachii y dominio de unión al almidón.

Productos comerciales de alfa-amilasa [0203] Las composiciones comerciales preferidas que comprenden alfa-amilasa incluyen MYCOLASE de DSM (Gist Brocades), BAN™, TERMAMYL™ SC, FUNGAMYL™, LIQUOZYME™ X y SAN™ SUPER, de SAN™ EXTRA L (Novozymes A/S) y CLARASE™ L-40,000, DEX-LOT™, SPEZYME™ FRED, SPEZYME™ AA y SPEZYME™ DELTA AA (Genencor Int.), y la alfa-amilasa fúngica ácida vendida bajo el nombre comercial SP288 (disponible en Novozymes A/S, Dinamarca).

[0204] Una alfa-amilasa ácida puede, según la invención, ser añadida en una cantidad de 0,1 a 10 AFAU/g DS, preferiblemente 0,10 a 5 AFAU/g DS y especialmente 0,3 a 2 AFAU/g DS. Producción de jarabe [0205] La presente invención también proporciona un proceso que usa una glucoamilasa de la invención para producir jarabe, tal como glucosa y similares, a partir de material que contiene almidón. Ejemplos de materias primas adecuadas se muestran en la sección "Materiales que contienen almidón" anteriormente vista. Generalmente, el proceso comprende los pasos de hidrolizar parcialmente el material que contiene almidón (licuefacción) en presencia de alfa-amilasa y luego sacarificar adicionalmente la liberación de glucosa de los extremos no reductores del almidón o moléculas de oligo- y polisacáridos en presencia de la glucoamilasa de la invención. [0206] La licuefacción y la sacarificación se pueden llevar a cabo como se ha descrito antes para la elaboración de productos de fermentación.

[0207] La glucoamilasa de la invención también se puede usar en forma inmovilizada. Esta es adecuada y se usa frecuentemente para producir jarabes especializados, tales como jarabes de maltosa, y además para la corriente de refinado de oligosacáridos en conexión con la producción de jarabes de fructosa, por ejemplo, jarabe rico en fructosa (HFS).

[0208] En consecuencia, este aspecto de la invención se refiere a un procedimiento de producción de jarabe a partir de material que contiene almidón, que comprende 1. (a) licuefacción del material que contiene almidón en presencia de una alfa-amilasa, 2. (b) sacarificación del material obtenido en el paso (a) utilizando una glucoamilasa de la invención. [0209] Un jarabe se puede recuperar del material sacarificado obtenido en el paso (b). [0210] Detalles sobre las condiciones adecuadas se pueden encontrar en lo anteriormente visto.

Elaboración de cerveza [0211] Una glucoamilasa de la invención también puede usarse en un proceso de elaboración de cerveza. Las glucoamilasas de la invención se añaden en cantidades eficaces que pueden ser fácilmente determinadas por aquel que sea experto en la técnica. Por ejemplo, en la producción de cervezas "bajas en carbohidratos" o muy atenuadas, se busca una proporción más alta de alcohol y una cantidad inferior de dextrina. Estas cervezas son formuladas utilizando composiciones de enzimas exógenas que comprenden actividades enzimáticas capaces de desramificar las dextrinas límite. Una glucoamilasa de la invención, preferiblemente Trametes cingulata, se puede aplicar para reducir el contenido de dextrinas límite así como para hidrolizar los enlaces alpha-1,4.

[0212] La presente invención es además descrita por los siguientes ejemplos que no deberían ser interpretados como limitantes del alcance de la invención. Materiales y métodos Glucoamilasas: [0213] * glucoamilasa derivada de Trametes cingulata descrita en la SEC ID nº: 2 y disponible en Novozymes A/S. * glucoamilasa derivada de Aspergillus niger descrita en (Boel et al. (1984), EMBO J. 3 (5) p. 1097-1102) y disponible en Novozymes A/S.

* glucoamilasa derivada de Talaromyces emersonii descrita en WO99/28448 y disponible en Novozymes A/S.

[0214] Las enzimas para manipulaciones de ADN (por ejemplo, endonucleasas de restricción, ligasas etc.) son obtenibles en New England Biolabs,Inc. y se usaron según las instrucciones del fabricante. Alfa-amilasa: [0215] Alfa-amilasa híbrida A: alfa-amilasa de Rhizomucor pusillus con enlazador de glucoamilasa de Athelia rolfsii y SBD descrita en la solicitud de patente EE.UU. nº 60/638.614 y la SEC ID nº: 29. [0216] Levadura: Red Star™ disponible en Red Star/Lesaffre, EE.UU.

Cepas microbianas [0217] - DH12alfa de E. coli (GIBCO BRL, Life Technologies, EE.UU.) - IFO 4177 de Aspergillus oryzae está disponible en el Institute for Fermentation, Osaka (IFO) Culture Collection of Microorganisms, 17- 85, Juso-honmachi, 2-chome, Yodogawa-ku, Osaka, 532-8686, Japón).

- BECh-2 de Aspergillus oryzae es descrita en WO 2000/39322 (Novozymes). Es un mutante de JaL228 (descrita en WO 98/12300) la cual es un mutante de IFO 4177. - La cepa Mbin119 de Aspergillus niger es descrita en WO 2004/090155 (véase el ejemplo 11).

Otros materiales [0218] Pululano disponible en Wako Pure Chemical (Japón). Depósito de Material biológico [0219] El siguiente material biológico ha sido depositado según las condiciones del tratado de Budapest en Deutshe Sammmlung von Microorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1 b, D-38124 Braunschweig DE, y se le ha dado los siguientes números de acceso: Depósito Número de acceso Fecha del depósito

Escherichia coli NN049798 DSM 17106 2 de Febrero de 2005

Escherichia coli NN049797 DSM 17105 2 de Febrero de 2005 [0220] La cepa ha sido depositada bajo condiciones que aseguran que el acceso al cultivo estará disponible durante la pendencia de esta solicitud de patente para aquel que el comisario de patentes y marcas registradas determine que está autorizado a ello bajo 37 C.F.R. §1.14 y 35 U.S.C. §122. El depósito representa un cultivo sustancialmente puro de la cepa depositada. El depósito está disponible según los requisitos de las leyes de patente extranjera en países donde duplicados de la solicitud o su descendencia sean solicitados. No obstante, se debe entender que la disponibilidad de un depósito no constituye una licencia para practicar la presente invención en derogación de los derechos de patentes concedidos por acción gubernamental. Medios y reactivos: [0221] Los productos químicos usados como tampones y sustratos eran productos comerciales de al menos calidad reactiva. PDA2: 39 g/l de agar papa dextrosa, 20 g/l de agar, 50 ml/L de glicerol COVE: 342,3 g/l de sacarosa, 20 ml/L de solución salina de COVE, acetamida 10mM, 30 g/l de agar noble. Solución salina de COVE: 26 g de KCI, 26 g de MgSO4 ∙7H2O, 76 g KH2PO4, 50ml metales traza de COVE por litro.

Metales traza de COVE: 0,04 g de NaB4O7 ·10H2O, 0,4 g de CuSO4 ·5H2O, 1,2 g de FeSO4 ·7H2O, 0,7 g de MnSO4 ·H2O, 0,7 g de Na2 MoO2 ·2H2O y 0,7 g de ZnSO4 ·7H2O por litro. YPG: 4 g/l de extracto de levadura, 1 g/l de KH2PO4, 0,5 g/l de MgSO4∙7H2Oaq y 5 g/l de glucosa, pH 6,0.

STC: Sorbitol 0,8 M, Tris 25 mM pH 8, CaCl2 25 mM.

STPC: 40 % de PEG4000 en tampón STC. Agarosa superior COVE: 342,3 g/l de sacarosa, 20 ml/L de solución salina de COVE, 10mM acetamida, 10 g/l de agarosa de fusión baja.

MS-9: 30 g polvo de semilla de soja, 20 g de glicerol, pH 6,0 por litro. MDU-pH5: 45 g de maltosa-1aq, 7 g de extracto de levadura, 12 g de KH2PO4, 1 g de MgSO4∙7H2O, 2 g de K2 SO4, 0,5 ml de solución de metal traza AMG y 25 g de ácido 2-morfolinoetanesulfonico, pH 5,0 por litro.

Métodos [0222] A menos que se indique lo contrario, las manipulaciones y transformaciones de ADN fueron realizadas utilizando métodos estándar de la biología molecular tal y como se describe en Sambrook et al. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.), "Current protocols in Molecular Biology" John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990. Actividad de glucoamilasa [0223] La actividad de glucoamilasa se puede medir en unidades AGI o en unidades de glucoamilasa (AGU). Actividad de glucoamilasa (AGI) [0224] La glucoamilasa (equivalente a la amiloglucosidasa) convierte el almidón en glucosa. La cantidad de glucosa se determina aquí mediante el método de glucosa-oxidasa para la determinación de la actividad. El método descrito en la sección 76-11 del método de almidón-glucoamilasa con medición posterior de glucosa con glucosa-oxidasa en "Approved methods of the American Association of Cereal Chemists". Vol.1-2 AACC, de la American Association of Cereal Chemists, (2000); ISBN: 1- 891127-12-8.

[0225] Una unidad de glucoamilasa (AGI) es la cantidad de enzima que formará 1 micro mol de glucosa por minuto bajo las condiciones estándar del método. Condiciones estándar/condiciones de reaccion: [0226] Sustrato: almidón soluble, concentración aprox. 16 g material seco/l. Tampón: acetato, aprox. 0.04 M, pH=4,3 PH: 4,3 Temperatura de incubación: 60°C Tiempo de reacción: 15 minutos Terminación de la reacción: NaOH con una concentración de aproximadamente 0,2 g/l (pH~9) Concentración enzimática: 0,15-0,55 AAU/ml.

[0227] El almidón debe ser almidón Lintner, que es un almidón de ebullición fina usado en el laboratorio como indicador colorimétrico. El almidón Lintner se obtiene mediante el tratamiento con ácido clorhídrico diluido de almidón natural de modo que éste retiene la capacidad para colorear en azul con yodo.

Actividad de glucoamilasa (AGU) [0228] La unidad Novo de glucoamilasa (AGU) se define como la cantidad de enzima, que hidroliza 1 micromol de maltosa por minuto bajo las condiciones estándar de 37°C, pH 4,3, sustrato: maltosa 23,2 mM, tampón: acetato 0,1 M, tiempo de reacción 5 minutos.

[0229] Se puede utilizar un sistema autoanalizador. Se añade Mutarotasa al reactivo de glucosa deshidrogenasa de modo que cualquier alfa-D-glucosa presente se convierte en beta-D-glucosa. La glucosa deshidrogenasa reacciona específicamente con beta-D-glucosa en la reacción mencionado anteriormente, formando NADH la cual se determina usando un fotómetro a 340 nm como medida de la concentración de glucosa original.

Incubación AMG: Sustrato: maltosa 23,2 mM Tampón: acetato 0,1 M pH: 4,30 ± 0,05 Temperatura de 37°C ± 1 incubación: Tiempo de reacción: 5 minutos Rango de trabajo de la 0,5-4,0 AGU/ml Enzima: Reacción de color: GlucDH: 430 U/l Mutarotasa: 9 U/l NAD: 0,21 mM Tampón: fosfato 0,12 M; 0,15 M NaCl pH: 7,60 ± 0,05 Temperatura de 37°C ± 1 incubación: Tiempo de reacción: 5 minutos Longitud de onda: 340 nm [0230] Una carpeta (EB-SM-0131,02/01) que describe este método analítico con más detalle está disponible bajo demanda en Novozymes A/S, Dinamarca, esta carpeta se incluye por la presente mediante referencia.

Actividad de alfa-amilasa (KNU) [0231] La actividad de alfa-amilasa se puede determinar usando almidón de patata como sustrato. Este método se basa en la descomposición de almidón modificado de patata por la enzima, y la reacción continua mezclando muestras de la solución de almidón/enzima con una solución de yodo. Inicialmente, se forma un color azul negruzco, pero durante la descomposición del almidón el color azul se debilita y se convierte gradualmente en un marrón rojizo, que es en comparado con un estándar de vidrio coloreado. [0232] Una unidad Kilo Novo de alfa-amilasa (KNU) se define como la cantidad de enzima que, bajo condiciones estándar, (es decir, a 37°C +/- 0,05, 0.+,0003 M Ca2+; y pH 5,6) dextriniza 5260 mg sustancia seca de almidón Merck Amylum soluble. [0233] Una carpeta EB-SM-0009,02/01 que describe este método analítico con más detalle está disponible bajo demanda en Novozymes A/S, Dinamarca, esta carpeta se incluye por la presente mediante referencia.

Actividad de alfa-amilasa ácida [0234] Cuando se usa según la presente invención, la actividad de cualquier alfa-amilasa ácida se puede medir en AFAU (unidades de alfa-amilasa ácida fúngica). Alternativamente la actividad de alfa-amilasa ácida se puede medir en AAU (unidades de alfa-amilasa ácida). Unidades de alfa-amilasa ácida (AAU) [0235] La actividad de alfa-amilasa ácida se puede medir en AAU (unidades de alfa-amilasa ácida), que es un método absoluto. Una unidad de amilasa ácida (AAU) es la cantidad de enzima que convierte 1 g de almidón (100% de sustancia seca) por hora, bajo condiciones estandarizadas, en un producto que tiene una transmisión a 620 nm después de la reacción con una solución de yodo de fuerza conocida igual a la de referencia de color. Condiciones estándar/condiciones de reacción: [0236] Sustrato: Almidón soluble. Concentración approx. 20 g DS/l.

Tampón: Citrato, approx. 0,13 M, pH=4,2 Solución de yodo: 40,176 g de yoduro de potasio + 0,088 g de yodo/l Agua de ciudad 15°-20°dH (grados alemanes de dureza) pH: 4,2 Temperatura de 30°C Incubación: Tiempo de reacción: 11 minutos Longitud de onda: 620 nm Concentración 0,13-0,19 AAU/ml enzimática: Rango de trabajo de la 0,13-0,19 AAU/ml Enzima: [0237] El almidón debería ser almidón Lintner, que es un almidón de ebullición fina usado en el laboratorio como indicador colorimétrico. Almidón Lintner se obtiene por tratamiento de ácido clorhídrico de diluido de almidón natural de modo que éste retiene la capacidad para colorear azul con yodo. Detalles adicionales pueden ser descubiertos en EP 0140410 B2. Actividad de alfa-amilasa ácida (AFAU) [0238] La actividad de alfa-amilasa ácida se puede medir en AFAU (unidades de alfa-amilasa ácida fúngica), que se determinan con respecto a un estándar enzimático. 1 AFAU se define como la cantidad de enzima que degradan 5.260 mg de materia seca de almidón por hora bajo las condiciones estándar mencionadas más adelante. [0239] La alfa-amilasa ácida, una endo-alfa-amilasa (1,4-alfa-D-glucano-glucanohidrolasa, E.C. 3.2.1.1) hidroliza enlaces alfa-1,4-glucosidicos en las regiones internas de la molécula de almidón para formar dextrinas y oligosacáridos con diferentes longitudes de cadena. La intensidad de color formado con yodo es directamente proporcional a la concentración de almidón. La actividad de amilasa se determina utilizando colorimetría inversa como reducción en la concentración de almidón bajo las condiciones analíticas especificadas.

Azul/violeta t = 23 seg. Decoloración Condiciones estándar/condiciones de reaccion: [0240] Sustrato: Almidón soluble approx., 0,17 g/l Tampón: Citrato, approx. 0,03 M Yodo (I2): 0,03 g/L CaCl2: 1,85 mM pH: 2,50 ± 0,05 Temperatura de 40°C incubación: Tiempo de reacción: 23 segundos Longitud de onda: 590nm Concentración 0,025 AFAU/ml enzimática: Rango de trabajo de la 0,01-0,04 AFAU/ml enzima: [0241] Una carpeta EB-SM-0259,02/01 que describe este método analítico con más detalle está disponible bajo demanda en Novozymes A/S, Dinamarca.

Ejemplos Ejemplo 1 Selección Molecular de genes de glucoamilasa [0242] Se crecieron Trametes cingulata en un medio PDA2 y se aisló el ADN del genoma a partir de 0,2 g de mycelium usando el FastDNA SPIN Kit para suelo (Qbiogene; EE.UU.) según las instrucciones del fabricante. [0243] La reacción por PCR se hizo en el ADN del genoma con los cebadores degenerados ArAF1 y ArAR3 ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEC ID nº: 7) ArAR3 5' GTCAGARCADGGYTGRRASGTG-3' (SEC ID nº: 8) Donde 0 =A o G o T; R = A o G; S = C o G; V = A o C o G; Y = C o T [0244] La reacción de amplificación (13 μl) estaba compuesta de 1 μl de solución de ADN de genoma, cebador ArAF1 1 μM, cebador ArAR3 1 μM, 11 μl de Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). La reacción fue incubada en un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 20 ciclos cada uno a 94°C durante 30 segundos, 65°C durante 45 segundos, con un descenso de temperatura de anillado de 1°C por ciclo, y 72°C durante 1 minuto y 30 segundos; seguido por 20 ciclos cada uno a 94°C durante 30 segundos, 45°C durante 45 segundos y 72°C durante 1 minuto y 30 segundos, 1 ciclo a 72°C durante 7 minutos; y mantenido a 4°C. El producto de PCR fue purificado utilizando ExoSAP-IT (USB; EE.UU.), según las instrucciones del fabricante, y secuenciado. La secuencia fue posteriormente comparada con el gen de glucoamilasa de Aspergillus niger, mostrando que el producto de PCR codificaba una parte de una glucoamilasa.

Ejemplo 2 Selección Molecular de genes de glucoamilasa [0245] Se creció Pachikitospora papiracea en un medio de PDA2 y se aisló el ADN del genoma a partir de 0,2 g de mycelium usando un FastDNA SPIN Kit para suelo (Qbiogene; EE.UU.) según las instrucciones del fabricante. [0246] La reacción por PCR (PCR 1) se hizo en el ADN del genoma con los cebadores degenerados AM2F y AM4R2: AM2F 5-TGGGGIMGNCCNCARMGNGAYGG-3' (SEC ID nº: 9) AM4R2 5' RTCYTCNGGRTANCKNCC-3' (SEC ID nº: 10) Donde I =inosina; K = G o T; M = A o C; N= A o C o G o T; R = A o G; Y= C o T [0247] La reacción de amplificación (25 μl) estaba compuesta por 1 μl de solución de ADN de genoma, cebador AM2F 2 μM, cebador AM4R2 2 μM, 22 μl de Reddy PCR Master Mix (ABgene, UK). La reacción fue incubada en un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 20 ciclos cada uno a 94°C durante 1 minuto, 55°C durante 1 minuto, con un descenso de temperatura de anillado de 1°C por ciclo, y 72°C durante 1 minuto; seguido por 20 ciclos cada uno a 94°C durante 1 minuto, 40°C durante 1 minuto y 72°C durante 1 minuto; 1 ciclo a 72°C durante 7 minutos; y mantenido a 4°C. [0248] Posteriormente una reacción por PCR se hizo en una alícuota de la primera reacción por PCR (PCR 1) con los cebadores degenerados AM3F y AM4R2: AM3F 5'-TAYGAYYTNYGGGARGA-3' (SEC ID nº: 11) AM4R2 5'-RTCYTCNGGRTANCKNCC-3' (SEC ID nº: 10) Donde K = G o T; N = A o C o G o T; R = A o G; Y=C o T [0249] La reacción de amplificación (13 μl) estaba compuesta por 1 μl de la primera reacción PCR (PCR 1), cebador AM3F 1 μM, cebador AM4R2 1 μM, 11 μl de Reddy PCR Master Mix (ABgene, UK). La reacción fue incubada en un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 5 ciclos cada uno a 94°C durante 45 segundos, 45°C durante 45 segundos y 72°C durante 1 minuto; seguidos de 30 ciclos cada uno a 94°C durante 45 segundos, 40°C durante 45 segundos y 72°C durante 1 minuto; 1 ciclo a 72°C durante 7 minutos; y mantenido a 4°C. Se obtuvo una banda de PCR amplificada de 0,5 kb. El producto de reacción fue aislado en un gel de agarosa de 1,0% usando tampón TBE y fue cortado del gel y purificado utilizando GFX ADN PCR y Gel band Purification Kit (Amersham Biosciences, UK). La banda cortada fue secuenciada y posteriormente comparada con el gen de glucoamilasa de Aspergillus niger, mostrando que el producto PCR codificó una parte de una glucoamilasa. Ejemplo 3 Clonación del gen de glucoamilasa de Trametes cingulata

[0250] De la secuencia parcial de la glucoamilasa de Trametes cingulata se obtuvo más secuencia de genes con paseo cromosómico basado en PCR utilizando el Vectorette Kit de Sigma- Genosys. El paseo cromosómico se hizo básicamente como se describe en el protocolo del fabricante. 0,15 μg de ADN genómico de Trametes cingulata fueron digeridos con EcoRI, BamHI e HindIII, de manera independiente. El ADN digerido fue ligado con las correspondientes unidades Vectorette suministradas por el fabricante usando un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 16°C durante 60 minutos; 4 ciclos cada uno a 37°C durante 20 minutos, 16°C durante 60 minutos, 37°C durante 10 minutos; seguidos por 1 ciclo a 16°C durante 60 minutos y mantenido a 4°C. Las reacciones de ligado fueron posteriormente diluidas 5 veces con agua esterilizada.

[0251] Se realizaron reacciones PCR con ADN de genoma ligado con enlazador, de Trametes cingulata, como plantilla con un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 40 ciclos cada uno a 94°C durante 15 segundos, 72°C durante 1 minuto, 72°C durante 1 minuto, 1 ciclo a 72°C durante 7 minutos; y mantenido a 4°C utilizando el cebador Vectorette y el cebador TraF1 suministrados, como se muestra a continuación.

TraF1: 5'- TAGTCGTACTGGAACCCCACC -3' (SEC ID nº: 12) [0252] Las reacciones de amplificación (12,5 μl) estaban compuestas de 0,5 μl de ADN de genoma ligado con enlazador, cebador Vectorette 400 nM, cebador TraF1 400 nM cebador, 11 μl de Extensor Hi-Fidelity PCR Master Mix (ABgene, UK).

[0253] Una banda amplificada de 0,5 kb se obtuvo mediante la reacción de PCR a partir ADN de genoma digerido en HindIII. El producto de reacción fue aislado en gel de agarosa del 1,0% usando tampón TBE y fue cortado del gel. 100 μl agua esterilizada fueron añadidos al fragmento de gel de agarosa cortado y fue fundido mediante incubación a 95°C durante 5 minutos para liberar el ADN. La banda de ADN volvió a ser amplificada repitiendo la reacción PCR anteriormente descrita usando 0,5 μl del fragmento de ADN aislado en vez del ADN de genoma ligado con enlazador. [0254] Después de la reacción PCR el ADN fue purificado utilizando ExoSAP-IT (USB; EE.UU.) según las instrucciones del fabricante, y secuenciado y posteriormente comparado con el gen de glucoamilasa de Aspergillus

niger, mostrando que codificó además una parte del gen de glucoamilasa de 250 pares de bases. [0255] Para clonar las partes que faltaban del gen de glucoamilasa de Trametes cingulata, se llevó a cabo el paseo cromosómico basado en PCR usando el LA PCR™ in vitro cloning kit (Takara; Japón) según las instrucciones del fabricante.

[0256] Cinco μg de ADN de genoma de Trametes cingulata fueron digeridos con BamHI, EcoRI, HindIII, Pstl, SalI y Xbal, de manera independiente. 200 ml de etanol enfriado con hielo se añadieron a la mezcla de reacción (50 μl) y luego el ADN digerido fue recuperado mediante centrifugado a 15.000 x g durante 30 minutos a 4°C. El ADN recuperado fue ligado con enlaces artificiales correspondientes suministrados por manufacturas. El ADN ligado con enlazador fue recuperado añadiendo 200 ml de etanol enfriado con hielo a la mezcla de reacción (50 μl) seguido de centrifugado a 15.000 x g durante 30 minutos a 4°C.

[0257] Reacciones PCR con ADN de genoma ligado con enlazador de Trametes cingulata como plantilla fueron realizadas con un sistema LA PCR (Takara; Japón) usando los cebadores C1 y TC5' para clonar el gen de 5'- glucoamilasa que falta y los cebadores C1 y TC3' para que clonar el gen de 3'-glucoamilasa que falta, como se muestra a continuación. C1: 5'-gtacatattgtcgttagaacgcgtaatacgactca-3' (SEC ID nº: 13) TC5': 5'-cgtatatgtcagcgctaccatgt-3' (SEC ID nº: 14) TC3': 5'-aaacgtgagcgaccattttctgt-3' (SEC ID nº: 15) [0258] Las reacciones de amplificación (50 μl) estaban compuestas de 1 ng de ADN plantil a por μl, dNTP 250 mM cada una, cebador 250 nM, cebador 250 nM, 0,1 U de LA Taq polimerasa por μl en tampón 1X (Takara, Japón). Las reacciones fueron incubadas en un motor de ADN PTC-200 (MJ Research, Japón) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 30 ciclos cada uno a 94°C durante 0,5 minutos, 55°C durante 2 minutos, y 72°C durante 2 minutos; 1 ciclo a 72°C durante 10 minutos; y mantenido a 4°C. [0259] Se obtuvieron bandas amplificadas de 0,4 kb y 1,0 kb a partir de ADN de genoma digerido en SalI con los cebadores C1 y TC5', y ADN de genoma digerido en Xbal con los cebadores C1 y TC3', respectivamente. Estos productos de reacción fueron aislados en un gel de agarosa 1,0% usando tampón TAE y fue cortado del gel y purificado utilizando un QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante. [0260] Los fragmentos de ADN amplificados fueron ligados a pT7Blue (Invitrogen; Países Bajos), de manera independiente. La mezcla de ligamiento fue luego transformada en DH12alfa de E. coli (GIBCO BRL, Life Technologies, EE.UU.) para crear pHUda438 y pHUda439 para una banda amplificada de 0,4 kb y una banda amplificada de 1,0 kb, respectivamente. Los plásmidos resultantes fueron secuenciados y comparados con el gen de glucoamilasa Aspergillus niger, mostrando que los clones codifican las partes que faltan de la glucoamilasa. Ejemplo 4 Construcción del vector de expresión pHUda440 [0261] El vector de expresión pHUda440 fue construido para la transcripción del gen de glucoamilasa de Trametes cingulata. Una reacción PCR con el ADN de genoma de las Trametes cingulata como platilla se realizó con un sistema ExpandTM PCR (Roche Diagnostics, Japón) usando los cebadores TFF para introducir un sitio BamH I y el cebador TFR para introducir un sitio Xho I, como se muestra a continuación. TFF: 5'-tttggatccaccatgcgtttcacgctcctcacctcc-3' (SEC ID nº: 16) TFR: 5'-tttctcgagctaccgccaggtgtcattctg-3' (SEC ID nº: 17) [0262] Las reacciones de amplificación (50 μl) estaban compuestas de 1 ng de ADN plantil a por μl, dNTP 250 mM cada una, cebador TFF 250 nM, cebador TFR 250 nM y 0,1 U de Taq polimerasa por μl en tampón 1X (Roche Diagnostics, Japón). Las reacciones fueron incubadas en un motor de ADN PTC 200 (MJ-Research; Japón) programadas de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 30 ciclos cada uno a 92°C durante 1 minuto, 55°C durante 1 minuto, y 72°C durante 2 minutos; 1 ciclo a 72°C durante 10 minutos; y mantenido a 4°C.

[0263] Los productos de reacción fueron aislados en un gel de agarosa 1,0% usando tampón TAE donde un banda de producto de 2,2 kb fue cortada del gel y purificada utilizando un QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante.

[0264] El fragmento amplificado de ADN de 2,2 kb fue digerido con BamHI y XhoI, y ligado en el casete de expresión pCaHj483 de Aspergillus, digerido con BamH I y Xhol. La mezcla de ligamiento fue transformada en DH12alfa de E. coli (GIBCO BRL, Life Technologies, EE.UU.) para crear el plásmido de expresión pHUda440. El plásmido amplificado fue recuperado utilizando un QIAprep® Spin Miniprep Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante.

[0265] El plásmido pCaHj483 comprendía un casete de expresión basado en el promotor de la amilasa II neutra de Aspergillus niger fusionado a la secuencia líder no traducida de triosa fosfato isomerasa (Na2/tpi promotor) de Aspergillus nidulans y el terminador de glucoamilasa (terminador AMG) de Aspergillus niger, el marcador selectivo amdS de Aspergillus nidulans que permite crecimiento en acetamida como única fuente de nitrógeno.

Ejemplo 4 Clonación del gen de glucoamilasa de Pachykytospora papiraceae [0266] Para clonar las partes que faltan del gen de glucoamilasa de Pachykytospora papiraceae, se llevó a cabo un paseo cromosómico basado en PCR usando el LA PCR™ in vitro cloning kit (Takara; Japón) según las instrucciones del fabricante. [0267] Cinco μg de ADN de genoma de Pachykytospora papiraceae fueron digeridos con BamHI, EcoRI, HindIII, Pstl, SalI y Xbal, de manera independiente. Se añadieron a la mezcla de reacción 200 ml de etanol enfriado con hielo (50 μl) y luego el ADN digerido fue recuperado mediante centrifugado a 15.000 xg durante 30 minutos a 4°C. El ADN recuperado fue ligado con enlazadores artificiales correspondientes suministrados por manufacturas. El ADN ligado por enlazador fue recuperado añadiendo 200 ml de etanol enfriado con hielo a la mezcla de reacción (50 μl) seguido de centrifugado a 15.000 x g durante 30 minutos a 4°C.

[0268] Reacciones PCR con el ADN de genoma ligado con enlazadores de la Pachykytospora papiraceae como plantilla fueron realizadas con un sistema LA PCR (Takara; Japón) usando los cebadores C1 y PP5' para clonar el gen de 5'-glucoamilasa que faltan y los cebadores C1 y PP3' para clonar el gen de 3'- glucoamilasa que falta, como se muestra a continuación.

C1: 5'-gtacatattgtcgttagaacgcgtaatacgactca-3' (SEC ID nº: 13) PP5': 5'-cctccctgagtgagcgatgctgc-3' (SEC ID nº: 18) PP3': 5'-caactccggcctctcctccagcg-3' (SEC ID nº: 19) [0269] Las reacciones de amplificación (50 μl) estaban compuestas de 1 ng de ADN plantil a por μl, dNTP 250 mM cada una, cebador 250 nM, cebador 250 nM, 0,1 U de LA Taq polimerasa por μl en tampón 1X (Takara, Japón). Las reacciones fueron incubadas en un motor de ADN PTC-200 (MJ Research, Japón) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 30 ciclos cada uno a 94°C durante 0,5 minutos, 55°C durante 2 minutos, y 72°C durante 2 minutos; 1 ciclo a 72°C durante 10 minutos; y mantenido a 4°C.

[0270] Se obtuvieron bandas amplificadas de 0,5 kb y 0,9 kb a partir de ADN de genoma digerido en Xbal con los cebadores C1 y PP5', y ADN de genoma digerido en EcoRI con los cebadores C1 y PP3', respectivamente. Estos productos de reacción fueron aislados en un gel de agarosa 1,0% usando tampón TAE y fue cortado del gel y purificado utilizando un QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante.

[0271] Los fragmentos de ADN amplificados fueron ligados a pT7Blue (Invitrogen; Países Bajos), de manera independiente. La mezcla de ligamiento fue luego transformada en DH12alfa de E. coli (GIBCO BRL, Life Technologies, EE.UU.) para crear pHUda448 y pHUda449 para una banda amplificada de 0,5 kb y una banda amplificada de 0,9 kb, respectivamente. Los plásmidos resultantes fueron secuenciados y comparados con el gen de glucoamilasa Aspergillus niger, mostrando que los clones codifican las partes que faltan de la glucoamilasa. Ejemplo 5 Construcción del vector de expresión pHUda450.

[0272] El vector de expresión pHUda450 fue construido para la transcripción del gen de glucoamilasa de Pachykytospora papiraceae. Una reacción PCR con el genoma de ADN de Pachykytospora papiraceae como plantilla modelo fue realizada con un sistema ExpandTM PCR (Roche Diagnostics, Japón) usando los cebadores PPF para introducir un sitio BamH I y un cebador PPR a introducir un sitio Xho I, como se muestra a continuación.

PPF: 5'-tttggatccaccatgcgcttcaccctcctctcctcc-3' (SEC ID nº: 20) PPR: 5'-tttctcgagtcaccgccaggtgtcgttctg-3' (SEC ID nº: 21) [0273] Las reacciones de amplificación (50 μl) estaban compuestas de 1 ng de ADN plantil a por μl, dNTP 250 mM cada una, cebador PPF 250 nM, cebador PPR 250 nM, 0,1 U de Taq polimerasa por μl en tampón 1X (Roche Diagnostics, Japón). Las reacciones fueron incubadas en un motor de ADN PTC-200 (MJ Research, Japón) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 30 ciclos cada uno a 94°C durante 1 minuto, 55°C durante 1 minuto, y 72°C durante 2 minutos; 1 ciclo a 72°C durante 10 minutos; y mantenido a 4°C. [0274] Los productos de reacción fueron aislados en un gel de agarosa 1,0% usando tampón TAE donde una banda de 2,2 kb de producto fue cortado del gel y purificada utilizando un QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante. [0275] El fragmento amplificado de ADN de 2,2 kb fue digerido con BamHI y XhoI, y ligado en el casete de expresión pCaHj483 de Aspergillus, digerido con BamH I y Xhol. La mezcla de ligamiento fue transformada en DH12alfa de E.

coli (GIBCO BRL, Life Technologies, EE.UU.) para crear el plásmido de expresión pHUda440. El plásmido amplificado fue recuperado utilizando un QIAprep® Spin Miniprep Kit (QIAGEN Inc., Valencia, CA) según las instrucciones del fabricante. Ejemplo 6 Expresión de los genes glucoamilasa derivada de Trametes cingulata y Pachykytospora papiraceae en Aspergillus

oryzae. [0276] La cepa de Aspergillus oryzae BECh-2 fue inoculada a 100 mL de medio YPG e incubada durante 16 horas a 32°C a 80 r.p.m. Los gránulos fueron recogidos y lavados con KCI 0,6 M, y resuspendidos en 20 ml de KCI 0,6 M con un producto de beta-glucanasa comercial (GLUCANEX™, Novozymes A/S, Bagsvaerd, Dinamarca) a una concentración final de 600 μl por ml. La suspensión fue incubada a 32°C y 80 r.p.m. hasta que se formaron protoplastos, y luego lavada dos veces con tampón STC. Los protoplastos fueron contados con un hematómetro, y resuspendidos y ajustado en una solución 8:2:0.1 de STC:STPC:DMSO hasta una concentración final de 2,5x107 de protoplastos/ml. Aproximadamente 3 μg de pHUda440 o pHUda450 se añadieron a 100 μl de la suspensión de protoplastos, mezclado con cuidado, e incubado en hielo durante 20 minutos. Se añadió un ml de SPTC y la suspensión de protoplastos fue incubada durante 30 minutos a 37°C. Después de añadir 10 ml de agarosa superior COVE a 50°C, la reacción fue vertida sobre placas de agar de COVE y las placas fueron incubadas a 32°C. Después de 5 días los transformantes fueron seleccionados del medio COVE.

[0277] Cuatro transformantes seleccionados de forma aleatoria fueron inoculados en 100 ml de medio MS-9 y cultivados a 32°C durante 1 día. Tres ml de medio MS-9 fueron inoculados en 100 ml de medio MDU-pH5 y cultivados a 30°C durante 3 días. Los sobrenadantes se obtuvieron mediante centrifugado a 3,000 x g durante 10 minutos.

[0278] La actividad de glucoamilasa en las muestras de sobrenadantes fue determinada como un aumento en la producción NADH por la reacción de glucosa deshidrogenasa y de mutarotasa con generación de glucosa, y la absorbancia medida a 340 nm. Seis μl de muestras de enzima disueltas en tampón de acetato sódico 100 mM pH 4,3 fueron mezclados con 31 μl de maltosa 23,2 mM en tampón de acetato sódico 100 mM pH 4,3 e incubados a 37°C durante 5 minutos. Luego, 313 μl de reactivo de color (430 U de glucosa deshidrogenasa por litro, 9 U de mutarotasa por litro, NAD 0,21 mM y tampón de NaCl 0,15 M en fosfato 0,12 M pH 7,6) se añadieron a la mezcla de reacción y se incubaron a 37°C durante 5 minutos. La actividad fue medida a 340 nm en un espectrofotómetro. Seis μl de agua destilada fueron usados en lugar de las muestras enzimáticas como controles. [0279] Las tablas 1 y 2 muestran las actividades de glucoamilasa de los transformantes seleccionados, en relación con la actividad de la cepa huésped, BECh-2 de Aspergillus oryzae, que fue normalizada a 1,0. Tabla 1. Resultados en matraz de agitación de los transformantes seleccionados que expresan glucoamilasa de Trametes cingulata

Cepas

Glucoamilasa de T. cingulata (AGU/ ml) Actividades relativas #13-1 180 #13-2 199 #19-1 148 #19-2 169 BECh-2 1,0 Tabla 2. Resultados en matraz de agitación de los transformantes seleccionados que expresan glucoamilasa de Pachykytospora papyracea

Cepas

Glucoamilasa de P. papyraceae (AGU/ ml) Actividades relativas # B11-1 42 #B11-2 48 #B11-3 36 #B11-4 BECh-2 1,0 Ejemplo 7 Evaluación de la glucoamilasa de Trametes cingulata en fermentaciones de etanol de combustible en una etapa [0280] El rendimiento relativo de la glucoamilasa de Trametes cingulata respecto a la glucoamilasa Aspergillus niger y la glucoamilasa de Talaromyces emersonii fue evaluada a través de fermentaciones mini-escala. Aproximadamente 380 g de maíz molido (triturado en un molino de martillos de escala experimental a través de un filtro de 1,65 mm) se añadieron a aproximadamente 620 g agua del grifo. Esta mezcla fue suplementada con 3 ml de penicilina de 1 g/l. El pH de esta pasta fue ajustado a 5,0 con H2 SO4 del 40%. El nivel de sólido seco (DS) se determinó por triplicado que era aproximadamente del 32%. Se añadieron aproximadamente 5 g de esta pasta a tubos de 15 ml. [0281] Un dosis-respuesta de dos dosis fue llevado a cabo con cada enzima. Las dosificaciones usadas fueron 0,3 y 0,6 nmol / g de DS. Seis réplicas de cada tratamiento fueron ejecutadas.

[0282] Después de la dosificación, los tubos fueron inoculados con 0,04 ml/g de masa de propagado de levadura (Levadura de RED STAR™) que habían sido crecidos durante 22,5 horas en masa de maíz. Los tubos fueron tapados con un tornillo en la parte superior que había sido perforado con una aguja pequeña para permitir la liberación de gas y agitados brevemente antes de ser pesados e incubados a 32°C. 70 horas de fermentación se llevaron a cabo y los productos de etanol se determinaron pesando los tubos. Los tubos fueron agitados brevemente antes de ser pesados. El resultado del experimento se muestra en la tabla 1. [0283] Se puede ver en la tabla 1 que la producción de etanol por gramo de DS es significativamente más alta cuando se usa la glucoamilasa de Trametes cingulata en comparación con la producción de glucoamilasa de

Aspergillus niger y de Talaromyces emersonii tipo salvaje.

Tabla 1 Glucoamilasa nmol /g de Productos de DS Etanol

Trametes cingulata

0,3 56,2

Aspergillus niger

47,2

Talaromyces emersonii

30,5

Trametes cingulata

0,6 100,8

Aspergillus niger

87,2

Talaromyces emersonii

43,4 Ejemplo 8 Evaluación de la glucoamilasa de Pachykytospora papiracea en fermentaciones de etanol de combustible en una etapa [0284] El rendimiento relativo de la glucoamilasa de Pachykytospora papiracea respecto a la glucoamilasa Aspergillus niger y la glucoamilasa de Talaromyces emersonii fue evaluada a través de fermentaciones mini-escala.

Aproximadamente 380 g de maíz molido (triturado en un molino de martillos de escala experimental a través de un filtro de 1,65 mm) se añadieron a aproximadamente 620 g agua del grifo. Esta mezcla fue suplementada con 3 ml de penicilina de 1 g/l. El pH de esta pasta fue ajustado a 5,0 con H2 SO4 del 40%. El nivel de sólido seco (DS) se determinó por triplicado que era aproximadamente del 32%. Se añadieron aproximadamente 5 g de esta pasta a tubos de 15 ml.

[0285] Un dosis-respuesta de dos dosis fue llevado a cabo con cada enzima. Las dosificaciones usadas fueron 0,3 y 0,6 nmol / g de DS. Seis réplicas de cada tratamiento fueron ejecutadas. [0286] Después de la dosificación, los tubos fueron inoculados con 0,04 ml/g de masa de propagado de levadura (Levadura de RED STAR™) que habían sido crecidos durante 22,5 horas en masa de maíz. Los tubos fueron tapados con un tornillo en la parte superior que había sido perforado con una aguja pequeña para permitir la liberación de gas y agitados brevemente antes de ser pesados e incubados a 32°C. 70 horas de fermentación se llevaron a cabo y los productos de etanol se determinaron pesando los tubos. Los tubos fueron agitados brevemente antes de ser pesados. El resultado del experimento se muestra en la tabla 2.

[0287] Se puede ver en la tabla 2 que la producción de etanol por gramo de DS es significativamente más alta cuando se usa la glucoamilasa de Pachykytospora papiracea en comparación con la producción de glucoamilasa de Aspergillus niger y de Talaromyces emersonii tipo salvaje.

Tabla 2 Glucoamilasa nmol /g de Productos de DS Etanol

Pachykytospora

0,3 76,3

papyracea

Aspergillus niger

47,2

Talaromyces emersonii

30,5

Pachykytospora

0,6 102,0

papyracea

Aspergillus niger

87,2

Talaromyces emersonii

43,4 Ejemplo 9 Glucoamilasa de Trametes cingulata en combinación con alfa-amilasa A híbrida de Rhizomucor pusillus para una fermentación en una etapa [0288] Todos los tratamientos fueron evaluados a través de fermentaciones mini-escala. 410 g de maíz molido se añadieron a 590 g de agua del grifo. Esta mezcla fue suplementada con 3,0 ml de penicilina de 1g/l de y 1g de urea.

El pH de este pasta fue ajustado a 4,5 con NaOH 5N (el pH inicial, antes del ajuste era aproximadamente 3,8). Se determinó que el nivel de sólido seco (DS) era del 35%. Aproximadamente 5 g de esta pasta se añadieron a viales de 20 ml. Cada vial fue dosificado con la cantidad apropiada de enzima seguido de la adición de 200 μl de propagado de levadura/5 g fermentación. Las dosificaciones reales estaban basadas en el peso exacto de pasta de maíz en cada vial. Los viales fueron incubados a 32ºC. 9 fermentaciones replicadas de cada tratamiento fueron ejecutadas. Tres réplicas fueron seleccionadas durante 24 horas, 48 horas y 70 horas para el momento de análisis. Los viales fueron agitados a las 24, 48 y 70 horas. El análisis de punto temporal consistía en pesar los viales y preparando la muestra para HPLC. La preparación de HPLC consistía en parar la reacción añadiendo 50 μl de H2 SO4 del 40%, centrifugando y filtración a través de un filtro de 0,45 μm. Las muestras que esperaban el análisis de HPLC se almacenaron a 4°C.

Enzimas usadas en este estudio: nºde % dosis de enzima AGU/g de DS AFAU/g de DS prueb a Glucoamilasa de T. Alfa-Amilasa A de glucoamilasa de Alfa-Amilasa A de

cingulata

Rhizomucor pusillus

T.cingulata

Rhizomucor pusillus

1 100% 0% 0,43 2 90% 10% 0,387 0,01 3 80% 20% 0,344 0,02 4 70% 30% 0,301 0,03 60% 40% 0,258 0,04 6 45% 55% 0,1935 0,055 7 30% 70% 0,129 0,07 8 15% 85% 0,0645 0,085 9 0% 100% 0,1 Nota: La glucoamilasa de T. cingulata (49 AGU/ml) y la Alfa-Amilasa A híbrida de Rhizomucor pusillus (17 AFAU/ml) son enzimas purificadas por Novozymes Japan. DS=sólido seco.

Resultados [0289] El efecto sinérgico de la alfa-amilasa y la glucoamilasa se presenta en una tabla a continuación. Cuando la glucoamilasa de T. cingulata fue usada en una fermentación de una sola etapa, produjo 54,1, 81,2 y 99,0 g/l de etanol después de 24, 48 y 70 horas de fermentación, respectivamente. Cuando la alfa-amilasa A híbrida de Rhizomucor pusillus se usa sola en la fermentación, produjo 90,5, 124,6 y 1381 g/l de etanol después de 24, 48 y 70 horas de fermentación, respectivamente.

nº de Glucoamilasa de

T. Alfa-Amilasa A de Etanol (g/l) Proporción Prueba cingulata

Rhizomucor pusillus AGU/g de DS AFAU/g de DS 24hrs 48hrs 70hrs AGU/AFAU 1 0,430 0,000 54,1 81,2 99,0 N/A 2 0,387 0,010 88,5 130,7 145,0 38,70 3 0,344 0,020 92,9 132,1 145,9 17,20 4 0,301 0,030 96,7 135,3 146,6 10,03 0,258 0,040 96,1 136,6 147,1 6,45 6 0,194 0,055 97,1 135,5 145,6 3,52 7 0,129 0,070 95,4 132,9 144,6 1,84 8 0,065 0,085 93,3 130,4 142,9 0,76 9 0,000 0,100 90,5 124,6 138,1 0,00 [0290] La proporción óptima de glucoamilasa T. cingulata respecto a alfa-amilasa A híbrida de alfa-amilasa de Rhizomucor pusillus es aproximadamente 6,5 AGU/AFAU (tabla por anterior). Se observó un rendimiento esencialmente similar en términos de producción de etanol después de 70 horas de fermentación en el rango de proporción de 0,76- 38,7 AGU/AFAU, indicando un rendimiento robusto para un amplio rango de proporción de actividad de las mezclas de glucoamilasas de T. cingulata con alfa-amilasa A híbrida. Ejemplos 10 Extracción de ADN y amplificación PCR de Leucopaxillus giganteus: [0291] 0,2 -2 g de la capa que se forma a partir de esporas (lamellas) de los cuerpos de fruta frescos de Leucopaxillus giganteus se usaron para extraer DNA genómico utilizando el FastDNA SPIN Kit para suelo (Qbiogene; EE.UU.) según las instrucciones del fabricante.

[0292] Se hizo una reacción PCR en el ADN del genoma con los cebadores degenerados ArAF1 y ArAR3 ArAF1 5'-CRTRCTYDVCAACATYGG-3' (SEC ID nº: 7) ArAR3 5' GTCAGARCADGGYTGRRASGTG-3' (SEC ID nº: 8) Donde D = A o G o T; R = A o G; S = C o G; V = A o C o G; Y = C o T [0293] La reacción de amplificación (13 μl) estaba compuesta por 1 μl de solución de ADN de genoma, cebador ArAF1 1 μM (25 pmol/μl), cebador ArAR3 1 μM (25 pmol/ μl) y 11 μl de Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). La reacción fue incubada en un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos, 20 ciclos cada uno a 94°C durante 30 segundos, 65°C durante 45 segundos, con un descenso de la temperatura de anillado de 1°C por ciclo, y 72°C durante 1 minuto y 30 segundos; seguido por 20 ciclos cada uno a 94°C durante 30 segundos, 45°C durante 45 segundos y 72°C durante 1 minuto y 30 segundos ,1 ciclo a 72°C durante 7 minutos; y mantenido 4°C. El producto de PCR fue purificado utilizando un ExoSAP-IT (USB; EE.UU.) según a las instrucciones del fabricante y secuenciado utilizando los cebadores tal como se usan en la reacción de amplificación. La secuencia fue posteriormente comparada con el gen de glucoamilasa de Aspergillus niger, mostrando que el producto de PCR codificó una parte de una glucoamilasa.

[0294] De la secuencia parcial de la glucoamilasa de Leucopaxillus giganteus se obtuvieron más secuencias de genes con PCR basado en el paseo cromosómico usando el Vectorette Kit Sigma- Genosys. El paseo cromosómico fue realizado como se describe en el protocolo del fabricante. 0,15 μg de ADN genómico de Leucopaxillus giganteus fue digerido con EcoRI, BamHI e HindIII, de manera independiente. El ADN digerido fue ligado con las correspondientes unidades Vectorette suministradas por el fabricante, usando un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 16°C durante 60 minutos, 4 ciclos cada uno a 37°C durante 20 minutos, 16°C durante 60 minutos, 37°C durante 10 minutos, seguidos por 1 ciclo a 16°C durante 60 minutos y mantenido a 4°C. Las reacciones de ligamiento fueron posteriormente diluidas 5 veces con agua esterilizada.

[0295] Reacciones PCR con ADN de genoma ligado por enlazador de Leucopaxillus giganteus como plantilla fueron realizadas con un motor de ADN Dyad PTC-0220 (MJ Research, EE.UU.) programado de la siguiente manera: 1 ciclo a 94°C durante 2 minutos; 40 ciclos cada uno a 94°C durante 15 segundos, 72°C durante 1 minuto, 72°C durante 1 minuto, 1 ciclo a 72°C durante 7 minutos; y mantenido a 4°C utilizando el cebador Vectorette suministrado y usando los cebadores AMG específicos Nc1 R2 y NC1F0 de Leucopaxillus giganteus, como se muestra a continuación. Nc1 R2: 5'- GGTAGACTAGTTACCTCGTTGG -3' (SEC ID nº: 31) Nc1F0: 5'- GCTTCCCTAGCCACTGCGATTGG -3' (SEC ID nº: 32) [0296] Las reacciones de amplificación (12,5 μl) estaban compuestas de 0,5 μl de ADN de genoma ligado por enlazadores, cebador 400 nM Vectorette, cebador específico 400 nM de Leucopaxillus giganteus y 11 μl de Extensor Hi-Fidelity PCR Master Mix (ABgene, UK). [0297] Después de la reacción PCR los productos PCR fueron purificados utilizando ExoSAP-IT (USB; EE.UU.) según a las instrucciones del fabricante y secuenciados y posteriormente comparados con el gen de glucoamilasa de Aspergillus niger. [0298] Se obtuvo una banda amplificada de 1,7 kb mediante la reacción PCR a partir de ADN de genoma digerido en HindIII amplificado con el cebador Nc1R2. La secuenciación del producto PCR usando este cebador mostró que codificó los 600 pares de bases restantes del gen de glucoamilasa en la dirección 5'. [0299] Una banda amplificada de 1,8 se obtuvo mediante la reacción PCR de ADN de genoma digerido en HindIII con el cebador Nc1F0. La secuenciación del producto PCR usando este cebador mostró que codificó además aproximadamente 530 pares de bases del gen de glucoamilasa, no obstante, sin alcanzar el final del gen. Por lo tanto, un cebador de secuenciación adicional Nc1 F2 fue diseñado basándose en la secuencia adicional obtenida recientemente del gen de glucoamilasa. Usando Nc1 F2 como un cebador corriente abajo de Nc1F0 en el mismo producto PCR mostró que codificó los aproximadamente restantes 520 pares de bases del gen de glucoamilasa en la dirección 3'. Nc1F2 5' GTTGATTTAACTTGGAGCTATGC (SEC ID nº: 33) Ejemplo 11 Clonación y expresión de la glucoamilasa de Leucopaxillus giganteus [0300] De la secuencia parcial de la glucoamilasa de Leucopaxillus giganteus se obtuvo más secuencia de genes. [0301] Se usaron los siguientes cebadores de clonación por PCR: [0302] La PCR se hizo con ADNg de Leucopaxillus giganteus como plantilla usando Phusion como polimerasa y los cebadores anteriores que introducen respectivamente BamHI y Xhol. 5 μl del producto PCR fue probado en gel de agarosa 1%, y mostró una banda de alrededor de 2,2 kb. El producto PCR fue purificado en una columna QIAquick.

[0303] El producto purificado y el vector de Aspergillus pEN12516 de Leucopaxillus giganteus (ver WO 2004/069872) fueron digeridos con BamHI y Xhol. El vector y fragmentos de inserto fueron purificados a partir de un gel de agarosa del 1% preparatorio que utiliza el método QIAquick. El fragmento de 2,2 kb fue ligado en el vector pENI2516 y transformado en células competentes TOP10 de E.coli. El plásmido resultante fue denominado pENI3372. Transformación en Aspergillus niger

[0304] Se hicieron los protoplastos de la cepa de Aspergillus niger Mbin119 (ver WO 2004/090155). Aproximadamente 5 μg de pENI3372 fueron transformados en los protoplastos. Los transformantes de Aspergillus niger resultantes fueron evaluados para determinar su actividad de glucoamilasa.

Ejemplo 12 Actividad desramificante hacia pululano de glucoamilasa de Trametes cingulata [0305] Se investigó la actividad desramificante de alfa-1,6 de glucoamilasas derivadas de Trametes cingulata,

Athelia rolfsii, Aspergillus niger y Talaromyces emersonii. [0306] El pululano (PM 50.000~100.000) fue disuelto en agua MilliQ y añadido a una mezcla de reacción con una concentración final del 3% que contiene tampón de NaAc 50 mM, pH 4,0, con dosificación enzimática de 0,42 μg de enzima/mg de pululano a 37°C. El perfil de oligosacáridos fue analizado periódicamente mediante HPLC.

[0307] El resultado de la prueba se muestra en la figura 1. Listado de secuencias [0308] <110> Novozymes North America, Inc. Novozymes A/S <120> polipéptidos que tienen actividad de glucoamilasa <130> 10761.504-WO <160> 43 <170> PatentIn Versión 3.3 <210> 1 <211> 2166 <212> ADN <213> Trametes cingulata <220> <221> sig peptide <222> (1)..(54) <220> <221> CDS <222> (1)..(162) <220> <221> mat peptide <222> (55)..(2166) <220> <221> intrón <222> (163)..(247) <220> <221> CDS <222> (248)..(521) <220> <221> intrón <222> (522)..(577) <220> <221> CDS <222> (578)..(722) <220> <221> intrón <222> (723)..(772) <220> <221> CDS <222> (773)..(932) <220> <221> intrón <222> (933)..(1001) <220> <221> CDS <222> (1002)..(1277) <220> <221> intrón <222> (1278)..(1341) <220> <221> CDS <222> (1342)..(1807) <220> <221> misc feature <222> (1744)..(1773) <223> región enlazante <220> <221> misc feature <222> (1774)..(2166) <223> dominio de unión <220> <221> intrón <222> (1808)..(1864) <220> <221> CDS <222> (1865)..(1963) <220> <221> intrón <222> (1964)..(2023) <220> <221> CDS <222> (2024)..(2163) <400> 1 <210> 3 <211> 1725 <212> ADN <213> Trametes cingulate <220> <221> misc feature <222> (1)..(1725) <223> ADNc <220> <221> misc feature <222> (55)..(1725) <223> región codificante de ADNc <220> <221> misc feature <222> (1420)..(1725) <223> dominio de unión <400> 3 <210> 4 <211> 2189 <212> ADN <213> Pachykytospora papiracea <220> <221> CDS <222> (1)..(159) <220> <221> sig peptide <222> (1)..(54) <220> <221> mat peptide <222> (55)..(2186) <220> <221> intrón <222> (160)..(238) <220> <221> CDS <222> (239)..(720) <220> <221> intrón <222> (516)..(572) <220> <221> intrón <222> (721)..(782) <220> <221> CDS <222> (783)..(942) <220> <221> intrón <222> (943)..(1005) <220> <221> CDS <222> (1006)..(1281) <220> <221> intrón <222> (1282)..(1340) <220> <221> CDS <222> (1391)..(1803) <220> <221> misc feature <222> (1743)..(1769) <223> enlazador <220> <221> misc feature <222> (1770)..(2189) <223> región de unión <220> <221> intrón <222> (1804)..(1882) <220> <221> CDS <222> (1883)..(1978) <220> <221> intrón <222> (1979)..(2043) <220> <221> CDS <222> (2044)..(2186) <400> 4 <210> 6 <211> 1725 <212> ADN <213> Pachykytospora papiracea <220> <221> misc feature <222> (1)..(1725) <223> ADNc <220> <221> misc feature <222> (55)..(1725) <223> región codificante de ADNc <220> <221> misc feature <222> (1423)..(1725) <223> dominio de unión <400> 6 <210> 7 <211> 18 <212> ADN <213> Artificial <220> <223> cebador degenerado ArAF1 <220> <221> misc feature <222> (2)..(2) <223> R = A o G <220> <221> misc feature <222> (4)..(4) <223> R = A o G <220> <221> misc feature <222> (7)..(7) <223> Y = C o T <220> <221> misc feature <222> (8)..(8) <223> D = A o G o T <220> <221> misc feature <222> (9)..(9) <223> V = A o C o G <220> <221> misc feature <222> (16)..(16) <223> Y = C o T <400> 7 crtrctydvc aacatygg 18 <210> 8 <211> 22 <212> ADN <213> Artificial <220> <223> cebador degenerado ArAF3 <220> <221> misc feature <222> (7)..(7) <223> R = A o G <220> <221> misc feature <222> (10)..(10) <223> D = A o G o T <220> <221> misc feature <222> (13)..(13) <223> Y = C o T <220> <221> misc feature <222> (16)..(16) <223> R = A o G <220> <221> misc feature <222> (17)..(17) <223> R = A o G <220> <221> misc feature <222> (19)..(19) <223> S = C o G <400> 8 gtcagarcad ggytgrrasg tg 22 <210> 9 <211> 23 <212> ADN <213> Artificial <220> <223> cebador degenerado AM2F <220> <221> misc feature <222> (6)..(6) <223> n es inosina <220> <221> misc feature <222> (7)..(7) <223> M = A o C <220> <221> misc feature <222> (9)..(9) <223> N = A o C o G o T <220> <221> misc feature <222> (12)..(12) <223> N = A o C o G o T <220> <221> misc feature <222> (15)..(15) <223> R = A o G <220> <221> misc feature <222> (16)..(16) <223> M = A o C <220> <221> misc feature <222> (18)..(18) <223> N = A o C o G o T <220> <221> misc feature <222> (21)..(21) <223> Y = C o T <400> 9 tggggnmgnc cncarmgnga ygg 23 <210> 10 <211> 18 <212> ADN <213> Artificial <220> <223> cebador degenerado AM4R2 <220> <221> misc feature <222> (1)..(1) <223> R = A o G <220> <221> misc feature <222> (4)..(4) <223> Y = C o T <220> <221> misc feature <222> (7)..(7) <223> N = A o C o G o T <220> <221> misc feature <222> (10)..(10) <223> R = A o G <220> <221> misc feature <222> (13)..(13) <223> N = A o C o G o T <220> <221> misc feature <222> (15)..(15) <223> K = G o T <220> <221> misc feature <222> (16)..(16) <223> n es a, c, g o t <220> <221> misc feature <222> (136)..(16) <223> N = A o C o G o T <400> 10 rtcytcnggr tanckncc 18 <210> 11 <211> 17 <212> ADN <213> Artificial <220> <223> cebador degenerado AMF3 <220> <221> misc feature <222> (3)..(3) <223> Y = C o T <220> <221> misc feature <222> (6)..(6) <223> Y = C o T <220> <221> misc feature <222> (7)..(7) <223> Y = C o T <220> <221> misc feature <222> (9)..(9) <223> N = A o C o G o T <220> <221> misc feature <222> (10)..(10) <223> Y = C o T <220> <221> misc feature <222> (15)..(15) <223> R = A o G <400> 11 taygayytny gggarga 17 <210> 12 <211> 21 <212> ADN <213> Artificial <220> <223> cebador TraF1 <220> <221> misc feature <222> (1)..(21) <223> cebador TraF1 <400> 12 tagtcgtact ggaaccccac c 21 <210> 13 <211> 35 <212> ADN <213> Artificial <220> <223> cebador C1 <400> 13 gtacatattg tcgttagaac gcgtaatacg actca 35 <210> 14 <211> 23 <212> ADN <213> Artificial <220> <223> cebador TC5' <220> <221> misc feature <222> (1)..(23) <223> cebador TC5' <400> 14 cgtatatgtc agcgctacca tgt 23 <210> 15 <211> 23 <212> ADN <213> Artificial <220> <223> cebador TC3' <220> <221> misc feature <222> (1)..(23) <223> cebador TC3' <400> 15 aaacgtgagc gaccattttc tgt 23 <210> 16 <211> 36 <212> ADN <213> Artificial <220> <223> cebador TFF <400> 16 tttggatcca ccatgcgttt cacgctcctc acctcc 36 <210> 17 <211> 30 <212> ADN <213> Artificial <220> <223> cebador TFR <400> 17 tttctcgagc taccgccagg tgtcattctg 30 <210> 18 <211> 23 <212> ADN <213> Artificial <220> <223> cebador PP5' <400> 18 cctccctgag tgagcgatgc tgc 23 <210> 19 <211> 23 <212> ADN <213> Artificial <220> <223> cebador PP3' <400> 19 caactccggc ctctcctcca gcg 23 <210> 20 <211> 36 <212> ADN <213> Artificial <220> <223> cebador PPF <400> 20 tttggatcca ccatgcgctt caccctcctc tcctcc 36 <210> 21 <211> 30 <212> ADN <213> Artificial <220> <223> cebador PPR <400> 21 tttctcgagt caccgccagg tgtcgttctg 30 <210> 22 <211> 31 <212> PRT <213> Aspergillus kawachii

<220> <221> péptido <222> (1)..(31) <223> enlazador <400> 22 <210> 23 <211> 2494 <212> ADN <213> Leucopaxillus giganteus <220> <221> misc feature <222> (29)..(29) <223> n es a, c, g o t <220> <221> misc feature <222> (38)..(38) <223> n es a, c, g o t <220> <221> sig peptide <222> (66)..(128) <220> <221> CDS <222> (66)..(319) <220> <221> mat peptide <222> (117)..(2249) <220> <221> intrón <222> (320)..(375) <220> <221> CDS <222> (376)..(540) <220> <221> intrón <222> (541)..(591) <220> <221> CDS <222> (592)..(605) <220> <221> intrón <222> (606)..(664) <220> <221> CDS <222> (665)..(809) <220> <221> intrón <222> (810)..(863) <220> <221> CDS <222> (864)..(1023) <220> <221> intrón <222> (1024)..(1088) <220> <221> CDS <222> (1089)..(1361) <220> <221> intrón <222> (1362)..(1415) <220> <221> CDS <222> (1416)..(1896) <220> <221> misc feature <222> (1821)..(1853) <223> enlazador <220> <221> misc feature <222> (1854)..(2249) <223> dominio de unión <220> <221> intrón <222> (1897)..(1954) <220> <221> CDS <222> (1955)..(2014) <220> <221> intrón <222> (2015)..(2106) <220> <221> CDS <222> (2107)..(2249) <400> 23 <210> 25 <211> 1722 <212> ADN <213> Leucopaxillus giganteus <220> <221> CDS <222> (1)..(1719) <223> ADNc <220> <221> sig peptide <222> (1)..(51) <220> <221> misc feature <222> (1)..(1404) <223> dominio catalítico <220> <221> mat peptide <222> (52)..(1719) <220> <221> misc feature <222> (1405)..(1437) <223> enlazador <220> <221> misc feature <222> (1438)..(1719) <223> dominio de unión <400> 25 <221> misc feature <222> (211)..(211) <223> El ' Xaa' en la ubicación 211 representa Pro.

<400> 26 <210> 27 <211> 1761 <212> ADN <213> Artificial <220> <223> Variante de fungamil híbrido JA118 con SBD de A. rolfsii

<220> <221> mat peptide <222> (1)..(1758) <220> <221> CDS <222> (1)..(1758) <400> 27 <220> <223> constructo sintético <400> 28 <220> <223> alfa-amilasa híbrida con dominio catalítico de Rhizomucor pusillus y enlazador de A. rolfsii y SBD <400> 29 <210> 30 <211> 574 <212> PRT <213> Artificial <220> <223> alfa-amilasa híbrida con dominio catalítico de Meripilus giganteous con enlazador de A. rolfsii y SBD.

<400> 30 <220> <223> cebador <400> 31 ggtagactag ttacctcgtt gg 22 <210> 32 <211> 23 <212> ADN <213> Artificial <220> <223> cebador <400> 32 gcttccctag ccactgccat tgg 23 <210> 33 <211> 23 <212> ADN <213> Artificial <220> <223> cebador <400> 33 gttgatttaa cttggagcta tgc 23 <210> 34 <211> 35 <212> ADN <213> Artificial <220> <223> cebador directo de Leucopaxillus <400> 34 tcccttggat ccaggatgca tttctctgtc ctctc 35 <210> 35 <211> 34 <212> ADN <213> Artificial <220> <223> cebador inverso de Leucopaxillus <400> 35 cttatcctcg agctacttcc acgagtcatt ctgg 34 <210> 36 <211> 2166 <212> ADN <213> Trametes cingulata <220> <221> CDS <222> (1)..(171) <220> <221> misc signal <222> (1)..(54) <220> <221> mat peptide <222> (55)..(2166) <220> <221> intrón <222> (172)..(244) <220> <221> CDS <222> (245)..(521) <220> <221> intrón <222> (522)..(577) <220> <221> CDS <222> (578)..(722) <220> <221> intrón <222> (723)..(772) <220> <221> CDS <222> (773)..(935) <220> <221> intrón <222> (936)..(1001) <220> <221> CDS <222> (1002)..(1277) <220> <221> intrón <222> (1278)..(1341) <220> <221> CDS <222> (1342)..(1807) <220> <221> misc feature <222> (1744)..(1773) <223> enlazador <220> <221> misc feature <222> (1774)..(2163) <223> dominio de unión <220> <221> intrón <222> (1808)..(1864) <220> <221> CDS <222> (1865)..(1960) <220> <221> intrón <222> (1961)..(2020) <220> <221> CDS <222> (2021)..(2163) <400> 36 <210> 38 <211> 1740 <212> ADN <213> Trametes cingulata <220> <221> misc feature <222> (1)..(1740) <223> ADNc <220> <221> misc feature <222> (55)..(1740) <223> región codificante de péptido maduro de ADNc <220> <221> misc feature <222> (1435)..(1464) <223> enlazador <220> <221> misc feature <222> (1465)..(1740) <223> dominio de unión <400> 38 <210> 39 <211> 2182 <212> ADN <213> Pachykytospora papiraceae <220> <221> CDS <222> (1)..(159) <220> <221> misc signal <222> (1)..(54) <220> <221> mat peptide <222> (55)..(2182) <220> <221> intrón <222> (160)..(238) <220> <221> CDS <222> (239)..(515) <220> <221> intrón <222> (516)..(565) <220> <221> misc feature <222> (523)..(524) <223> n es a, c, g o t <220> <221> misc feature <222> (555)..(555) <223> n es a, c, g o t <220> <221> CDS <222> (566)..(713) <220> <221> misc feature <222> (613)..(613) <223> n es a, c, g o t <220> <221> misc feature <222> (648)..(648) <223> n es a, c, g o t <220> <221> intrón <222> (714)..(775) <220> <221> misc feature <222> (727)..(727) <223> n es a, c, g o t <220> <221> misc feature <222> (753)..(753) <223> n es a, c, g o t <220> <221> misc feature <222> (768)..(768) <223> n es a, c, g o t <220> <221> misc feature <222> (770)..(770) <223> n es a, c, g o t <220> <221> CDS <222> (776)..(935) <220> <221> intrón <222> (936)..(971) <220> <221> CDS <222> (972)..(1274) <220> <221> intrón <222> (1275)..(1333) <220> <221> CDS <222> (1334)..(1796) <220> <221> misc feature <222> (1736)..(1762) <223> enlazador <220> <221> misc feature <222> (1763)..(2182) <223> dominio de unión <220> <221> intrón <222> (1797)..(1875) <220> <221> CDS <222> (1876)..(1971) <220> <221> intrón <222> (1972)..(2036) <220> <221> CDS <222> (2037)..(2179) <400> 39 <210> 40 <211> 583 <212> PRT <213> Pachykytospora papiraceae <220> <221> misc feature <222> (144)..(144) <223> El ' Xaa' en la ubicación 144 representa Met, Val, o Leu. <400> 40 <210> 41 <211> 1752 <212> ADN <213> Pachykytospora papiraceae <220> <221> misc feature <222> (1)..(54) <223> señal <220> <221> misc feature <222> (55)..(1752) <223> ADNc codificante de péptido maduro <220> <221> misc feature <222> (1450)..(1476) <223> enlazador <220> <221> misc feature <222> (1477)..(1752) <223> dominio de unión <400> 41 <210> 42 <211> 1623 <212> ADN <213> Leucopaxillus giganteus <220> <221> CDS <222> (1)..(1620) <223> ADNc <220> <221> misc signal <222> (1)..(51) <220> <221> mat peptide <222> (52)..(1620) <220> <221> misc feature <222> (1306)..(1338) <223> enlazador <220> <221> misc feature <222> (1339)..(1620) <223> dominio de unión <220> <221> misc feature <222> (1339)..(1620) <223> dominio de unión <400> 42

REIVINDICACIONES

1. Polipéptido que tiene actividad de glucoamilasa, seleccionado del grupo que consta de: (a) un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos para los aminoácidos de polipéptido maduro 1 a 556 de la SEC ID nº: 2; o (a1) un polipéptido que tiene una secuencia de aminoácidos con al menos un 90% de identidad con los aminoácidos para los aminoácidos de polipéptido maduro 1 a 561 de la SEC ID nº: 37; (b) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3, o (iii) una cadena complementaria de (i) o (ii); o (b1) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 36, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1737 de la SEC ID nº: 38, o (iii) una cadena complementaria de (i) o (ii). 2. Polipéptido según la reivindicación 1, que consiste en la parte madura de las SEC ID nº: 2 o 37, respectivamente, o un fragmento de las mismas, que tienen actividad de glucoamilasa.

3. Polipéptido según la reivindicación 1, que comprende una región catalítica de los aminoácidos 1 a 455 de la SEC ID Nº: 2 o los aminoácidos 1 a 460 de la SEC ID nº: 37. 4. Polipéptido según la reivindicación 1, que comprende dominios de unión ubicados en los aminoácidos 466 a 556 de la SEC ID nº: 2. o los aminoácidos 471 a 561 de la SEC ID nº: 37.

5. Polinucleótido que tiene una secuencia de nucleótidos que codifica el polipéptido según cualquiera de las reivindicaciones 1-4. 6. Constructo de ácidos nucleicos que comprende el polinucleótido según la reivindicación 5, operativamente enlazado a uno o varias secuencias de control que dirigen la producción del polipéptido en un huésped de expresión. 7. Vector de expresión recombinante que comprende el constructo de ácidos nucleicos según la reivindicación 6. 8. Vélula huésped recombinante que comprende el constructo de ácidos nucleicos según la reivindicación 6 o el vector de expresión recombinante según la reivindicación 7. 9. Método para producir un polipéptido según cualquiera de las reivindicaciones 1-4, que comprende (a) cultivar una célula huésped que comprende un constructo de ácidos nucleicos que comprende una secuencia de nucleótidos que codifica el polipéptido bajo condiciones propicias para la producción del polipéptido; y (b) recuperar el polipéptido.

10. Polinucleótido que codifica un polipéptido con actividad de glucoamilasa, seleccionado del grupo que consta de: (a) un polinucleótido que codifica un polipéptido que tiene una secuencia de aminoácidos que tiene al menos un 90% de identidad con los aminoácidos del polipéptido maduro 1 a 556 de la SEC ID nº: 2; o (a1) un polinucleótido que codifica un polipéptido que tiene una secuencia de aminoácidos que tiene al menos un 90% de identidad con los aminoácidos del polipéptido maduro 1 a 561 de la SEC ID Nº: 37; (b) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 2166 de la SEC ID nº: 1; o (b1) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 2166 de la SEC ID nº: 36; (c) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 1725 de la SEC ID nº: 3; o (c1) un polinucleótido que tiene al menos un 90% de identidad con los nucleótidos 55 a 1737 de la SEC ID nº: 38; (d) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 1, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1725 de la SEC ID nº: 3, o (iii) una cadena complementaria de (i) o (ii) o (d1) un polipéptido que es codificado por una secuencia de nucleótidos (i) que se hibrida al menos bajo condiciones de astringencia altas con los nucleótidos 55 a 2166 de la SEC ID nº: 36, o (ii) que se hibrida al menos bajo condiciones de astringencia altas con la secuencia de ADNc contenida en los nucleótidos 55 a 1737 de la SEC ID nº: 38, o (iii) una cadena complementaria de (i) o (ii).

11. Proceso para elaborar un producto de fermentación a partir de un material que contiene almidón que incluye las etapas de: (a) licuefacción del material que contiene almidón en presencia de una alfa-amilasa; (b) sacarificación del material licuado obtenido en el paso (a) utilizando una glucoamilasa según cualquiera de las reivindicaciones 1-4; (c) fermentación del material sacarificado usando un organismo fermentador. 12. Proceso según la reivindicación 11, donde el paso (b) y (c) se realizan consecutivamente o simultáneamente (es decir, proceso de SSF). 13. Proceso según cualquiera de las reivindicaciones 11-12, donde el producto de fermentación es etanol 14. Proceso según cualquiera de las reivindicaciones 11-13, donde la materia prima que contiene almidón son granos enteros, preferiblemente granos de maíz o trigo enteros. 15. Proceso según cualquiera de las reivindicaciones 11-14, donde el organismo fermentador es una cepa de Saccharomyces.

16. Proceso según cualquiera de las reivindicaciones 11-15, que comprende además, antes del paso (a), los pasos de: X) reducir el tamaño de partícula de material que contiene almidón; Y) formar una pasta que comprende el material que contiene almidón y agua.

17. Proceso para elaborar un producto de fermentación de material que contiene almidón que comprende: (a) sacarificar el material que contiene almidón con una glucoamilasa según cualquiera de las reivindicaciones 1-4, a una temperatura inferior a la temperatura de gelatinización inicial de dicho material que contiene almidón; (b) fermentar utilizando un organismo fermentador.

18. Proceso de reivindicación 17, donde el material que contiene almidón es almidón granulado. 19. Proceso según cualquiera de las reivindicaciones 17-18, donde la sacarificación y la fermentación se realizan simultáneamente.

20. Proceso según la reivindicación 19, donde una alfa-amilasa está presente. 21. Proceso según la reivindicación 20, donde la alfa-amilasa es una alfa-amilasa fúngica, preferiblemente derivada del género Aspergillus, especialmente una cepa de A. niger, A. oryzae, A. awamori o Aspergillus kawachii, o del género Rhizomucor, preferiblemente una cepa de Rhizomucor pusillus, o el género Meripilus, preferiblemente una cepa de Meripilus giganteus. 22. Proceso según cualquiera de las reivindicaciones 17-21, donde el producto de fermentación es un alcohol, preferiblemente etanol, especialmente etanol combustible, etanol potable y/o etanol industrial.

23. Proceso para producir jarabe del material que contiene almidón, que comprende (a) licuefacción del material que contiene almidón en presencia de una alfa-amilasa, (b) sacarificación del material obtenido en el paso (a) utilizando una glucoamilasa según cualquiera de las reivindicaciones 1-4. 24. Composición que comprende una glucoamilasa según cualquiera de las reivindicaciones 1-4. 25. Composición según la reivindicación 24, que comprende además una alfa-amilasa.

26. Composición según la reivindicación 25, donde la alfa-amilasa se deriva del género Aspergillus, preferiblemente una cepa de A. niger, A. oryzae, Aspergillus awamori o A. kawachii; del género Rhizomucor, preferiblemente una cepa el Rhizomucor pusillus; o el género Meripilus, preferiblemente una cepa de Meripilus giganteus.

27. Composición según cualquiera de las reivindicaciones 24-26, que comprende además otra glucoamilasa.