Nuevos compuestos de imidazolidina como moduladores del receptor de andrógenos.

Un compuesto de acuerdo con la fórmula Ib:**Fórmula**

en la que

X es O o S;

R1 es H; o

R1 se elige entre C1-C6 alquilo, C3-C7 cicloalquilo, C3-C6 alquenilo, C3-C6 alquinilo y C1-C6 acilo; cada uno de los cuales puede estar opcionalmente sustituido con ciano, uno o más halo, hidroxilo, o C1-C6 alcoxi;

R2a se elige entre H, P

(O)(OH)2 y C(O)(CH2)n1C(O)OH; o

R2a se elige entre C1-C6 acilo y C3-C6 alquenilo; cada uno de los cuales puede estar opcionalmente sustituido con amino o carboxi; n1 es 0, 1, 2, 3 o 4;

cada R2b y R2c se elige independientemente entre H y C1-C6 alquilo; oR2b y R2c se pueden unir para formar un C3-C7 cicloalquilo;

R3a es H, halo, ciano o nitro;

cada R3b es independientemente halo, ciano o nitro;

cada R4a y R4b es independientemente H, halo, ciano, carboxi o nitro; o

cada R4a y R4b se elige entre C1-C6 alquilo y C1-C6 alcoxi; cada uno de los cuales puede estar opcionalmente sustituido con uno o más halo, o C1-C6 alcoxi; o

R4a y R4b se unen para formar un cicloalquilo de 5 o 6 miembros, heterocicloalquilo de 5 o 6 miembros, arilo de 5 o 6 miembros o heteroarilo de 5 o 6 miembros;

R4c es halo, ciano o nitro; y

m1 es 0, 1 o 2;

o las sales farmacéuticamente aceptables, y los solvatos de los compuestos o los solvatos de sus sales farmacéuticamente aceptables.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2009/061733.

Solicitante: Akashi Therapeutics, Inc.

Inventor/es: WIGERINCK, PIET, TOM, BERT, PAUL, DEPREZ, PIERRE, LEFRANCOIS, JEAN-MICHEL, NIQUE, FRANCOIS, JAGERSCHMIDT,CATHERINE, BLANQUÉ,ROLAND, PEIXOTO,CHRISTOPHE, TRIBALLEAU,NICOLAS, NAMOUR,FLORENCE SYLVIE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > A61P35/00 (Agentes antineoplásicos)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen ingredientes... > A61K31/4166 (teniendo grupos oxo unidos directamente al heterociclo, p. ej. fenitoína)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > COMPUESTOS HETEROCICLICOS (Compuestos macromoleculares... > Compuestos heterocíclicos que contienen ciclos de... > C07D233/60 (con radicales hidrocarbonados, sustituidos por átomos de oxígeno o azufre, unidos a los átomos de nitrógeno del ciclo)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > COMPUESTOS HETEROCICLICOS (Compuestos macromoleculares... > Compuestos heterocíclicos que contienen ciclos de... > C07D233/66 (con heteroátomos o con átomos de carbono que tienen 3 enlaces a heteroátomos, con a lo sumo un enlace a halógeno, p. ej. radicales éster o nitrilo, unidos directamente a los átomos de carbono del ciclo)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Nuevos compuestos de imidazolidina como moduladores del receptor de andrógenos Antecedentes de la invención La presente invención se refiere a compuestos de imidazolidina que pueden afectar la actividad del receptor de andrógenos (AR). En un aspecto, un compuesto de la invención es un antagonista o antagonista parcial y está destinado a la prevención y/o el tratamiento de tumores dependientes de andrógenos y/o a todas las afecciones en las que la estimulación del AR puede ser perjudicial como acné, alopecia y/o hirsutismo; o en un aspecto alternativo un compuesto de la invención es un modulador selectivo del receptor de andrógenos (agonista o agonista/antagonista mixto) que se puede usar en el tratamiento de afecciones caquécticas y trastornos de atrofia muscular progresiva (por ejemplo, pero no exclusivamente, caquexia inducida por cáncer, inducida por VIH, inducida por glucocorticoides, inducida por inmovilización, pérdida muscular inducida por dieta, quemaduras térmicas, insuficiencia renal crónica, insuficiencia cardíaca congestiva o enfermedad pulmonar obstructiva crónica) declinación funcional relacionada con el envejecimiento (por ejemplo, pero no exclusivamente, sarcopenia) y/u osteoporosis masculina o femenina. La presente invención también proporciona procesos para la producción de los compuestos de la invención, las composiciones farmacéuticas que contienen un compuesto de la invención y el uso de un compuesto de la invención en la prevención o el tratamiento de los trastornos dados a conocer en este documento.

En los hombres, los andrógenos, de los cuales la testosterona y su metabolito 5α-DHT son los principales representantes endógenos, se asocian al desarrollo y el mantenimiento de las características masculinas primarias (epidídimo, conductos deferentes, próstata, genitales externos) y las características masculinas secundarias (desarrollo de vello, musculatura de la laringe, distribución del tejido graso, comportamiento y libido). Además, contribuyen al desarrollo muscular y óseo, y también actúan sobre la hematopoyesis, el sistema nervioso central y la función sexual.

En las mujeres, los andrógenos han sido implicados entre otras cosas en el desarrollo y el mantenimiento del tejido óseo y la libido.

La reducción progresiva en los niveles de andrógenos circulantes en los hombres entrados en años (PADAM: declinación parcial de andrógenos en hombres añosos) contribuye a una serie de manifestaciones clínicas específicas, que incluyen osteoporosis, pérdida de la fuerza y la masa muscular, disminución de la libido y disfunción sexual, anemia y cambios en la cognición, cambios de humor y depresión (véase una revisión en: Kaufman JM y Vermeulen A., 2005, The decline of androgen levels in elderly men and its clinical and therapeutic implications Endocr Rev. 26:833-76). Sin embargo, la seguridad clínica de la terapia con andrógenos para las enfermedades cardiovasculares y prostáticas es incierta. Por consiguiente, no se recomienda la complementación con andrógenos, en hombres ancianos sanos (Liu PY et al. 2004, Clinical review, 171: The rationale, efficacy and safety of androgen therapy in older men: future research and current practice recommendations. J. Clin. Endocrinol. Metab. 89:4789-96).

También se ha descrito en las mujeres un síndrome asociado a la reducción de los niveles de andrógenos circulantes (ADIF: disminución de andrógenos en las mujeres). Puede tener varias causas, que incluyen el envejecimiento, la quimioterapia y la infección por el virus del SIDA. Los síntomas asociados incluyen: osteoporosis/osteopenia, sarcopenia y debilidad muscular, disminución de la libido, disfunción sexual, cambios en la cognición, cambios de humor y depresión. También se han descrito endometriosis y mayor riesgo de cáncer de mama, de útero y de ovario (Davison SL y Davis SR 2003 Androgens in women. J. Steroid Biochem. Mol. Biol.

85:363-366). La administración de dosis altas de andrógenos a las mujeres puede resultar en la aparición de signos de masculinización, cambios de humor y acné. Se deben tener en cuenta estos riesgos cuando se administran andrógenos a las mujeres.

Las limitaciones al uso de agonistas o antagonistas esteroides de los receptores de andrógenos, se torna clara puesto que estos están plagados de efectos indeseables debidos a su metabolización en otras hormonas sexuales y esteroides, los que a su vez inducen efectos indeseables.

Por consiguiente, se están investigando alternativas no esteroideas que son particularmente deseadas porque permiten los efectos beneficiosos de la testosterona sobre órganos específicos (tejido óseo y muscular) y el mantenimiento de la libido, y es menos probable que tengan efectos secundarios sobre tejidos específicos, como la próstata en los hombres y el útero en las mujeres, dado que no interferirían con el sistema hormonal. Representan una terapia alternativa más segura frente a las terapias convencionales en cualquiera de las patologías vinculadas al déficit de andrógenos, como osteoporosis o sarcopenia, y la disminución en la libido asociada a los síndromes del tipo PADAM y ADIF. También se pueden usar en el tratamiento de caquexia inducida por enfermedades específicas, como cáncer o SIDA, o en el tratamiento de pérdida muscular inducida por el tratamiento a largo plazo con glucocorticoides. Además, se pueden usar en el tratamiento de tumores dependientes de andrógenos, como cáncer o hiperplasia de próstata, cuyo crecimiento en una etapa precoz puede ser regulado habitualmente por administración de antiandrógenos esteroides.

Los moduladores selectivos de los receptores de andrógenos (SARM -moduladores selectivos de los receptores de andrógenos) de estructura no esteroidea son moléculas que actúan como ligandos de los receptores de andrógenos (AR) con cierto grado de especificidad tisular.

La importancia del AR como objetivo es grande en muchas áreas del descubrimiento de fármacos y la farmacoterapia. Se sugiere que los compuestos de la invención dados a conocer en este documento tienen dos modos de acción principales:  Como antagonistas (totales o parciales), inhibidores del AR se pueden emplear en oncología, y pueden ser particularmente útiles en el tratamiento del cáncer de próstata dependiente de andrógenos. También se pueden usar como anticonceptivos masculinos y en la hiperplasia benigna de próstata, y el cáncer de ovario y de mama (por un análisis comparativo véanse Mohler et al., Expert Opin. Ther. Patents (2005) 15(11), 1565-1585).

 Como agonistas (totales o parciales, incluidos los agonistas/antagonistas mixtos), pueden ser particularmente útiles para trastornos metabólicos y enfermedades endocrinas, especialmente enfermedades relacionadas con el envejecimiento y afecciones caquécticas. Además debido a su presencia en las células óseas, los SARM se pueden usar ventajosamente en el desarrollo y el mantenimiento del esqueleto.

Desafortunadamente los andrógenos disponibles en la actualidad siguen siendo defectuosos, con efectos secundarios (como ginecomastia o sensibilidad en las mamas) debido a la baja selectividad tisular, y son muy deseables SARM potentes con menos efectos secundarios.

EP-A-0966447 da a conocer una serie de compuestos de imidazolidina útiles en el tratamiento de afecciones inflamatorias y mediadas por células inmunitarias, y que actúan inhibiendo la interacción de las moléculas de adhesión celular. Aunque los compuestos dados a conocer en ese documento son similares a los de la presente invención, en algunos aspectos no hay ninguna divulgación de compuestos comprendidos por el alcance de la presente invención.

EP-A-0572191 da a conocer ciertas imidazolidinas sustituidas con un grupo yodopropargilo, útiles como antimicrobianos.

WO 2007/137874 da a conocer compuestos de imidazolidina similares a los de la presente invención pero en los cuales, en la fórmula (I), al menos uno de R3a o R3b es OH, SH o uno de sus derivados. Esos compuestos requieren un grupo OH o SH disponible en los grupos activos para poder unirse a His-874 del receptor de andrógenos. Esos compuestos presentan una alta actividad in vitro pero una actividad decepcionantemente baja in vivo, de modo que esos compuestos no se consideran viables desde el punto de vista comercial.

Sorprendentemente, se encontró en la actualidad que la actividad in vivo se puede aumentar sustancialmente eliminando el grupo débilmente ácido OH fenólico o SH, o los derivados que puedan producir este OH o SH, partir de la posición R3.

Resumen de la invención Los compuestos de la invención tienen buena absorción, buena semivida, buena solubilidad, buena biodisponibilidad y buena estabilidad metabólica. En un aspecto particular, un compuesto de la invención presenta mejoras inesperadamente significativas en sus propiedades farmacológicas, en particular una mayor biodisponibilidad.

Por lo tanto, la presente invención proporciona derivados de imidazolidina y métodos para identificar y designar un compuesto de la invención, donde dichos compuestos afectan la actividad de los receptores de andrógenos.

La presente invención proporciona un compuesto de la invención como el reivindicado en las reivindicaciones, que tiene la fórmula Ib siguiente: en la que X es O o S; R1 es H; o R1 se elige entre C1-C6 alquilo, C3-C7 cicloalquilo, C3-C6 alquenilo, C3-C6 alquinilo y C1-C6 acilo; cada uno de los cuales puede estar opcionalmente sustituido con ciano, uno o más halo, hidroxilo, o C1-C6 alcoxi sin sustituir; R2a se elige entre H, P(O)(OH)2 y C(O)(CH2)n1C(O)OH; o R2a se elige entre C1-C6 acilo y C3-C6 alquenilo; cada uno de los cuales puede estar opcionalmente sustituido con amino o carboxi; n1 es 0, 1, 2, 3 o 4; cada R2b y R2c se elige independientemente entre H y C1-C6 alquilo; o R2b y R2c se pueden unir para formar un C3-C7 cicloalquilo; R3a es H, halo, ciano o nitro; cada R3b es independientemente halo, ciano o nitro; cada R4a y R4b es independientemente H, halo, ciano, carboxi o nitro; o cada R4a y R4b se elige entre C1-C6 alquilo y C1-C6 alcoxi; cada uno de los cuales puede estar opcionalmente sustituido con uno o más halo, o C1-C6 alcoxi; o R4a y R4b se unen para formar un cicloalquilo de 5 o 6 miembros, heterocicloalquilo de 5 o 6 miembros, arilo de 5 o 6 miembros o heteroarilo de 5 o 6 miembros; R4c es halo, ciano o nitro; y m1 es 0, 1 o 2.

En otro aspecto, la presente invención proporciona composiciones farmacéuticas que contienen un compuesto de la invención y un portador, excipiente o diluyente farmacéuticamente aceptable. En este aspecto de la invención, la composición farmacéutica puede contener uno o más de los compuestos de la invención descritos en este documento. Además, un compuesto de la invención útil en las composiciones farmacéuticas y los métodos de tratamiento dados a conocer aquí, es farmacéuticamente aceptable de la manera que se prepara y se usa.

En otro aspecto de la invención, esta invención proporciona un compuesto de la invención para usar en un método de tratamiento de un mamífero propenso a una afección o aquejado de una afección de las que se indican en este documento, y particularmente enfermedades relacionadas con el envejecimiento por ejemplo, pero no exclusivamente, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades que incluyen, entre otras, cáncer y SIDA, enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual o anemia, donde dicho método comprende administrar una cantidad eficaz de un compuesto agonista o agonista/antagonista mixto de la invención o una composición farmacéutica que contenga un compuesto agonista o agonista/antagonista mixto de la invención como el descrito en este documento.

En otro aspecto, la presente invención proporciona un compuesto de la invención para usar en un método de tratamiento de un mamífero propenso a tumores o aquejado de tumores dependientes de andrógenos, como cáncer o hiperplasia de próstata, donde dicho método comprende administrar una cantidad eficaz de un compuesto antagonista de la invención o una composición farmacéutica que contenga un compuesto antagonista de la invención como el descrito en este documento.

En otro aspecto, la presente invención proporciona un compuesto de la invención para usar en el tratamiento o la prevención de una afección elegida entre las que se indican en este documento, y particularmente enfermedades relacionadas con el envejecimiento por ejemplo, pero no exclusivamente, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades que incluyen, entre otras, cáncer y SIDA, enfermedad pulmonar obstructiva crónica, insuficiencia renal crónica, quemaduras térmicas, enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual o anemia, donde dicho método comprende administrar una cantidad eficaz de un compuesto agonista o agonista/antagonista mixto de la invención o una composición farmacéutica que contenga un compuesto agonista o agonista/antagonista mixto de la invención como el descrito en este documento.

En otro aspecto, la presente invención proporciona un compuesto de la invención para usar en el tratamiento o la prevención de una afección elegida entre las indicadas en este documento, como cáncer o hiperplasia de próstata, donde dicho método comprende administrar una cantidad eficaz de un compuesto antagonista de la invención o una composición farmacéutica que contenga un compuesto antagonista de la invención como el descrito en este documento.

En aspectos adicionales, esta invención proporciona métodos para sintetizar un compuesto de la invención, de los cuales se dan a conocer más adelante protocolos y rutas de síntesis representativos.

En otro aspecto, la presente invención proporciona métodos para determinar la actividad agonista o antagonista de un compuesto de la invención descrito en este documento.

En consecuencia, es un objetivo principal de esta invención proporcionar una serie de nuevos compuestos, que puedan modular la actividad del receptor de andrógenos (AR) y de ese modo prevenir o tratar todas las enfermedades que pueden estar relacionadas causalmente con la actividad aberrante de éste.

Otro objetivo de la presente invención es proporcionar un compuesto de la invención como el mencionado previamente que pueda actuar como un agonista o agonista/antagonista mixto del AR, y que por lo tanto sea eficaz para tratar o aliviar enfermedades como las enfermedades relacionadas con el envejecimiento, por ejemplo, pero no exclusivamente, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades que incluyen, entre otras, cáncer y SIDA, enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual o anemia.

Otro objetivo de esta invención es proporcionar una serie de compuestos que puedan actuar como antagonistas del AR, y de esa manera ser eficaces para tratar o aliviar enfermedades o síntomas de las mismas, como cáncer de próstata dependiente de andrógenos, anticoncepción masculina e hiperplasia benigna de próstata, cáncer de ovario y de mama. En un aspecto, un compuesto de la invención es un antagonista o antagonista parcial y se usa en la prevención y/o el tratamiento de tumores dependientes de andrógenos y de todas las afecciones en las que la estimulación del AR puede ser perjudicial como acné, alopecia e hirsutismo; o en un aspecto alternativo el compuesto de la invención es un modulador selectivo del receptor de andrógenos (agonista o agonista/antagonista mixto) que se puede usar en el tratamiento de afecciones caquécticas y trastornos de atrofia muscular progresiva (que incluyen, pero no exclusivamente, caquexia inducida por cáncer, inducida por VIH, inducida por glucocorticoides, inducida por inmovilización, pérdida muscular inducida por dieta, quemaduras térmicas, insuficiencia renal crónica o enfermedad pulmonar obstructiva crónica), declinación funcional relacionada con el envejecimiento (por ejemplo, pero no exclusivamente, sarcopenia) y osteoporosis masculina y femenina.

La presente invención también proporciona procesos para la producción de un compuesto de la invención, composiciones farmacéuticas que contienen un compuesto de la invención y el uso de un compuesto de la invención en la prevención o el tratamiento de cualquiera de los trastornos dados a conocer en este documento.

Aún otro objetivo de esta invención es proporcionar composiciones farmacéuticas que contengan o incluyan un compuesto de la invención, para los usos terapéuticos mencionados en este documento.

Todavía otro objetivo más de la invención es proporcionar un compuesto de la invención para usar en métodos de tratamiento que empleen dicho compuesto o una composición farmacéutica de la invención.

Otros objetivos y ventajas se tornarán evidentes para los expertos a partir de la consideración de la descripción detallada resultante.

Descripción detallada de la invención Definiciones Los términos siguientes pretenden tener los significados presentados en relación con ellos a continuación y son útiles en la comprensión de la descripción y el alcance propuesto de la presente invención.

Al describir la invención, que puede incluir los compuestos de la invención, las composiciones farmacéuticas que contienen dichos compuestos de la invención y los métodos de uso de dichos compuestos y composiciones de la invención, los términos siguientes, si están presentes, tienen el significado siguiente a menos que se indique lo contrario. Se debe entender que cuando se describen en este documento cualquiera de las porciones definidas a continuación pueden estar sustituidas con diversos sustituyentes y que las definiciones respectivas tienen la intención de incluir dichas porciones sustituidas dentro de su alcance según se indica a continuación. A menos que se indique lo contrario, el término "sustituido(a)"se definirá como se indica a continuación. Se debe entender que los términos "grupos" y "radicales" se pueden considerar intercambiables cuando se usan en este documento.

Los artículos 'un' y 'una' se pueden usar para referirse a uno o más de uno (es decir al menos uno) de los objetos gramáticos del artículo. A modo de ejemplo, "un análogo" significa un análogo o más de un análogo.

'Acilo' se refiere a un radical -C(O)R20, en el que R20 es hidrógeno, C1-C6 alquilo, C3-C7 cicloalquilo, C3-C10 cicloalquil metilo, heterocicloalquilo de 4 a 10 miembros, arilo, arilalquilo, heteroarilo o heteroarilalquilo de 5 a 10 miembros según se define en este documento. Los ejemplos representativos incluyen, pero no exclusivamente, formilo, acetilo, ciclohexilcarbonilo, ciclohexilmetilcarbonilo, benzoilo y bencilcarbonilo. Los ejemplos de grupos 'acilo' son -C(O)H, -C(O)-C1-C6 alquilo, -C(O)-(CH2)t(C6-C10 arilo), -C(O)-(CH2)t(heteroarilo de 5-10 miembros), -C(O)-(CH2)t(C3-C10 cicloalquilo) y -C(O)-(CH2)t(heterocicloalquilo de 4-10 miembros), en los que t es un número entero entre 0 y 4.

'Acilamino' se refiere a un radical -NR22C(O)R23, en el que R22 es hidrógeno, C1-C6 alquilo, C3-C7 cicloalquilo, heterocicloalquilo de 4-10 miembros, C6-C10 arilo, arilalquilo, heteroarilo o heteroarilalquilo de 5-10 miembros y R23 es hidrógeno, C1-C6 alquilo, C3-C10 cicloalquilo, heterocicloalquilo de 4-10 miembros, C6-C10 arilo, arilalquilo, heteroarilo o heteroarilalquilo de 5-10 miembros, como los definidos en este documento. Los ejemplos de 'acilamino' incluyen, entre otros, formilamino, acetilamino, ciclohexilcarbonilamino, ciclohexilmetil-carbonilamino, benzoilamino y bencilcarbonilamino. Los ejemplos de grupos 'acilamino' son -NR21'C(O)-C1-C6 alquilo, -NR21'C(O)-(CH2)t(C6-C10 arilo), -NR21'C(O)-(CH2)t(heteroarilo de 5-10 miembros), -NR21'C(O)-(CH2)t(C3-C7 cicloalquilo) y -NR21'C(O)- (CH2)t(heterocicloalquilo de 4-10 miembros), en los que t es un número entero entre 0 y 4, cada R21 representa independientemente H o C1-C6 alquilo.

'Alcoxi' se refiere al grupo -OR26 en el que R26 es C1-C6 alquilo. Grupos alcoxi particulares son metoxi, etoxi, n- propoxi, isopropoxi, n-butoxi, tert-butoxi, sec-butoxi, n-pentoxi, n-hexoxi y 1,2-dimetilbutoxi. Grupos alcoxi particulares son los alcoxi inferiores, es decir que tienen entre 1 y 6 átomos de carbono. Otros grupos alcoxi particulares tienen entre 1 y 4 átomos de carbono.

'Alcoxicarbonilo' se refiere a un radical -C(O)-OR27 en el que R27 representa un C1-C6 alquilo, C3-C7 cicloalquilo, C3- C10 cicloalquilalquilo, heterocicloalquilalquilo de 4-10 miembros, aralquilo o heteroarilalquilo de 5-10 miembros como los definidos en este documento. Los ejemplos de grupos "alcoxicarbonilo" son C(O)O-C1-C6 alquilo, -C(O)O- (CH2)t(C6-C10 arilo), -C(O)O-(CH2)t(heteroarilo de 5-10 miembros), -C(O)O-(CH2)t(C3-C7 cicloalquilo) y-C(O)O- (CH2)t(heterocicloalquilo de 4-10 miembros), en los que t es un número entero entre 1 y 4.

'O-Aril-carbonilo' se refiere a un radical -C(O)-OR29 en el que R29 representa un C6-C10 arilo, como el definido en este documento. Un ejemplo de grupos "O-Aril-carbonilo" es -C(O)O-(C6-C10 arilo).

'Hetero-O-Aril-carbonilo' se refiere a un radical -C(O)-OR31 en el que R31 representa un heteroarilo de 5-10 miembros, como el definido en este documento.

'Alquilo' significa un hidrocarburo alifático, lineal o ramificado, de 1 a 6 átomos de carbono. Otro grupo particular tiene de 1 a 4 átomos de carbono. Los ejemplos de grupos de cadena lineal incluyen metilo, etilo, n-propilo y n- butilo. De cadena ramificada significa que uno o más grupos alquilo inferiores como metilo, etilo, propilo o butilo está unido a una cadena alquílica lineal, los ejemplos de grupos ramificados incluyen isopropilo,iso-butilo, t-butilo y isoamilo.

'Amino' se refiere al radical -NH2.

'Alquilamino' se refiere al grupo -NHR34, en el que R34 es C1-C6 alquilo.

'Alquilarilamino' se refiere al grupo -NR36R37, en el que R36 es C6-C10 arilo y R37 es C1-C6 alquilo.

'Arilamino' significa un radical -NHR40 en el que R40 se elige entre C6-C10 arilo y heteroarilo de 5-10 miembros como los definidos en este documento.

'Dialquilamino' se refiere al grupo -NR42R43, en el que cada uno de R42 y R43 se elige independientemente entre C1- C6 alquilo.

'Diarilamino' se refiere al grupo -NR46R47, en el que cada uno de R46 y R47 se elige independientemente entre C6-C10 arilo.

'Aminosulfonilo' o 'sulfonamida' se refiere al radical -S(O2)NH2.

'Aralquilo' o 'arilalquilo' se refiere a un grupo alquilo, como el definido antes, sustituido con uno o más grupos arilo, como los definidos antes. Grupos alquilo o arilalquilo particulares son grupos alquilo sustituidos con un grupo arilo.

'Arilo' se refiere a un grupo hidrocarburo aromático monovalente derivado por eliminación de un átomo de hidrógeno de un solo átomo de carbono de un sistema de anillo aromático precursor. En particular arilo se refiere a una estructura de anillo aromático, monocíclico o policíclico que tiene de 5 a 12 miembros en el anillo, más usualmente de 6 a 10. Cuando el grupo arilo es un sistema de anillo monocíclico contiene preferentemente 6 átomos de carbono.

Los grupos arilo típicos incluyen, pero no exclusivamente, grupos derivados de aceantrileno, acenaftileno, acefenantrileno, antraceno, azuleno, benceno, criseno, coroneno, fluoranteno, fluoreno, hexaceno, hexafeno, hexaleno, as-indaceno, s-indaceno, indano, indeno, naftaleno, octaceno, octafeno, octaleno, ovaleno, penta-2,4- dieno, pentaceno, pentaleno, pentafeno, perileno, fenaleno, fenantreno, piceno, pleiadeno, pireno, pirantreno, rubiceno, trifenileno y trinaftaleno. Particularmente los grupos arilo incluyen fenilo, naftilo, indenilo y tetrahidronaftilo.

'Amido' se refiere al radical -C(O)NH2.

'Carboxi' se refiere al radical -C(O)OH.

'Cicloalquilo' se refiere a grupos hidrocarbilo cíclicos no aromáticos que tienen de 3 a 7 átomos de carbono. Dichos grupos cicloalquilo incluyen, a modo de ejemplo, estructuras de un solo anillo como ciclopropilo, ciclobutilo, ciclopentilo, ciclohexilo y cicloheptilo.

'Ciano' se refiere al radical -CN.

'Halo' o 'halógeno' se refiere a fluoro (F), cloro (Cl), bromo (Br) y yodo (I). Grupos halo particulares son fluoro o cloro.

'Hetero' cuando se usa para describir un compuesto o un grupo presente en un compuesto significa que uno o más átomos de carbono del compuesto o grupo han sido reemplazados por un heteroátomo de nitrógeno, oxígeno o azufre. Hetero se puede aplicar a cualquiera de los grupos hidrocarbilo descritos antes como alquilo, por ej.

heteroalquilo, cicloalquilo, por ej. heterocicloalquilo, arilo, por ej. heteroarilo, cicloalquenilo, por ej. cicloheteroalquenilo, y similares que tengan de 1 a 5, y particularmente de 1 a 3 heteroátomos.

'Heteroarilo' significa una estructura de anillo aromático, monocíclico o policíclico, que incluye uno o más heteroátomos y 5 a 12 miembros en el anillo, más usualmente de 5 a 10 miembros en el anillo. El grupo heteroarilo puede ser, por ejemplo, un anillo monocíclico de cinco o seis miembros o una estructura bicíclica formada a partir de anillos de cinco y seis miembros fusionados o dos anillos de seis miembros fusionados o, a modo de otro ejemplo, dos anillos de cinco miembros fusionados. Cada anillo puede contener hasta cuatro heteroátomos elegidos habitualmente entre nitrógeno, azufre y oxígeno. Generalmente el anillo heteroarilo contendrá hasta 4 heteroátomos, más generalmente hasta 3 heteroátomos, más generalmente hasta 2, por ejemplo un solo heteroátomo. En una realización, el anillo heteroarilo contiene al menos un átomo de nitrógeno en el anillo. Los átomos de nitrógeno en los anillos heteroarilo pueden ser básicos como en el caso de un nitrógeno de imidazol o piridina, o esencialmente no básicos como en el caso de un nitrógeno de indol o pirrol. En general la cantidad de átomos de nitrógeno básicos presentes en el grupo heteroarilo, incluidos todos los grupos amino sustituyentes del anillo, será menor de cinco. Los ejemplos de grupos heteroarilo monocíclicos de cinco miembros incluyen, pero no exclusivamente, grupos pirrol, furano, tiofeno, imidazol, furazano, oxazol, oxadiazol, oxatriazol, isoxazol, tiazol, isotiazol, pirazol, triazol y tetrazol.

Los ejemplos de grupos heteroarilo monocíclicos de seis miembros incluyen, pero no exclusivamente, piridina, pirazina, piridazina, pirimidina y triazina. Los ejemplos particulares de grupos heteroarilo bicíclicos que contienen un anillo de cinco miembros fusionado a otro anillo de cinco miembros incluyen, pero no exclusivamente, imidazotiazol e imidazoimidazol. Los ejemplos particulares de grupos heteroarilo bicíclicos que contienen un anillo de seis miembros fusionado a un anillo de cinco miembros incluyen, pero no exclusivamente, grupos benzofurano, benzotiofeno, bencimidazol, benzoxazol, isobenzoxazol, bencisoxazol, benzotiazol, bencisotiazol, isobenzofurano, indol, isoindol, isoindolona, indolizina, indolina, isoindolina, purina (por ej., adenina, guanina), indazol, pirazolopirimidina, triazolopirimidina, benzodioxol y pirazolopiridina. Los ejemplos particulares de grupos heteroarilo bicíclicos que contienen dos anillos de seis miembros fusionados incluyen, pero no exclusivamente, grupos quinolina, isoquinolina, cromano, tiocromano, cromeno, isocromeno, cromano, isocromano, benzodioxano, quinolizina, benzoxazina, benzodiazina, piridopiridina, quinoxalina, quinazolina, cinolina, ftalazina, naftiridina y pteridina. Los grupos heteroarilo particulares son los derivados de tiofeno, pirrol, benzotiofeno, benzofurano, indol, piridina, quinolina, imidazol, oxazol y pirazina.

Los ejemplos de arilo representativos que contienen heteroátomos que tienen sustitución incluyen los siguientes: en los que cada W se elige entre C(R54)2, NR54, O y S; y cada Y se elige entre carbonilo, NR54, O y S; y R54 es independientemente hidrógeno, C1-C6 alquilo, C3-C70 cicloalquilo, heterocicloalquilo de 4-10 miembros, C6-C10 arilo y heteroarilo de 5-10 miembros.

Los ejemplos de heteroarilos representativos incluyen los siguientes: en los que cada Y se elige entre carbonilo, N, NR55, O y S; y R55 es independientemente hidrógeno, C1-C6 alquilo, C3-C7 cicloalquilo, heterocicloalquilo de 4-10 miembros, C6-C10 arilo y heteroarilo de 5-10 miembros.

Según se usa en este documento, el término 'heterocicloalquilo' se refiere a un anillo heterocíclico, no aromático, estable de 4-10 miembros, y/o incluidos los anillos que contienen uno o más heteroátomos elegidos independientemente entre N, O y S, fusionados al mismo. Un sistema de anillo heterocíclico fusionado puede incluir anillos carbocíclicos y sólo tiene que incluir un anillo heterocíclico. Los ejemplos de anillos heterocíclicos incluyen, pero no exclusivamente, morfolina, piperidina (por ej. 1-piperidinilo, 2-piperidinilo, 3-piperidinilo y 4-piperidinilo), pirrolidina (por ej. 1-pirrolidinilo, 2-pirrolidinilo y 3-pirrolidinilo), pirrolidona, pirano (2H-pirano o 4H-pirano), dihidrotiofeno, dihidropirano, dihidrofurano, dihidrotiazol, tetrahidrofurano, tetrahidrotiofeno, dioxano, tetrahidropirano (por ej. 4-tetrahidro piranilo), imidazolina, imidazolidinona, oxazolina, tiazolina, 2-pirazolina, pirazolidina, piperazina y N-alquil piperazinas como N-metil piperazina. Otros ejemplos incluyen tío morfolina y sus S-oxido y S,S-dióxido (particularmente tiomorfolina). Aún otros ejemplos incluyen azetidina, piperidona, piperazona y N-alquil piperidinas como N-metil piperidina. Ejemplos particulares de grupos heterocicloalquilo se muestran en los ejemplos ilustrativos siguientes: en los que cada W se elige entre CR56, C(R56)2, NR56, O y S; y cada Y se elige entre NR56, O y S; y R56 es independientemente hidrógeno, C1-C6 alquilo, C3-C7 cicloalquilo, heterocicloalquilo de 4-10 miembros, C6-C10 arilo, heteroarilo de 5-10 miembros. Estos anillos heterocicloalquilo pueden estar opcionalmente sustituidos con uno o más grupos elegidos del grupo que consiste en acilo, acilamino, aciloxi (-O-acilo o -OC(O)R2), alcoxi, alcoxicarbonilo, alcoxicarbonilamino (-NR"-alcoxicarbonilo o -NH-C(O)-OR27), amino, amino sustituido, aminocarbonilo (amido o - C(O)-NR"2), aminocarbonilamino (-NR"-C(O)-NR"2), aminocarboniloxi (-O-C(O)-NR"2), aminosulfonilo, sulfonilamino, arilo, -O-arilo, azido, carboxilo, ciano, cicloalquilo, halógeno, hidroxi, nitro, tiol, -S-alquilo, -S-arilo, -S(O)-alquilo,- S(O)-arilo, -S(O)2-alquilo y -S(O)2-arilo. Los grupos sustituyentes incluyen carbonilo o tiocarbonilo los que proporcionan, por ejemplo, derivados lactama y urea.

'Hidroxi' se refiere al radical -OH.

'Nitro' se refiere al radical -NO2.

'Sustituido(a)' se refiere a un grupo en el cual uno o más átomos de hidrógeno son reemplazados independientemente con el (o los) mismo(s) o diferente(s) sustituyente(s). Los sustituyentes típicos se pueden elegir del grupo que consiste en: halógeno, -R57, -O-, =O, -OR57, -SR57, -S-, =S, -NR57R58, =NR57, -CCl3, -CF3, -CN, -OCN -SCN, -NO, -NO2, =N2, -N3, -S(O)2O-, -S(O)2OH, -S(O)2R57, -OS(O2)O-, -OS(O)2R57, -P(O)(O-)2, -P(O)(OR57)(O-), - OP(O)(OR57)(OR58), -C(O)R57, -C(S)R57, -C(O)OR57, -C(O)NR57R58, -C(O)O-, -C(S)OR57,-NR59C(O)NR57R58, -NR59C(S)NR57R58, -NR60C(NR59)NR57R58 y -C(NR59)NR57R58; en los que cada R57, R58, R59 y R60 son independientemente:  hidrógeno, C1-C6 alquilo, C6-C10 arilo, arilalquilo, C3-C7 cicloalquilo, heterocicloalquilo de 4-10 miembros, heteroarilo de 5-10 miembros, heteroarilalquilo; o  C1-C6 alquilo sustituido con halo o hidroxi; o  C6-C10 arilo, heteroarilo de 5-10 miembros, C6-C7 cicloalquilo o heterocicloalquilo de 4-10 miembros sustituido con C1-C4 alquilo sin sustituir, halo, C1-C4 alcoxi sin sustituir, C1-C4 haloalquilo sin sustituir, C1-C4 hidroxialquilo sin sustituir, o C1-C4 haloalcoxi sin sustituir o hidroxi.

En una realización particular, los grupos sustituidos están sustituidos con uno o más sustituyentes, particularmente con 1 a 3 sustituyentes, en particular con un grupo sustituyente.

'Perfluoro' cuando se usa como prefijo, se refiere a un grupo en el que todos los átomos de hidrógeno de dicho grupo fueron reemplazados por átomos de flúor. Particularmente, el término perfluoroalquilo se refiere a un alquilo (según se definió en este documento) en el que todos los átomos de hidrógeno han sido reemplazados por átomos de flúor. Un grupo perfluoroalquilo particular es CF3.

En otra realización particular el grupo o los grupos sustituyentes se eligen entre: halo, ciano, nitro, trifluorometilo, trifluorometoxi, azido, -NR"'SO2R", -SO2NR"R", -C(O)R", -C(O)OR", -OC(O)R",-NR"'C(O)R", -C(O)NR"R"', -NR"R"', - (CR"'R"')mOR"', en los que, cada R" se elige independientemente entre H, C1-C6 alquilo, -(CH2)t(C6-C10 arilo), - (CH2)t(heteroarilo de 5-10 miembros), -(CH2)t(C3-C7 cicloalquilo), y -(CH2)t(heterocicloalquilo de 4-10 miembros), en los que t es un número entero entre 0 y 4; y • todos los grupos alquilo presentes, pueden ellos mismos estar sustituidos con halo o hidroxi; y • todos los grupos arilo, heteroarilo, cicloalquilo o heterocicloalquilo presentes, pueden ellos mismos estar sustituidos con C1-C4 alquilo sin sustituir, halo, C1-C4 alcoxi sin sustituir, C1-C4 haloalquilo sin sustituir, C1-C4 hidroxialquilo sin sustituir o C1-C4 haloalcoxi sin sustituir, o hidroxi. Cada R” representa independientemente H o C1-C6 alquilo.

'Sulfo' o 'ácido sulfónico' se refiere a un radical como -SO3H.

Un experto en el área de la síntesis orgánica reconocerá que el número máximo de heteroátomos en un anillo heterocíclico estable o químicamente factible, ya sea aromático o no aromático, está determinado por el tamaño del anillo, el grado de insaturación y la valencia de los heteroátomos. En general, un anillo heterocíclico puede tener uno a cuatro heteroátomos en tanto el anillo heteroaromático sea químicamente factible y estable.

'Farmacéuticamente aceptable' significa aprobado(a) o aprobable por un organismo regulador del gobierno federal o estatal o el organismo correspondiente en países que no sean Estados Unidos; o que esté indicado(a) en la farmacopea de los Estados Unidos u otra farmacopea reconocida en general, para el uso en animales, y más particularmente, en seres humanos.

'Sal farmacéuticamente aceptable' se refiere a una sal de un compuesto de la invención que es farmacéuticamente aceptable y posee la actividad farmacológica deseada del compuesto precursor. En particular, dichas sales no son tóxicas y pueden ser sales de adición de ácido inorgánico u orgánico y sales de adición de bases. Específicamente, dichas sales incluyen: (1) sales de adición de ácido, formadas con ácidos inorgánicos como ácido clorhídrico, ácido bromhídrico, ácido sulfúrico, ácido nítrico, ácido fosfórico y similares; o formadas con ácidos orgánicos como ácido acético, ácido propiónico, ácido hexanoico, ácido ciclopentanopropiónico, ácido glicólico, ácido pirúvico, ácido láctico, ácido malónico, ácido succínico, ácido málico, ácido maleico, ácido fumárico, ácido tartárico, ácido cítrico, ácido benzoico, ácido 3-(4-hidroxibenzoil)benzoico, ácido cinámico, ácido mandélico, ácido metanosulfónico, ácido etanosulfónico, ácido 1,2-etano-disulfónico, ácido 2-hidroxietanosulfónico, ácido bencenosulfónico, ácido 4- clorobencenosulfónico, ácido 2-naftalenosulfónico, ácido 4-toluenosulfónico, ácido canforsulfónico, ácido 4- metilbiciclo[2.2.2]-oct-2-eno-1-carboxílico, ácido glucoheptónico, ácido 3-fenilpropiónico, ácido trimetilacético, ácido tert-butilacético, ácido lauril sulfúrico, ácido glucónico, ácido glutámico, ácido hidroxinaftoico, ácido salicílico, ácido esteárico, ácido mucónico y similares; o (2) sales formadas cuando un protón ácido presente en el compuesto precursor es reemplazado por un ion metálico, por ej., un ion de un metal alcalino, un ion de un metal alcalinotérreo, o un ion de aluminio; o se coordina con una base orgánica como etanolamina, dietanolamina, trietanolamina, N- metilglucamina y similares. Las sales incluyen además, sólo a modo de ejemplo, sodio, potasio, calcio, magnesio, amonio, tetraalquilamonio y similares; y cuando el compuesto contiene una funcionalidad básica, sales de ácidos orgánicos o inorgánicos no tóxicos, como clorhidrato, bromhidrato, tartrato, mesilato, acetato, maleato, oxalato y similares. La expresión "catión farmacéuticamente aceptable" se refiere a un contraión catiónico aceptable de un grupo funcional ácido. Dicho cationes están ejemplificados por cationes sodio, potasio, calcio, magnesio, amonio, tetraalquilamonio y similares.

'Ésteres farmacéuticamente aceptables' son aquellos que son suficientemente atóxicos para ser aprobables por los organismos reguladores. Los ésteres preferidos son ésteres fosfóricos y sus derivados, y ésteres carboxílicos. En general, los ésteres farmacéuticamente aceptables se pueden formar con ácidos farmacéuticamente aceptables, como ácido fosfórico y sus derivados que forman ésteres, como alquil y dialquil ésteres de ácido fosfórico, y ácidos orgánicos como ácido acético, ácido propiónico, ácido hexanoico, ácido ciclopentanopropiónico, ácido glicólico, ácido pirúvico, ácido láctico, ácido malónico, ácido succínico, ácido málico, ácido maleico, ácido fumárico, ácido tartárico, ácido cítrico, ácido benzoico, ácido 3-(4-hidroxibenzoil)benzoico, ácido cinámico, ácido mandélico, ácido 4- metilbiciclo[2.2.2]-oct-2-eno-1-carboxílico, ácido glucoheptónico, ácido 3-fenil propiónico, ácido trimetilacético, ácido tert-butilacético, ácido glucónico, ácido glutámico, ácido hidroxinaftoico, ácido salicílico, ácido esteárico, ácido mucónico y similares.

'Vehículo farmacéuticamente aceptable' se refiere a un diluyente, adyuvante, excipiente o portador con el cual se administra un compuesto de la invención.

'Profármacos' se refiere a compuestos, incluidos los derivados de los compuestos de la invención, que tienen grupos escindibles y se convierten por solvólisis o en condiciones fisiológicas en los compuestos de la invención que son farmacéuticamente activos in vivo. Dichos ejemplos incluyen, pero no exclusivamente, derivados de éster colina, ésteres de N-alquilmorfolino, glicina, valina u otros ésteres de aminoácidos y similares, ésteres de ácidos carboxílicos, ésteres de sulfato o fosfato.

'Solvato' se refiere a las formas de un compuesto que se asocian con un solvente generalmente por una reacción de solvólisis. Esta asociación física incluye los enlaces de hidrógeno. Los solventes convencionales incluyen agua, etanol, ácido acético y similares. Los compuestos de la invención se pueden preparar por ejemplo en forma cristalina y pueden estar solvatados o hidratados. Los solvatos adecuados incluyen solvatos farmacéuticamente aceptables, como los hidratos, y además incluyen solvatos tanto estequiométricos como no estequiométricos. En algunos casos el solvato será capaz de aislamiento, por ejemplo, cuando una o más moléculas del solvente se incorporan en la red cristalina del sólido cristalino. 'Solvato' abarca tanto la fase solución como los solvatos aislables. Los solvatos representativos incluyen hidratos, etanolatos y metanolatos.

'Sujeto' incluye los seres humanos. Los términos 'humano', 'paciente' y 'sujeto' en este documento se usan indistintamente.

'Cantidad terapéuticamente eficaz' significa la cantidad de un compuesto de la invención que, cuando se administra a un sujeto para tratar una enfermedad, es suficiente para efectuar dicho tratamiento para la enfermedad. La "cantidad terapéuticamente eficaz" puede variar dependiendo del compuesto de la invención, de la enfermedad y su gravedad, y de la edad, el peso, etc., del sujeto que se va a tratar.

'Prevenir' o 'prevención' se refiere a una reducción del riesgo de adquirir o presentar una enfermedad o trastorno (es decir, causar que al menos uno de los síntomas clínicos de la enfermedad no se presente en un sujeto que puede estar expuesto a un agente que causa la enfermedad o predispuesto a la enfermedad antes del inicio de la misma).

El término 'profilaxis' se relaciona con 'prevención', y se refiere a una medida o un procedimiento cuyo propósito es prevenir, más bien que tratar o curar una enfermedad. Los ejemplos no limitantes de medidas profilácticas pueden incluir la administración de vacunas, la administración de heparina de bajo peso molecular a pacientes hospitalizados con riesgo de trombosis debido, por ejemplo, a inmovilización; y la administración de un antipalúdico como la cloroquina antes de la visita a una región geográfica en la que el paludismo es endémico o el riesgo de contraerlo es elevado.

'Tratar' o 'tratamiento' de cualquier enfermedad o trastorno se refiere, en una realización a mejorar la enfermedad o el trastorno (es decir detener la enfermedad o reducir la manifestación, la magnitud de la gravedad de al menos uno de sus síntomas clínicos). En otra realización 'tatar' o 'tratamiento' se refiere a mejorar al menos un parámetro físico, que puede no ser discernible por el sujeto. Aún en otra realización, 'tratar' o 'tratamiento' se refiere a la modulación de la enfermedad o el trastorno, ya sea físicamente, (por ej., estabilización de un síntoma discernible), fisiológicamente, (por ej., estabilización de un parámetro físico), o ambos. En otra realización, "tratar" o "tratamiento" se refiere a retrasar el avance de la enfermedad.

Según se usa en este documento, el término 'cáncer' se refiere a un tumor maligno o benigno de células en la piel u órganos corporales, por ejemplo, sin limitación, mama, próstata, pulmón, riñón, páncreas, estómago o intestino. Un cáncer tiende a infiltrarse en el tejido adyacente y diseminarse (producir metástasis) en órganos distantes, por ejemplo huesos, hígado, pulmón o cerebro. Según se usa en este documento el término cáncer incluye tanto tipos celulares de tumores metastásicos, por ejemplo, pero no exclusivamente, melanoma, linfoma, leucemia, fibrosarcoma, rabdomiosarcoma y mastocitoma como tipos de carcinomas tisulares, por ejemplo, pero no exclusivamente, cáncer colorrectal, cáncer de próstata, cáncer pulmonar microcítico y cáncer pulmonar no microcítico, cáncer de mama, cáncer pancreático, cáncer de vejiga, cáncer renal, cáncer gástrico, glioblastoma, cáncer hepático primario, cáncer de ovario, cáncer de próstata y leiomiosarcoma uterino.

Según se usa en este documento el término 'agonista' se emplea para describir un tipo de compuesto que se une a un receptor y desencadena una reacción de transducción de una señal. La capacidad para alterar la actividad de un receptor, también conocida como eficacia agonista, se refiere a la capacidad de un compuesto para inducir una respuesta biológica en su objetivo molecular.

Según se usa en este documento, el término 'antagonista' se emplea para describir un compuesto que no provoca una respuesta biológica por sí mismo al unirse a un receptor, pero bloquea o amortigua las respuestas mediadas por agonistas.

Según se usa en este documento la expresión 'compuesto(s) de la invención', y expresiones equivalentes, pretenden incluir los compuestos de las fórmulas descritas precedentemente, cuya expresión incluye, las sales farmacéuticamente aceptables, y los solvatos de los compuestos o los solvatos de las sales farmacéuticamente aceptables, por ej., hidratos, cuando el contexto así lo permita. Análogamente, la referencia a productos intermedios, sean o no ellos mismos reivindicados, pretende abarcar sus sales y solvatos, cuando el contexto así lo permita.

Cuando en este documento se hace referencia a intervalos, por ejemplo pero sin limitación, C1-C6 alquilo, la mención de un intervalo se debe considerar una representación de cada miembro de dicho intervalo.

Otros derivados de los compuestos de la invención tienen actividad tanto en su forma ácida como en sus formas derivadas de ácidos, pero en su forma sensible al ácido a menudo ofrecen ventajas de solubilidad, compatibilidad tisular o liberación prolongada en el organismo de los mamíferos (véase, Bundgard, H., Design of Prodrugs, pp. 7-9, 21-24, Elsevier, Amsterdam 1985). Los profármacos incluyen derivados de ácidos bien conocidos por los expertos en el área, como por ejemplo, ésteres preparados por reacción del ácido precursor con un alcohol adecuado, o amidas preparadas por reacción de un compuesto ácido precursor con una amina sustituida o sin sustituir, o anhídridos de ácido, o anhídridos mixtos. Los ésteres simples alifáticos o aromáticos, las amidas y los anhídridos derivados de grupos ácidos que penden de los compuestos de la invención son profármacos particularmente útiles. En algunos casos es deseable preparar profármacos tipo éster doble como ésteres (aciloxi)alquilo o ésteres ((alcoxicarbonil)oxi)alquilo. Son profármacos particulares los ésteres C1 a C8 alquilo, C2-C8 alquenilo, arilo, C7-C12 arilo sustituido y C7-C12 arilalquilo de los compuestos de la invención.

Según se usa en este documento, la expresión 'variante isotópica' se refiere a un compuesto que contiene proporciones no naturales de isótopos en uno o más de los átomos que constituyen dicho compuesto. Por ejemplo una 'variante isotópica' de un compuesto puede contener uno o más isótopos no radiactivos, como por ejemplo, deuterio (2H o D), carbono-13 (13C), nitrógeno-15 (15N), o similares. Se entenderá que, en un compuesto en el que se hace dicha sustitución isotópica, los átomos siguientes, cuando están presentes, pueden variar, de manera que por ejemplo, cualquier hidrógeno puede ser 2H/D, cualquier carbono puede ser 13C, o cualquier nitrógeno puede ser 15N, y que la presencia y la colocación de dichos átomos puede ser determinada con la capacitación en el área. Asimismo, la invención puede incluir la preparación de variantes isotópicas con radioisótopos, en el caso por ejemplo, en que el compuesto resultante se pueda usar para estudios de distribución tisular de fármacos y/o sustratos. Los isótopos radiactivos tritio, es decir 3H, y carbono-14, es decir 14C, son particularmente útiles para este propósito en vistas de su facilidad de incorporación y rápida forma de detección. Además, se pueden preparar compuestos que están sustituidos con isótopos que emiten positrones, como 11C, 18F, 15O y 13N, y serán útiles en estudios de Topografía por Emisión de Positrones (PET) para examinar la ocupación del receptor por el sustrato.

Todas las variantes isotópicas de un compuesto de la invención provistas en este documento, radiactivas o no, pretenden estar comprendidas por el alcance de los compuestos de la invención según se los definió en este documento.

También se debe entender que los compuestos que tienen la misma fórmula molecular pero difieren en la naturaleza o la secuencia del enlace de sus átomos o de la disposición de sus átomos en el espacio se denominan 'isómeros'. Los isómeros que difieren en la disposición de sus átomos en el espacio se denominan ‘estereoisómeros’.

Los estereoisómeros que no son imágenes especulares uno de otro se denominan 'diastereoisómeros' y los que son imágenes especulares que no se pueden superponer entre sí se denominan 'enantiómeros'. Cuando un compuesto tiene un centro asimétrico, por ejemplo, está enlazado a 4 grupos diferentes, es posible un par de enantiómeros. Un enantiómero se puede caracterizar por la configuración absoluta de su centro asimétrico y se describe por las reglas de secuenciación R y S de Cahn y Prelog, o por la manera en que la molécula rota el plano de la luz polarizada y se designan como isómeros dextrorrotatorio o levorrotatorio (es decir, como isómeros (+) o (-), respectivamente). Un compuesto quiral puede existir como un enantiómero individual o como una mezcla de éstos. Una mezcla que contiene proporciones iguales de los enantiómeros se denomina 'mezcla racémica'.

Todos los estereoisómeros de los compuestos están comprendidos por el término compuesto de la invención según se usa en este documento. Un compuesto de la invención está generalmente disponible como estereoisómeros en el estereocentro del anillo de imidazol. La presente invención prevé el uso de cualquier enantiómero, o de mezclas racémicas en cualquier proporción, cuando hay un centro óptico.

'Tautómeros' se refiere los compuestos que son formas intercambiables de una estructura particular de un compuesto, y que varían en el desplazamiento de los átomos de hidrógeno y los electrones. Por lo tanto, dos estructuras pueden estar en equilibrio a través del movimiento de los electrones π y un átomo (habitualmente H). Por ejemplo, los enoles y las cetonas son tautómeros porque se convierten rápidamente uno en otro mediante tratamiento con ácido o base. Otro ejemplo de tautomerismo son las formas aci- y nitro- de fenilnitrometano, que se forman análogamente mediante tratamiento con ácido o base.

Las formas tautoméricas pueden ser importantes para lograr la reactividad química y la actividad biológica óptimas de un compuesto de interés. Según se usa en este documento, la expresión compuesto de la invención incluye las formas tautoméricas de los compuestos dados a conocer.

Los compuestos La presente invención proporciona un compuesto de la invención de acuerdo con la fórmula Ib siguiente: en la que X es P o S; R1 es H; o R1 se elige entre C1-C6 alquilo, C3-C7 cicloalquilo, C3-C6 alquenilo, C3-C6 alquinilo y C1-C6 acilo; cada uno de los cuales puede estar opcionalmente sustituido con ciano, uno o más halo, hidroxilo, o C1-C6 alcoxi; R2a se elige entre H, P(O)(OH)2 y C(O)(CH2)n1C(O)OH; o R2a se elige entre C1-C6 acilo y C3-C6 alquenilo; cada uno de los cuales puede estar opcionalmente sustituido con amino o carboxi; n1 es 0, 1, 2, 3 o 4; cada R2b y R2c se elige independientemente entre H y C1-C6 alquilo; o R2b y R2c se pueden unir para formar un C3-C7 cicloalquilo; R3a es H, halo, ciano o nitro; cada R3b es independientemente halo, ciano o nitro; cada R4a y R4b es independientemente H, halo, ciano, carboxi o nitro; o cada R4a y R4b se elige entre C1-C6 alquilo y C1-C6 alcoxi; cada uno de los cuales puede estar opcionalmente sustituido con uno o más halo, o C1-C6 alcoxi; o R4a y R4b se unen para formar un cicloalquilo de 5 o 6 miembros, heterocicloalquilo de 5 o 6 miembros, arilo de 5 o 6 miembros o heteroarilo de 5 o 6 miembros; R4c es halo, ciano o nitro; y m1 es 0, 1 o 2.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, X es O.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2b es H.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2b es Me o Et.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2c es C1-C6 alquilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2c es H, Me o Et.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2b y R2c se unen para formar un anillo ciclopropilo o ciclobutilo.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, cada R2b y R2c es H.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es H o P(O)(OH)2 o C1-C6 acilo (donde C1-C6 acilo puede estar opcionalmente sustituido con amino o carboxi).

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C1-C6 acilo opcionalmente sustituido con amino o carboxi.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es H.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C3-C6 alquenilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es CH2-CH=CH2.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es P(O)(OH)2.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es una mono o bis sal farmacéuticamente aceptable de P(O)(OH)2.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es P(O)(ONa)2.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C(O)(CH2)n1C(O)OH; y n1 es 0, 1, 2 o 3.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C(O)-CH2CH2- C(O)OH.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es una sal farmacéuticamente aceptable de C(O)-CH2CH2-C(O)OH.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C(O)-CH2CH2- C(O)ONa.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C(O)- CH(iPr)NH2.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R2a es C(O)- CH(iPr)NH3Cl.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es H.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es C1-C6 alquilo sustituido con halo, ciano o hidroxilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es C1-C6 alquilo sustituido con ciano.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es C3-C6 alquinilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es -CH2-C≡CH.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es C1-C6 alquilo.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es Me, Et, i-Pr o n-Pr.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R1 es Me.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R3a es H, halo, ciano o nitro.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, R3b es halo, ciano o nitro.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, m1 es 0.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula Ib, el compuesto de la invención está de acuerdo con la fórmula II: en la que R3a, R3b, R4a, R4b, R4c y m1 son los descritos en cualquiera de los párrafos precedentes.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4c es ciano, halo o nitro.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4c es ciano.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, Rab es H, halo, ciano, C1-C6 alquilo o C1-C6 haloalquilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4b es Cl, F, CN o CF3.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4b es CF3.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4a es H, halo, ciano, C1-C6 alquilo o C1-C6 haloalquilo.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4a es Cl o F.

En otra realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, R4a es H.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, el compuesto de la invención está de acuerdo con las fórmulas IIIa o IIIb: en las que R3a, R3b, R4b y m1 son los descritos en cualquiera de los párrafos precedentes.

En una realización, con respecto a un compuesto de la invención de fórmulas IIIa o IIIb, R4b es H, halo, ciano, C1-C6 alquilo o C1-C6 haloalquilo.

En una realización preferida, con respecto a un compuesto de la invención de fórmulas IIIa o IIIb, R4b es Cl, F, CN o CF3.

En una realización más preferida, con respecto a un compuesto de la invención de fórmula IIIa, R4b es CF3.

En otra realización más preferida, con respecto a un compuesto de la invención de fórmula IIIb, R4b es Cl.

En una realización, con respecto a un compuesto de la invención de acuerdo con la fórmula II, el compuesto de la invención está de acuerdo con las fórmulas IVa o IVb: en las que R3a, R3b y m1 son los descritos en cualquiera de los párrafos precedentes.

En una realización, con respecto a un compuesto de la invención de fórmulas IVa o IVb, R3a es H, halo o ciano.

En una realización preferida, con respecto a un compuesto de la invención de fórmulas IVa o IVb, R3a es H, Cl, F o CN.

En otra realización, con respecto a un compuesto de la invención de fórmulas IVa o IVb, m1 es 1 o 2.

En otra realización, con respecto a un compuesto de la invención de fórmulas IVa o IVb, R3b es halo o ciano.

En una realización preferida, con respecto a un compuesto de la invención de fórmulas IVa o IVb, R3b es Cl, F o CN.

En otra realización, con respecto a un compuesto de la invención de fórmulas IVa o IVb, m1 es 0.

En una realización, con respecto a un compuesto de la invención de fórmula I, el compuesto de la invención está de acuerdo con las fórmulas Va, Vb, Vc o Vd: en las que R3a es el descrito en cualquiera de los párrafos precedentes; R3c es H, halo, ciano o nitro.

En una realización, con respecto a un compuesto de la invención de fórmula I, el compuesto de la invención está de acuerdo con la fórmula Va.

En una realización, con respecto a un compuesto de la invención de fórmula I, el compuesto de la invención está de acuerdo con la fórmula Vb.

En una realización, con respecto a un compuesto de la invención de fórmula I, el compuesto de la invención está de acuerdo con la fórmula Vc.

En una realización, con respecto a un compuesto de la invención de fórmula I, el compuesto de la invención está de acuerdo con la fórmula Vd.

En una realización, con respecto a un compuesto de la invención de fórmulas Va, Vb, Vc o Vd, R3a es H, halo o ciano; y R3c es H.

En una realización, con respecto a un compuesto de la invención de fórmulas Va, Vb, Vc o Vd, R3a es H, CN, Cl o F y R3c es H.

En una realización, con respecto a un compuesto de la invención de fórmulas Va, Vb, Vc o Vd, R3a es H y R3c es H, halo o ciano.

En otra realización, con respecto a un compuesto de la invención de fórmulas Va, Vb, Vc o Vd, R3a es H; y R3c es CN, Cl o F.

En otra realización, con respecto a un compuesto de la invención de fórmulas Va, Vb, Vc o Vd, cada R3a y R3c es H.

En una realización preferida, el compuesto de la invención está de acuerdo con la fórmula Vb en la que R3a y R3c son H.

En otra realización preferida, el compuesto de la invención está de acuerdo con la fórmula Vd en la que R3a y R3c son H.

En una realización, el compuesto de la invención se elige entre los compuestos de la invención indicados en la tabla 1.

En otra realización, los compuestos de la invención son los de la fórmula (VI): en la que: R5 es H, C1-6 alquilo, C2-6 alquenilo, C2-6 alquinilo, o R5 es C1-4 alquilo sustituido con un grupo ciano o uno o más grupos halo; R6 es H o C1-4 alquilo; R7 es halo o ciano; R8 es halo, ciano o nitro; p es 0, 1 o 2; q es 1, 2 o 3; cuando p es 2 entonces cada R7 es el mismo o diferente; cuando q es 2 o 3 entonces cada R8 es el mismo o diferente; y sus ésteres farmacéuticamente aceptables.

En una realización, se prefiere que R6 sea H.

En otro aspecto, se prefiere que R5 sea metilo o etilo.

Se prefiere aún más que R5 sea propionilo.

En un aspecto, se prefiere que p sea 1. En este aspecto, se prefiere que R7 sea Cl o F.

Cuando p es 1, se prefiere que R7 esté en la posición para.

En otro aspecto, se prefiere que p sea 0.

En otro aspecto, se prefiere que q sea 2. En esta realización, se prefiere que cada R8 se elija entre F, Cl y ciano.

Cuando q es 2, se prefiere que un sustituyente R8 esté en la posición para y el otro en la posición meta.

Un éster farmacéuticamente aceptable particularmente preferido es el éster de fosfato.

Un éster farmacéuticamente aceptable particularmente preferido es el éster de hemi-succinato.

Un éster farmacéuticamente aceptable particularmente preferido es el éster de valinato.

En otro aspecto la presente invención proporciona un compuesto de la invención de fórmula (VII): en la que X es O; R5 es H, C1-C6 alquilo, C3-C6 alquenilo o C3-C6 alquinilo, cada uno de los cuales puede estar sin sustituir o sustituido con ciano, o uno o más halo; R6a es H, un éster fosfórico o un derivado de éste, o un éster carboxílico y preferentemente P(O)(OH)2, C(=O)-(CH2)2-CO2H o -C(=O)CH(NH3Cl)iPr; R6b es H; R6c se elige independientemente entre H y C1-C6 alquilo; R7a es H, halo o ciano; R7b es halo o ciano; cada R8a y R8b es independientemente H, halo, ciano o C1-C4 alquilo, cada uno de los cuales puede estar sin sustituir o sustituido con uno o más halo; R8c es halo, ciano o nitro; y p1 es 0, 1 o 2.

En un aspecto particular R6c se elige entre H y C1-C4 alquilo.

En un aspecto particular R7a se elige entre H, halo y ciano.

En un aspecto particular R7b se elige entre halo o ciano.

En un aspecto particular cada R8a y R8b es independientemente H, halo, ciano o C1-C4 alquilo, que pueden estar sin sustituir o sustituidos con uno o más halo.

En un aspecto particular R6c es H.

En un aspecto particular R6a es H.

En un aspecto particular R6a es P(O)(OH)2.

En un aspecto particular R5 es metilo o etilo.

En otro aspecto particular R5 es propionilo.

En un aspecto particular p1 es 0.

En un aspecto particular R7a es Cl o F.

En un aspecto particular R7a es H.

En otros aspectos particulares cuando un grupo alquilo está sustituido con halógeno, el halógeno es F. En otro aspecto particular el grupo alquilo sustituido es un grupo trifluorometilo.

En un aspecto particular cada R8a, R8b se elige entre F, Cl, ciano, nitro, trifluorometilo y metilo, y R8c se elige entre F, Cl, ciano y nitro.

En un aspecto particular R8a es H.

En un aspecto particular R8b y R8c son Cl. En otra realización, R8c es ciano y R8b es trifluorometilo.

Los compuestos preferidos de la invención se eligen entre: 4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(4-fluorofenil)-4-(hidroximetil)-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(4-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(4-fluorofenil)-4-hidroximetil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(3-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; (S)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; (R)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-3-etil-4-(hidroximetil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(4-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 4-[4-(3-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona; 4-[2,5-Dioxo-4-(hidroximetil)-3-(1-metiletil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[3-Cianometil-2,5-dioxo-4-(hidroximetil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(hidroximetil)-4-fenil-3-(1-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(2-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; Fosfato diácido de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo; Ácido 4-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico; y Cloruro de (2S)-1-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1- oxobutan-2-aminio.

Ácido 4-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico; Fosfato diácido de (S)-(1-(4-ciano-3-(trifluorometil)fenil)-3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metilo; Ácido (S)-4-((1-(4-ciano-3-(trifluorometil)fenil)-3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metoxi)-4- oxobutanoico.

En una realización el compuesto de la invención según cualquiera de las realizaciones no es una variante isotópica.

En una realización, con respecto a la fórmula I, el compuesto se elige entre los compuestos indicados en la tabla 1.

En un aspecto, un compuesto de la invención según cualquiera de las realizaciones descritas está presente como una base libre.

En un aspecto, un compuesto de la invención según cualquiera de las realizaciones descritas es una sal farmacéuticamente aceptable.

En un aspecto, un compuesto de la invención según cualquiera de las realizaciones descritas es un solvato.

En un aspecto, un compuesto de la invención según cualquiera de las realizaciones descritas es un solvato o una sal farmacéuticamente aceptable.

Si bien los grupos especificados para cada realización han sido listados antes en general por separado, un compuesto de la invención incluye uno en el que varias o cada realización de la fórmula anterior, así como de otras fórmulas presentadas en este documento, se elige entre uno o más miembros o grupos particulares designados respectivamente, para cada variable. Por consiguiente, esta invención pretende incluir todas las combinaciones de dichas realizaciones dentro de su alcance.

La presente invención proporciona el uso de un compuesto de la invención según se definió antes en la profilaxis o el tratamiento de la caquexia.

Composiciones farmacéuticas Cuando se emplea como un producto farmacéutico, un compuesto de la invención se administra habitualmente en forma de una composición farmacéutica. Dichas composiciones se pueden preparar de manera bien conocida en el área farmacéutica y contienen al menos un principio activo. Generalmente, un compuesto de la invención se administra en una cantidad farmacéuticamente eficaz. La cantidad del compuesto que se administra realmente será determinada habitualmente por un médico, a la luz de las circunstancias pertinentes, que incluyen la afección que se va a tratar, la vía de administración elegida, el compuesto que se va administrar en realidad, la edad, el peso y la respuesta de cada paciente, y la gravedad de los síntomas del paciente.

Las composiciones farmacéuticas de esta invención se pueden administrar por diversas vías que incluyen las vías oral, rectal, transdérmica, subcutánea, intraarticular, intravenosa, intramuscular e intranasal. Dependiendo de la vía de administración deseada, los compuestos de la invención se formulan preferentemente como composiciones orales o inyectables o como bálsamos, como lociones o como parches, todos para la administración transdérmica.

Las composiciones para administración oral pueden tomar la forma de soluciones o suspensiones líquidas a granel, o polvos a granel. Más comúnmente, sin embargo, las composiciones se presentan en formas farmacéuticas unitarias para facilitar la dosificación exacta. La expresión "formas farmacéuticas unitarias" se refiere a unidades físicamente discretas adecuadas como dosis unitarias para sujetos humanos y otros mamíferos, donde cada unidad contiene una cantidad predeterminada de principio activo calculada para producir el efecto terapéutico deseado, asociada a un excipiente, vehículo o portador farmacéutico adecuado. Las formas farmacéuticas unitarias típicas incluyen ampollas o jeringas prellenadas, premedidas, de las composiciones líquidas, o pastillas, comprimidos, cápsulas o análogos en el caso de las composiciones sólidas. En dichas composiciones, el principio activo es generalmente un componente menor (entre aproximadamente 0.1 y aproximadamente 50% en peso o preferentemente entre aproximadamente 1 y aproximadamente 40% en peso) siendo el resto diversos vehículos o portadores y auxiliares de procesamiento, útiles para dar forma a la forma farmacéutica deseada.

Las formas líquidas adecuadas para administración oral pueden incluir un vehículo acuoso o no acuoso adecuado con tampones, suspendentes y agentes de dispensación, colorantes, saborizantes y similares. Las formas sólidas pueden incluir, por ejemplo, cualquiera de los ingredientes siguientes o compuestos de naturaleza similar: un aglutinante como celulosa microcristalina, goma tragacanto o gelatina; un excipiente como almidón o lactosa, un desintegrante como ácido algínico, Primogel o almidón de maíz; un lubricante como estearato de magnesio; un deslizante como dióxido de silicio coloidal; un edulcorante como sacarosa o sacarina; un aromatizante como aromatizante de menta, salicilato de metilo o naranja.

Las composiciones inyectables se basan habitualmente en solución salina estéril inyectable o solución salina tamponada con fosfato u otros vehículos inyectables conocidos en el área. Al igual que antes, el principio activo en dichas composiciones es generalmente un componente menor, a menudo entre aproximadamente 0.05 y 10% en peso, siendo el resto vehículo inyectable y similares.

Las composiciones transdérmicas se formulan generalmente como pomadas o cremas tópicas que contienen el principio o los principios activos, generalmente en una cantidad entre aproximadamente 0.01 y aproximadamente 20% en peso, preferentemente entre aproximadamente 0.1 y aproximadamente 20% en peso, preferentemente entre aproximadamente 0.1 y aproximadamente 10% en peso, y más preferentemente entre aproximadamente 0.5 y aproximadamente 15% en peso. Cuando se formulan como una pomada, los principios activos se combinarán generalmente con una base de pomada parafínica o miscible con agua. Alternativamente, los principios activos se pueden formular en una crema, por ejemplo una base de crema de aceite en agua. Dichas formulaciones transdérmicas son bien conocidas en el área e incluyen en general otros ingredientes para aumentar la penetración dérmica o la estabilidad de los principios activos o la formulación. Todas esas formulaciones transdérmicas conocidas y los ingredientes están comprendidos por el alcance de la invención.

Los compuestos de la invención también se pueden administrar mediante un dispositivo transdérmico. Concordantemente, la administración transdérmica se puede llevar a cabo utilizando un parche ya sea del tipo de reservorio o membrana porosa o de una variedad de matriz sólida.

Los componentes descritos antes para composiciones que se pueden administrar por vía oral inyectable o tópica son meramente representativos. Otros materiales así como técnicas de procesamiento y similares se indican en la parte 8 de Remington's Pharmaceutical Sciences, 17ª edición, 1985, Mack Publishing Company, Easton, Pennsylvania, que se incorpora en este documento por referencia.

Los compuestos de la invención también se pueden administrar en formas de liberación sostenida o desde sistemas de administración de fármacos de liberación sostenida. Una descripción de materiales de liberación sostenida representativos se puede encontrar en Remington's Pharmaceutical Sciences.

Los ejemplos de formulación siguientes ilustran composiciones farmacéuticas representativas que se pueden preparar de conformidad con esta invención. No obstante, la presente invención no se limita a las composiciones farmacéuticas siguientes.

Formulación 1 - Comprimidos Un compuesto de la invención se puede mezclar como un polvo seco con un aglutinante de gelatina seco en una proporción en peso aproximada de 1:2. Se puede agregar una cantidad menor de estearato de magnesio como lubricante. Con la mezcla se preparan comprimidos de 240-270 mg (80-90 mg de principio activo por comprimido) en una compresora.

Formulación 2 - Cápsulas Un compuesto de la invención se puede mezclar como un polvo seco con un diluyente de almidón en una proporción en peso aproximada de 1:1. La mezcla se coloca en cápsulas de 250 mg (125 mg de principio activo por cápsula).

Formulación 3 - Líquido Un compuesto de la invención (125 mg), se puede mezclar con sacarosa (1.75 g) y goma xantana (4 mg) y la mezcla resultante se puede entreverar, pasar a través de un tamiz U.S. de malla Nº 10, y después mezclar con una solución preparada previamente de celulosa microcristalina y carboximetilcelulosa sódica (11:89, 50 mg) en agua. Se diluyen benzoato de sodio (10 mg), saborizantes y colorante con agua y se agregan con agitación. Después se puede agregar agua suficiente con agitación. Después se agrega agua suficiente para producir un volumen total de 5 mL.

Formulación 4 - Comprimidos Un compuesto de la invención se puede mezclar como un polvo seco con un aglutinante de gelatina seco en una proporción en peso aproximada de 1:2. Se agrega una cantidad menor de estearato de magnesio como lubricante. Con la mezcla se preparan comprimidos de 450-900 mg (150-300 mg de principio activo por comprimido) en una compresora.

Formulación 5 - Inyección Un compuesto de la invención se puede disolver o suspender en un medio acuoso inyectable de solución salina tamponada estéril en una concentración de aproximadamente 5 mg/mL.

Formulación 6 - Tópica Se pueden fundir alcohol estearílico (250 g) y vaselina blanca (250 g) a aproximadamente 75 °C y después se le puede agregar una mezcla de un compuesto de la invención (50 g), metilparabeno (0.25 g), propilparabeno (0.15 g), laurilsulfato de sodio (10 g) y propilenglicol (120 g) disueltos en agua (aproximadamente 370 g) y la mezcla resultante se agita hasta que se congela.

Métodos de tratamiento La presente invención se refiere a nuevos compuestos de imidazolidina que modulan la actividad de los receptores de andrógenos. Estos compuestos se pueden utilizar en el tratamiento y/o la prevención de una serie de trastornos como se tratará más adelante en detalle. Un experto en el área apreciará que la actividad de un compuesto de la invención como un antagonista (total o parcial) o agonista (total o parcial) representa un espectro continuo. Por consiguiente, si bien algunos compuestos serán claramente agonistas o claramente antagonistas, algunos compuestos tendrán actividad tanto de agonista como de antagonista. Estos compuestos con actividades mixtas tendrán potencialmente uso en el tratamiento de diversos trastornos. En los ejemplos provistos en este documento hay detalles de cómo se pueden identificar las actividades relativas de un compuesto de la invención y cómo clasificarlos como agonistas, antagonistas o agonistas/antagonistas mixtos. Por consiguiente es claro que forma parte de las capacidades de los expertos en el área empleando su conocimiento corriente general, combinado con la información provista en los ejemplos, identificar si un compuesto particular de la invención es un agonista, un antagonista o un agonista/antagonista mixto y por lo tanto los usos adecuados de dicho compuesto.

Un compuesto de la invención puede tener buena absorción, buena semivida, buena solubilidad, buena biodisponibilidad, baja afinidad de unión a proteínas, menor interacción fármaco-fármaco y buena estabilidad metabólica. En un aspecto particular, un compuesto de la invención presenta mejoras inesperadamente significativas en sus propiedades farmacológicas, en particular una mayor biodisponibilidad. Cuando un compuesto de la invención presenta una o más de estas mejoras, esto puede tener un efecto sobre su uso en las afecciones descritas en este documento. Por ejemplo, cuando un compuesto de la invención presenta una mayor biodisponibilidad, se esperaría que el compuesto de la invención se pudiera administrar a una dosis menor, reduciendo así la aparición de posibles efectos secundarios indeseables. Análogamente, las mejoras en otras propiedades indicadas antes también conferirán ventajas en los usos potenciales de un compuesto de la invención.

Los compuestos de la presente son útiles como agentes terapéuticos para el tratamiento de afecciones que están causalmente relacionadas o que se pueden atribuir a una alteración en los niveles de andrógenos circulantes en mamíferos. En consecuencia, en un aspecto, la presente invención proporciona un compuesto de la invención para usar en medicina.

En una realización, la presente invención proporciona un compuesto de la invención para usar en la prevención y/o el tratamiento de enfermedades relacionadas con el envejecimiento que incluyen, entre otras, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades, por ejemplo pero no exclusivamente, cáncer y SIDA, o inducida por quemaduras térmicas o inmovilización a largo plazo; y enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual, o anemia. En un aspecto particular de esta realización, un compuesto de la invención es un agonista o un agonista/antagonista mixto del AR.

En otra realización, la presente invención proporciona un compuesto de la invención para utilizar en un método de tratamiento y/o prevención de enfermedades relacionadas con el envejecimiento, que incluyen, entre otras, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades por ejemplo pero no exclusivamente, cáncer y SIDA, enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual, o anemia, donde dicho método comprende administrar a un sujeto que lo necesita una cantidad terapéuticamente eficaz de un compuesto de la invención o de una composición farmacéutica de la invención. En un aspecto particular de esta realización, el compuesto de la invención es un agonista o un agonista/antagonista mixto del AR o la composición farmacéutica contiene un agonista o un agonista/antagonista mixto del AR.

En una realización, la presente invención proporciona un compuesto de la invención para utilizar en la prevención y/o el tratamiento de tumores dependientes de andrógenos como el cáncer o la hiperplasia de próstata. En un aspecto particular de esta realización, un compuesto de la invención es un antagonista del AR.

En otra realización, la presente invención proporciona un compuesto de la invención para utilizar en un método de tratamiento y/o prevención de tumores dependientes de andrógenos, como cáncer o hiperplasia de próstata, donde dicho método comprende administrar a un sujeto que lo necesita una cantidad terapéuticamente eficaz de un compuesto de la invención o de una composición farmacéutica de la invención. En un aspecto particular de esta realización, el compuesto de la invención es un antagonista del AR o la composición farmacéutica contiene un antagonista del AR.

En un aspecto, la presente invención proporciona un compuesto de la invención que es un antagonista del receptor de andrógenos según cualquiera de las fórmulas I-VII anteriores donde el valor de KSchild es inferior a 1 µM para utilizar en la prevención o el tratamiento de tumores dependientes de andrógenos, como cáncer o hiperplasia de próstata.

En un aspecto, la presente invención proporciona un método de tratamiento y/o prevención de tumores dependientes de andrógenos, como cáncer o hiperplasia de próstata, donde dicho método comprende administrar a un sujeto que lo necesita una cantidad terapéuticamente eficaz de un compuesto de la invención según cualquiera de las fórmulas I-VII anteriores, donde dicho compuesto de la invención es un antagonista del receptor de andrógenos, y donde el valor de KSchild es inferior a 1 µM.

En un aspecto, la presente invención proporciona un compuesto de la invención que es un agonista o agonista/antagonista mixto del receptor de andrógenos según cualquiera de las fórmulas I-VII anteriores, donde los valores de EC50 y KSchild son ambos inferiores a 1 µM, para utilizar en la prevención o el tratamiento de enfermedades relacionadas con el envejecimiento que incluyen, entre otras, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades por ejemplo, pero no exclusivamente, cáncer y SIDA, y enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual, o anemia.

En un aspecto, la presente invención proporciona un compuesto de la invención para utilizar en un método de tratamiento y/o prevención de enfermedades relacionadas con el envejecimiento, que incluyen, entre otras, sarcopenia, afecciones caquécticas y pérdida muscular inducida por enfermedades por ejemplo pero no exclusivamente, cáncer y SIDA, y enfermedades óseas y articulares, como osteoporosis, disminución de la libido y disfunción sexual, o anemia, donde dicho método comprende administrar a un sujeto que lo necesita una cantidad terapéuticamente eficaz de un compuesto de la invención según cualquiera de las fórmulas I-VII anteriores, donde dicho compuesto de la invención es un agonista o un agonista/antagonista mixto del receptor de andrógenos, donde los valores de EC50 y KSchild son ambos inferiores a 1 µM.

Las dosis transdérmicas se eligen generalmente para proporcionar niveles sanguíneos similares o inferiores a los logrados usando dosis inyectables.

Cuando los compuestos de esta invención se usan para prevenir la sarcopenia, se administrarán al paciente que corre riesgo de presentar la afección, generalmente según el consejo y bajo la supervisión de un médico, en los niveles de dosificación descritos antes. Los pacientes que corren riesgo de presentar una afección particular incluyen en general ancianos, cuya masa muscular disminuye como resultado de la pérdida de motilidad o la mayor dificultad en los movimientos.

Cuando los compuestos de esta invención se usan para prevenir la osteoporosis, se administrarán al paciente que corre riesgo de presentar la afección, generalmente según el consejo y bajo la supervisión de un médico, en los niveles de dosificación descritos antes. Los pacientes que corren riesgo de sufrir una afección particular generalmente incluyen los ancianos, cuya disminución de la densidad ósea puede causar mayores riesgos de fractura.

Cuando se usa para prevenir caquexia resultante de una dolencia primaria, por ejemplo, pero no exclusivamente, cáncer, VIH, enfermedad pulmonar obstructiva crónica (EPOC), insuficiencia cardíaca congestiva, o insuficiencia renal en etapa tardía, los compuestos de esta invención se administrarán a un paciente, generalmente según el consejo y bajo la supervisión de un médico, en los niveles de dosificación descritos antes. Los pacientes típicos incluyen pacientes que han sido tratados por cáncer, VIH o SIDA.

Un compuesto de la invención se puede administrar como el único principio activo o se puede administrar en combinación con otros agentes terapéuticos, incluidos otros compuestos que tengan la misma actividad terapéutica o similar y que se haya determinado que son seguros y eficaces para dicha administración combinada. En una realización específica, la coadministración de dos (o más) agentes permite el tratamiento de una afección primaria, y sus efectos secundarios asociados.

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de sarcopenia; los agentes particulares incluyen, pero no exclusivamente, testosterona, corotinoides, andrógenos, SARM y factor de crecimiento semejante a la insulina tipo 1.

En una realización, un compuesto de la invención se administra con otro régimen terapéutico para el tratamiento y/o la prevención de sarcopenia; los regímenes particulares incluyen, pero no exclusivamente, ejercicio físico solo o en combinación con monohidrato de creatinina o proteínas dietéticas.

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de osteoporosis; los agentes particulares incluyen, pero no exclusivamente, bisfosfonatos (alendronato de sodio, reisedronato, ibendronato o ácido zoledrónico), teriparatida, ranelato de estroncio, reemplazo hormonal, (raloxifeno), complemento de calcio o vitamina D.

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de caquexia; y los agentes particulares incluyen, pero no exclusivamente estimulantes del apetito/antieméticos (por ejemplo, pero sin limitación, acetato de megestrol, tetrahidrocannabinol), inhibidores de ACE, betabloqueantes, anabólicos (por ejemplo pero sin limitación oxandrolona, nandrolona, ghrelina).

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de caquexia inducida por VIH; los agentes particulares incluyen, pero no exclusivamente, inhibidores de la transcriptasa inversa análogos de los nucleótidos (NtARTI o NtRTI) (por ejemplo pero sin limitación Tenofovir®, Adefovir®), inhibidores no nucleósidos de la transcriptasa inversa (NNRTI) (por ejemplo pero sin limitación Efavirenz®, Nevirapine®, Delavirdine®, Etravirine®), inhibidores de la proteasa (por ejemplo pero sin limitación Saquinavir®, Ritonavir®, Indinavir®, Nelfinavir®, Amprenavir®, Lopinavir®, Atazanavir®, Fosamprenavir®, Tipranavir®, Darunavir®), inhibidores de la entrada (por ejemplo pero sin limitación Maraviroc®, Enfuvirtide®) o inhibidores de la integrasa (por ejemplo pero sin limitación raltegravir).

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de caquexia inducida por insuficiencia cardíaca congestiva; los agentes particulares incluyen, pero no exclusivamente, diuréticos del asa orales (furosemida, torsemida o bumetamida), betabloqueantes (bisoprolol, carvedilol y metoprolol de liberación sostenida), inhibidores de ACE (Captopril, Zofenopril, Enalapril, Ramipril, Quinapril, Perindopril, Lisinopril, Benazepril o Fosinopril), antagonistas del receptor de la angiotensina II (Candesartan) o vasodilatadores.

En una realización, un compuesto de la invención se coadministra con otro agente terapéutico para el tratamiento y/o la prevención de caquexia inducida por insuficiencia renal en etapa tardía; los agentes particulares incluyen, pero no exclusivamente, inhibidores de ACE (Captopril, Zofenopril, Enalapril, Ramipril, Quinapril, Perindopril, Lisinopril, Benazepril o Fosinopril), antagonistas del receptor de la angiotensina II (Candesartan), vitamina D3, o calcio asociado a aglutinantes de fosfato.

Mediante coadministración se incluye cualquier medio para administrar dos o más agentes terapéuticos a los pacientes como parte del mismo régimen de tratamiento, como resultará evidente para los expertos. Si bien los dos o más agentes se pueden administrar simultáneamente en una única formulación esto no es esencial. Los agentes se pueden administrar en formulaciones diferentes y en momentos diferentes.

Procedimientos generales de síntesis General Los compuestos de la invención se pueden preparar a partir de materiales de partida fácilmente disponibles empleando los métodos y procedimientos generales siguientes. Se apreciará que cuando se indican condiciones típicas o preferidas del proceso (es decir, temperaturas de reacción, tiempos, relaciones molares de los reactantes, solventes, presiones, etc.), también se pueden usar otras condiciones de proceso, a menos que se indique lo contrario. Las condiciones de reacción óptimas pueden variar con los reactantes o los solventes particulares usados, pero tales condiciones pueden ser determinadas por un técnico con experiencia en el tema mediante procedimientos de optimización de rutina.

Además, como resultará evidente para los expertos en el área, pueden ser necesario grupos protectores convencionales para evitar que ciertos grupos funcionales sufran reacciones indeseables. La elección de un grupo protector adecuado para un grupo funcional particular así como las condiciones adecuadas para la protección y la desprotección son bien conocidas en el área. Por ejemplo, se describen numerosos grupos protectores y su introducción y eliminación en T. W. Greene y P. G. M. Wuts, Protecting Groups in Organic Synthesis, segunda edición, Wiley, Nueva York, 1991, y referencias citadas en el mismo.

Los métodos siguientes se presentan detalladamente en lo que se refiere a la preparación de compuestos representativos que han sido mencionados precedentemente. Un compuesto de la invención puede ser preparado a partir de materiales de partida y reactivos conocidos o comerciales por un técnico con experiencia en el área de la síntesis orgánica.

Todos los reactivos son de calidad comercial y se usan como se reciben sin purificación adicional, a menos que se indique lo contrario. Los solventes anhidros disponibles en el comercio se usan para las reacciones conducidas en atmósfera inerte. En todos los otros casos se usan solventes de calidad reactivo, a menos que se especifique lo contrario. La cromatografía en columna se realiza en gel de sílice 60 (35-70 µm). La cromatografía en capa delgada se lleva a cabo usando placas de gel de sílice F-254 pre-recubiertas (espesor 0.25 mm). Los espectros 1H RMN se registran en un espectrómetro Bruker DPX 400 RMN (400 MHz). Los desplazamientos químicos (δ) para los espectros 1H RMN se informan en partes por millón (ppm) con relación al tetrametilsilano (δ 0.00) o el pico de solvente residual adecuado, es decir CHCl3 (δ 7.27), como referencia interna. Las multiplicidades se indican como singulete (s), doblete (d), triplete (t), cuatriplete (q), multiplete (m) y ancho (br). Las constantes de acoplamiento (J) se informan en Hz. Los espectros de masas por electronebulización (MS) se obtienen en un espectrómetro de LCMS de plataforma Micromass. Columnas utilizadas para todos los análisis de LCMS: Chromolith Performance RP-18 100 mm x 3 mm (Merck AG). Todos los métodos usan el gradiente siguiente: Solvente A: MeCN; solvente B: H2O, ambos solventes contienen 0.1% de ácido fórmico.

Gradiente: 100% de B a 0% de B de 0 a 3.5 min; 0% de B de 3.5 a 4.5 min; 0% a 100% de B de 4.5 a 4.6 min; 100% de B de 4.6 a 5 min. Velocidad de flujo: 2.5 mL/min Lista de las abreviaturas utilizadas en la sección experimental: DCM: Diclorometano DiPEA: N,N-diisopropiletilamina MeCN Acetonitrilo BOC

tert-butiloxicarbonilo DMF

N,N-dimetilformamida TFA Ácido trifluoroacético RMN Resonancia Magnética Nuclear DMSO Dimetilsulfóxido DPPA Difenilfosforilazida LCMS Cromatografía Líquida acoplada a Espectrometría de Masas ppm partes por millón Fr relación de frentes Rt tiempo de retención s singulete br s singulete ancho m multiplete d doblete P.f.

Punto de fusión ta Temperatura ambiente Rt Tiempo de retención TEA Trietilamina Procedimientos generales: Esquema general: Los compuestos de la invención se pueden preparar según los procedimientos siguientes: Método A Método B Ejemplo 1: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 1-Fenil-2-(2-propeniloxi)etanona

Este compuesto se prepara a partir de 2-hidroxi-1-feniletanona, según el procedimiento utilizado por G.A. Molander y J.A. McKie en 1-hidroxi-2-butanona, J. Org.Chem. (1995), 60, 872-882.

Paso de protección (opcional):

La 1-hidroxi-2-butanona se puede proteger mediante diversos grupos bien conocidos según procedimientos de rutina conocidos por los técnicos con experiencia en el área. Por ejemplo, se obtiene 2-(tert-butil-dimetil-silaniloxi)-1-fenil- etanona cuantitativamente mezclando 1-hidroxi-2-butanona, tBDMSCl e imidazol en DMF (véase ref 10). Este producto intermedio se usa después como se describe en los pasos siguientes.

Paso 2: 4-Fenil-2-(propeniloxi)imidazolidin-2,5-diona

Se calientan 0.775 g de 1-fenil-2-(2-propeniloxi)etanona, 0.575 g de cianuro de potasio y 1.6 g de carbonato de amonio a 55 °C durante 3 horas en 23 mL de una mezcla de etanol/agua 50/50. La mezcla de reacción se diluye con agua y se extrae con acetato de etilo. La solución orgánica se lava con una solución acuosa saturada de cloruro de sodio, después se seca en sulfato de sodio y se evapora para obtener el producto deseado (sólido amarillo blancuzco).

TLC: Fr = 0.42 (heptano/acetato de etilo 50/50) δ 1H RMN (CD3OD): 3.68 (d, 1H); 4.13 (m, 3H); 4.22 (d, 1H); 4.92 (s, 2H); 5.22 (dd, 1H); 5.34 (dd, 1H); 5.95 (ddt, 1H); 7.45 (m, 3H); 7.64 (d, 2H) LCMS: (Rt = 5.79 min): 288+ (MH,MeCN+)

Paso 3: 4-[2,5-Dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 0.47 g de 4-fenil-2-(propeniloxi)imidazolidin-2,5-diona en 30 mL de dimetilacetamida se le agregan 0.28 g de óxido de cobre (I) y 0.81 g de 4-bromo-2-trifluorometilbenzonitrilo. La mezcla se calienta a 160 °C durante 3 horas. A temperatura ambiente, la mezcla se diluye con solución acuosa de amoníaco al 50% y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 70/30 para proporcionar el producto deseado.

TLC: Fr = 0.30 (heptano/acetato de etilo 70/30) δ 1H RMN (CDCl3): 3.86 (d, 1H); 4.14 (sl, 2H); 4.27 (d, 1H); 5.28 (d, 1H); 5.32 (d, 1H); 5.89 (ddt, 1H); 7.52 (m, 3H); 7.70 (m, 2H); 7.98 (m, 2H); 8.14 (m, 1H) LCMS: (Rt = 6.91 min): 414- (M-H-)

Paso 4: 4-[2,5-Dioxo-3-metil-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 0.86 g de 4-[2,5-dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo y 0.26 mL de yodometano en 30 mL de DMF se le agregan 430 mg de carbonato de potasio. La mezcla se agita a temperatura ambiente durante 5 horas, se evapora hasta sequedad, se diluye con agua y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de heptano/acetato de etilo 70/30 para proporcionar el producto deseado.

TLC: Fr = 0.37 (heptano/acetato de etilo 70/30) δ 1H RMN (CDCl3): 3.07 (s, 3H); 3.98 (d, 1H); 4.14 (s a, 2H); 4.44 (d, 1H); 5.28 (d, 1H); 5.32 (d, 1H); 5.87 (ddt, 1H); 7.39 (m, 2H); 7.49 (m, 3H); 7.92 (d, 1H); 8.00 (d, 1H); 8.13 (m, 1H) LCMS: (Rt = 7.11 min): 471+ (MH, MeCN+)

Paso 5: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 0.52 g de 4-[2,5-dioxo-3-metil-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo en 40 mL de diclorometano se le agregan 2 mL de complejo de trifluoroborano-dimetilsulfuro en 10 mL de diclorometano. La mezcla se agita a temperatura ambiente durante 3 horas, se vierte en una solución acuosa saturada de bicarbonato de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de heptano/acetato de etilo 70/30 para proporcionar el producto deseado.

P.f. = 160 °C.

TLC: Fr = 0.33 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 3.09 (s, 3H); 4.18 (d, 2H); 4.73 (d, 1H); 7.38 (m, 2H); 7.50 (m, 3H); 7.93 (d, 1H); 8.02 (d, 1H); 8.17 (m, 1H) LCMS: (Rt = 6.53 min): 358- (M-CH2OH-) Ejemplos 2 y 3: 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método B)

Paso 1: 2-Metilamino-2-fenilacetato de metilo

Se agregan lentamente 6.63 mL de cloruro de tionilo a una solución de 1.5 g de ácido 2-metilamino-2-fenil acético en 100 mL de metanol. La mezcla es heterogénea y se vuelve límpida después de 2 horas de agitación. La mezcla se agita durante 48 h a temperatura ambiente y después el solvente se evapora hasta sequedad. El producto crudo se diluye con una solución acuosa de bicarbonato de sodio y se extrae con acetato de etilo. Las fases orgánicas se lavan con agua y solución saturada de cloruro de sodio y se secan en sulfato de magnesio, se filtran y se evaporan para proporcionar el producto deseado, que se usa tal cual en el paso siguiente.

TLC: Fr = 0.56 (diclorometano/metanol 90/10) δ 1H RMN (CDCl3): 1.96-1.99 (s a, 1H); 2.43 (s, 3H); 3.73 (s, 3H); 4.30 (s, 1H); 7.31-7.42 (m, 5H)

Paso 2: 4-[2,5-Dioxo-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 1.26 g de trifósgeno en 20 mL de tolueno anhidro se le agrega lentamente una solución de 1.18 g de 4-amino-2-trifluorometilbenzonitrilo en 16 mL de dioxano anhidro. La mezcla se calienta a reflujo durante 1.5 horas. Después de enfriar a temperatura ambiente se evapora hasta sequedad. A este producto crudo diluido con 50 mL de THF anhidro se le agregan 1.13 g de 2-metilamino-2-fenilacetato de metilo en 10 mL de THF. La mezcla se agita a temperatura ambiente durante 30 min. Se agregan 1.96 mL de TEA, la mezcla se calienta a reflujo durante 1.5 horas, se agita a temperatura ambiente durante 16 h y después se evapora hasta sequedad. El producto crudo se diluye con una solución acuosa de bicarbonato de sodio y se extrae con acetato de etilo. Las fases orgánicas se lavan con agua y después solución saturada de cloruro de sodio, se secan en sulfato de magnesio, se filtran y se evaporan. El producto crudo se cristaliza en acetato de etilo, se filtra y se enjuaga con éter etílico para proporcionar el producto deseado.

TLC: Fr = 0.67 (diclorometano/éter etílico 90/10) δ 1H RMN (CDCl3): 3.06 (s, 3H); 5.06 (s, 1H); 7.35-7.39 (m, 2H); 7.48-7.56 (m, 3H); 7.96 (d, 1H); 8.03 (dd, 1H); 8.18 (d, 1H) LCMS: (rt = 2.91 min, método apolar): no ionizable

Paso 3: 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 200 mg de 4-[2,5-dioxo-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo en 4 mL de THF anhidro enfriada hasta -78 °C se le agrega lentamente 0.64 mL de bis(trimetilsilil)amida de litio al 20% en hexano. La solución se torna marrón oscura. La mezcla se agita a -78 °C durante 10 min. Después se le agregan lentamente 121 µL de propanaldehído y la solución se torna roja oscura. La adición de otros 121 µL de propanaldehído conduce a la decoloración total de la mezcla. La mezcla se agita a -78 °C durante 30 min y la reacción se detiene a -78 °C con una solución acuosa de cloruro de amonio. Se permite que la mezcla alcance la temperatura ambiente y la fase acuosa se extrae con acetato de etilo. Las fases orgánicas se lavan con agua y después solución saturada de cloruro de sodio, se secan en sulfato de magnesio, se filtran y se evaporan. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con 1/1 a 0/1 de una mezcla de heptano/diclorometano después con 99/1 a 95/5 de una mezcla de diclorometano/éter etílico, para producir dos diastereoisómeros: isómero A e isómero B.

Datos analíticos para el isómero A: TLC: Fr = 0.45 (diclorometano/éter etílico 9/1) δ 1H RMN (CDCl3): 1.19 (t, 3H); 1.48-1.63 (m, 1H); 1.65-1.78 (m, 1H); 3.26 (s, 3H); 4.70-4.77 (m, 1H); 7.46- 7.62 (m, 5H); 7.93 (d, 1H); 7.99 (d, 1H); 8.13 (s, 1H) LCMS: (Rt = 3.47 min): 358- (M-CH3CH2CHOH)- Datos analíticos para el isómero B: TLC: Fr = 0.36 (diclorometano/éter etílico 9/1) δ 1H RMN (CDCl3): 1.18 (t, 3H); 1.42-1.55 (m, 1H); 1.72-1.84 (m, 1H); 3.08 (s, 3H); 4.63-4.70 (m, 1H); 7.39- 7.55 (m, 5H); 7.95 (d, 1H); 8.02 (d, 1H); 8.15 (s, 1H) LCMS: (Rt = 3.46 min): 358- (M-CH3CH2CHOH)- Ejemplos 4 y 5: 4-[2,5-Dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Se obtiene 4-[2,5-dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo utilizando el mismo protocolo que el utilizado para los ejemplos 2 y 4 partiendo de 4-[2,5-dioxo-3-metil-4-fenilimidazolidin-1-il]-2- trifluorometilbenzonitrilo empleando acetaldehído en vez de propionaldehído. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con 1/1 a 0/1 de una mezcla de heptano/diclorometano después con 99/1 a 95/5 de una mezcla de diclorometano/éter etílico, para producir dos diastereoisómeros: isómero C e isómero D.

Datos analíticos para el isómero C: TLC: Fr = 0.32 (diclorometano/éter etílico/NH4OH 90/10/0.1) δ 1H-RMN (CDCl3): 1.42 (d, 3H); 3.26 (s, 3H); 5.03-5.61 (m, 1H); 7.47-7.60 (m, 5H); 7.93 (d, 1H); 7.99 (d, 1H); 8.12 (s, 1H) LCMS: (Rt = 3.35 min): 358- (M-CH3CHOH)- Datos analíticos para el isómero D: TLC: Fr = 0.26 (diclorometano/éter etílico/NH4OH 90/10/0.1) δ 1H-RMN (CDCl3): 1.44 (d, 3H); 3.10 (s, 3H); 4.98-5.06 (m, 1H); 7.42-7.56 (m, 5H); 7.95 (d, 1H); 8.02 (d, 1H); 8.16 (s, 1H) LCMS: (Rt = 3.34 min): 358- (M-CH3CHOH)- Ejemplo 6: 4-[4-(2,5-Dioxo-4-fluorofenil)-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 1-(4-Fluorofenil)-2-hidroxietanona

2 g de 2-bromo-1-(4-fluorofenil)etanona y 6 eq de formiato de sodio en 15 mL de etanol/agua se irradian con microondas durante 5 min a 150 °C, 11 bar. Después de la filtración y la evaporación del etanol se agrega agua. Se aísla el producto esperado por filtración.

δ 1H RMN (DMSO D6): 4.78 (s, 2H); 5.12 (m, 1H); 7,35 (m, 2H); 8.00 (m, 2H).

LCMS: (Rt = 2.51 min): Sin ionización

Paso 2: 1-(4-Fluorofenil)-2-(2-propeniloxi)etanona

2.4 g de 1-(4-fluorofenil)-2-hidroxi etanona obtenida en el paso 1, 10 mL de bromuro de alilo y 9.4 g de CaSO4 se mezclan entre sí en atmósfera de argón. Se agregan 6.2 g de Ag2O en porciones en el transcurso de 1.5 h. Esta mezcla se agita 3 h a temperatura ambiente, se diluye con éter etílico, se filtra y el solvente se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 90/10.

δ 1H RMN (DMSO D6): 4.05 (m, 2H); 4.82 (s, 2H); 5.17 (dd, 1H); 5.28 (dd, 1H); 5.92 (ddt, 1H); 7.37 (m, 2H); 8.00 (m, 2H) LCMS: (Rt = 2.69 min): Sin ionización

Paso 3: 4-(4-Fluorofenil)-4-[(2-propeniloxi)metil]imidazolidin-2,5-diona

Se calientan 1.8 g de 1-(4-fluorofenil)-2-(2-propeniloxi)etanona obtenida en el paso 2, 1.21 g de cianuro de potasio y 4.69 g de carbonato de amonio a 55 °C durante 2 horas en 50 mL de una mezcla de etanol/agua 50/50. Mientras se calienta la mezcla a 55 °C, se agregan 4.69 g de carbonato de amonio 3 veces luego de 1 hora, 4 y 15 horas, respectivamente. La mezcla de reacción se diluye después con agua y se extrae con acetato de etilo. La solución orgánica se seca en sulfato de sodio y se evapora para proporcionar el producto deseado.

δ 1H RMN (DMSO D6): 3.50 (d, 1H); 3.95 (d, 1H); 4.03 (d, 2H); 5.15 (dd, 1H); 5.25 (dd, 1H, (dd, 1H); 5.85 (ddt, 1H); 7.25 (m, 2H); 7.58 (m, 2H); 8.65 (s, 1H); 10.80 (s, 1H).

LCMS: (Rt = 2.43 min): Sin ionización.

Paso 4: 4-[2,5-Dioxo-4-(4-fluorofenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Se agregan 0.33 g de óxido de cobre (I) y 0.95 g de 4-bromo-2-trifluorometilbenzonitrilo a una solución de 1 g de 4- (4-fluorofenil)-4-[(2-propeniloxi)metil]imidazolidin-2, 5-diona obtenida en el paso 3 en 3 mL de DMAC. La mezcla se calienta a 160 °C durante 3 horas. Después de enfriar, la mezcla se diluye con solución acuosa de amoníaco al 50% y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 2/1.

δ 1H RMN (DMSO D6): 3.62 (d, 1H); 4.07 (m, 2H); 4.15 (d, 1H); 5.15 (d, 1H); 5.22 (d, 1H); 5.85 (ddt, 1H); 7.30 (m, 2H); 7.70 (m, 2H); 8.00 (d, 1H); 8.10 (s, 1H), 8.33(d, 1H).

LCMS: (Rt = 3.30 min): 432- (M-H-)

Paso 5: 4-[2,5-Dioxo-4-(4-fluorofenil)-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Se agregan 325 mg de carbonato de potasio y 0.25 mL de yodometano a una solución de 0.85 de 4-[2,5-dioxo-4-(4- fluorofenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo obtenida en el paso 4 y se disuelve en 3 mL de DMF. La mezcla se agita a temperatura ambiente durante 4 horas en atmósfera de argón, se evapora hasta sequedad, se diluye con agua y solución saturada de cloruro de sodio, y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra y se evapora para proporcionar el producto deseado.

δ 1H RMN (DMSO D6): 2.85 (s, 3H); 4.17 (m, 2H); 4.20 (d, 1H); 4.40 (d, 1H); 5.15 (d, 1H); 5.21 (d, 1H); 5.87 (ddt, 1H); 7.30 (m, 2H); 7.55 (m, 2H); 8.00 (d, 1H); 8.12 (s, 1H), 8.33 (d, 1H).

LCMS: (Rt = 3.43 min): Sin ionización

Paso 6: 4-[2,5-Dioxo-4-(4-fluorofenil)-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

La mezcla cruda de 4-[2,5-dioxo-4-(4-fluorofenil)-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo obtenida en el paso 5 se solubiliza en 5 mL de DCM en atmósfera de argón. Se le agrega 0.9 mL de complejo de trifluoroborano-dimetilsulfuro. La mezcla se agita a temperatura ambiente durante 7 horas. Se le agrega lentamente una solución acuosa saturada de bicarbonato de sodio, el producto se extrae con DCM y la capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con DCM/acetato de etilo 4/1.

δ 1H RMN (DMSO D6): 2.87 (s, 3H); 4.08 (m, 1H); 4.40 (m, 1H); 5.80 (m, 1H); 7.30 (m, 2H); 7.52 (m, 2H); 8.05 (d, 1H); 8.19 (s, 1H), 8.32(d, 1H).

LCMS: (Rt = 2.97 min): 376- (M-CH2OH-) Ejemplo 7: 4-[4-(4-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A) [0264]

Paso 1: 1-(4-Clorofenil)-2-hidroxietanona

Usando el protocolo del ejemplo 6, paso 1, haciendo reaccionar 2 g de 2-bromo-1-(4-clorofenil)etanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 4.78 (s, 2H); 5.15 (m, 1H); 7,60 (d, 2H); 7.94 (d, 2H).

LCMS: (Rt = 2.55 min): Sin ionización

Paso 2: 1-(4-Clorofenil)-2-(2-propeniloxi)etanona

Usando el protocolo del ejemplo 6, paso 2, haciendo reaccionar 2.64 g de 2-bromo-1-(4-clorofenil)etanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 4,08 (m, 2H); 4.84 (s, 2H); 5,18 (dd, 1H); 5.29 (dd, 1H); 5,92 (ddt, 1H); 7,61 (d, 2H); 7.92 (d, 2H)

Paso 3: 4-(4-Clorofenil)-4-(2-propeniloxi)imidazolidin-2,5-diona

Usando el protocolo del ejemplo 6, paso 3, haciendo reaccionar 2.5 g de 1-(4-clorofenil)-2-(2-propeniloxi)etanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 3,50 (d, 1H); 3.93 (d, 1H); 4.03(d, 2H); 5,15 (dd, 1H); 5,25 (dd, 1H, (dd, 1H); 5,84 (ddt, 1H); 7,47 (m, 2H); 7,55 (m, 2H); 8.67 (s, 1H); 10.82 (s, 1H).

LCMS: (Rt = 3.06 min): Sin ionización.

Paso 4: 4-[4-(4-Clorofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 4, haciendo reaccionar 1.4 g de 4-(4-clorofenil)-4-(2- propeniloxi)imidazolidin-2,5-diona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 3,71 (d, 1H); 4,05 (m, 2H); 4,15 (d, 1H); 5,13 (d, 1H); 5,21 (d, 1H); 5,85 (ddt, 1H); 7.53 (d, 2H); 7,68 (d, 2H); 7.98 (d, 1H); 8.10 (s, 1H); 8.31(d, 1H).

LCMS: (Rt = 3.41 min): (448/450)- (M-H-)

Paso 5: 4-[4-(4-Clorofenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 5, haciendo reaccionar 0.50 g de 4-[4-(4-clorofenil)-2,5-dioxo-4-[(2- propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 2.87(s, 3H); 4,10 (m, 2H); 4.18 (d, 1H); 4,40 (d, 1H); 5,15 (d, 1H); 5,21 (d, 1H); 5,88 (ddt, 1H); 7,54 (m, 4H); 8.00 (d, 1H); 8.12 (s, 1H); 8.33(d, 1H).

LCMS: (Rt = 3.57 min): Sin ionización

Paso 6: 4-[4-(4-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 6, haciendo reaccionar 0.6 g de 4-[4-(4-clorofenil)-2,5-dioxo-3-metil-4-[(2- propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 2.87 (s, 3H); 4.07 (m, 1H); 4,40 (m, 1H); 5.82 (m, 1H); 7,51 (m, 4H); 8.03 (d, 1H); 8.19 (s, 1H); 8.32 (d, 1H).

LCMS: (Rt = 3.13 min): (392/394)- (M-CH2OH-) Ejemplo 8: 4-[4-(4-Fluorofenil)-2,5-dioxo-4-hidroximetil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Paso 1: 4-[2,5-Dioxo-4-(4-fluorofenil)-4-[(2-propeniloxi)metil]-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo.

A una solución de 0.42 g de 4-[2,5-dioxo-4-(4-fluorofenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo en 3 mL de DMF, se le agregan 160 mg de carbonato de potasio y 0.2 mL de bromuro de propargilo (solución al 80% en tolueno). La mezcla se agita a temperatura ambiente durante 4 horas en atmósfera de argón. Después se agrega 0.04 mL de bromuro de propargilo (solución al 80% en tolueno) y la mezcla se agita durante 1 hora a temperatura ambiente, se evapora hasta sequedad, se diluye con agua y solución saturada de cloruro de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra y se evapora.

El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 4/1.

δ 1H RMN (DMSO D6): 3.17 (s, 1H); 4,05-4.12 (m, 2H); 4.25-4.40 (m, 4H); 5,12 (d, 1H); 5,22 (d, 1H); 5,88 (ddt, 1H); 7.30 (m, 2H); 7,60 (m, 2H); 8.00 (d, 1H); 8.12 (s, 1H); 8.33(d, 1H).

LCMS: (Rt = 3.46 min): Sin ionización

Paso 2: 4-[4-(4-Fluorofenil)-2,5-dioxo-4-hidroximetil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

0.45 g de 4-[2,5-dioxo-4-(4-fluorofenil)-4-[(2-propeniloxi)metil]-3-(2-propinil)imidazolidin-1-il]-2- trifluorometilbenzonitrilo obtenido en el paso 1 se disuelve en 5 mL de DCM en atmósfera de argón. Se le agrega 0.2 mL de complejo de trifluoroborano-dimetilsulfuro. La mezcla se agita a temperatura ambiente durante 18 horas. Se le agrega lentamente una solución acuosa saturada de bicarbonato de sodio. El producto se extrae con DCM y la capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con DCM/acetato de etilo 6/1.

δ 1H RMN (DMSO D6): 3.10 (m, 3H); 4.10-4.40 (m, 4H); 5.80 (m, 1H); 7.28 (m, 2H); 7,60 (m, 2H); 8.05 (d, 1H); 8.20 (s, 1H); 8.35 (d, 1H).

LCMS: (Rt = 3.07 min): 400- (M-CH2OH-) Ejemplo 9: 4-[4-(3-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 1-(3-Clorofenil)-2-hidroxietanona

Usando el protocolo del ejemplo 6, paso 1, haciendo reaccionar 2 g de 2-bromo-1-(3-clorofenil)etanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 4.80 (s, 2H); 5.20 (m, 1H); 7,58 (t, 1H); 7.72 (d, 1H); 7.88 (d, 1H); 7.95 (s, 1H).

LCMS: (Rt = 2.30 min): Sin ionización

Paso 2: 1-(3-Clorofenil)-2-(2-propeniloxi)etanona

Usando el protocolo del ejemplo 6, paso 2, haciendo reaccionar 2.5 g de 1-(3-clorofenil)-2-hidroxietanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 4.07 (m, 2H); 4.88 (s, 2H); 5.18 (dd, 1H); 5.30 (dd, 1H); 5.92 (ddt, 1H); 7.58 (t, 1H); 7.72 (d, 1H); 7.88 (d, 1H); 7.92 (s, 1H).

Paso 3: 4-(3-Clorofenil)-4-(2-propeniloxi)imidazolidin-2,5-diona

Usando el protocolo del ejemplo 6, paso 3, haciendo reaccionar 1.5 g de 1-(3-clorofenil)-2-(2-propeniloxi)etanona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 3.52 (d, 1H); 3.95 (d, 1H); 4.02(d, 2H); 5.16 (dd, 1H); 5.25 (dd, 1H); 5.85 (ddt, 1H); 7.44 (m, 2H); 7.52 (m, 1H); 7.59 (s, 1H); 8.70 (s, 1 H); 10.83 (s, 1 H).

LCMS: (Rt = 2.57 min): Sin ionización

Paso 4: 4-[4-(3-Clorofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 4, haciendo reaccionar 1.0 g de 4-(3-clorofenil)-4-(2- propeniloxi)imidazolidin-2,5-diona se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 3.72 (d, 1H); 4.05 (m, 2H); 4.18 (d, 1H); 5.13 (d, 1H); 5.21 (d, 1H); 5.85 (ddt, 1H); 7.50 (m, 2H); 7.62 (m, 1H); 7.70 (s, 1H); 7.98 (d, 1H); 8.10 (s, 1H); 8.32 (d, 1H); 9.12 (s, 1H).

LCMS: (Rt = 3.41 min): (448/450)- (M-H-)

Paso 5: 4-[4-(3-Clorofenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 5, haciendo reaccionar 0.66 g de 4-[4-(3-clorofenil)-2,5-dioxo-4-[(2- propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se obtiene el producto deseado.

δ 1H RMN (DMSO D6): 2.88 (s, 3H); 4,10 (m, 2H); 4.20 (d, 1H); 4,42 (d, 1H); 5,16 (d, 1H); 5,22 (d, 1H); 5,89 (ddt, 1H); 7,50 (m, 1H); 7.52(m, 2H); 7.60(s, 1H); 8.00 (d, 1H); 8.15 (s, 1H), 8.33(d, 1H).

LCMS: (rt = 3.57 min, método apolar): Sin ionización

Paso 6: 4-[4-(3-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

Usando el protocolo del ejemplo 6, paso 6, haciendo reaccionar 0.60 g de 4-[4-(3-clorofenil)-2,5-dioxo-3-metil-4-[(2- propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se obtiene el producto deseado.

δ 1H RMN (MeOD): 3.08 (s, 3H); δ 4.20 (m, 1H); 4.61 (m, 1H); 7.45 (m, 1H); 7.52 (m, 2H); 8.14 (m, 2H); 8.25 (s, 1H).

LCMS: (Rt = 3.10 min): (392/394)- (M-CH2OH-) Ejemplos 10 y 11: (S)-4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo y (R)-4- [2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Los dos enantiómeros de 4-[2,5-dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo se separan por cromatografía de 1.5 g de muestra de la mezcla racémica obtenida en el ejemplo 1 en Chiralcel OD (columna LC50 Prochrom) mientras se eluye con una mezcla de heptano/isopropanol 75/25.

El enantiómero (S) se eluye en primer lugar. Evaporando el solvente, se obtiene el compuesto deseado.

[α]D = - 40.8° (c = 1 %, EtOH).

HPLC: Columna Chiralcel OD, 250 x 4.6 mm, heptano/isopropanol 75/25, velocidad de flujo 1 mL/min, Rt: 9.01 min.

El enantiómero (R) se eluye en segundo lugar. Una purificación adicional en las mismas condiciones seguida de evaporación del solvente proporciona el compuesto deseado.

[α]D = + 41.1° (c = 1 %, EtOH).

HPLC: Columna Chiralcel OD, 250 x 4.6 mm, heptano/isopropanol 75/25, velocidad de flujo 1 mL/min, Rt: 13.24 min.

Ruta alternativa: [0283] Siguiendo la misma ruta descrita para el ejemplo 1 representada en el esquema 3, se puede llevar a cabo la purificación "del producto intermedio n-1", para obtener los compuestos de los ejemplos 10 y 11 después de la desprotección usando una columna chiralpakAD® (250 x 4.6 mm), con una mezcla de CO2 supercrítico/MeCN/iPrOH (90/5/5) a 40 °C, a 100 bar, seguida de eliminación del grupo protector según procedimientos conocidos (véase ref 10).

Ejemplo 12: 4-[2,5-Dioxo-3-etil-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 4-[2,5-Dioxo-3-etil-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

El procedimiento del ejemplo 1, paso 1 aplicado a 0.23 g de 4-[2,5-dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1- il]-2-trifluorometilbenzonitrilo con 0.18 mL de yodoetano proporciona el compuesto deseado.

LCMS: (Rt = 3.20 min): 444+ (MH+)

Paso 2: 4-[2,5-Dioxo-3-etil-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

0.2 g de 4-[2,5-dioxo-3-etil-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se trata con 0.2 mL de complejo de trifluoroborano-dimetilsulfuro como se describe en el ejemplo 3, paso 2, para proporcionar el compuesto deseado.

TLC: Fr = 0.35 (heptano/acetato de etilo 20/10) δ 1H RMN (DMSO D6): 1.05 (t, 3H); 3.32 (c, 2H); 4.22 y 4.40 (2m, 2H); 5.62 (t, 1H); 7.4-7.5 (m, 5H); 8.08 (d, 1H); 8.20 (s, 1H); 8.33 (d, 1H).

LCMS: (Rt = 3.81 min): 372- (M-CH2OH-) Ejemplo 13: 4-[4-(4-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 4-(2-Hidroxiacetil)benzonitrilo

Una solución de 1 g de 4-(2-bromoacetil)benzonitrilo en acetonitrilo (5 mL) y agua (10 mL) se trata con irradiación de microondas (125 °C, 50 min). El mismo experimento se conduce cinco veces. Todos los viales se recogen, se extraen con éter etílico, se secan en sulfato de magnesio y se concentran al vacío para dar el compuesto deseado.

TLC: Fr = 0.15 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 4.94 (s, 2H); 7.85-7.87 (dd, 2H); 8.05-8.07 (dd, 2H) LCMS: (Rt = 2.40 min): No ionizable

Paso 2: 4-[2-(2-Propeniloxi)acetil]benzonitrilo

A una solución de 2.7 g de 4-(2-hidroxiacetil)benzonitrilo en bromuro de alilo (15 mL) se le agregan 10.2 g de sulfato de calcio y 6.7 g de óxido de plata. La mezcla se agita en atmósfera de argón y en la oscuridad durante 2 horas. La mezcla se diluye con AcOEt, se filtra en celite, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.38 (acetato de etilo/ciclohexano 40/60) δ 1H RMN (CDCl3): 4.01 (d, 2H); 4.57 (s, 2H); 5.13 (d, 1H); 5.22 (s, 1H); 5.73-5.86 (m, 1H); 7.64 (d, 2H); 7.91 (d, 2H) LCMS: (Rt = 3.05 min): No ionizable

Paso 3: 4-[2,5-Dioxo-4-[(2-propeniloxi)metil]imidazolidin-4-il]benzonitrilo

A una solución de 500 mg de 4-[2-(2-propeniloxi)acetil]benzonitrilo (en EtOH (5 mL) y agua (5 mL) se le agregan 324 mg de cianuro de potasio y 1.67 g de carbonato de amonio. La mezcla se calienta a reflujo toda la noche a 55 °C. La mezcla se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra al vacío para dar el compuesto deseado.

TLC: Fr = 0.16 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CD3OD): 3.45 (d, 1H); 3.86 (m, 3H); 4.95 (d, 1H); 5.06 (dd, 1H); 5.60-5.73 (m, 1H); 7.58 (s, 4H) LCMS: (Rt = 2.77 min): 270- (M-H)-

Paso 4: 4-[4-(4-Cianofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 675 mg de 4-[2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-4-il]benzonitrilo y 622 mg de 4-bromo- 2-trifluorometilbenzonitrilo en DMAC (2.5 mL) se le agregan 214 mg de óxido de cobre (I). La mezcla se calienta a reflujo toda la noche a 130 °C. La mezcla se concentra, se toma en DCM, se lava con una solución acuosa de amoníaco al 10% y solución saturada de cloruro de sodio. La fase orgánica se seca en sulfato de magnesio, se concentra al vacío y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.48 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.85 (d, 1H); 4.09-4.19 (m, 3H); 5.25-5.31 (m, 2H); 5.80-5.87 (m, 1H); 6.07 (s, 1H); 7.79-7.84 (s, 4H); 7.95 (s, 2H); 8.07 (s, 1H) LCMS: (Rt = 3.29 min): 439- (M-H)-

Paso 5: 4-[4-(4-Cianofenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 459 mg de 4-[4-(4-cianofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo obtenida en el paso 4 en DMF (1.5 mL), se le agregan 173 mg de carbonato de potasio y 130 µL de yoduro de metilo. La mezcla se agita 3 horas a temperatura ambiente, se evapora, se lava con solución saturada de cloruro de sodio, se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra para dar el compuesto deseado.

TLC: Fr = 0.54 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.09 (s, 3H); 3.95 (d, 1H); 4.14 (m, 2H); 4.39 (d, 1H); 5.28-5.34 (m, 2H); 5.84-5.91 (m, 1H); 7.57 (d, 2H); 7.80 (d, 2H), 7.95 (s, 2H), 8.10 (s, 1H) LCMS: (Rt = 3.81 min): No ionizable

Paso 6: 4-[4-(4-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 433 mg de 4-[4-(4-cianofenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo obtenida en el paso 5 en DCM (5 mL), se le agregan 600 µL de complejo de trifluoruro de boro-dimetilsulfuro. La mezcla se agita 8 horas a temperatura ambiente, se diluye con DCM, se lava con una solución acuosa de bicarbonato de sodio, se seca en sulfato de magnesio, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.10 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 3.14 (s, 3H); 4.16 (d, 1H); 4.73 (d, 1H); 7.57 (d, 2H); 7.82 (d, 2H), 7.93-8.00 (m, 2H), 8.13 (s, 1H) LCMS: (Rt = 3.05 min): 383- (M-CH2OH)- Ejemplo 14: 4-[4-(3-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 3-(2-Hidroxiacetil)benzonitrilo

Una solución de 776 mg de 3-(2-bromoacetil)benzonitrilo en acetonitrilo (5 mL) y agua (10 mL) se trata con irradiación de microondas (125 °C, 50 min). El mismo experimento se realiza una segunda vez con 976 mg. Todos los viales se recogen, se extraen con éter etílico, se secan en sulfato de magnesio y se concentran al vacío para dar el compuesto deseado.

TLC: Fr = 0.38 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 4.94 (s, 2H); 7.71 (t, 1H); 7.95 (d, 1H); 8.18 (d, 1H); 8.25 (s, 1H)

Paso 2: 3-[2-(2-Propeniloxi)acetil]benzonitrilo

A una solución de 1.08 g de 3-(2-hidroxiacetil)benzonitrilo en bromuro de alilo (8 mL) se le agregan 4 g de sulfato de calcio y 2.6 g de óxido de plata. La mezcla se agita en atmósfera de argón y oscuridad toda la noche. La mezcla se diluye con acetato de etilo, se filtra en celite, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 30/70) para dar el compuesto deseado.

TLC: Fr = 0.64 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 4.18 (d, 2H); 4.73 (s, 2H); 5.31 (d, 1H); 5.37 (d, 1H); 5.92-6.02 (m, 1H); 7.66 (t, 1H); 7.90 (d, 1H); 8.22 (d, 1H); 8.29 (s, 1H) LCMS: (Rt = 3.04 min: No ionizable

Paso 3: 3-[2,5-Dioxo-4-[(2-propeniloxi)metil]imidazolidin-4-il]benzonitrilo

A una solución de 450 mg de 3-[2-(2-propeniloxi)acetil]benzonitrilo (en EtOH (5 mL) y agua (5 mL) se le agregan 291 mg de cianuro de potasio y carbonato de amonio. La mezcla se calienta a reflujo una noche a 55 °C. La mezcla se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra al vacío para dar el compuesto deseado.

TLC: Fr = 0.1 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CD3OD): 3.70 (d, 1H); 4.10-4.14 (m, 3H); 5.23 (d, 1H); 5.33 (d, 1H); 5.89-5.98 (m, 1H); 7.67 (t, 1H); 7.80 (d, 2H); 7.98-8.02 (m, 1H)

Paso 4: 4-[4-(3-Cianofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 579 mg de 3-[2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-4-il]benzonitrilo y 534 mg de 4-bromo- 2-(trifluorometil)benzonitrilo en DMAC (2.5 mL) se le agregan 183 mg de óxido de cobre. La mezcla se calienta a reflujo toda la noche a 130 °C. La mezcla se concentra, se toma en DCM, se lava con una solución acuosa de amoníaco al 10% y solución saturada de cloruro de sodio. La fase orgánica se seca en sulfato de magnesio, se concentra al vacío y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.3 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.85 (d, 1H); 4.07-4.21 (m, 3H); 5.26-5.38 (m, 2H); 5.80-5.89 (m, 1H); 6.24 (s, 1H); 7.59-7.70 (m, 1H); 7.80(d, 1H); 7.94-8.19 (m, 5H) LCMS: (Rt = 3.26 min): 439- (M-H)-

Paso 5: 4-[4-(3-Cianofenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 358 mg de 4-[4-(3-cianofenil)-2,5-dioxo-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo en DMF (1.5 mL), se le agregan 135 mg de carbonato de potasio y 101 µL de yoduro de metilo. La mezcla se agita durante la noche a temperatura ambiente, se evapora, se lava con solución saturada de cloruro de sodio, se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra para dar el compuesto deseado.

TLC: Fr = 0.58 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.09 (s, 3H); 3.95 (d, 1H); 4.14 (m, 2H); 4.38 (d, 1H); 5.29-5.34 (m, 2H); 5.84-5.91 (m, 1H); 7.63- 7.79 (m, 4H); 7.96 (s, 2H); 8.11 (s, 1H) LCMS: (Rt = 3.81 min): No ionizable

Paso 6: 4-[4-(3-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

Se agregan 328 µL de complejo de trifluoroborano-dimetilsulfuro a una solución de 354 mg de 4-[4-(3-cianofenil)-2,5- dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo en DCM (5 mL). La mezcla se agita 6 horas a temperatura ambiente, se diluye con DCM, se lava con una solución acuosa de bicarbonato de sodio, se seca en sulfato de magnesio, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.30 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.14 (s, 3H); 4.17 (m, 1H); 4.71 (d, 1H); 7.65-7.79 (m, 4H); 7.94-8.02 (m, 2H); 8.14 (s, 1H) LCMS: (Rt = 3.04 min): 383- (M-CH2OH)- Ejemplo 15: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-(3-trifluorometilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 1-(3-Trifluorometilfenil)-2-hidroxietanona

Una solución de 2-bromo-1-[3-(trifluorometil)fenil]etanona (1 g) en acetonitrilo (2.5 mL) y agua (10 mL) se trata con irradiación de microondas (125 °C, 50 min). El mismo experimento se repite cinco veces. Todos los viales se recogen, se extraen con DCM, se secan en sulfato de magnesio y se concentran al vacío para dar el compuesto deseado.

δ 1H RMN (CDCl3): 4.96 (s, 2H); 7.70 (m, 1H); 7.93 (d, 1H); 8.14 (d, 1H), 8.22 (s, 1H)

Paso 2: 2-[(2-Propeniloxi)metil]-1(3-trifluorometilfenil)etanona

A una solución de 1-(3-trifluorometilfenil)-2-hidroxietanona (3.66 g) en bromuro de alilo (20 mL) se le agregan sulfato de calcio (10.9 g) y óxido de plata (7.1 g). La mezcla se agita en atmósfera de argón y oscuridad durante 2 horas. La mezcla se diluye con acetato de etilo, se filtra en celite, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 15/85) para dar el compuesto deseado.

TLC: Fr = 0.79 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 4.20 (m, 2H); 4.78 (s, 2H); 5.30 (d, 1H); 5.38 (d, 1H); 5.94-6.02 (m, 1H); 7.66 (t, 1H); 7.88 (d, 1H); 8.18 (d, 1H), 8.25 (s, 1H) LCMS: (Rt = 3.53 min): No ionizable

Paso 3: 4-[(2-Propeniloxi)metil]-4-(3-(trifluorometilfenil)imidazolidin-2,5-diona

A una solución de 2-[(2-propeniloxi)metil]-1-(3-trifluorometilfenil)etanona (1.17 g) en EtOH (5 mL) y agua (5 mL) se le agrega cianuro de potasio (624 mg) y carbonato de amonio (3.2 g). La mezcla se calienta a reflujo toda la noche a 55 °C. La mezcla se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra al vacío para dar el compuesto deseado.

TLC: Fr = 0.45 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.80 (d, 1H); 4.00-4.10 (m, 3H); 5.20-5.27 (m, 2H); 5.77-5.87 (m, 1H); 6.77 (s, 1H); 7.57 (t, 1H); 7.67 (d, 1H); 7.77-7.88 (m, 2H), 8.59 (s, 1H) LCMS: (Rt = 3.19 min): 313- (M-H)-

Paso 4: 4-[2,5-Dioxo-4-[(2-propeniloxi)metil]-4-(3-trifluorometilfenil)-imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 4-[(2-propeniloxi)metil]-4-(3-trifluorometilfenil)imidazolidin-2,5-diona (1.45 g) y 4-bromo-2- (trifluorometil)benzonitrilo (1.15 g) en DMAC (7 mL) se le agrega óxido de cobre (528 mg). La mezcla se calienta a reflujo toda la noche a 130 °C. La mezcla se concentra, se toma en acetato de etilo, se lava con una solución acuosa de amoníaco al 10% y solución saturada de cloruro de sodio. La fase orgánica se seca en sulfato de magnesio, se concentra al vacío y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.69 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.84 (d, 1H); 4.10 (m, 2H); 4.20 (d, 1H); 5.25-5.30 (m, 2H); 5.80-5.89 (m, 1H); 6.57 (s, 1H); 7.62- 7.66 (t, 1H); 7.74 (d, 1H); 7.91-7.96 (m, 4H), 8.09 (s, 1H) LCMS: (Rt = 3.55 min): 482- (M-H)-

Paso 5: 4-[2,5-Dioxo-3-metil-4-[(2-propeniloxi)metil]-4-(3-trifluorometilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 814 mg de 4-[2,5-dioxo-4-[(2-propeniloxi)metil]-4-(3-trifluorometilfenil)imidazolidin-1-il]-2- trifluorometilbenzonitrilo en DMF (1.5 mL) se le agrega carbonato de potasio (279 mg) y yoduro de metilo (420 µL). La mezcla se agita 5 horas a temperatura ambiente, se evapora, se lava con solución saturada de cloruro de sodio, se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra para dar el compuesto deseado.

TLC: Fr = 0.39 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 3.09 (s, 3H); 3.98 (d, 1H); 4.14-4.19 (m, 2H); 4.42 (d, 1H); 5.28-5.34 (m, 2H); 5.85-5.92 (m, 1H); 7.64-7.68 (m, 3H); 7.75 (d, 1H); 7.93-8.00 (m, 2H), 8.12 (s, 1H) LCMS: (Rt = 4.05 min): No ionizable

Paso 6: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-(3- trifluorometilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 782 mg de 4-[4-(3-trifluorometilfenil)-2,5-dioxo-3-metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo en DCM (5 mL), se le agregan 662 µL de complejo de trifluoroborano-dimetilsulfuro. La mezcla se agita 6 horas a temperatura ambiente, se diluye con DCM, se lava con una solución acuosa de bicarbonato de sodio, se seca en sulfato de magnesio, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.45 (acetato de etilo/ciclohexano 50/50) δ 1H RMN (CDCl3): 3.14 (s, 3H); 4.18 (d, 1H); 4.75 (dd, 1H); 7.62-7.69 (m, 3H); 7.76 (d, 1H); 7.95 (d, 1H); 8.02 (d, 1H); 8.16 (s, 1H) LCMS: (Rt = 3.10 min): 426- (M-CH2OH)- Ejemplo 16: 1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona (Método A)

Paso 1: 1-Fenil-2-(2-propeniloxi)etanona

Este compuesto se prepara a partir de 2-hidroxi-1-feniletanona, según el procedimiento utilizado por G.A. Molander y J.A. McKie en 1-hidroxi-butan-2-ona, J. Org.Chem. (1995), 60, 872-882.

Paso 2: 4-Fenil-4-[(2-propeniloxi)metil]imidazolidin-2,5-diona

Se calientan 0.775 g de 1-fenil-2-(2-propeniloxi)etanona, 0.575 g de cianuro de potasio y 1.6 g de carbonato de amonio a 55 °C durante 3 horas en 23 mL de una mezcla de etanol/agua 50/50. La mezcla de reacción se diluye con agua y se extrae con acetato de etilo. La solución orgánica se lava con una solución acuosa saturada de cloruro de sodio, después se seca en sulfato de sodio y se evapora para obtener el compuesto deseado.

TLC: Rf = 0.42 (gel de sílice, eluyente: heptano-acetato de etilo 50-50) δ 1H-RMN (CD3OD): 3.68 (d, 1H); 4.13 (m, 3H); 4.22 (d, 1H); 4.92 (s, 2H); 5.22 (dd, 1H); 5.34 (dd, 1H); 5.95 (ddt, 1H); 7.45 (m, 3H); 7.64 (d, 2H) LCMS: (rt = 5.79 min): 288+ (MH, MeCN+)

Paso 3: 1-(3,4-Diclorofenil)-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-2,5-diona

Se disuelven 0.7 g de 4-fenil-2-(propeniloxi)imidazolidin-2,5-diona en 2 mL de DMAC y se agregan 780 mg de 1,2- dicloro-4-yodobenceno, seguido de 234 mg de óxido de cobre (I). La mezcla se calienta a 160 °C durante 3 horas. A temperatura ambiente, la mezcla se diluye con una solución acuosa de amoníaco al 20% y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 2/1.

δ 1H RMN (DMSO): 3.70 (d, 1H); 4.08 (m, 2H); 4.15 (d, 1H); 5.17 (d, 1H); 5.25 (d, 1H); 5.88 (ddt, 1H); 7.38-7.50 (m, 4H); 7.62 (d, 2H); 7.67 (m, 1H); 7.78 (d, 1H), 9.40(s, 1H).

LCMS: (Rt = 3.44 min): sin ionización

Paso 4: 1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona

A una solución de 0.45 g de 5-1-(3,4-diclorofenil)-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-2,5-diona en 3 mL de DMF, se le agregan 238 mg de carbonato de potasio y 0.143 mL de yodometano. La mezcla se agita a temperatura ambiente durante 5 horas, se evapora hasta sequedad, se diluye con solución saturada de cloruro de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de sodio, se filtra se evapora para producir 0.47 g de aceite amarillo, que después se disuelve en 5 mL de DCM en atmósfera de argón. Después se le agrega 0.4 mL de complejo de trifluoroborano-dimetilsulfuro. La mezcla se agita a temperatura ambiente durante 5 horas. Se le agrega lentamente una solución acuosa saturada de bicarbonato de sodio. La mezcla se extrae con DCM y la capa orgánica se seca en sulfato de sodio, se filtra y se evapora. El producto crudo se purifica por cristalización de DCM/éter etílico.

δ 1H RMN (MeOD): 3.02 (s, 3H); 4.20 (d, 1H); 4.62 (d, 1H); 7.43-7.57 (m, 5H); 7.68 (d, 1H); 7.92 (d, 1H); 7.75 (m, 1H).

LCMS: (Rt = 3.13 min): Sin ionización Procedimiento general para los ejemplos 17 a 19, (Método A) Paso 1 Se disuelven 0.415 g de 4-[2,5-dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo en 40 mL de DMF con el haluro de alquilo adecuado y 163 mg de carbonato de potasio. La mezcla se agita a temperatura ambiente durante 5 h, se evapora hasta sequedad, se diluye con agua y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y el solvente se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 70/30.

Paso 2 Se agrega 0.3 mL de complejo trifluoroborano-dimetilsulfuro en 10 mL de diclorometano a una solución de los compuestos obtenidos en el paso 1, se disuelve en 15 mL de diclorometano (respectivamente 0.32 g de N- isopropilo, 0.4 g de N-ciano metilo y 0.4 g de N-propargilo). La mezcla se agita a temperatura ambiente durante 6 h, se vierte en una solución acuosa saturada de bicarbonato de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 70/30.

Ejemplo 17: 4-[2,5-Dioxo-4-hidroximetil-3-(1-metiletil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Paso 1: 4-[2,5-Dioxo-3-(1-metiletil)-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo TLC: Fr = 0.65 (heptano/acetato de etilo 50/50) Paso 2: 4-[2,5-Dioxo-4-hidroximetil-3-(1-metiletil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo TLC: Fr = 0.45 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 1.41 (d, 3H); 1.53 (d, 3H); 3.40 (dt, 1H); 4.30 (d, 1H); 4.72 (d, 1H); 7.37 (m, 2H); 7.48 (m, 3H); 7.93 (d, 1H); 8.06 (d, 1H); 8.20 (s a, 1H) LCMS: (Rt = 3.37 min): 386- (M-CH2OH-) Ejemplo 18: 4-[2,5-Dioxo-3-cianometil-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

Paso 1: 4-[3-Cianometil-2,5-dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

TLC: Fr = 0.25 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 4.09 (d, 1H); 4.20 (m, 3H); 4.47 (d, 1H); 4.60 (d, 1H); 5.29 (d, 1H); 5.33 (d, 1H); 5.92 (ddt, 1H); 7.38 (m, 2H); 7.53 (m, 3H); 7.98 (s a, 2H); 8.11 (s a, 1H) LCMS: (Rt = 3.39 min): no ionizable

Paso 2: 4-[2,5-Dioxo-3-cianometil-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

TLC: Fr = 0.35 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 4.10 (d, 1H); 4.46 (d, 1H); 4.69 (d, 1H); 4.77 (d, 1H); 7.36 (m, 2H); 7.53 (m, 3H); 7.98 (d, 1H); 8.01 (d, 1H); 8.12 (s a, 1H) LCMS: (Rt = 3.12 min): 383- (M-CH2OH-) Ejemplo 19: 4-[2,5-Dioxo-4-hidroximetil-4-fenil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

Paso 1: 4-[2,5-Dioxo-4-fenil-4-[(2-propeniloxi)metil]-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

TLC: Fr = 0.65 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 2.27 (m, 1H); 4.06 (dd, 1H); 4.14 (m, 2H); 4.22 (d, 1H); 4.40 (dd, 1H); 4.46 (d, 1H); 5.26 (d, 1H); 5.31 (d, 1H); 5.91 (ddt, 1H); 7.41 (m, 2H); 7.49 (m, 3H); 7.94 (d, 1H); 8.01 (dd, 1H); 8.14 (s a, 1H) LCMS: (Rt = 3.45 min): no ionizable

Paso 2: 4-[2,5-Dioxo-4-hidroximetil-4-fenil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

TLC: Fr = 0.40 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 2.48 (m, 1H); 3.83 (dd, 1H); 4.48 (d, 1H); 4.73 (d, 1H); 4.81 (dd, 1H); 7.46 (m, 2H); 7.51 (m, 3H); 7.95 (d, 1H); 8.03 (d, 1H); 8.18 (s a, 1H) LCMS: (Rt = 3.16 min): 382- (M-CH2OH-) Ejemplo 20: 4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 4-[2,5-Dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 0.47 g de 4-fenil-4-[(2-propeniloxi)metil]imidazolidin-2,5-diona en 30 mL de DMF se le agregan 0.28 g de óxido de cobre (I) y 0.81 g de 4-bromo-2-trifluorometilbenzonitrilo. La mezcla se calienta a 135 °C durante 20 horas y después se evapora hasta sequedad. El producto crudo se diluye con una solución acuosa de amoníaco al 20% y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 70/30.

TLC: Fr = 0.30 (heptano/acetato de etilo 7/-30) δ 1H RMN (CDCl3): 3.86 (d, 1H); 4.14 (s a, 2H); 4.27 (d, 1H); 5.28 (d, 1H); 5.32 (d, 1H); 5.89 (ddt, 1H); 7.52 (m, 3H); 7.70 (m, 2H); 7.98 (m, 2H); 8.14 (m. 1H) LCMS: (Rt = 6,91 min): 414- (M-H-)

Paso 2: 4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 0.18 g de 4-[2,5-dioxo-4-fenil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo en 15 mL de DCM se le agregan 0.2 mL de complejo de trifluoroborano-dimetilsulfuro en 10 mL de diclorometano. La mezcla se agita a temperatura ambiente durante 6 horas, se vierte en una solución acuosa saturada de bicarbonato de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 70/30.

TLC: Fr = 0.25 (heptano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 3.99 (d, 1H); 4.42 (d, 1H); 7.11 (s a, 1H); 7.49 (m, 3H); 7.64 (m, 2H); 7.94 (m, 2H); 8.10 (s a, 1H) LCMS: (Rt = 3.02 min): 344- (M-CH2OH-) Ejemplo 21: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-(3-metilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo (Método A)

Paso 1: 2-bromo-1-(3-metilfenil)etanona

A una solución de 1-(3-metilfenil)etanona (2 g) en éter etílico (20 mL) se le agrega bromo (726 µL) a 0 °C. La mezcla se trata con una solución acuosa de bicarbonato de sodio, se extrae con éter etílico, se seca en sulfato de magnesio, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano 0/100) para dar el compuesto deseado.

TLC: Fr = 0.42 (acetato de etilo/ciclohexano 10/90).

δ 1H RMN (CDCl3): 2.47 (s, 3H); 4.49 (s, 2H); 7.40-7.47 (m, 2H); 7.81-7.91 (m, 2H).

LCMS: (Rt = 3.42 min): no ionizable.

Paso 2: 2-hidroxi-1-(3-metilfenil)etanona

Una solución de 2-bromo-1-(3-metilfenil)etanona (1 g) en acetonitrilo (2.5 mL) y agua (13 mL) se trata con irradiación de microondas (125 °C, 50 min). El mismo experimento se repite tres veces. Todos los viales se recogen, se extraen con DCM, se secan en sulfato de magnesio y se concentran al vacío para dar el compuesto deseado.

TLC: Fr = 0.15 (acetato de etilo/ciclohexano 10/90).

δ 1H RMN (CDCl3): 2.47 (s, 3H); 4.90 (s, 2H); 7.41-7.49 (m, 2H); 7.74-7.78 (m, 2H).

Paso 3: 2-[(2-Propeniloxi)metil]-1-(3-metilfenil)etanona

A una solución de 2-hidroxi-1-(3-metilfenil)etanona (1.95 g) en bromuro de alilo (10 mL) se le agrega sulfato de calcio (7.9 g) y óxido de plata (5.1 g). La mezcla se agita en atmósfera de argón y oscuridad durante 2 horas. La mezcla se diluye con acetato de etilo, se filtra en celite, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano 0/100 a 15/85) para dar el compuesto deseado.

TLC: Fr = 0.54 (acetato de etilo/ciclohexano 30/70) δ 1H RMN (CDCl3): 2.45 (s, 3H); 4.20 (d, 2H); 4.79 (s, 2H); 5.29 (d, 1H); 5.37 (d, 1H); 5.96-6.04 (m, 1H); 7.37-7.45 (m, 2H); 7.75-7.79 (m, 2H).

LCMS: (Rt = 3.30 min): no ionizable.

Paso 4: 4-[(2-Propeniloxi)metil]-4-(3-(metilfenil)imidazolidin-2,5-diona

A una solución de 2-[(propeniloxi)metil]-1-(3-metilfenil)etanona (690 mg) en etanol (5 mL) y agua (5 mL) se le agregan cianuro de potasio (472 mg) y carbonato de amonio (2.44 g). La mezcla se calienta a reflujo toda la noche a 55 °C. La mezcla se extrae con acetato de etilo, se seca en sulfato de magnesio y se concentra al vacío para dar el compuesto deseado.

δ 1H RMN (CDCl3): 2.41 (s, 3H); 3.78 (d, 1H); 4.06-4.09 (m, 3H); 5.22-5.30 (m, 2H); 5.81-5.90 (m, 1H); 5.94 (s, 1H); 7.21-7.39 (m, 4H); 7.61 (s, 1H).

LCMS: (Rt = 2.97 min): no ionizable.

Paso 5: 4-[2,5-Dioxo-4-(3-metilfenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 4-[(2-propeniloxi)metil]-4-(3-metilfenil)imidazolidin-2,5-diona (899 mg) y 4-bromo-2- (trifluorometil)benzonitrilo (863 mg) en DMAC (5 mL) se le agrega óxido de cobre (I) (395 mg). La mezcla se calienta a reflujo toda la noche a 130 °C. La mezcla se concentra, se toma en acetato de etilo, se lava con una solución acuosa de amoníaco al 10% y solución saturada de cloruro de sodio. La fase orgánica se seca en sulfato de magnesio, se concentra al vacío y se purifica en gel de sílice (acetato de etilo/ciclohexano: 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.30 (acetato de etilo/ciclohexano 30/70).

δ 1H RMN (CDCl3): 2.44 (s, 3H); 3.80 (d, 1H); 4.10 (m, 2H); 4.22 (d, 1H); 5.23-5.30 (m, 2H); 5.83-5.90 (m, 1H); 6.37 (s, 1H); 7.26-7.45 (m, 4H); 7.93-7.98 (s, 2H); 8.11 (s, 1H).

LCMS: (Rt = 3.43 min): 428- (M-H)-.

Paso 6: 4-[2,5-Dioxo-3-metil-4-(3-metilfenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 4-[2,5-dioxo-4-(3-metilfenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo (829 mg) en DMF (1.5 mL) se le agrega carbonato de potasio (320 mg) y yoduro de metilo (480 µL). La mezcla se agita 3 horas a temperatura ambiente, se evapora, se lava con solución saturada de cloruro de sodio, se extrae con acetato de etilo, se seca en MgSO4 y se concentra para dar el compuesto deseado.

TLC: Fr = 0.43 (acetato de etilo/ciclohexano 30/70).

δ 1H RMN (CDCl3): 2.43 (s, 3H); 3.04 (s, 3H); 3.97 (d, 1H); 4.14 (m, 2H); 4.42 (d, 1H); 5.25-5.34 (m, 2H); 5.85-5.91 (m, 1H); 7.17 (m, 2H); 7.26-7.28 (m, 1H); 7.93 (d, 2H); 8.01 (d, 1H); 8.15 (s, 1H).

LCMS: (Rt = 4.01 min): no ionizable.

Paso 7: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-(3-metilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo

A una solución de 856 mg de 4-[2,5-dioxo-3-metil-4-(3-metilfenil)-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2- trifluorometilbenzonitrilo en DCM (5 mL) se le agrega complejo de trifluoroborano-dimetilsulfuro (812 µL). La mezcla se agita 4 horas a temperatura ambiente, se diluye con DCM, se lava con una solución acuosa de bicarbonato de sodio, se seca en sulfato de magnesio, se concentra y se purifica en gel de sílice (acetato de etilo/ciclohexano 0/100 a 50/50) para dar el compuesto deseado.

TLC: Fr = 0.76 (acetato de etilo/ciclohexano 50/50).

δ 1H RMN (CDCl3): 2.44 (s, 3H); 3.09 (s, 3H); 4.17 (d, 1H); 4.72 (d, 1H); 7.17 (m, 2H); 7.28 (m, 1H); 7.39 (m, 1H); 7.93 (d, 1H); 8.03 (d, 1H); 8.18 (s, 1H).

LCMS: (Rt = 3.19 min): 372- (M-CH2OH)-.

Ejemplo 22: 4-[4-(2-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Usando el protocolo descrito en el ejemplo 6, paso 6, haciendo reaccionar 0.80 g de 4-[4-(2-clorofenil)-2,5-dioxo-3- metil-4-[(2-propeniloxi)metil]imidazolidin-1-il]-2-trifluorometilbenzonitrilo se obtiene el compuesto deseado.

δ 1H RMN (DMSO D6): 2.69 (s, 3H); δ 4.25 (m, 1H); 4.46 (m, 1H); 5.90 (t, 1H); 7.50 (m, 3H); 7.58 (m, 2H); 8.05 (m, 2H), 8.35(d, 1H).

LCMS: (Rt = 3.47 min): (392/394)- (M-CH2OH-).

Ejemplo 23: Sulfato ácido de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo Una solución de 0.39 g de 4-[3-metil-4-hidroximetil-2,5-dioxo-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo y 0.48 g de complejo de trióxido de azufre-piridina en 20 mL de piridina, se calienta a reflujo durante 18 horas y después se evapora hasta sequedad. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de DCM/metanol/ácido acético/agua 90/10/1/1.

TLC: Fr = 0.25 (DCM/metanol/ácido acético/agua 90/10/1/1).

δ 1H RMN (CD3OD): 3.09 (NCH3); 4.69 (d, 1H); 5,03 (d, 1H); 7.54 (m, 5H); 8.13 (m, 2H); 8.25 (sl, 1H). LCMS: (Rt = 3.52 min): 468- (M-H-).

Ejemplo 24: Fosfato ácido de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

Paso 1: Dietil fosfato de [1-(4-Ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

Una solución de 0.4 g de 4-[3-metil-4-hidroximetil-2,5-dioxo-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo en 2 mL de piridina y 0.2 mL de fosfato de dietilo se agita durante 3 horas a temperatura ambiente en atmósfera de argón.

La mezcla se detiene con ácido clorhídrico acuoso 2 M y se extrae con éter dietílico y acetato de etilo. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de DCM/acetato de etilo 4/1.

TLC: Fr = 0.7 (DCM/acetato de etilo 4/1).δ 1H RMN (CD3OD): 1.31 (c, 6H); 3.03 (s, 3H); 4.15 (m, 4H); 4.83 y 5.07 (2m, 2H); 7.45-7.55 (m, 5H); 8.06 (m, 1H); 8.15 (m, 2H).

LCMS: (Rt = 3.76 min): 526+ (MH+).

Paso 2: Fosfato diácido de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

En atmósfera de argón, se agrega 1 mL de bromotrimetilsilano a una solución de 0.39 g de dietil fosfato de 1-(4- ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo en 10 mL de DCM enfriado a 0 °C. La reacción se agita durante 1 hora a 0 °C y después 18 horas a temperatura ambiente. El solvente se evapora y después el residuo se disuelve en una mezcla de agua y etanol. Los solventes se evaporan y este proceso se repite dos veces. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de DCM/metanol/ácido acético/agua 85/15/1/1 para proporcionar 0.25 g de un sólido blanco. Después de lavar con una mezcla de éter dietílico/pentano, se obtiene el compuesto deseado.

δ 1H RMN (DMSO D6): 2.90 (s, 3H); 4.58 y 4.70 (m, 2H);7.49 (m, 5H); 8.04 (d, 1H); 8.20 (s, 1H); 8.35 (d, 1H).

LCMS: (Rt = 2.46 min): 468- (M-H-).

Ejemplo 25: Cloruro de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1- oxobutan-2-aminio

Paso 1: Éster [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metílico del ácido (2S)-2-[(1,1- dimetiletoxi)carbonilamino]-3-metilbutanoico

Una solución de 0.3 g de 4-[2,5-dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo, 0.217g de ácido (2S)-2-[(1,1-dimetiletoxi)carbonilamino]-3-metilbutanoico, 0.122 g de 4-dimetilaminopìridina y 0.3 g de clorhidrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida en 50 mL de diclorometano se agita durante 18 horas, y después se vierte en agua y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de heptano/acetato de etilo 70/30 para proporcionar el compuesto deseado.

TLC: Fr = 0.20 (heptano/acetato de etilo 70/30).

LCMS: (Rt = 4.07 min): 489+ (M-tBuOCO+H+).

Paso 2: Cloruro de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1- oxobutan-2-aminio

Se agregan 2 mL de ácido trifluoroacético a una solución de 0.43 g de éster [1-(4-ciano-3-trifluorometilfenil)-2,5- dioxo-3-metil-4-fenilimidazolidin-4-il]metílico del ácido (2S)-2-[(1,1-dimetiletoxi)carbonilamino]-3-metilbutanoico en 20 mL de diclorometano. La mezcla se agita a 25 °C durante 2 horas y después el solvente se evapora hasta sequedad. El producto crudo se diluye con una solución acuosa saturada de bicarbonato de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora.

El producto crudo se disuelve en 100 mL de mezcla de diclorometano/éter etílico (5/95) y se agrega 0.4 mL de una solución de cloruro de hidrógeno 2 M en éter etílico. Después de la filtración, se obtiene el compuesto deseado.

TLC: Fr = 0.2 (diclorometano/metanol 95/5).

δ 1H RMN (CD3OD): 1.06 (m, 6H); 2.25 (m, 1H); 3.07 (d, 3H); 4.12 (m, 1H); 4.75 (dd, 1H); 4.88 (t, 1H); 7.58 (m, 5H); 8.19 (m, 2H); 8.26 (m, 1H).

LCMS: (Rt = 2.8 min): 489+ (M+H+).

Ejemplo 26: Ácido-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico A una solución de 0.20 g de 4-[3-metil-4-hidroximetil-2,5-dioxo-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo en 3 mL de piridina se le agregan 6 mg de dimetilaminopiridina y 0.052 g de anhídrido succínico. La mezcla se agita durante 12 horas y después se evapora hasta sequedad. El producto crudo se lava con agua y se extrae con DCM. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con ciclohexano/acetato de etilo 50/50 para dar el compuesto deseado.

TLC: Fr = 0.17 (ciclohexano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 2.67-2.72 (m, 4H); 3.02 (s, 3H); 4.92 (d, 1H); 5.03 (d, 1H); 7.39 (m, 2H); 7.53 (m, 3H); 7.96 (d, 1H); 8.04 (dd, 1H); 8.18 (d, 1H).

LCMS: (Rt = 3.49 min): 358- (M-H-CH2O-C4H4O3).

Ejemplo 27: Fosfato diácido de (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

Paso 1: Dietil fosfato de (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

Una solución de 1.2 g de (S)-4-[3-metil-4-hidroximetil-2,5-dioxo-4-fenilimidazolidin-il]-2-trifluorometilbenzonitrilo en 6 mL de piridina y 0.6 mL de cloro fosfato de dietilo se agita durante 48 horas a temperatura ambiente en atmósfera de argón. La mezcla se detiene con ácido clorhídrico acuoso 2 M y se extrae con acetato de etilo. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 1/1.

TLC: Fr = 0.12 (heptano/acetato de etilo 1/1).

δ 1H RMN (CDCl3): 1.45 (m, 6H); 1.75 (sl, 1H); 3.10 (s, 3H); 4.13 (m, 4H); 4.65(c, 1H); 5.02 (c, 1H); 7.37 (m, 2H); 7.51 (m, 3H); 7.95 (d, 1H); 8.0 (dd, 1H); 8.13 (sl, 1H).

LCMS: (Rt = 4,66 min): 526+ (MH+).

[α]D = - 44.8° (c = 1 %, EtOH).

Paso 2: Fosfato diácido de (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo

En atmósfera de argón, se agregan 2.5 mL de bromotrimetilsilano a una solución de 0.80 g de dietil fosfato de (S)-1- (4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo en 25 mL de DCM enfriado a 0 °C. La reacción se agita durante 1 hora a 0 °C y después 18 horas a temperatura ambiente. El solvente se evapora y después el residuo se disuelve en una mezcla de agua y metanol. Los solventes se evaporan y este proceso se repite dos veces. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de diclorometano/metanol/ácido acético/agua 90/10/1/1 a 85/15/2/2 para proporcionar el compuesto deseado.

TLC: Fr = 0.12 (diclorometano/metanol/ácido acético/agua 85/15/2/2).

δ 1H RMN (CD3OD): 2.00 (m, 2H); 3.09 (m, 2H); 3.37(sl, 3H); 4.51 (dl, 1H); 4.91 (dl bajo el pico del agua), 1H); 7.53 (m, 5H); 816 (m, 2H); 8.27 (m, 1H).

LCMS: (Rt = 2.50 min): 470 + (M+H+).

[α]D = - 47.6° (c = 1.05 %, EtOH).

Ejemplo 28: Ácido-(S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico A una solución de 0.60 g de (S)-4-[3-metil-4-hidroximetil-2,5-dioxo-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo en 24 mL de piridina se le agregan 19 mg de dimetilaminopiridina y 1.54 g de anhídrido succínico. La mezcla se agita a 110 °C durante 7 horas y después se evapora hasta sequedad. El producto crudo se lava con agua y se extrae con diclorometano. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con heptano/acetato de etilo 50/50 para dar el compuesto deseado.

TLC: Fr = 0.17 (ciclohexano/acetato de etilo 50/50) δ 1H RMN (CDCl3): 2.67-2.74 (m, 4H); 3.02 (s, 3H); 4.92 (d, 1H); 5.03 (d, 1H); 7.38 (m, 2H); 7.52 (m, 3H); 7.96 (d, 1H); 8.04 (dd, 1H); 8.18 (d, 1H).

LCMS: (Rt = 3.22 min): 358- (M-H-CH2O-C4H4O3).

Ejemplo 29: Cloruro de (S)-((S)-1-(4-ciano-3-(trifluorometil)fenil)-3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metil-3- metilbutanoato-2-amonio

Paso 1: Éster (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-y]metílico del ácido (2S)-2- [(1,1-dimetiletoxi)carbonilamino]-3-metilbutanoico.

Una solución de 0.45 g de (S)-4-[2,5-dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo, 0.33 g de ácido (2S)-2-[(1,1-dimetiletoxi)carbonilamino]-3-metilbutanoico, 0.185 g de 4-dimetilaminopiridina y 0.45 g de clorhidrato de 1-(3-dimetilaminopropil)-3-etilcarbodiimida en 70 mL de diclorometano se agita durante 1 hora después se vierte en agua y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se purifica por cromatografía en gel de sílice mientras se eluye con mezcla de heptano/acetato de etilo 70/30 para proporcionar el compuesto deseado.

TLC: Fr = 0.20 (heptano/acetato de etilo 70/30).

δ 1H RMN (CDCl3): 0.89 y 0.97 (2d, 6H); 1.46 (s, 9H); 2.05 (m, 1H); 3.02 (s, 3H); 4.22 (m, 1H); 4.93 (m, 2H); 5.04 (m, 1H); 7.38 (m, 2H); 7.52 (m, 3H); 7.96 (d, 1H); 8.04 (dl, 1H); 8.15 (sl, 1H).

LCMS: (Rt = 3.90 min): 489+ (M-tBuOCO+H+).

[α]D = - 54.7° (c = 1.25 %, EtOH).

Paso 2: Cloruro de (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1-

oxobutan-2-aminio

Se agregan 3 mL de ácido trifluoroacético a una solución de 0.65 g de éster (S)-[1-(4-ciano-3-trifluorometilfenil)-2,5- dioxo-3-metil-4-fenilimidazolidin-4-il]metílico del ácido (2S)-2-[(1,1-dimetiletoxi)carbonilamino]-3-metilbutanoico en 30 mL de diclorometano. La mezcla se agita a temperatura ambiente durante 5 horas, se agregan 20 mL de tolueno y después el solvente se evapora hasta sequedad. El producto crudo se diluye con una solución acuosa saturada de bicarbonato de sodio y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra y se evapora. El producto crudo se disuelve en 120 mL de mezcla de diclorometano/éter etílico (10/90) y se agrega 0.75 mL de una solución de cloruro de hidrógeno 2 M en éter etílico. Después de la filtración, se obtiene el compuesto deseado. TLC: Fr = 0.2 (diclorometano/metanol 95/5).

δ 1H RMN (CD3OD): 1.07 y 1.10 (2d, 6H); 2.26 (m, 1H); 3.07 (s, 3H); 4.11 (d, 1H); 5.22 y 5.36 (2d, 2H); 7.58 (m, 5H); 8.19 (AB, 2H); 8.25 (sl, 1H).

[α]D = - 46.7° (c = 1.08 %, EtOH).

Ejemplo 30: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-metoxibenzonitrilo

Paso 1: 4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2-metoxibenzonitrilo

Una solución de 384 mg de isocianato de 4-ciano-3-metoxifenilo (preparada según WO 2007/137874) en 8 mL de dioxano se agrega una solución de 200 mg de 2-hidroximetil-2-fenilglicina (preparada según un procedimiento bibliográfico) en una solución acuosa de 1.8 mL de hidróxido de sodio 1 N en 2 mL de agua. La mezcla se agita a temperatura ambiente toda la noche, se acidifica agregando 3 mL de HCl 12 N y se calienta a 110 °C durante 2 horas. La solución se trata después con una solución acuosa saturada de bicarbonato de sodio, se extrae con acetato de etilo, se seca en sulfato de magnesio, se filtra, se evapora y se purifica en gel de sílice eluyendo con mezcla de heptano/acetato de etilo 60/40 para dar el producto esperado.

TLC: Fr = 0.30 (heptano/acetato de etilo 50/50).

δ 1H RMN (CDCl3): 3.98 (s, 3H); 4.06 y 4.40 (2d, 2H); 6.07 (bs, 1H); 7.23 (m, 2H); 7.51 (m, 3H); 7.66 (m, 3H).

LCMS: (Rt = 5.44 min): 306- (M-CH2OH)-.

Paso 2: 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1-il]-2-metoxibenzonitrilo

Se agregan 173 mg de carbonato de potasio y 86 µL de yoduro de metilo a una solución de 141 mg de 4-[2,5-dioxo- 4-hidroximetil-4-fenilimidazolidin-1-il]-2-metoxibenzonitrilo en 2 mL de DMF. La mezcla se agita toda la noche a temperatura ambiente y se evapora hasta sequedad. El residuo se toma en agua y se extrae con acetato de etilo. La capa orgánica se seca en sulfato de magnesio, se filtra, se evapora y se somete a cromatografía en gel de sílice mientras se eluye con una mezcla de heptano/acetato de etilo 70/30 para dar el producto esperado.

δ 1H RMN (CDCl3): δ 3.09 (s, 3H); 3.97 (s, 3H); 4.17 y 4.72 (2d, 2H); 7.27 (m, 2H); 7.40 (m, 2H); 7.50 (m, 3H); 7.64 (m, 1H).

LCMS: (Rt = 5.67 min): no ionizable.

Ejemplo 31: (S)-1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona

Paso 1: (S)-1-(3,4-Diclorofenil)-4-hidroximetill-4-fenilimidazolidin-2,5-diona

Se disuelven 217 mg de (S)-2-hidroximetil-2-fenilglicina (preparada según A. Olma, Polish J. Chem., 70, (1996), 1442-1447) en 5 mL de hidróxido de sodio acuoso 0.5 N. Se agregan lentamente en el transcurso de 10 min 300 mg de isocianato de 3,4-diclorofenilo disueltos en 5 mL de dioxano y después la mezcla se agita durante 1 h, el pH es de alrededor de 7 a 7.5. Se agregan 3 mL de hidróxido de sodio acuoso 0.5 N para hacer el pH alcalino y después 300 mg de isocianato de 3,4-diclorofenilo disueltos en 5 mL de dioxano se vuelven a agregar lentamente. La mezcla se agita durante otra hora más a temperatura ambiente y después se agrega ácido clorhídrico 12 N hasta pH ácido y la mezcla se calienta durante 1 h a temperatura de reflujo. Se elimina al dioxano por evaporación al vacío y la fase acuosa se extrae con acetato de etilo. Los extractos se lavan con solución saturada de cloruro de sodio, se secan en sulfato de magnesio y se evaporan hasta sequedad. El residuo se purifica en gel de sílice mientras se eluye con un gradiente de mezcla de heptano a acetato de etilo puro para proporcionar el producto esperado.

[α]D = - 13.3° (c = 1.02 %, MeOH).

Paso 2: (S)-1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona

Se disuelven 150 mg de (S)-1-(3,4-diclorofenil)-4-hidroximetil-4-fenilimidazolidin-2,5-diona en 5 mL de dimetilformamida, después se agregan 165 mg de carbonato de potasio seguidos de 137 µL de dimetilsulfato. La mezcla se agita toda la noche a temperatura ambiente y después se toma en una mezcla de agua y acetato de etilo. La fase acuosa se extrae con acetato de etilo. Los extractos se lavan con solución saturada de cloruro de sodio, se secan en sulfato de magnesio y se evaporan hasta sequedad. El residuo se purifica en gel de sílice mientras se eluye con un gradiente de mezcla de heptano a acetato de etilo puro para proporcionar el producto esperado.

δ 1H RMN (CDCl3): 3.04 (s, 3H); 4.11 y 4.65 (2d, 2H); 7.37 (m, 3H); 7.51 (m, 4H); 7.66 (d, 1H).

LCMS: (Rt = 3.16 min): 364/366+ (MH+); 333/335- (M- CH2OH)-.

[α]D = - 38.5° (c = 0.925 %, EtOH).

Tabla 1: Compuestos representativos de la invención ID Estructura Nombre PM calc.

1 4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin- 389.3 1-il]-2-trifluorometilbenzonitrilo 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4- 2 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Isómero 417.4 A 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4- 3 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo Isómero 417.4 B ID Estructura Nombre PM calc.

4 4-[2,5-Dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin- 403.4 1-il]-2-trifluorometilbenzonitrilo Isómero A 4-[2,5-Dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin- 1-il]-2-trifluorometilbenzonitrilo Isómero B 403.4 6 4-[2,5-Dioxo-4-(4-fluorofenil)-4-(hidroximetil)-3- 407.3 metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo ID Estructura Nombre PM calc.

7 4-[4-(4-Clorofenil)-2,5-dioxo-4-hidroximetil-3- 423.8 metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo 8 4-[2,5-Dioxo-4-(4-fluorofenil)-4-hidroximetil-3-(2- 431.3 propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo 4-[4-(3-Clorofenil)-2,5-dioxo-4-hidroximetil-3- 9 metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo 423.8 ID Estructura Nombre PM calc.

(S)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4- 389.3 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 11 (R)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4- 389.3 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 4-[2,5-Dioxo-3-etil-4-(hidroximetil)-4-fenilimidazolidin-1- 12 403.4 il]-2-trifluorometilbenzonitrilo ID Estructura Nombre PM calc.

13 4-[4-(4-Cianofenil)-2,5-dioxo-4-hidroximetil-3- 414.3 metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 4-[4-(3-Cianofenil)-2,5-dioxo-4-hidroximetil-3- 14 metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 414.3 1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4- 16 365.2 fenilimidazolidin-2,5-diona ID Estructura Nombre PM calc.

17 4-[2,5-Dioxo-4-(hidroximetil)-3-(1-metiletil)-4- 417.4 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 4-[3-Cianometil-2,5-dioxo-4-(hidroximetil)-4- 18 fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo 414.3 4-[2,5-Dioxo-4-(hidroximetil)-4-fenil-3-(1- 19 propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo 413.4 ID Estructura Nombre PM calc.

4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2- 375.3 trifluorometilbenzonitrilo 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-(3- 21 metilfenil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo 403.4 22 4-[4-(2-Clorofenil)-2,5-dioxo-4-hidroximetil-3- 423.8 metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo ID Estructura Nombre PM calc.

23 Sulfato ácido de [1-(4-ciano-3-trifluorometilfenil)-2,5- 469.06 dioxo-3-metil-4-fenilimidazolidin-4-il]metilo Fosfato diácido de [1-(4-ciano-3-trifluorometilfenil)-2,5- 24 dioxo-3-metil-4-fenilimidazolidin-4-il]metilo 469.31 Cloruro de (2S)-1-[1-(4-ciano-3-trifluorometilfenil)-2,5- dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1- 488.47 oxobutan-2-aminio ID Estructura Nombre PM calc.

26 Ácido 4-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3- 489.41 metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico 27 Fosfato diácido de (S)-(1-(4-ciano-3-(trifluorometil)fenil)- 469.31 3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metilo Ácido (S)-4-((1-(4-ciano-3-(trifluorometil)fenil)-3-metil- 28 2,5-dioxo-4-fenilimidazolidin-4-il)metoxi)-4- 489.41 oxobutanoico ID Estructura Nombre PM calc.

Cloruro de (S)-((S)-1-(4-ciano-3-(trifluorometil)fenil)-3- 29 metil-2,5-dioxo-4-fenilimidazolidin-4-il)metil-3- 488.47 metilbutanoato-2-amonio 4-[2,5-Dioxo-4-hidroximetil-3-metil-4-fenilimidazolidin-1- il]-2-metoxibenzonitrilo 351.37 (S)-1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4- 31 fenilimidazolidin-2,5-diona 365.22 Ejemplos biológicos La eficacia de los compuestos de la invención descritos en este documento puede ser demostrada in vitro en pruebas de transactivación después de la expresión simultánea y estable del receptor de andrógenos humano (hAR) y un gen reportero colocado bajo el control transcripcional de los elementos de respuesta (ARE) del receptor de andrógenos (AR) en células huésped. Esta prueba constituye un método de identificación de agonistas puros o parciales que imitan los efectos de las hormonas naturales, como DHT (dihidrotestosterona) en el caso presente o, por otra parte, antagonistas que los inhiben.

Para esta prueba de transactivación, se introducen juntos plásmidos que codifican un gen reportero y el receptor de andrógenos humano (hAR) mediante transfección en la línea celular HeLa. El plásmido del reportero contiene ADNc de luciferasa bajo el control de los elementos de respuesta contenidos en las secuencias promotoras del gen probasina (3xpbAREminicoll-luciferasa/pGL3-puro). La expresión del gen reportero constituye una indicación de la actividad transcripcional del hAR. También codifica una proteína que permite que las células que lo expresan resistan un tratamiento con puromicina. El plásmido que codifica el hAR contiene el ADNc del hAR bajo el control del promotor del citomegalovirus (CMV). También codifica una proteína que permite que las células que lo expresan resistan un tratamiento con neomicina. El tratamiento de las células con cantidades crecientes de compuestos potencialmente agonistas aumentará la expresión del gen reportero. Para detectar antagonistas, por otra parte, se prueban dosis crecientes de los compuestos de prueba en presencia de concentraciones crecientes de DHT. La expresión del gen reportero, que es constante para cada dosis de DHT, disminuye cuando la concentración de los compuestos de prueba aumenta.

1 - Prueba de eficacia funcional 1.1 Construcción de plásmidos 1.1 a):- Construcción del plásmido de resistencia a la puromicina 3xpbAREminicoll-luciferasa/pGL3 El primer paso implica introducir, en el vector básico pGL3 (Promega), el promotor mínimo del gen de la colagenasa en dirección 5' del gen que codifica la luciferasa. Se sintetizan dos oligonucleótidos (coll-sense y coll-rev). Éstos permiten la introducción de los sitios de escisión de las enzimas de restricción SacI (subrayado simple en las secuencias siguientes) y BglII (subrayado doble en las secuencias siguientes) en los extremos 5' y 3' respectivamente de la secuencia entre las posiciones -42 y +46 (en negrita en la secuencia siguiente) de la secuencia promotora descrita [P Angel et al. 1987 Mol. Cell. Biol. 7:2256-2266]. Luego de la hibridación y la clonación entre los sitios SacI (posición 8) y BglII- (posición 37) del plásmido "pGL3 básico", se obtiene el plásmido "minicoll-luciferasa/pGL3". La secuencia de los oligonucleótidos "coll-sense" y "coll-rev" es la siguiente:  coll-sense (SEC. ID Nº: 1):  coll-rev (SEC. ID Nº: 2): El segundo paso implica multimerizar 3 veces el elemento de respuesta del receptor de andrógenos contenido en el promotor probasin (pbARE) (en negrita en las secuencias siguientes) (F. Claessens et al 1996 J. Biol. Chem. 271:19013-19016) e introducirlo entre los sitios KpnI y Ec1136II del plásmido "minicoll-luciferasa/pGL3". Se sintetizan dos oligonucleótidos (coll-sense y coll-rev). Estos permiten la introducción de los sitios de escisión de las enzimas de restricción KpnI (subrayado simple en las secuencias siguientes) y un extremo romo (subrayado doble en las secuencias siguientes) en los extremos 5' y 3', respectivamente. Luego de la hibridación, se obtiene un fragmento de ADN que se puede clonar entre los sitios KpnI (posición 1) y Ecl136II (posición 8) del plásmido "minicoll-luciferasa/pGL3", generando de ese modo el plásmido "3xpbAREminicoll-luciferasa/pGL3". Las secuencias de oligonucleótidos "coll-sense" y "3xpbARE-rev" son las siguientes:  3xpbARE-sense (SEC. ID Nº: 3):  3xpbARE-rev (SEC. ID Nº: 4): El tercer paso implica introducir el gen de resistencia a la puromicina en el plásmido "3xpbAREminicoll- luciferasa/pGL3". El conjunto [promotor - gen de resistencia a la puromicina - de la secuencia de poliadenilación de SV40] (fragmento 1-1396, genoteca U07648) se subclona usando amplificación por PCR, partiendo del plásmido "pPUR" (Clontech), y usando dos oligonucleótidos (pPUR-sense y pPUR-rev) permitiendo la introducción del sitio de escisión BamHI. El fragmento de 1550 pares de bases obtenido después de la PCR (30 ciclos, 30 segundos a 94 °C, segundos a 55 °C, 1.5 minutos a 72 °C) es digerido por BamHI después clonado en el sitio único BamHI del plásmido 3xpbAREminicoll-luciferasa/pGL3 produciendo de esta manera el plásmido de resistencia a la puromicina 3xpbAREminicoll-luciferasa/pGL3. Las secuencias de nucleótidos "coll-sense" y "coll-rev" son las siguientes:  pPUR-sense (SEC. ID Nº: 5): 5' TAAGGATCCGCTGTGGAATGTGTGTCAGTT 3'  pPUR-rev (SEC. ID Nº: 6): 3' GACGGATCCAGACATGATAAGATACATTGA 5' 1.1 b- Construcción del plásmido "pcDNA3-hAR" La secuencia que codifica el ADNc de hAR se clona entre los sitios EcoRI y XbaI del vector pcDNA3.1(+) (Invitrogen) partiendo del vector psg5-hAR (provisto por el Profesor P. Chambon, IGBMC, Illkirch, Francia). Este plásmido contiene la secuencia descrita por Tilley WD et al. [Tilley WD et al. 1989 Proc Natl Acad Sci USA 86:327-31; genoteca J04150].

1.2 Establecimiento de la línea celular estable HALP Para esta prueba, se obtienen células HeLa de la American Type Culture Collection (Rockville, MD) y se cultivan en medio DMEM que contiene 4.5 g/L de glucosa, complementado con Glutamax y con aminoácidos no esenciales y con 10% de suero fetal de ternero (SVF; Dominique Dutscher).

El día antes de la transfección, se siembran un millón de células en medio DMEM sin rojo fenol, complementado con Glutamax y con SVF desesteroidado (5%) en placas de Petri. Las células se transfectan con 4 µg de los plásmidos de resistencia a la puromicina pcDNA3-hAR y 3xpbAREminicoll-luciferasa/pGL3 usando el reactivo "Lipofectamine plus" (Invitrogen), según las recomendaciones del proveedor. El día posterior a la transfección, las células se siembran a diferentes densidades celulares (10 000 a 100 000 células por placa de Petri). Dos días después de la transfección, se seleccionan las células transfectadas en medio DMEM sin rojo fenol, complementado con Glutamax y SVF desesteroidado (5%) que contiene 400 µg/mL de G418 (Invitrogen) y 150 ng/mL de puromicina (Sigma). El medio de cultivo se renueva semanalmente hasta que aparecen los clones resistentes. Los clones resistentes se extraen y amplifican antes de ser ensayados con respecto a su respuesta funcional.

La prueba de respuesta funcional se lleva a cabo de la manera siguiente: Se siembran las células (80 000 células por pocillo, 48 pocillos por placa) 24 horas antes de la fase de estimulación en medio DMEM que contiene 4.5 g/L de glucosa, complementado con Glutamax y aminoácidos no esenciales, y con SVF desesteroidado (5%). El día de la estimulación, el medio sembrado es reemplazado por medio DMEM sin rojo fenol, complementado con Glutamax y con SVF desesteroidado (5%) que contiene un intervalo de concentraciones de DHT (1 pM a 1 µM). Las células se colocan en contacto con los compuestos durante 18 horas a 37 °C. Después se retira el medio, se miden las células lisadas y la actividad de luciferasa usando el reactivo "Sistema de ensayo de luciferasa" (Promega) de conformidad con las instrucciones del fabricante. La luminiscencia producida se detecta en un contador tipo TopCount (Perkin- Elmer). El clon (HALP2) retenido para la prueba de detección mostró una curva de respuesta transcripcional semejante a la obtenida después de la transfección transitoria de los mismos vectores en células HeLa.

1.3 Prueba de respuesta funcional La prueba de respuesta funcional se lleva a cabo en placas de 96 pocillos. Se siembran las células HALP2 (20 000 células por pocillo) en medio de cultivo (DMEM con rojo fenol, 1% de Pen-Strep, 1% de aminoácidos no esenciales, 10% de suero fetal bovino, 400 µg/mL de Geneticin y 0.150 µg/mL de puromicina) el día 1. Después de 24 horas de incubación a 37 °C, 5% de CO2, alta humedad (día 2) se retira el medio y se pone medio de prueba fresco (DMEM sin complemento de rojo fenol, 1% de Pen-Strep, 1% de aminoácidos no esenciales y 5% de suero fetal bovino desesteroidado). Después de otras 24 horas de incubación a 37 °C, 5% de CO2, alta humedad (día 3), el medio se renueva una vez más antes de la fase de estimulación.

La estimulación implica cruzar un intervalo de concentraciones de DHT (0.329 pM a 640 nM) con un intervalo de concentraciones del compuesto de prueba (6.4 nM a 4 µM). Las células se colocan en contacto con los compuestos durante 24 horas a 37 °C, 5% de CO2, alta humedad. El día 4 el medio se retira y se coloca el reactivo de lectura de la actividad de luciferasa en contacto con las células de conformidad con las instrucciones del fabricante (SteadyLite, Perkin-Elmer). La luminiscencia producida se detecta en un lector Envision (Perkin-Elmer).

El agonismo se caracteriza por el valor de EC50, en otras palabras, la concentración del compuesto de prueba que induce 50% del efecto agonista máximo observado con el compuesto de prueba. El antagonismo se caracteriza por el valor de KSchild, en otras palabras, la concentración del compuesto probado que aumenta la EC50 del DHT (dihidrotestosterona) en un factor de 2. Esta concentración se determina por una regresión convencional de Schild.

La determinación del agonismo/antagonismo relativo de un compuesto se obtiene comparando la activación máxima obtenida con dicho compuesto y la activación obtenida con DHT sola (100%).

Tabla 2: Medición del agonismo y el antagonismo del compuesto de la invención: Puntuación semicuantitativa: 2- Caracterización en modelos animales 2.1 Modelo adaptado de la prueba de Hershberger La actividad in vivo de los compuestos de la invención se puede demostrar en un modelo adaptado de la prueba de Hershberger de la manera siguiente: La actividad de modulación selectiva del receptor de andrógenos se prueba en un modelo de ratas jóvenes inmaduras castradas. Este modelo, que es ampliamente reconocido para evaluar los efectos anabólicos de los compuestos androgénicos sobre los músculos y la próstata, fue descrito por Hershberger et al. 1953 Proc. Soc. Expt. Biol. Med. 83:175.

El método se basa en la medición de los efectos bien conocidos de los andrógenos sobre el crecimiento de los músculos y los órganos sexuales masculinos secundarios en los animales, y también en los hombres. Las consecuencias de la castración aparecen en forma de una rápida involución y atrofia de la próstata y las vesículas seminales y del músculo elevador del ano (levator ani). Este efecto puede ser compensado completamente por la administración exógena de andrógeno, en particular de testosterona. El modelo se usa por lo tanto para determinar la capacidad de las moléculas probadas para mantener el peso de los órganos sexuales secundarios y musculares en ratas inmaduras castradas, y por consiguiente su eficacia androgénica.

Se distribuyen al azar ratas Sprague Dawley jóvenes inmaduras (de 4 a 5 semanas de vida) que pesan aproximadamente 140-160 g (Charles River, Les Oncins, FRANCIA) en varios grupos y se mantienen en un ambiente a 22 ± 2 °C con un ciclo alternante día/noche de 12 horas y acceso a voluntad a alimentos y bebida.

El día 0 (siete días antes de comenzar el primer tratamiento) las ratas se pesan individualmente y después se las anestesia con una dosis intraperitoneal de ketamina/xilazina (85/15 mg/kg, aproximadamente 2 ml/kg). Después cada animal se coloca sobre un campo estéril y se le desinfectan el abdomen y el escroto con betadina y alcohol al 70 %. En el caso de los animales de control orquidectomizados (ORX), los testículos se extraen a través de una incisión en el medio del escroto. Se realiza una sutura estéril para ligar la porción supratesticular del tejido antes del corte quirúrgico de cada testículo. Los grupos de animales a ser tratados con los compuestos de prueba se operan de manera idéntica. En el caso de los animales de control intactos (intervención simulada), los testículos se extraen de manera similar y se reintroducen delicadamente en su ubicación original. El sitio de la intervención quirúrgica se sutura después usando hilo de sutura estéril, y el sitio se vuelve a desinfectar mediante aplicación de betadina. Cada animal se mantiene bajo una almohadilla estéril hasta que se despierta, antes de retornarlo a su jaula. Los animales se mantienen en un ambiente a 22 ± 2 °C con un ciclo alternante día/noche de 12 horas y acceso a voluntad a alimentos y bebida. Los animales se tratan con las moléculas que se van a probar desde el día 7 posterior a la cirugía hasta el día 10 que precede al sacrificio (día 11).

Las ratas se dividen en grupos y se tratan diariamente desde el día 7 hasta el día 10 en las condiciones definidas a continuación: 1. Grupo de intervención simulada de control: Vehículo (PEG400/DMSO/agua; 79/1/20) administrado por vía oral.

2. Grupo ORX de control: Vehículo (PEG400/DMSO/agua; 79/1/20) administrado por vía oral.

3. Grupo ORX tratado: Los compuestos de prueba se administran individualmente por vía oral en el vehículo descrito antes, en una dosis de 10 mg/kg.

Después del tratamiento durante 4 días sucesivos, los animales se decapitan usando una guillotina. Se extirpan el levator ani y la próstata ventral y se pesan individualmente. Para comparar datos entre experimentos, el peso de cada órgano se estandariza y se expresa en miligramos por 100 g de peso del animal (W). Para cada órgano, el promedio de los pesos estandarizados del grupo ORX de control se fija por definición en 0 % y el promedio de los pesos estandarizados del grupo intervención simulada de control se fija por definición en 100 %. La eficacia de cada producto se expresa como un porcentaje y se calcula usando la fórmula siguiente: (W tratado – W ORX) / (W SIMUL – W ORX) x 100 A continuación se usa una prueba ANOVA para el análisis estadístico a fin de identificar las diferencias entre grupos.

Tabla 3: Datos de la prueba de Herschberger para compuestos escogidos de la invención Puntuación semicuantitativa 0.5-25 % * 25-50 % ** 50-75% *** 75-100% **** Ejemplo Dosis probada (mg/kg) Actividad anabólica % Actividad androgénica % (Próstata) 6 ** * 7 ** 9 *** * **** * 11 *** * 12 **** *** 13 * * 14 **** ** ** 16 **** * 17 **** *** 18 **** * 19 **** ** 21 * 3. Determinación de la biodisponibilidad absoluta Para hacer rápidamente una detección sistemática de los derivados de imidazolinas basándose en su biodisponibilidad absoluta, se investiga un perfil farmacocinético restringido con sólo cuatro tiempos de muestreo después de la ruta oral e intravenosa en ratas Sprague Dawley de la manera siguiente: cada compuesto de prueba se administra por vía oral (10 mg/kg) e intravenosa (3 mg/kg) a grupos de 3 ratas machos Sprague Dawley. Las dosis orales se administran como solución en EtOH/PEG400/H2O (1/79/20; v/v) mediante sonda esofágica (2 mg/mL; 5 mL/kg) y la dosis intravenosa como una solución en DMSO/PEG400/H2O (1/65/34;v/v) como un bolo en la vena de la cola (3 mg/mL; 1 mL/kg). Antes de la administración oral, a los animales se los priva de alimentos (agua a voluntad) durante 16 horas antes del inicio del estudio y 6 horas después de la administración.

Se extrae sangre del seno retro-orbital en tubos de polipropileno (heparinato de Li) a +4 °C a los tiempos de muestreo siguientes: 0.083, 0.25, 1 y 3 h después de la inyección intravenosa y 0.25, 1, 3 y 6 horas después de la dosificación oral. Se toman muestras de tres (3) animales por cada tiempo de muestreo; y se toman muestras cuatro veces de cada animal. Después de la centrifugación a 5000 rpm durante 10 min a +4 °C, se recoge el plasma en tubos de polipropileno y se mantiene congelado a -20 °C esperando los ensayos. Se analizan las muestras de plasma por un método de LC-MS/MS con un límite inferior de cuantificación de 1 a 10 ng/mL dependiendo del compuesto (volumen de plasma: 100 µL).

Se lleva a cabo un método de LC-MS/MS para la cuantificación en plasma heparinizado para cada compuesto de prueba. La preparación de la muestra consiste en la precipitación de las proteínas plasmáticas con metanol y la filtración por centrifugación del sobrenadante en placas de filtro de 0.2 µm de 96 pocillos Captiva. Se agrega agua a la fase sobrenadante de metanol antes del análisis por cromatografía líquida (Pursuit 5 C18 20 x 2.0 mm VARIAN, 2 µL asa, gradiente agua/metanol (90/10 a 0/100) en 1.7 min) con espectrometría de masas en tándem con nebulización iónica con turbo (API4000) en modo negativo usando monitoreo de reacción múltiple. El método incluye 8 niveles estándar y 3 niveles de control de calidad con el límite inferior de cuantificación correspondiente al primer nivel estándar.

Las exposiciones se determinan usando un modelo no compartimental (WinNonLin 2.1) y la biodisponibilidad absoluta (F) se calcula como sigue: [AUC(0-6 h) oral * 3 mg/kg] / AUC(0-3 h) IV 10 mg/kg] y se expresa en porcentaje.

Tabla 4: Medición de la biodisponibilidad de compuestos representativos de la invención: Puntuación semicuantitativa: >90% ### 50-90%: ## 0-49% # ID Biodisponibilidad 1 ## 3 ## 4 # ### 6 ## 7 ### 8 ### ### 12 ## 4. Determinación de la biodisponibilidad absoluta de compuestos escogidos de la invención en ratas y perros Se investiga la biodisponibilidad absoluta de un fármaco después de la administración oral con los correspondientes profármacos éster en ratas Sprague Dawley de la manera siguiente: cada profármaco se administra por vía oral (10 mg/kg es decir 8 mg/kg de dosis equivalente del fármaco) y el fármaco se administra por vía intravenosa (3 mg/kg) a grupos de 3 ratas machos Sprague Dawley. Las dosis orales se administran como solución en EtOH/PEG400/H2O (1/79/20; v/v) mediante sonda esofágica (2 mg/mL; 5 mL/kg) y la dosis intravenosa como una solución en DMSO/PEG400/H2O (1/65/34;v/v) como un bolo en la vena de la cola (0.6 mg/mL; 5 mL/kg). Antes de la administración oral, a los animales se los priva de alimentos (agua a voluntad) durante 16 horas antes del inicio del estudio y 6 horas después de la administración.

La sangre se extrae a través de un catéter introducido la vena yugular y se recoge en tubos de polipropileno (heparinato de Li) a +4 °C a los tiempos de muestreo siguientes: 0.05, 0.25, 0.5, 1, 3, 5 y 8 h después de la inyección intravenosa y 0.25, 0.5, 1, 3, 5, 8 y 24 horas después de la dosificación oral. Para evitar cualquier escisión ex-vivo del profármaco en fármaco, se agrega a los tubos de recolección un volumen de PMSF (5 mg/mL de fluoruro de fenilmetilsulfonilo en solución etanólica) correspondiente a 10% del volumen de sangre extraído. Se toman muestras de tres (3) animales por cada tiempo. Después de la centrifugación a 5000 rpm durante 3 min a +4 °C, se recoge el plasma en tubos de polipropileno y se mantiene congelado a -20 °C esperando los ensayos.

En los perros, se investiga la biodisponibilidad absoluta de un fármaco después de la administración oral con los correspondientes profármacos éster de la manera siguiente: cada profármaco se administra por vía oral (10 mg/kg de dosis equivalente del fármaco) y el fármaco se administra por vía intravenosa (3 mg/kg) a 3 perros machos Beagle. Las dosis orales se administran como un polvo dentro de cápsulas de gelatina y la dosis intravenosa se administra como una solución en DMSO/PEG400/H2O (1/65/34;v/v) como un bolo en la vena cefálica (3 mg/mL; 1 mL/kg). Antes de la administración oral, a los animales se los priva de alimentos (agua a voluntad) durante 12 horas antes del inicio del estudio y 4 horas después de la administración.

La sangre se extrae por venopunción directa en la vena yugular de cada uno de los tres perros y se recoge en tubos de polipropileno (heparinato de Li) a +4 °C a los tiempos de muestreo siguientes: 0.083, 0.167, 0.25, 0.5, 1, 2, 4, 8, 10 y 24 h después de la inyección intravenosa y 0.25, 0.5, 1, 2, 4, 6, 8, 10 y 24 horas después de la dosificación oral. Como no se produce escisión del profármaco en fármaco ex-vivo en el plasma de los perros, no se agrega inhibidor de la esterasa a los tubos de recolección. Después de la centrifugación a 5000 rpm durante 3 min a +4 °C, se recoge el plasma en tubos de polipropileno y se mantiene congelado a -20 °C esperando los ensayos.

El nivel de fármaco se determina en las muestras de ratas y perros mediante un método de LC-MS/MS con un límite inferior de cuantificación de 1 ng/mL (volumen de plasma: 25 µL). La preparación de la muestra consiste en la precipitación de las proteínas plasmáticas con metanol y la filtración por centrifugación del sobrenadante en placas de filtro de 0.2 µm de 96 pocillos Captiva. Se agrega agua a la fase sobrenadante de metanol antes del análisis por cromatografía líquida (Pursuit 5 C18 20 x 2.0 mm VARIAN, 2 µL asa, gradiente agua/metanol (90/10 a 0/100) en 1.7 min) con espectrometría de masas en tándem con nebulización iónica con turbo (API4000) en modo negativo usando monitoreo de reacción múltiple. El método incluye 8 niveles estándar y 3 niveles de control de calidad con el límite inferior de cuantificación correspondiente al primer nivel estándar.

Las exposiciones se determinan usando un modelo no compartimental (WinNonLin 5.2) y la biodisponibilidad absoluta (F) se calcula como sigue: [AUC(0-z) oral * 3 mg/kg] / AUC(0-z) IV 8 o 10 mg/kg] y se expresa en porcentaje.

Tabla 5: Medición de la biodisponibilidad absoluta de compuestos escogidos de la invención: >90% #### 50-90%: ### 20-49% ## <20% # ID Biodisponibilidad en la rata Biodisponibilidad en el perro 27 ## ## 28 ### ###

ES 2 552 684 T3   5. Experimentos in-vivo.

5.1 Pérdida muscular inducida por glucocorticoides (ratas).

En este modelo se investiga el impacto del compuesto de la invención sobre la pérdida muscular inducida por dexametasona (Kun Ma et al, 2003). Se tratan ratas machos Sprague Dawley de 8 semanas de vida diariamente con 0.3 mg/kg de dexametasona mediante administración subcutánea durante 15 días. La ratas se dividen en varios grupos: intervención simulada (sin tratamiento, n = 8), control (vehículo solo, n = 8), decanoato de nandrolona (3 mg/kg/día, s.c., n = 8) y el compuesto de prueba (intervalo de dosis oral elegido, n = 8). Después de 15 días de tratamiento se extrae el gastrocnemio se pesa y se determina la función muscular en el tibial anterior (Hourdé et al, 2009).

5.2 Caquexia inducida por TNF (ratones) En este modelo (Dario Coletti et al, 2005), la producción del factor de necrosis tumoral-α (TNF) es inducida por electroporación de ADN con expresión génica de TNF en el tibial de ratones. La exposición crónica a TNF desencadena una atrofia muscular progresiva reminiscente de la caquexia. Los ratones machos se dividen en varios grupos: intervención simulada, control, decanoato de nandrolona y G100192. Al final del tratamiento se extraen el gastrocnemio y el sóleo, se pesan y se determina la función muscular progresiva en el sóleo (Hourdé et al, 2009).

5.3 Modelo de inmovilización (ratones) La suspensión trasera causa perdida ósea y muscular. Los efectos del compuesto de la invención sobre la suspensión trasera se investigan usando suspensión por la cola durante 14 días (Roland et al, 2005). Los ratones machos se dividen en varios grupos: sin suspender, suspendidos por la cola, suspendidos por la cola tratados con el compuesto de prueba y suspendidos por la cola tratados con decanoato de nandrolona. Al final del tratamiento se extraen el sóleo y el gastrocnemio, se pesan y se determina la función muscular en el sóleo (Hourdé et al, 2009).

5.4 Modelo orquidectomizado (ratas) La orquidectomía aumenta el recambio óseo y la masa grasa muscular. En este modelo se investiga al efecto del compuesto de la invención, tanto sobre la composición del músculo (relación entre masa magra y masa grasa) como sobre el recambio óseo (Hourdé et al, 2009). Se dividen ratas machos Sprague Dawley de 8 semanas de vida en varios grupos: ratas intactas (intervención simulada) y ratas orquidectomizadas tratadas durante 2 meses con vehículo, decanoato de nandrolona o compuesto de prueba. Al final del experimento se estudia la relación entre masa magra y masa grasa, y el recambio óseo, se extrae el gastrocnemio y se pesa y se determina la función muscular en el sóleo (Hourdé et al, 2009).

A partir de la descripción precedente varias modificaciones y cambios en las composiciones y los métodos de esta invención podrán ocurrírseles a los expertos en el área. Todas estas modificaciones comprendidas por el alcance de las reivindicaciones adjuntas pretenden estar incluidas en ellas.

Se debe entender que factores como la capacidad diferencial de penetración celular de los diversos compuestos puede contribuir a discrepancias entre la actividad de los compuestos en los ensayos bioquímicos y celulares in

vitro.

Al menos algunos de los nombres químicos de los compuestos de la invención según se dan y se indican en esta aplicación, pueden haber sido generados en una base automática mediante un programa informático de denominación química comercial y no han sido verificados independientemente. Los programas representativos que realizan esta función incluyen la herramienta de denominación Lexichem comercializada por Open Eye Software, Inc. y la herramienta Autonom Software comercializada por MDL, Inc. En caso de que el nombre químico indicado y la estructura representada difieran, prevalecerá la estructura representada.

Las estructuras químicas que se muestran en este documento fueron preparadas utilizando ChemDraw® o ISIS® /DRAW. Cualquier valencia abierta que aparezca en un átomo de carbono, oxígeno o nitrógeno en las estructuras de este documento indica la presencia de un átomo de hidrógeno. Cuando exista un centro quiral en una estructura pero no se muestre una estereoquímica específica para el centro quiral, ambos enantiómeros asociados con la estructura quiral están comprendidos por la estructura.

ES 2 552 684 T3  

REIVINDICACIONES

1. Un compuesto de acuerdo con la fórmula Ib: en la que X es O o S; R1 es H; o R1 se elige entre C1-C6 alquilo, C3-C7 cicloalquilo, C3-C6 alquenilo, C3-C6 alquinilo y C1-C6 acilo; cada uno de los cuales puede estar opcionalmente sustituido con ciano, uno o más halo, hidroxilo, o C1-C6 alcoxi; R2a se elige entre H, P(O)(OH)2 y C(O)(CH2)n1C(O)OH; o R2a se elige entre C1-C6 acilo y C3-C6 alquenilo; cada uno de los cuales puede estar opcionalmente sustituido con amino o carboxi; n1 es 0, 1, 2, 3 o 4; cada R2b y R2c se elige independientemente entre H y C1-C6 alquilo; oR2b y R2c se pueden unir para formar un C3-C7 cicloalquilo; R3a es H, halo, ciano o nitro; cada R3b es independientemente halo, ciano o nitro; cada R4a y R4b es independientemente H, halo, ciano, carboxi o nitro; o cada R4a y R4b se elige entre C1-C6 alquilo y C1-C6 alcoxi; cada uno de los cuales puede estar opcionalmente sustituido con uno o más halo, o C1-C6 alcoxi; o R4a y R4b se unen para formar un cicloalquilo de 5 o 6 miembros, heterocicloalquilo de 5 o 6 miembros, arilo de 5 o 6 miembros o heteroarilo de 5 o 6 miembros; R4c es halo, ciano o nitro; y m1 es 0, 1 o 2; o las sales farmacéuticamente aceptables, y los solvatos de los compuestos o los solvatos de sus sales farmacéuticamente aceptables.

2. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 1, en el que X es O.

3. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 1 o 2, en el que R2b es H.

4. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con cualquiera de las reivindicaciones 1 a 3, en el que R2c es H o C1-C6 alquilo.

5. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con cualquiera de las reivindicaciones 1 a 4, en el que R1 es Me, Et, i-Pr o n-Pr.

6. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 1, donde el compuesto está de acuerdo con la fórmula II

ES 2 552 684 T3   en la que R3a, R3b, R4a , R4b , R4c y m1 son los reivindicados en la reivindicación 1.

7. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con cualquiera de las reivindicaciones 1 a 6, en el que R4c es ciano, halo o nitro.

8. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con cualquiera de las reivindicaciones 1 a 7, en el que R4b es Cl, F, CN o CF3.

9. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 1, donde el compuesto está de acuerdo con las fórmulas Va, Vb, Vc o Vd: y en el que R3a es el de la reivindicación 1; y R3c es H, halo, ciano o nitro.

10. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 9, en el que R3a es H, CN, Cl o F y R3c es H.

11. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 9, en el que R3a es H; y R3c es CN, Cl, F, Me o CF3.

12. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 9, en el que R3a y R3e es H.

13. Un compuesto o su sal farmacéuticamente aceptable, de acuerdo con la reivindicación 1, donde el compuesto se elige entre: 4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(1-hidroxipropil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(1-hidroxietil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo;

ES 2 552 684 T3   4-[2,5-Dioxo-4-(4-fluorofenil)-4-(hidroximetil)-3-metilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(4-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(4-fluorofenil)-4-hidroximetil-3-(2-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(3-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; (S)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; (R)-4-[2,5-Dioxo-4-(hidroximetil)-3-metil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-3-etil-4-(hidroximetil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(4-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 4-[4-(3-Cianofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; 1-(3,4-Diclorofenil)-4-hidroximetil-3-metil-4-fenilimidazolidin-2,5-diona; 4-[2,5-Dioxo-4-(hidroximetil)-3-(1-metiletil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[3-Cianometil-2,5-dioxo-4-(hidroximetil)-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-(hidroximetil)-4-fenil-3-(1-propinil)imidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[2,5-Dioxo-4-hidroximetil-4-fenilimidazolidin-1-il]-2-trifluorometilbenzonitrilo; 4-[4-(2-Clorofenil)-2,5-dioxo-4-hidroximetil-3-metilimidazolidin-1-il)-2-trifluorometilbenzonitrilo; Fosfato diácido de [1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metilo; Ácido 4-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico; yCloruro de (2S)-1-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-3-metil-1- oxobutan-2-aminio.

Ácido 4-[1-(4-ciano-3-trifluorometilfenil)-2,5-dioxo-3-metil-4-fenilimidazolidin-4-il]metoxi-4-oxobutanoico; Fosfato diácido de (S)-(1-(4-ciano-3-(trifluorometil)fenil)-3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metilo; Ácido (S)-4-((1-(4-ciano-3-(trifluorometil)fenil)-3-metil-2,5-dioxo-4-fenilimidazolidin-4-il)metoxi)-4- oxobutanoico.

14. Una composición farmacéutica que contiene un portador farmacéuticamente aceptable y una cantidad terapéuticamente eficaz de un compuesto de acuerdo con cualquiera de las reivindicaciones 1 a 13.

15. Un compuesto o una de sus sales farmacéuticamente aceptables de acuerdo con cualquiera de las reivindicaciones 1 a 13 para usar en medicina.

16. Un compuesto agonista o agonista/antagonista mixto o una de sus sales farmacéuticamente aceptables, de acuerdo con cualquiera de las reivindicaciones 1 a 13, para usar en el tratamiento o la profilaxis de caquexia, osteoporosis, sarcopenia, disminución de la libido y/o disfunción sexual.

17. Un compuesto antagonista o agonista/antagonista mixto o una de sus sales farmacéuticamente aceptables, de acuerdo con cualquiera de las reivindicaciones 1 a 13, para usar en el tratamiento o la profilaxis de tumores dependientes de andrógenos como cáncer o hiperplasia de próstata.