Nuevos genes marcadores seleccionables.

Una célula vegetal transgénica que comprende un polinucleótido que codifica una proteína que tiene actividad fosfinotricina acetiltransferasa

, en la que dicha proteína tiene al menos 90% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:2.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2007/086813.

Solicitante: DOW AGROSCIENCES LLC.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 9330 ZIONSVILLE ROAD INDIANAPOLIS, IN 46268-1054 ESTADOS UNIDOS DE AMERICA.

Inventor/es: WRIGHT, TERRY, R., SMITH, KELLEY, A., MERLO, DONALD J., LIRA,JUSTIN M, ARNOLD,NICOLE L, RUSSELL,SEAN M, WEBB,STEVEN ROBERT, ROBINSON,ANDREW E.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > AGRICULTURA; SILVICULTURA; CRIA; CAZA; CAPTURA; PESCA > NOVEDADES VEGETALES O PROCEDIMIENTOS PARA SU OBTENCION;... > A01H1/00 (Procedimientos de modificación de los genotipos (A01H 4/00 tiene prioridad))
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/82 (para células vegetales)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/21 (modificados por la introducción de material genético extraño)
google+ twitter facebookPin it
Nuevos genes marcadores seleccionables.

Texto extraído del PDF original:

DESCRIPCIÓN

Nuevos genes marcadores seleccionables

Antecedentes de la invención

Un marcador seleccionable es un rasgo genético o un segmento de ADN detectable que puede identificarse y rastrearse. Un gen marcador generalmente actúa como señal para otro gen, que a veces se denomina gen diana. Un gen marcador generalmente se emplea con un gen diana que se utiliza para transformar células diana. Las células diana que reciben hereditariamente el gen diana pueden identificarse seleccionando las células que también expresan el gen marcador. El gen marcador está lo suficientemente cerca del gen diana como para que los dos genes (el gen marcador y el gen diana) estén genéticamente conectados y normalmente se heredan juntos. El prototipo actual de marcador seleccionable es el gen “pat”, que codific una enzima denominada fosfinotricina acetil transferasa.

La glutamina sintetasa (“GS”) presente en muchas plantas es una enzima fundamental para el desarrollo y la vida de las células vegetales. La GS convierte el glutamato en glutamina. La GS también está implicada en la asimilación del amoniaco y en el metabolismo del nitrógeno. La GS está implicada en una vía presente en la mayoría de las plantas para la desintoxicación del amoniaco liberado por la reducción de nitratos. Por tanto, los inhibidores potentes de la GS son muy tóxicos para las células vegetales. La descomposición o la modificación del herbicida dentro de la planta podría conducir a una resistencia.

Se ha desarrollado una clase concreta de herbicidas basada en el efecto tóxico debido a la inhibición de la GS en plantas. El bialafós y la fosfinotricina son dos de estos inhibidores de la acción de la GS y poseen excelentes propiedades herbicidas. Estos dos herbicidas no son selectivos; inhiben el crecimiento de todas las diferentes especies de plantas presentes en el suelo, provocando en consecuencia su total destrucción.

El bialafós también es un herbicida de amplio espectro. El bialafós está compuesto de fosfinotricina (PPT o PTC; ácido 2-amino-4-metilfosfinobutírico), un ánalogo del ácido L-glutámico, y dos restos L-alanina. Así, la diferencia estructural entre la PPT y el bialafós reside en la ausencia de dos aminoácidos alanina en el caso de la PPT. Tras la eliminación de los restos L-alanina del bialafós por peptidasas intracelulares se libera la PPT. La PPT es un potente inhibidor de la GS. La inhibición de la GS en plantas por la PPT provoca la acumulación rápida de amoniaco y la muerte de las células vegetales.

El bialafós fue descrito en primer lugar como un compuesto con propiedades antibióticas, lo cual permite su utilización como plaguicida o fungicida. La patente de EEUU n.º 3.832.394 se refiere al cultivo de Streptomyces

hygroscopicus, y la recuperacióndel bialafós del medio de cultivo. Sin embargo, otras cepas, tales como Streptomyces viridochromogenes, también producen este compuestos. También se sabe que en la naturaleza existen otros antibióticos de tripéptidos que contienen un resto PPT, tales como la fosalacina. La PPT también se obtiene mediante síntesis química y se distribuye en el mercado.

Las cepas de Streptomyces hygroscopicus y Streptomyces viridochromogenes que producen bialafós se protegen frente a la toxicidad de la PTT por medio de una enzima con actividad fosfinotricina acetil transferasa (Plant Physiol., abril de 2001, vol. 125, pp. 1585-1590, “Expression of bar in the Plastid Genome Confers Herbicide Resistance,” Lutz et al.). Las especies de Streptomyces que producen estos antibióticos resultarían destruidas si no tuvieran un mecanismo de autodefensa contra estos antibióticos. Se ha descubierto que este mecanismo de autodefensa comprende, en varios casos, una enzima capaz de inhibir el efecto antibiótico.

La fosfinotricina acetil transferasa es codificada por los genes bar (resistencia al bialafós; Thompson et al., 1987) o pat (fosfinotricina acetil transferasa; Strauch et al., 1988), y elimina la toxicidad de la PPT mediante la acteilación del grupo amino libre de la PPT. Las enzimas codificadas por estos dos genes son funcionalmente idénticas y muestran una identidad del 85% a nivel de aminoácidos (Wohlleben et al., 1988; Wehrmann et al., 1996). Se han obtenido cultivos resistentes a la PPT mediante la expresión de genes bar o pat quiméricos en el citoplasma a partir de genes nucleares. Se han obtenido líneas resistentes a herbicidas mediante la selección directa para la resistencia a la PPT en el tabaco (Nicotiana tabacum cv Petit Havana), la potata, Brassica napus, Brassica oleracea (De Block et al., 1987; De Block et al., 1989), el maíz (Spencer et al., 1990), y el arroz (Cao et al., 1992).

Se ha identificado un gen (bar) adyacente al gen del factor sigma hrdD en Streptomyces coelicolor A3. El producto previsto de bar muestra una identididad del 32,2% y 30,4% con los de los genes pat y bar de los productores de bialafós Streptomyces viridochromogenes y Streptomyces hygroscopicus, respectivamente. El gen bar de S. coelicolor confiere resistencia al bialafós cuando se clona en S. coelicolor con un vector de alto número de copias (Bedford et al., Gene, 31 de julio de 1991, 104(1):39-45, “Characterization of a gene conferring bialaphos resistance in Streptomyces coelicolor A3(2)”). La expresión heteróloga de este gen en otros microbios, o la tranformación de este gen en plantas no se ha indicado hasta la fecha.

El uso del rasgo de resistencia a herbicidas se indica en el documento DE 3642 829 A y en la patente de EEUU n.º 5.879.903 (así como en las patentes de EEUU n.os 5.637.489; 5.276.268; 5.273.894; y US 2009/158469), en los que el gen pat se aisla a partir de Streptomyces viridochromogenes. El documento WO 87/05629 y la patente de EEUU n.º 5.648.477 (así como las patentes de EEUU n.os 5.646.024 y 5.561.236) se refieren al uso del gen bar procedente de S. hygroscopicus para proteger a las células vegetales y las plantas de los inhibidores de la glutamina sintetasa (tales como PPT) y para el desarrollo de la resistencia a herbicidas en las plantas. El gen que codifica la resistencia al herbicida BASTA (fosfinotricina de Hoechst) o Herbiace (bialafós de Meiji Seika) ha sido introducido mediante una infección por Agrobacterium en plantas de tabaco (Nicotiana tabacum cv Petit Havan SRI), patata (Solanum tuberosum cv Benolima), y tomate (Lycopersicum esculentum), y confirió resistencia a herbicidas.

Breve exposición de la invención

La presente invención se refiere a un nuevo gen denominado en la presente DSM-2. Este gen se identificó en Streptomyces coelicolor (A3). La proteína DSM-2 está lejanamente relacionada con PAT y BAR. Se describen genes optimizados en plantas que codifican proteínas DSM-2. El DSM-2 puede emplearse como rasgo transgénico para impartir tolerancia en microorganismos, células vegetales y plantas frente a las moléculas herbicidas y antibacterianas glufosinato, fosfinotricina y/o bialafós.

La transformación en Arabidopsis permite la recuperación de glufosinato a altas proporciones. Tras haber sido introducido, el gen DSM-2 tiene la capacidad de proporcionar una significativa selección y resistencia en la planta completa.

Los presentes genes tienen un elevado valor inherente simplemente como marcadores seleccionables para proyectos de biotecnología. En algunas realizaciones preferidas, los presentes genes pueden emplearse como marcadores para seleccionar células correctamente transformadas en cultivo y plantas completas en el invernadero y en el campo. Este gen y sus homólogos similares pueden emplearse en lugar de pat y/o bar.

El uso de este gen como marcador seleccionable en un sistema de transformación bacteriano puede aumentar la eficacia en todas las transformaciones de plantas. El uso de DSM-2 como único marcador de selección elimina la necesidad de emplear otro marcador de antibiótico medicinal (tal como la resistencia a ampicilina) durante la clonación.

También son posibles diversos otros usos según la presente invención. El DSM-2 puede ser útil como rasgo transgénico para impartir tolerancia en plantas a los herbicidas glufosinato y bialafós.

Este gen también puede emplearse como base para un nuevo sistema de transformación de plantas junto con una cepa de Agrobacterium modificada. Según la presente invención también pueden producirse nuevas cepas de Pseudomonas fluorescens u otras cepas microbianas, empleadas para la producción de proteínas y para la incorporación de genes marcadores de resistencia a antibióticos no medicinales. Una mejora en los procesos de clonación y transformación y en la eficacia, mediante la eliminación de la purificación de los fragmentos de los elementos de resistencia a antibióticos medicinales también puede ser un beneficio.

Además de los rasgos de cultivo tolerante a herbicidas (HTC), también se describen métodos para controlar a las plantas adventicias empleando herbicidas para los cuales los presentes genes crean una tolerancia en cultivos transgénicos. La combinación del presente rasgo HTC también resulta beneficioso cuando se combina con otros rasgos HTC (que incluyen, pero no se limitan a la tolerancia al glifosato y la tolerancia a 2,4-D), en particular para controlar especies con resistencia recién adquirida o tolerancia inherente a un herbicida (tal como el glifosato). Además, cuando se rotan cultivos tolerantes al glifosato (que cada vez están más extendidos a nivel mundial) con otros cultivos tolerantes al glifosato, el control de las plantas espontáneas resistentes al glifosato puede resultar difícil. Por tanto, el uso de estos rasgos transgénicos apilados o transformados individualmente en los cultivos puede proporcionar una herramienta para el control de otros cultivos espontáneos HTC.

Breve descripción de las figuras

La figura 1 muestra la desactivación del glufosinato mediante una N-acetilación mediada por DSM2.

Breve descripción de las secuencias

SEQ ID NO:1 es la secuencia de DSM-2 nativa.

SEQ ID NO:2 es la secuencia de la proteína nativa.

SEQ ID NO:3 es la secuencia de DSM-2 (v2) de hemicotiledóneas.

SEQ ID NO:4 es la secuencia de la proteína reconstruida.

SEQ ID NO:5 es el cebador PTU de Pat (MAS123).

SEQ ID NO:6 es el cebador PTU de Pat (Per 5-4).

SEQ ID NO:7 es el cebador de la región codificadora de Pat.

SEQ ID NO:8 es el cebador de la región codificadora de Pat.

SEQ ID NO:9 es el cebador de la región codificadora de DSM-2 (v2).

SEQ ID NO:10 es el cebador de la región codificadora de DSM-2 (v2).

Descripción detallada de la invención

La presente invención se refiere a un nuevo gen denominado en la presente DSM-2. Este gen se identificó en Streptomyces coelicolor (A3). La proteína DSM-2 está lejanamente relacionada con PAT y BAR (30% y 28% de identidad de aminoácidos, respectivamente). Se describen genes optimizados en plantas que codifican las proteínas DSM-2, con un sesgo de hemicotiledóneas, por ejemplo. El DSM-2 puede emplearse como rasgo transgénico para impartir tolerancia en plantas y células vegetales frente a los herbicidas glufosinato, fosfinotricina y/o bialafós.

Los presentes genes tienen un elevado valor inherente simplemente como marcadores seleccionables para proyectos de biotecnología. Sin embargo, también son posibles diversos otros usos según la presente invención.

El DSM-2 puede utilizarse como rasgo transgénico para impartir tolerancia a plantas frente a los herbicidas glufosinato, fosfinotricina y bialafós.

En algunas realizaciones preferidas (aparte o además de los cultivos tolerantes a herbicidas, HTC), el uso es como marcador seleccionable para seleccionar con éxito células y plantas completas transformadas en cultivo, en invernadero y en el campo. Este gen y sus homólogos similares pueden utilizarse en lugar de pat y/o bar. Un ejemplo de realización que aparece en la presente es el uso de DSM-2 como marcador seleccionable en células de tabaco NT-1. Los presentes genes también pueden emplearse como marcadores seleccionables en otros sistemas de plantas, tales como maíz y arroz.

El uso de este gen como marcador seleccionable en un sistema bacteriano puede aumentar la eficacia para todas las transformaciones de plantas. El uso de DSM-2 como único marcador de selección elimina la necesidad de emplear otro marcador de antibiótico medicinal (tal como la resistencia a ampicilina) durante la clonación.

Los experimentos han demostrado que la línea celular de Escherichia coli BL21-Star (DE3) (Invitrogen n.º de catálogo C6010-03) resultó inhibida en un medio mínimo que contenía concentraciones de 100 g/ml de glufosinato amonio (Basta). La expresión de DSM-2 en la línea celular BL21-Star complementa la resistencia en un medio mínimo que contiene 400 g/ml de glufosinato. Estos experimentos indican que la expresión de DSM-2 puede utilizarse como marcador seleccionable de antibióticos no medicinales para aplicaciones de clonación en bacterias que son inhibidas por el glufosinato.

Otros experimentos han demostrado que los promotores vegetales de poliubitiquina 10 de Arabidopsis thaliana (At Ubi10) y el promotor vírico del virus del mosaico de las venas de la mandioca (CsVMV) son funcionales en la cepta de E. coli BL21-Star (DE3). Ambos promotores expresan la proteína DSM-2 adecuada para proporcionar resistencia a un medio mínimo que contiene 200 g/ml de glufosinato. Estos promotores vegetales pueden emplearse para dirigir la expresión de DSM-2 como un marcador seleccionable de antibióticos no medicinales en E. coli. La funcionalidad de un único promotor vegetal en bacterias y plantas elimina la necesidad de diferentes marcadores seleccionables para cada especie.

Este gen también puede utilizarse como base para un nuevo sistema de transformación de plantas junto con una cepa de Agrobacterium modificada. También pueden producirse nuevas cepas de Pseudomonas fluorescens u otras cepas microbianas, para la producción de proteínas empleando los genes marcadores de resistencia a antibióticos no medicinales según la presente invención. Una mejora en los procesos de clonación y transformación y en la eficacia, mediante la eliminación de la purificación de los fragmentos de los elementos de resistencia a antibióticos medicinales también puede ser un beneficio.

Además de los rasgos HTC, también se describen métodos para controlar a las plantas adventicias empleando herbicidas para los cuales los presentes genes crean una tolerancia en cultivos transgénicos. La combinación del presente rasgo HTC también resulta beneficioso cuando se combina con otros rasgos HTC (que incluyen, pero no se limitan a la tolerancia al glifosato y la tolerancia a 2,4-D), en particular para controlar especies con resistencia recién adquirida o tolerancia inherente a un herbicida (tal como el glifosato). Además, cuando se rotan cultivos tolerantes al glifosato (que cada vez están más extendidos a nivel mundial) con otros cultivos tolerantes al glifosato, el control de las plantas espontáneas resistentes al glifosato puede resultar difícil. Por tanto, el uso de estos rasgos transgénicos apilados o transformados individualmente en los cultivos puede proporcionar una herramienta para el control de otros cultivos espontáneos HTC.

Proteínas (y aislados de origen). Se describen proteínas funcionales. La “actividad funcional” (o “activa”) significa en la presente que las proteínas/enzimas para su uso según la presente invención tienen la capacidad para degradar o disminuir la actividad de un herbicida (solas o en combinación con otras proteínas). Las plantas que producen las proteínas de la presente invención producirán preferiblemente “una cantidad eficaz” de la proteína, de modo que cuando la planta se trata con un herbicida, el nivel de expresión de proteínas es suficiente para que la planta se transforme en completa o parcialmente resistente o tolerante al herbicida (a una proporción típica, a menos que se indique lo contrario; las proporciones de aplicación típicas pueden encontrarse en el bien conocido Herbicide Handbook (Weed Science Society of America, 8ª edición, 2002), por ejemplo). El herbicida puede aplicarse a unas proporciones que normalmente matarían a la planta diana, en las proporciones y concentraciones normales de uso en el campo (debido a la presente invención, el nivel y/o la concentración puede ser opcionalmente mayor que el que se ha utilizado previamente). Preferiblemente, las células vegetales y las plantas de la presente invención pueden protegerse frente a la inhibición del crecimiento o las lesiones provocadas por un tratamiento con herbicidas. Las plantas y células vegetales transformadas de la presente invención preferiblemente se convierten en resistentes o tolerantes a un herbicida, tal como se analiza en la presente, lo cual significa que la planta y las células vegetales transformadas pueden crecer en presencia de cantidades eficaces de uno o más herbicidas, según se analiza en la presente. Las proteínas preferidas de la presente invención tienen actividad catalítica para metabolizar uno o más compuestos de ariloxialcanoato. Es difícil analizar el término “resistencia” y no emplear el verbo “tolerar” o el adjetivo “tolerante”. La industría ha dedicado innumerables horas debatiendo los cultivos tolerantes a herbicidas (HTC) frente a los cultivos resistentes a herbicidas (HRC). HTC es un término preferido en la industria. Sin embargo, la definición oficial de Weed Science Society of America de resistencia es “la capacidad heredada de una planta para sobrevivir y reproducirse después de la exposición a una dosis de herbicida que normalmente sería mortal para el tipo salvaje. En una planta, la resistencia puede aparecer de modo natural o puede ser inducida mediante técnicas tales como la ingeniería genética o la selección de los variantes producidos por cultivo de tejidos o mutagénesis”. Tal como se emplea en la presente y a menos que se indique lo contrario, la “resistencia” a herbicidas es heredable y permite que la planta crezca y se reproduzca en presencia de un tratamiento herbicídamente eficaz típico con un herbicida para una planta concreta, tal como se sugiere en la actual edición de The Herbicide Handbook, así como en la presentación de la presente descripción. Tal como reconocen los expertos en la técnica, una planta todavía puede ser considerada “resistente” incluso si resulta evidente un cierto grado de daño en la planta como consecuencia de la exposición a herbicidas. Tal como se emplea en la presente, el término “tolerancia” es más amplio que el término “resistencia”, e incluye la “resistencia” según se define en la presente, así como la mayor capacidad de una planta concreta para soportar diversos grados de daños inducidos por herbicidas que generalmente se producirían en las plantas de tipo salvaje con el mismo genotipo a la misma dosis de herbicida.

La transferencia de la actividad funcional a sistemas de plantas o bacterianos puede implicar una secuencia de ácido nucleico que codifica la secuencia de aminoácidos para una proteína de la presente invención, integrada en un vector de expresión de proteínas apropiado para el hospedante en el cual residirá el vector. Una manera de obtener una secuencia de ácido nucleico que codifica una proteína con actividad funcional es aislar el material genético nativo de la especie bacteriana que produce la proteína de interés, empleando la información deducida de la secuencia de aminoácidos de la proteína, según se describe en la presente. Las secuencias nativas pueden optimizarse para la expresión en plantas, por ejemplo, tal como se analiza con más detalle a continuación. También puede diseñarse un polinucleótido optimizado basándose en la secuencia de proteína.

Una manera de caracterizar estas clases de proteínas y los polinucleótidos que las codifican es definiendo un polinucleótido según su capacidad para hibridarse, bajo una serie de condiciones especificadas, con una secuencia de nucleótidos ejemplificada (su complemento y/o una sonda o sondas derivadas de cualquiera de las hebras) y/o según su capacidad para ser amplificado mediante PCR empleando cebadores derivados de las secuencias ejemplificadas.

Existen una serie de métodos para obtener proteínas para su uso según la presente invención. Por ejemplo, pueden utilizarse anticuerpos contra las proteínas descritas en la presente para identificar y aislar otras proteínas de una mezcla de proteínas. De modo específico, pueden generarse anticuerpos contra las porciones de las proteínas que están más conservadas o que son más diferentes, comparado con otras proteínas relacionadas. Estos anticuerpos después pueden utilizarse para identificar de modo específico proteínas equivalentes con la actividad característica mediante inmunoprecipitación, ensayo inmunoabsorbente ligado a enzimas (ELISA), o inmunotransferencia. Pueden prepararse con facilidad anticuerpos contra las proteínas descritas en la presente, o contra proteínas equivalentes, o contra fragmentos de estas proteínas, empleando procedimientos convencionales. Estos anticuerpos son un aspecto de la presente invención. Los anticuerpos de la presente invención incluyen anticuerpos monoclonales y policlonales, preferiblemente producidos en respuesta a un proteína ejemplificada o sugerida.

Empleando las ventajas de la presente descripción pueden obtenerse proteínas y genes de la presente invención a partir de una diversidad de fuentes, que incluyen una diversidad de microorganismos, tales como bacterias recombinantes y/o de tipo salvaje, por ejemplo.

Puede prepararse mutantes de aislados bacterianos mediante procedimientos que son muy conocidos en la técnica.

Por ejemplo, pueden obtenerse mutantes asporógenos mediante la mutagénesis con sulfonato de etilmetano (EMS) de un aislado. Los mutantes pueden generarse utilizando luz ultravioleta y nitrosoguanidina mediante procedimientos muy conocidos en la técnica.

Una proteína “procedente” o “que puede obtenerse a partir de” cualquier de los presentes aislados indicados o sugeridos en la presente significa que la proteína (o una proteína similar) puede obtenerse a partir del aislado o de otra fuente, tal como otra cepa bacteriana o una planta. “Derivado de” también posee esta connotación, e incluye proteínas que pueden obtenerse a partir de un tipo concreto de bacteria que se modifican para la expresión en una planta, por ejemplo. Los expertos en la técnica reconocerán con facilidad que, dada la descripción de un gen y proteína bacterianos, una planta puede modificarse para producir la proteína. Pueden prepararse preparaciones de anticuerpos, sondas de ácidos nucleicos (ADN, ARN o ANP, por ejemplo) y similares empleando las secuencias polinucleotídicas y/o de aminoácidos descritas en la presente, y pueden emplearse para seleccionar y recuperar otros genes relacionados a partir de otras fuentes (naturales).

Pueden utilizarse las técnicas convencionales de la biología molecular para clonar y secuenciar las proteínas y los genes descritos en la presente. Puede encontrarse más información en Sambrook et al., 1989.

Polinucleótidos y sondas. La presente invención también proporciona secuencias de ácidos nucleicos que codifican proteínas para su uso según la presente invención. La presente invención proporciona además métodos para identificar y caracterizar genes que codifican proteínas que tienen la actividad herbicida deseada. En una realización, la presente invención proporciona secuencias de nucleótidos exclusivos que son útiles como sondas de hibridación y/o cebadores para las técnicas de PCR. Los cebadores producen fragmentos de genes característicos que pueden utilizarse para la identificación, la caracterización y/o el aislamiento de genes específicos de interés. Las secuencias de nucleótidos de la presente invención codifican proteínas que son diferentes de las proteínas previamente descritas.

Los polinucleótidos de la presente invención pueden emplearse para formar “genes” completos para codificar proteínas o péptidos en una célula hospedante deseada. Por ejemplo, tal como reconocerán con facilidad los expertos en la técnica, los presentes polinucleótidos pueden colocarse de modo apropiado bajo el control de un promotor en un hospedante de interés, tal como como se conoce en la técnica. El nivel de expresión génica y la expresión temporal/específica de tejido puede afectar mucho la utilidad de la invención. En general, unos niveles mayores de expresión de proteínas de un gen degradativo producen una degradación más rápida y completa de un sustrato (en este caso, un herbicida diana). Se deseará que los promotores expresen el gen diana a niveles altos, a menos que la alta expresión tenga un impacto negativo consiguiente sobre la salud de la planta. Generalmente, se desea que el gen DSM-2 se exprese constitutivamente en todos los tejidos para la protección completa de la planta en todas las etapas de crecimiento. Sin embargo, como alternativa se puede emplear un gen de resistencia vegetativamente expresado; esto permite el uso del herbicida diana en el propio cultivo para el control de plantas adventicias y después se controlaría la reproducción sexual del cultivo diana mediante la aplicación durante la etapa de floración.

Tal como conocen los expertos en la técnica, el ADN existe generalmente en forma bicatenaria. En esta disposición, una hebra es complementaria con la otra hebra y viceversa. A medida que el ADN se replica en una planta (por ejemplo), se van produciendo más hebras complementarias de ADN. En la técnica a menudo se utiliza la expresión “hebra codificadora” para referirse a la hebra que se une con la hebra antisentido. El ARNm se transcribe a partir de la hebra “antisentido” del ADN. La hebra “sentido” o “codificadora” presenta una serie de codones (un codón lo constituyen tres nucleótidos que pueden leerse como una unidad de tres restos para especificar un aminoácido concreto) que pueden ser leídos como un marco de lectura abierto (ORF) para formar una proteína o un péptido de interés. Para producir una proteína in vivo, generalmente una hebra de ADN se transcribe en una hebra complementaria de ARNm que se utiliza como molde para la proteína. Así, la presente invención incluye el uso de los ejemplos de polinucleótidos mostrados en la lista de secuencia adjunta y/o los equivalentes que incluyan las hebras complementarias. Los ARN y ANP (ácidos nucleicos peptídicos) que sean funcionalmente equivalentes a las moléculas de ADN ejemplificadas se incluyen en la presente invención.

En una realización de la presente invención, los aislados bacterianos pueden cultivarse bajo condiciones que produzcan una alta multiplicación del microbio. Después de tratar el microbio para proporcionar un ácido nucleico genómico monocatenario, el ADN puede ponerse en contacto con los cebadores de la invención y someterse a una amplificación de PCR. Los fragmentos característicos de los genes de interés serán amplificados por el procedimiento, identificando con ello la presencia del gen o genes de interés.

Otros aspectos de la presente invención incluyen genes y aislados identificados utilizando los métodos y las secuencias de nucleótidos descritos en la presente. Los genes identificados de esta forma pueden codificar proteínas de resistencia a herbicidas de la presente invención.

Las proteínas y los genes para su uso según la presente invención pueden identificarse y obtenerse empleando sondas oligonucleotídicas, por ejemplo. Esetas sondas son secuencias de nucleótidos detectables que pueden ser detectadas mediante un marcador apropiado, o que pueden hacerse inherentemente fluorescentes según se describe en la solicitud internacional n.º WO 93/16094. Las sondas (y los polinucleótidos de la presente invención) pueden ser ADN, ARN o ANP. Además de la adenina (A), citosina (C), guanina (G), timina (T), y uracilo (U, para moléculas de ARN), las sondas (y los polinucleótidos) sintéticos de la presente invención también pueden presentar inosina (una base neutra capaz de aparearse con las cuatro bases, que a veces se emplea en lugar de una mezcla de las cuatro bases en las sondas sintéticas) y/u otras bases sintéticas (no naturales). Así, cuando se menciona un oligonucleótido degenerado sintético en la presente y se emplea genericamente “N” o “n”, “N” o “n” pueden ser G, A, T, C o inosina. Los códigos de ambigüedad, tal como se emplean en la presente, están en consonancia con las convenciones de nomenclatura de IUPAC convencionales, así como con la presentación de la presente solicitud (por ejemplo, R significa A o G, Y significa C o T, etc.).

Tal como se conoce en la técnica, si una molécula de sonda se hibrida con una muestra de ácido nucleico, puede suponerse razonablemente que la sonda y la muestra presentan una homología/similitud/identidad sustancial. Preferiblemente, en primer lugar se realiza la hibridación del polinucleótido, seguido de lavados bajo condiciones de rigurosidad baja, moderada o alta mediante técnicas muy conocidas en la técnica, según se describe, por ejemplo, en Keller, G. H., M. M. Manak (1987), DNA Probes, Stockton Press, Nueva York, N.Y., pp. 169-170. Por ejemplo, tal como se menciona en esta referencia, pueden lograrse unas condiciones de baja rigurosidad mediante un primer lavado con 2x SSC (citrato con disolución salina convencional)/SDS (dodecilsulfato de sodio) al 0,1% durante 15 minutos a temperatura ambiente. Generalmente se realizan dos lavados. Después puede lograrse una mayor rigurosidad disminuyendo la concentración salina y/o aumentando la temperatura. Por ejemplo, al lavado descrito anteriormente le pueden seguir dos lavados con 0,1x SSC/SDS al 0,1% durante 15 minutos cada uno a temperatura ambiente, seguido de posteriores lavados con 0,1x SSC/SDS al 0,1% durante 30 minutos cada uno a 55 ºC. Estas temperaturas pueden utilizarse con otros protocolos de hibridación y lavado descritos en la presente y tal como conocen los expertos en la técnica (puede emplearse SSPE como sal en lugar de SSC, por ejemplo). El 2x SSC/SDS al 0,1% puede prepararse añadiendo 50 ml de 20x SSC y 5 ml de SDS al 10% a 445 ml de agua. El 20x SSC puede prepararse combinando NaCl (175,3 g/0,150 M), citrato de sodio (88,2 g/0,015 M) y agua, ajustando el pH a 7,0 con NaOH 10 N, y después ajustando el volumen a 1 litro. El SDS al 10% puede prepararse disolviendo 10 g de SDS en 50 ml de agua sometida a un autoclave, y después diluyendo hasta 100 ml.

La detección de la sonda proporciona un medio para determinar, de una manera conocida, si se ha mantenido la hibridación. Este análisis de la sonda proporciona un método rápido para identificar genes de la presente invención.

Los segmentos nucleotídicos empleados como sondas según la invención pueden sintetizarse utilizando un sintetizador de ADN y procedimientos convencionales. Estas secuencias de nucleótidos también pueden emplearse como cebadores de PCR para amplificar genes de la presente invención.

Pueden utilizarse las características de hibridación de una molécula para definir polinucleótidos de la presente invención. Así, la presente invención incluye polinucleótidos (y/o sus complementos, preferiblemente sus complementos enteros) que se hibridan con un polinucleótido ejemplificado en la presente. Es decir, una manera de definir un gen (y la proteína que codifica), por ejemplo, es por su capacidad para hibridarse (bajo cualquiera de las condiciones descritas específicamente en la presente) con un gen conocido o un gen específicamente ejemplificado.

Tal como se emplean en la presente, las condiciones “rigurosas” para la hibridación se refieren a condiciones que logran el mismo grado, o aproximadamente el mismo grado de especificidad de hibridación que las condiciones empleadas por los actuales solicitantes. De modo específico, la hibridación de ADN inmovilizado sobre transferencias Southern con sondas específicas de gen marcadas con 32P puede realizarse mediante métodos convencionales (véase, por ejemplo, Maniatis et al., 1982). En general, la hibridación y los lavados posteriores pueden realizarse bajo condiciones que permiten la detección de las secuencias diana. Para las sondas de genes de ADN bicatenario, la hibridación puede realizarse durante la noche a 20-25 ºC por debajo de la temperatura de fusión (Tf) del híbrido de ADN en 6x SSPE, 5x disolución de Denhardt, SDS al 0,1%, ADN desnaturalizado 0,1 mg/ml. La temperatura de fusión se describe mediante la siguiente fórmula (Beltz et al., 1983): Tf = 81,5 ºC + 16,6 Log[Na+] + 0,41(% de G+C) - 0,61(% de formamida) - 600/longitud del dúplex en pares de bases.

Los lavados generalmente pueden realizarse como sigue: (1) Dos veces a temperatura ambiente durante 15 minutos en 1x SSPE, SDS al 0,1% (lavado de baja rigurosidad).

(2) Una vez a Tf-20 ºC durante 15 minutos en 0,2x SSPE, SDS al 0,1% (lavado de rigurosidad moderada).

Para las ondas oligonucleotídicas, la hibridación puede realizarse durante la noche a 10-20º C por debajo de la temperatura de fusión (Tf) del híbrido en 6x SSPE, 5X disolución de Denhardt, SDS al 0,1%, ADN desnaturalizado 0,1 mg/ml. La Tf para las sondas oligonucleotídicas puede determinarse mediante la siguiente fórmula: Tf (ºC) = 2(número de pares de bases T/A) + 4(número de pares de bases G/C) (Suggs et al., 1981).

Los lavados generalmente pueden realizarse como sigue: (1) Dos veces a temperatura ambiente durante 15 minutos en 1x SSPE, SDS al 0,1% (lavado de baja rigurosidad).

(2) Una vez a la temperatura de hibridación durante 15 minutos en 1x SSPE, SDS al 0,1% (lavado de rigurosidad moderada).

En general, las sales y/o la temperatura pueden alterarse para cambiar la rigurosidad. Con un fragmento de ADN marcado con una longitud >70 bases o así, pueden utilizarse las siguientes condiciones: Bajas: 1 o 2x SSPE, temperatura ambiente Bajas: 1 o 2x SSPE, 42 ºC Moderadas: 0,2x o 1x SSPE, 65 ºC Altas: 0,1x SSPE, 65 ºC La formación de dúplex y la estabildad dependen de si existe una complementariedad sustancial entre las dos hebras de un híbrido y, tal como se indicó anteriormente, puede tolerarse un cierto grado de desapareamiento. Por tanto, las secuencias de las sondas de la presente invención incluyen mutaciones (puntuales y múltiples), deleciones, inserciones de las secuencias descritas, y sus combinaciones, en las que dichas mutaciones, inserciones y deleciones permiten la formación de híbridos estables con el polinucleótido diana de interés. Las mutaciones, inserciones y deleciones pueden producirse en una secuencia polinucleotídica concreta de muchas maneras, y estos métodos son conocidos por los expertos en la técnica. Otros métodos pueden surgir en el futuro.

Tecnología de PCR. La reacción en cadena de la polimerasa (PCR) es una síntesis cebada, enzimática y repetitiva de una secuencia de ácido nucleico. Este procedimiento es muy conocido y los expertos en la técnica lo emplean habitualmente (véase Mullis, patentes de EEUU n.os 4.683.195, 4.683.202, y 4.800.159; Saiki et al., 1985). La PCR se basa en la amplificación enzimática de un fragmento de ADN de interés que está flanqueado por dos cebadores oligonucleotídicos que se hibridan con las hebras opuestas de la secuencia diana. Los cebadores preferiblemente están orientados con los extremos 3’ apuntándose entre sí. Unos ciclos repetidos de termodesnaturalización del molde, apareamiento de los cebadores con sus secuencias complementarias y extensión de los cebadores apareados con una ADN polimerasa produce la amplificación del segmento definido por los extremos 5’ de los cebadores de PCR. El producto de la extensión de cada cebador puede actuar como molde para el otro cebador, de modo que cada ciclo fundamentalmente duplica la cantidad de fragmentos de ADN producidos en el ciclo previo. Esto resulta en la acumulación exponencial del fragmento diana específico, hasta varios millones de veces en unas pocas horas. Mediante el empleo de una ADN polimerasa termoestable, tal como Taq polimerasa, aislada a partir de la bacteria termofila Thermus aquaticus, el proceso de amplificación puede ser completamente automático. Los expertos en la técnica conocen otras enzimas que pueden utilizarse.

Las secuencias de ADN ejemplificadas o sus segmentos pueden emplearse como cebadores para la amplificación por PCR. Cuando se realiza la amplificación por PCR puede tolerarse un cierto grado de desapareamiento entre el cebador y el molde. Por tanto, son posibles mutaciones, deleciones e inserciones (en especial, adiciones de nucleótidos al extremo 5’) de los cebadores ejemplificados. Las mutaciones, inserciones y deleciones pueden producirse en un cebador concreto mediante métodos conocidos por los expertos en la técnica.

Modificaciones de genes y proteínas. Los presentes genes y proteínas pueden condensarse con otros genes y proteínas para producir proteínas quiméricas o de fusión. Los genes y las proteínas útiles según la presente invención incluyen no solo las secuencias de longitud completa ejemplificadas, sino también porciones, segmentos y/o fragmentos (que incluyen segmentos contiguos y deleciones internas y/o terminales, comparado con las moléculas de longitud completa) de estas secuencias, y sus variantes, mutantes, quimeras y fusiones. Las proteínas de la presente invención pueden presentar aminoácidos sustituidos, con la condición de que conserven la actividad funcional deseada. Los genes “variantes” tienen secuencias de nucleótidos que codifican las mismas proteínas o proteínas equivalentes que tienen una actividad equivalente o similar a una proteína ejemplificada. Las expresiones “proteínas variantes” y “proteínas equivalentes” se refieren a proteínas que tienen la misma o fundalmentalmente la misma actividad biológica/funcional contra los sustrato diana y unas secuencias equivalentes a las proteínas ejemplificadas. Tal como se emplea en la presente, la referencia a una secuencia “equivalente” se refiere a secuencias que tiene sustituciones, deleciones, adiciones o inserciones de aminoácidos que mejoran o que no afectan de modo adverso a la actividad en un grado significativo. Los fragmentos que conservan la actividad también se incluyen en esta definición. Son posibles fragmentos y otros equivalentes que conserven la misma función o actividad, o una función o actividad similar, que un correspondiente fragmento de una proteína ejemplificada. Pueden realizarse cambios, tales como sustituciones o adiciones de aminoácidos, para una diversidad de objetivos, tales como aumentar (o disminuir) la estabilidad frente a proteasas de la proteína (sin disminuir material o sustancialmente la actividad funcional de la proteína), eliminar o añadir un sitio de restricción y similares. Pueden construirse con facilidad variaciones de genes utilizando técnicas convencionales para realizar mutaciones puntuales, por ejemplo.

Además, la patente de EEUU n.º 5.605.793, por ejemplo, describe métodos para generar una mayor diversidad molecular utilizando ADN reensamblado después de una fragmentación aleatoria o enfocada. Esto puede denominarse un “reordenamiento” de genes, que generalmente implica mezclar fragmentos (de un tamaño deseado) de dos o más moléculas de ADN diferentes, seguido de rondas repetidas de renaturalización. Esto puede mejorar la actividad de una proteína codificada por un gen inicial. El resultado es una proteína quimérica que tiene mayor actividad, una especificidad alterada por el sustrato, una mayor estabilidad enzimática, una estereoespecificidad alterada u otras características.

El “reordenamiento” puede diseñarse y dirigirse después de obtener y estudiar las coordenadas tridimensionales atómicas y la estructura cristalina de una proteína de interés. Así, el “reordenamiento enfocado” puede dirigirse a ciertos segmentos de una proteína que sean ideales para la modificación, tales como los segmentos expuestos sobre la superficie y preferiblemente no segmentos internos que estén implicados en el plegamiento de la proteína y la integridad estructural tridimensional fundamental.

Los genes variantes pueden emplearse para producir proteínas variantes; pueden emplearse hospedantes recombinantes para producir las proteínas variantes. Empleando el “reordenamiento de genes” y otras técnicas pueden construirse genes y proteínas equivalentes que comprendan ciertos segmentos que presenten ciertos restos contiguos (aminoácidos o nucleótidos) de cualquiera de las secuencias ejemplificadas en la presente. Esta técnicas pueden ajustarse para obtener proteínas equivalentes/funcionalmente activas que tengan, por ejemplo, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, y 170 restos aminoácidos contiguos que se corresponden con un segmento (del mismo tamaño) en cualquiera de las secuencias ejemplificadas o sugeridas. Los polinucleótidos que codifican estos segmentos, en particular para las regiones de interés, también se incluyen en la presente invención y también pueden emplearse como sondas y/o cebadores, en especial para las regiones conservadas.

Pueden prepararse fragmentos de genes de longitud completa empleando exonucleasas o endonucleasas disponibles en el mercado según procedimientos convencionales. Por ejemplo, pueden emplearse enzimas, tales como Bal31, o la mutagénesis dirigida específica de sitio para cortar sistemáticamente los nucleótidos desde los extremos de estos genes. Además pueden obtenerse genes que codifican fragmentos activos empleando una diversidad de enzimas de restricción. Pueden utilizarse proteasas para obtener directamente fragmentos activos de estas proteínas.

Las proteínas pueden truncarse y aún mantener la actividad funcional. Una “proteína truncada” significa que una porción de una proteína puede romperse, pero la proteína truncada remanente aún conserva y muestra la actividad deseada después de la ruptura. La ruptura puede lograrse empleando diversas proteasas. Además, pueden producirse proteínas rotas de modo eficaz utilizando técnicas de biología molecular en las que las bases del ADN que codifican dicha proteína se eliminan mediante una digestión con endonucleasas de restricción u otras técnicas disponibles para los expertos en la técnica. Después del truncamiento, dichas proteínas pueden ser expresadas en sistemas heterólogos, tales como E. coli, baculovirus, sistemas víricos basados en plantas, levaduras y similares, y después emplearse en ensayo de insectos, tal como se describe en la presente, para determinar la actividad. En la técnica se sabe que pueden producirse con éxito proteínas truncadas, de modo que conserven la actividad funcional, pero con una secuencia menor que la secuencia entera de longitud completa. Por ejemplo, pueden emplearse proteínas de B.t. en forma truncada (proteína del núcleo) (véase, Höfte et al. (1989), y Adang et al. (1985)). Tal como se emplea en la presente, el término “proteína” puede incluir truncamientos funcionalmente activos.

En algunos casos, en especial para la expresión en plantas, puede resultar ventajoso emplear genes truncados que expresen proteínas truncadas. Los genes truncados preferidos codifican generalmente 90, 91, 92, 93, 94, 95, 96, 97, 98, o 99% de la proteína de longitud completa.

Ciertas proteínas de la presente invención se han ejemplificado específicamente en la presente. Puesto que estas proteínas son solo ejemplos de las proteínas de la presente invención, debería resultar evidente que la presente invención comprende proteínas variantes o equivalentes (y secuencias de nucleótidos que codifican sus equivalentes) que tengan la misma actividad o una actividad similar a la de las proteínas ejemplificadas. Las proteínas equivalentes tendrán una similitud (y/u homología) de aminoácidos con una proteína ejemplificada. La identidad de aminoácidos será de al menos 90%, y peude ser de al menos 95%. Las proteínas preferidas de la presente invención también pueden definirse en términos de unos intervalos de identidad y/o similitud más concretos. Por ejemplo, la identidad y/o similitud puede ser del 90, 91, 92, 93, 94, 95, 96, 97, 98, o 99%, comparado con una secuencia ejemplificada o sugerida en la presente. Cualquiera de los números listados anteriormente puede utilizarse para definir los límites superior e inferior.

A menos que se indique lo contrario, tal como se emplea en la presente, el porcentaje de identidad y/o similitud de secuencia de dos ácidos nucleicos se determina utilizando el algoritmo de Karlin y Altschul, 1990, modificado como en Karlin y Altschul, 1993. Este algoritmo se incorpora en los programas NBALST y XBLAST de Altschul et al., 1990.

Las búsquedas de nucleótidos de BLAST se realizan con el programa NBLAST, puntuación = 100, longitud de palabra = 12. El BLAST con huecos puede utilizarse tal como se describe en Altshcul et al., 1997. Cuando se utilizan los programas BLAST y BLAST con huecos, se emplean los parámetros por defecto de los respectivos programas (NBLAST y XBLAST). Véase el sitio web de NCBI/NIH. Para obtener alineamientos con huecos para objetivos de comparación, se usa la función AlignX de Vector NTI paquete 8 (InforMax, Inc., North Bethesda, MD, EEUU) que emplea los parámetros por defecto. Estos son: una penalización de apertura de hueco de 15, una penalización por extensión de hueco de 6,66, y un intervalo de penalización de separación de hueco de 8.

También pueden cambiarse diversas propiedades y características tridimensionales de la proteína sin afectar de modo adverso a la actividad/funcionalidad de la proteína. Pueden tolerarse/realizarse sustituciones de aminoácidos conservativas para no afectar de modo adverso a la actividad y/o configuración tridimensional de la molécula. Los aminoácidos pueden separarse en las siguientes clases: no polares, polares sin carga, básicos y ácidos. Son posibles las sustituciones conservativas en las que un aminoácido de una clase es reemplazado por otro aminoácido del mismo tipo, como la condición de que la sustitución no sea desfavorable para la actividad biológica del compuesto. La tabla 2 proporciona una lista de ejemplos de aminoácidos que pertenecen a cada clase.

Tabla 2

Clase de aminoácido

Ejemplos de aminoácidos

No polar Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Polar sin carga Gly, Ser, Thr, Cys, Tyr, Asn, Gln Ácido Asp, Glu Básico Lys, Arg, His En algunos casos, también pueden realizarse sustituciones no conservativas. Sin embargo, las sustituciones preferidas no perjudican significativamente a la actividad funcional/biológica de la proteína.

Tal como se emplea en la presente, la referencia a polinucleótidos “aislados” y/o proteínas “purificadas” se refiere a estas moléculas cuando están en un estado distinto del que se encontrarían en la naturaleza. Así, la referencia a “aislado” y/o “purificado” significa la implicación de la “mano del hombre”, tal como se describe en la presente. Por ejemplo, un “gen” bacteriano de la presente invención introducido en una planta para su expresión es un “polinucleótido aislado”. De modo similar, una proteína derivada de una proteína bacteriana y producida por una planta es una “proteína aislada”.

Debido a la degeneración/redundancia del código genético, una diversidad de diferentes secuencias de ADN puede codificar las secuencias de aminoácidos descritas en la presente. Dentro de los conocimientos de los expertos en la técnica se encuentra la capacidad para crear secuencias de ADN alternativas que codifican las mismas, o sustancialmente las mismas proteínas. Esto también se analiza con más detalle a continuación en la sección titulada “Optimización de la secuencia para la expresión en plantas”.

Optimización de la secuencia para la expresión en plantas. Para obtener una alta expresión de genes heterólogos en plantas, en general se prefiere volver a modificar los genes de modo que puedan ser expresados con más eficacia en (el citoplasma de) las células vegetales. El maíz es una de las plantas en las que puede preferirse rediseñar el gen o genes heterólogos antes de la transformación para aumentar su nivel de expresión en dicha planta. Por tanto, otra etapa en el diseño de genes que codifican una proteína bacteriana es la remodificación de un gen heterólogo para su expresión óptima, utilizando el sesgo de codones que se alinea mejor con la secuencia de la planta diana, tanto si es una especie dicotiledónea como monocotiledónea. Las secuencias también pueden optimizarse para la expresión en cualquiera de los tipos más concretos de plantas analizadas en otras secciones de la presente.

Hospedantes transgénicos. Los genes que codifican proteínas de la presente invención pueden introducirse en una amplia variedad de hospedantes microbianos o vegetales. La presente invención incluye células de plantas transgénicas y plantas transgénicas. Las plantas (y las células vegetales) preferidas son el maíz, Arabidopsis, tabaco, soja, algodón, canola, arroz, trigo, césped y hierbas de pasto, y similares. También pueden generarse otros tipos de plantas transgénicas según la presente invencón, tales como frutas, verduras, plantas ornamentales y árboles. Más en general, pueden utilizarse dicotiledóneas y/o monocotiledóneas en diversos aspectos de la presente invención.

Así, la presente invención puede adaptarse para su uso con plantas vasculares y no vasculares, que incluyen monocotiledóneas y dicotiledóneas, coníferas, briofitos, algas, hongos y bacterias. Las células animales y los cultivos de células animales también son una posibilidad.

En realizaciones preferidas, la expresión del gen da como resultado, directa o indirectamente, la producción intracelular (y el mantenimiento) de la proteína o proteínas de interés. De esta manera puede hacerse que las plantas sean resistentes a herbicidas. Estos hospedantes pueden denominarse hospedantes y/o células transgénicos, recombinantes, transformados y/o transfectados. En algunos aspectos de esta invención (cuando se clona y se preparar el gen de interés, por ejemplo), pueden producirse células microbianas (preferiblemente bacterianas) y emplearse según técnicas convencionales, con la ventaja de la presente descripción.

Las células vegetales transfectadas con un polinucleótido de la presente invención pueden regenerarse en plantas completas. La presente invención incluye cultivos celulares que incluyen cultivos de células de tejidos, cultivos líquidos y cultivos en placa. Las semillas producidas y/o empleadas para generar plantas de la presente invención también se incluyen en la presente invención. Otros tejidos y partes de plantas también se incluyen en la presente invención. De modo similar, la presente invención también incluye métodos para producir plantas o células que comprenden un polinucleótido de la presente invención. Un método preferido para producir estas plantas es plantando una semilla de la presente invención.

Inserción de genes para formar hospedantes transgénicos. Un aspecto de la presente invención es la transformación/transfección de plantas, células vegetales y otras células hospedantes con los polinucleótidos de la presente invención que expresan proteínas de la presente invención. Las plantas transformdas de esta manera pueden hacerse resistentes a una diversidad de herbicidas con diferentes modos de acción.

Están disponibles una amplia variedad de métodos para introducir un gen que codifica una proteína deseada en el hospedante diana bajo condiciones que permiten el mantenimiento estable y la expresión del gen. Estos métodos son muy conocidos por los expertos en la técnica y se describen, por ejemplo, en la patente de EEUU n.º 5.135.867.

La presente invención proporciona vectores que comprenden un polinucleótido DSM-2. Por ejemplo, está disponible un gran número de vectores de clonación que comprenden un sistema de replicación en E. coli y un marcador que permite la selección de las células transformadas, para la preparación para la inserción de los genes extraños en plantas superiores. Los vectores comprenden, por ejemplo, pBR322, la serie pUC, la serie M13mp, pACYC184, etc. Por consiguiente, la secuencia que codifica la proteína puede insertarse en el vector en un sitio de restricción adecuado. El plásmido resultante se emplea para la transformación en E. coli. Las células de E. coli se cultivan en un medio nutriente adecuado, después se recolectan y se lisan. El plásmido se recupera mediante una purificación del ADN genómico. En general se realizan análisis de la secuencia, análisis de restricción, electroforesis y otros métodos de biología molecular-bioquímicos como métodos de análisis. Después de cada manipulación, la secuencia de ADN empleada puede someterse a una digestión de restricción y unirse a la siguiente secuencia de ADN. Cada secuencia de plásmido puede clonarse en el mismo plásmido o en otros plásmidos. Dependiendo del método de inserción de los genes deseados en la planta, pueden ser necesarias otras secuencias de ADN. Por ejemplo, si se emplea el plasmido Ti o Ri para la transformación de la célula vegetal, entonces debe unirse al menos el límite derecho, pero a menudo el límite derecho e izquierdo, del ADN-T del plásmido Ti o Ri, como región flanqueante de los genes que se van a insertar. El uso de ADN-T para la transformación de células vegetales ha sido investigado a fondo y se describe en el documento EP 120 516; Hoekema (1985); Fraley et al. (1986); y An et al. (1985).

Están disponibles un gran número de técnicas para insertar ADN en una célula hospedante vegetal. Estas técnicas incluyen la transformación con ADN-T empleando Agrobacterium tumefaciens o Agrobacterium rhizogenes como agente de transformación, fusión, inyección, biolística (bombardeo de micropartículas), filamentos de carburo de silicio, haces de aerosol, PEG o electroporación, así como otros métodos posibles. Si se emplea Agrobacterium para la transformación, el ADN que se va a insertar debe clonarse en plásmidos especiales, concretamente en un vector intermedio o en un vector binario. Los vectores intermedios pueden integrarse en el plásmido Ti o Ri mediante recombinación homóloga debido a que las secuencias son homólogas a secuencias en el ADN-T. El plásmido Ti o Ri también comprende la región vir necesaria para la transferencia del ADN-T. Los vectores intermedios no pueden replicarse en Agrobacterium. El vector intermedio puede transferirse en Agrobacterium tumefaciens por medio de un plásmido auxiliar (conjugación). Los vectores binarios pueden replicarse en E. coli y en Agrobacterium. Comprenden un gen marcador seleccionable y un conector o policonector que está enmarcado por las regiones del límite derecho e izquierdo de ADN-T. Pueden transformarse directamente en Agrobacterium (Holsters, 1978). El Agrobacterium

utilizado como célula hospedante debe comprender un plásmido que porte una región vir. La región vir es necesaria para la transferencia del ADN-T hacia la célula vegetal. Puede contener otro ADN-T. La bacteria transformada de esta manera se emplea para la tranformación de células vegetales. Pueden cultivarse explantes de las plantas de forma ventajosa con Agrobacterium tumefaciens o Agrobacterium rhizogenes para la transferencia del ADN hacia la célula vegetal. Después pueden regenerarse plantas completas a partir del material vegetal infectado (por ejemplo, trozos de hojas, segmentos del tallo, raíces, pero también protoplastos o células cultivadas en suspensión) en un medio adecuado, que puede contener antibióticos o biocidas para la selección. Las plantas obtenidas de este modo después pueden ensayarse para la presencia del ADN insertado. No existen requisitos especiales para los plásmidos en el caso de la inyección y la electroporación. Es posible utilizar plásmidos normales, tales como, por ejemplo, derivados de pUC.

Las células transformadas se cultivan dentro de las plantas de la manera habitual. Pueden formar células germinales y transmitir el rasgo o rasgos transformados a las plantas de la progenie. Estas plantas pueden cultivarse de la manera normal y cruzarse con plantas que tengan los mismos factores hereditarios transformados u otros factores hereditarios. Los individuos híbridos resultantes tendrán las correspondientes propiedades fenotípicas.

En algunas realizaciones preferidas de la invención, los genes que codifican la proteína bacteriana se expresan a partir de unidades transcripcionales insertadas en el genoma de la planta. Preferiblemente, dichas unidades transcripcionales son vectores recombinantes capaces de una integración estable en el genoma de la planta y permiten la selección de las líneas de las plantas transformadas que expresan ARNm que codifica las proteínas.

Después de que el ADN insertado se haya integrado en el genoma, es relativamente estable en este emplazamiento (y no vuelve a salir). Normalmente contiene un marcador seleccionable que confiere a las células vegetales transformadas resistencia frente a un biocida o a un antibiótico, tal como kanamicina, G418, bleomicina, higromicina, o cloranfenicol, entre otros. Los marcadores seleccionables de plantas también pueden proporcionar generalmente resistencia a diversos herbicidas, tales como glufosinato (PAT), glifosato (EPSPS), imazetiapir (AHAS) y muchos otros. Por consiguiente, el marcador empleado individualmente debe permitir la selección de las células transformadas y no las células que no contienen el ADN insertado. El gen o genes de interés son expresados preferiblemente por promotores constitutivos o inducibles en la célula vegetal. Tras haber sido expresado, el ARNm se traduce en proteínas, incorporando con ello los aminoácidos de interés a la proteína. Los genes que codifican una proteína expresada en las células vegetales pueden estar bajo el control de un promotor constitutivo, un promotor específico de tejido o un promotor inducible.

Existen varias técnicas para introducir vectores recombinantes extraños en células vegetales y para obtener plantas que mantengan de forma estable y expresen el gen introducido. Estas técnicas incluyen la introducción de material genético revestido sobre micropartículas directamente a las células (patentes de EEUU n.os 4.945.050 de Cornell, y 5.141.131 de DowElanco, now Dow AgroSciences, LLC). Además, las plantas pueden transformarse empleando la tecnología de Agrobacterium, véanse las patentes de EEUU n.os 5.177.010 de University of Toledo; 5.104.310 de Texas A&M; la solicitud de patente europea 0131624B1; las solicitudes de patente europea 120516, 159418B1 y 176.112 de Schilperoot; las patentes de EEUU n.os 5.149.645, 5.469.976, 5.464.763 y 4.940.838 y 4.693.976 de Schilperoot; las solicitudes de patente europea 116718, 290799, 320500, todas de Max Planck; las solicitudes de patente europea 604662 y 627752, y la patente de EEUU n.º 5.591.616, de Japan Tobacco; las solicitudes de patente europea 0267159 y 0292435, y la patente de EEUU n.º 5.231.019, todas de Ciba Geigy, ahora Syngenta; las patentes de EEUU n.os 5.463.174 y 4.762.785, ambas de Calgene; y las patentes de EEUU n.os 5.004.863 y 5.159.135, ambas de Agracetus. Otra tecnología de transformación incluye la tecnología de filamentos (“whiskers”).

Véanse las patentes de EEUU n.os 5.302.523 y 5.464.765, ambas de Zeneca, ahora Syngenta. Otra tecnología de transformación para el transporte directo de ADN incluye la tecnología de haces de aerosol. Véase la patente de EEUU n.º 6.809.232. También se ha empleado la tecnología de la electroporación para transformar plantas. Véase el documento WO 87/06614 de Boyce Thompson Institute; las patentes de EEUU n.os 5.472.869 y 5.384.253, ambas de Dekalb; y los documentos WO 92/09696 y WO 93/21335, ambos de Plant Genetic Systems. Además, también pueden emplearse vectores víricos para producir plantas transgénicas que expresan la proteína de interés. Por ejemplo, pueden transformarse plantas monocotiledóneas con un vector vírico empleadno los métodos descritos en la patente de EEUU n.º 5.569.597 de Mycogen Plant Science y Ciba-Geigy (ahora Syngenta), así como las patentes de EEUU n.os 5.589.367 y 5.316.931, ambas de Biosource, ahora Large Scale Biology.

Tal como se mencionó previamente, la manera en la que la construcción de ADN se introduce en el hospedante vegetal no es crítica para la invención. Puede emplearse cualquier método que proporcione una transformación eficaz. Por ejemplo, en la presente se describen diversos métodos para la transformación de células vegetales e incluyen el uso de plásmidos Ti o Ri y similares para realizar la transformación mediada por Agrobacterium. En muchos casos, será deseable que la construcción utilizada para la transformación esté limitada, en uno o ambos lados, por los límites de ADN-T, de modo más específico el límite derecho. Esto resulta particularmente útil cuando la construcción emplea Agrobacterium tumefaciens o Agrobacterium rhizogenes como modo de transformación, aunque los límites del ADN-T pueden utilizarse con otros modos de transformación. Cuando se emplea Agrobacterium para la transformación de células vegetales, puede emplearse un vector que puede introducirse en el hospedante para la recombinación homóloga con ADN-T o el plásmido Ti o Ri presente en el hospedante. La introducción del vector puede realizarse mediante electroporación, apareamiento triparental u otras técnicas para transformar bacterias gram-negativas que son conocidas por los expertos en la técnica. La manera de realizar la transformación con el vector en el hospedante de Agrobacterium no es crítica para la invención. El plásmido Ti o Ri que contiene el ADN-T para la recombinación puede ser o no capaz de provocar la formación de agallas, y esto no es crítico para la invención, con la condición de que los genes vir estén presentes en dicho hospedante.

En algunos casos en los que se emplea Agrobacterium para la transformación, la construcción de expresión que está dentro de los límites del ADN-T se insertará en un vector de amplio espectro, tal como pRK2 o sus derivados, según se describe en Ditta et al. (1980), y el documento EPO 0 120 515. Dentro de la construcción de expresión y del ADN-T se incluyen uno o más marcadores, según se describe en la presente, que permiten la selección del Agrobacterium transformado y de las células vegetales transformadas. El marcador concreto empleado no es fundamental para esta invención, y el marcador preferido dependerá del hospedante y de la construcción utilizadas.

Para la transformación de células vegetales empleando Agrobacterium, los explantes pueden combinarse e incubarse con el Agrobacterium transformado durante un tiempo suficiente como para permitir su transformación. Después de la transformación, los Agrobacterium se destruyen mediante selección con el antibiótico apropiado, y las células vegetales se cultivan con el medio selectivo apropiado. Tras haberse formado los callos, la formación de brotes puede estimularse empleando las hormonas vegetales apropiadas según métodos muy conocidos en la técnica del cultivo de tejidos vegetales y la regeneración de plantas. Sin embargo, no siempre es necesaria una etapa intermedia de callo. Después de la formación de brotes, dichas células vegetales pueden transferirse a un medio que estimule la formación de raíces, completando con ello la regeneración de la planta. Las plantas después pueden cultivarse hasta la semilla y dicha semilla puede utilizarse para establecer futuras generaciones. Independientemente de la técnica de transformación, el gen que codifica la proteína bacteriana preferiblemente se incorpora en un vector de transferencia de genes adaptado para expresar dicho gen en una célula vegetal mediante la inclusión en el vector de un elemento regulador de promotor vegetal, así como regiones de terminación de la transcripción no traducidas 3’, tales como Nos y similares.

Además de las numerosas tecnologías para transformar plantas, el tipo de tejido que se va a poner en contacto con los genes extraños también puede variar. Este tejido incluye, pero no se limita a tejido embriogénico, tejido de callo de tipo I, II y III, hipocotilo, meristemo, tejido radicular, tejidos para la expresión en el floema, y similares. Casi todos los tejidos vegetales pueden transformarse durante la desdiferenciación empleando las técnicas apropiadas descritas en la presente.

Además de un marcador seleccionable, puede resultar deseable emplear un gen indicador. En algunos casos, puede emplearse un gen indicador con o sin un marcador seleccionable. Los genes indicadores son genes que generalmente no están presentes en el organismo o tejido receptor y generalmente codifican proteínas que producen algún cambio fenotípico o propiedad enzimática. Se proporcionan ejemplos de dichos genes en Weising et

al., 1988. Los genes indicadores preferidos incluyen la beta-glucuronidasa (GUS) del locus uidA de E. coli, el gen de the cloranfenicol acetil transferasa de Tn9 de E. coli, la proteína fluorescente verde de la medusa bioluminiscente Aequorea victoria, y los genes de luciferasa de la luciérnaga Photinus pyralis. Después puede realizarse un ensayo para detectar la expresión del gen indicador en un momento adecuado después de que dicho gen haya sido introducido en las células receptoras. Uno de estos ensayos preferidos implica el uso del gen que codifica la beta- glucuronidasa (GUS) del locus uidA de E. coli, según se describe en Jefferson et al., (1987), para identificar las células transformadas.

Además de los elementos reguladores de promotores vegetales, pueden emplearse con eficacia elementos reguladores de promotores procedentes de una diversidad de fuentes en células vegetales para expresar genes extraños. Por ejemplo, pueden utilizarse elementos reguladores de promotores de origen bacteriano, tales como el promotor de octopina sintasa, el promotor de nopalina sintasa, el promotor de manopina sintasa; promotores de origen vírico, tales como el virus del mosaico de la coliflor (35S y 19S), 35T (que es un promotor de 35S que se ha modificado de nuevo, véase la patente de EEUU n.º 6.166.302, en especial el ejemplo 7E) y similares. Los elementos reguladores de promotores vegetales incluyen, pero no se limitan a la subunidad pequeña (ssu) de la ribulosa-1,6-bisfosfato (RUBP) carboxilasa, el promotor de beta-conglicinina, el promotor de beta-faseolina, el promotor de ADH, los promotores de choque térmico, y promotores específicos de tejidos. Pueden estar presentes otros elementos, tales como regiones de unión a la matriz, regiones de unión al andamiaje, intrones, potenciadores, secuencias de poliadenilación y similares y, así, pueden mejorar la eficacia de la transcripción o la integración del ADN. Estos elementos pueden ser necesarios o no para la función del ADN, aunque pueden proporcionar una mejor expresión o funcionamiento del ADN afectando a la transcripción, la estabilidad del ARNm, y similares.

Estos elementos pueden incluirse en el ADN según se desee para obtener una actuación óptima del ADN transformado en la planta. Los elementos típicos incluyen, pero no se limitan a Adh-intrón 1, Adh-intrón 6, la secuencia conductora de la proteína de la envuelta del virus del mosaico de la alfalfa, secuencias UTR de osmotina, la secuencia conductora de la proteína de la envuelta del virus del rayado del maíz, así como otros disponibles para los expertos en la técnica. También pueden emplearse elementos reguladores de promotores constitutivos, dirigiendo con ello una expresión continua del gen en todos los tipos celulares y en todo momento (por ejemplo, actina, ubiquitina, CaMV 35S, y similares). Los elementos reguladores de promotores específicos de tejido son responsables de la expresión génica en tipos de células o de tejidos específicos, tales como las hojas o las semillas (por ejemplo, zeína, oleosina, napina, ACP, globulina y similares) y también pueden utilizarse.

Los elementos reguladores de promotores también pueden ser activos (o inactivos) durante cierta etapa del desarrollo de la planta, así como ser activos en tejidos y órganos de la planta. Los ejemplos de estos incluyen, pero no se limitan a elementos reguladores de promotores específicos del polen, específicos del embrión, específicos de las barbas del maíz, específicos de las fibras de algodón, específicos de la raiz, específicos del endospermo de la semilla, o específicos de la fase vegetativa y similares. Bajo ciertas circunstancias puede resultar deseable emplear un elemento regulador de promotor inducible que es responsable de la expresión de los genes en respuesta a una señal específica, tal como un estímulo físico (genes de choque térmico), la luz (RUBP carboxilasa), hormonas (Em), metabolitos, estímulos químicos (respuesta a tetraciclina) y estrés. Pueden utilizarse otros elementos de transcripción y traducción deseables que actúan en plantas. En la técnica se conocen numerosos vectores de transferencia de genes específicos de plantas.

También pueden emplearse sistemas basados en ARN de virus vegetales para expresar proteínas bacterianas.

Cuando se emplean, el gen que codifica una proteína puede insertarse en la región del promotor de la envuelta de un virus vegetal adecuado que infectará a la planta hospedante de interés. La proteína después puede expresarse, proporcionando con ello protección a la planta frente a los daños por herbicidas. Los sistemas basados en ARN de virus vegetales se describen en la patente de EEUU n.º 5.500.360 de Mycogen Plant Science, Inc. y las patentes de EEUU n.os 5.319.931 y 5.589.367, ambas de Biosource, ahora Large Scale Biology.

Agentes de selección. Además del glufosinato y el bialafós, los agentes de selección que pueden emplearse según la presente invención incluyen todos los análogos sintéticos y naturales que puedan ser inactivados por el mecanismo de la acetil transferasa mediado por un gen DSM-2 de la presente invención. Véase, por ejemplo, la figura 1.

A menos que se indique o se insinúe específicamente lo contrario, los términos “el/la” y “un/una” significan “al menos uno/una”, tal como se emplea en la presente.

A continuación se presentan ejemplos que ilustran los procedimientos para practicar la invención. Estos ejemplos no deben considerarse limitantes. Todos los porcentajes están en peso y todas las proporciones de mezclas de disolventes están en volumen, a menos que se indique lo contrario.

Ejemplo 1: Método para identificar genes que imparten resistencia al glufosinato dentro de las plantas

Para poder identificar genes que poseen actividad degradante de herbicidas dentro de las plantas, o en cultivo celular, es posible explorar basas de datos públicas actuales, tales como NCBI (National Center for Biotechnology Information). Para comenzar el proceso, es necesario haber identificado una secuencia de un gen funcional que codifique una proteína con las características deseadas (concretamente, fosfinotricina acetil transferasa). Esta secuencia de proteína entonces se utiliza como entrada para el algoritmo BLAST (Basic Local Alignment Search Tool) (Altschul et al., 1997) para compararla con las secuencias de proteínas de NCBI disponibles depositadas. Empleando los ajustes por defecto, esta búsqueda produce más de 100 secuencias de proteínas homólogas en diversos niveles. Estas varían desde proteínas casi idénticas (85-98%) hasta proteínas con identidad muy baja (23- 32%) a nivel de aminoácidos. Tradicionalmente, se esperaría que solo las secuencias con una alta homología conservasen propiedades similares a la secuencia de entrada. En este caso, solo se eligen las secuencias resultantes con  50% de homología. Tal como se ejemplifica en la presente, puede emplearse la clonación y la expresión recombinante de homólogos con una conservación de aminoácidos de tan solo 30% (con relación a pat de Streptomyces hygroscopicus) para seleccionar cultivos de células vegetales transformadas de las que no están transformadas.

El DSM-2 se identificó a partir de la base de datos de NCBI (véase el sitio web ncbi.nim.nih.gov; n.º de registro AAA26705) como un homólogo con solo 30% de identidad de aminoácidos con pat, y con 28% con bar. El porcentaje de identidad se determinó traduciendo en primer lugar las secuencias de nucleótidos depositadas en la base de datos a proteínas, y después utilizando ClustalW en el paquete informático VectorNTI para realizar el alineamiento de múltiples secuencias.

Ejemplo 2: Optimización de las secuencias para la expresión en plantas y bacterias

2.1 - Antecedentes

Para obtener unos niveles mayores de expersión de los genes heterólogos en plantas, puede preferirse volver a modificar la secuencia que codifica la proteína de los genes de modo que puedan expresarse con más eficacia en céluls vegetales. El maíz es una de las plantas en las que puede preferirse rediseñar la región codificadora de la proteína heteróloga antes de la transformación para aumentar el nivel de expresión del gen y el nivel de proteína codificada en la planta. Por tanto, otra etapa en el diseño de genes que codifican una proteína bacteriana es la remodificación de un gen heterólogo para su expresión óptima, véase Kawabe et al. (2003), “Patterns of Codon Usage Bias in Three Dicot and Four Monocot Plant Species,” Genes Genet. Syst., pp. 343-352; e Ikemura et al.

(1993), “Plant Molecular Biology Labfax”, Croy, ed., Bios Scientific Publishers Ltd., p. 3748), y todas las referencias pertinentes citadas en estas referencias.

Una razón para la remodificación de una proteína bacteriana para su expresión en el maíz, por ejemplo, es por el contenido en G+C no óptimo del gen nativo. Por ejemplo, el contenido muy bajo en G+C de muchos genes bacterianos nativos (y el consiguiente sesgo hacia un contenido alto en A+T) genera secuencias que imitan o duplican las secuencias de control del gen vegetal, que se sabe que tiene un alto contenido en A+T. La presencia de algunas secuencias ricas en A+T dentro del ADN del gen o genes introducidos en las plantas (por ejemplo, regiones de caja TATA que normalmente se encuentran en los promotores de genes) puede producir una expresión aberrante del gen o genes. Por otra parte, la presencia de otras secuencias reguladoras que residen en el ARNm transcrito (por ejemplo, secuencias de señal de poliadenilación (AAUAAA), o secuencias complementarias con ARN nucleares pequeños implicados en el corte y empalme de pre-ARNm) pueden conducir a la inestabilidad del ARN. Por tanto, un objetivo en el diseño de genes que codifican una proteína bacteriana para su expresión en maíz, denominado más preferiblemente gen o genes optimizados en plantas, es generar una secuencia de ADN que tenga un contenido mayor en G+C, y preferiblemente una que se parezca a los genes del maíz que codifican enzimas metabólicas. Otros objetivo en el diseño de un gen o genes optimizados en plantas que codifican una proteína bacteriana es generar un secuencia de ADN en la cual las modificaciones de la secuencia no impidan la traducción.

La tabla 3 ilustra cómo es de alto el contenido en G+C del maíz. Para los datos en la tabla 3, las regiones codificadoras de los genes se extrajeron de las entradas de GenBank (edición 71), y las composiciones de las bases se calcularon empleando el programa MacVectorTM (Accelerys, San Diego, California). No se tomaron en cuenta las secuencias de intrones en los cálculos.

Tabla 3 - Compilación del contenido en G+C de las regiones codificadores de proteínas de genes del maíz Clase de proteínaa % de G+C, intervalo % de G+C, promediob Enzimas metabólicas (76) 44,4-75,3 5,90 ( 8,0) Proteínas estructurales (18) 48,6-70,5 63,6 ( 6,7) Proteínas reguladoras (5) 57,2-68,8 62,0 ( 4,9) Proteínas sin caracterizar (9) 41,5-70,3 64,3 ( 7,2) Todas las proteínas (108) 44,4-75,3 60,8 ( 5,2)c a El número de genes en la clase aparece entre paréntesis.

b Las desviaciones estándar aparecen entre paréntesis.

c No se tomó en cuenta el promedio combinado de los grupos en el cálculo del promedio.

Debido a la plasticidad aportada por la redundancia/degeneración del código genético (es decir, algunos aminoácidos son especificados por más de un codón), la evolución de los genomas en diferentes organismos o clases de organismos ha producido una utilización diferencial de los codones redundantes. Este “sesgo de codones” se refleja en el promedio de la composición de bases de las regiones codificadoras de las proteínas. Por ejemplo, los organismos con un contenido relativamente bajo en G+C utilizan codones que tienen A o T en la tercera posición de los codones redundantes, mientras que los que tienen un mayor contenido en G+C utilizando codones que tienen G o C en la tercera posición. Se cree que la presencia de codones “minoritarios” dentro de un ARNm puede reducir la velocidad de traducción absoluta de ese ARNm, en especial cuando la abundancia relativa del ARNt cargado que corresponde al codón minoritario es baja. Una extensión de esto es que la disminución de la velocidad de traducción por los codones minoritarios individuales sería al menos aditiva para multiples codones minoritarios. Por tanto, los ARNm que tienen un contenido relativamente alto en codones minoritarios tendrán unas correspondientes velocidades bajas de traducción. Esta velocidad se reflejará en los posteriores niveles bajos de proteínas codificadas.

Cuando se modifican genes que codifican una proteína bacteriana para la expresión en el maíz (u otras plantas, tales como algodón, soja, trigo, Brassica/canola, arroz, o más en general para cultivos para aceite, plantas monocotiledóneas, dicotiledóneas y hemicotiledóneas), se determina el sesgo de codones de la planta. El sesgo de codones para el maíz es la distribución estadística de codones que la planta utiliza para codificar sus proteínas, y en la tabla 4 se muestra la utilización de codones preferidas. Después de determinar el sesgo, se determina el porcentaje de frecuencia de los codones en el gen o genes de interés. Deben determinarse los codones principales preferidos por la planta, así como la segunda, tercera y cuarta elección de los codones preferidos cuando existan múltiples opciones. Después puede diseñarse una nueva secuencia de ADN que codifique la secuencia de aminoácidos de la proteína bacteriana, pero la nueva secuencia de ADN se diferencia de la secuencia de ADN bacteriana nativa (que codifica la proteína) por la sustitución de los codones de la planta (el primero preferido, el segundo preferido, el tercero preferido, o el cuarto preferido) para especificar el aminoácido en cada posición dentro de la secuencia de aminoácidos de la proteína. La nueva secuencia después se analiza para los sitios de enzimas de restricción que podrían haberse creado por la modificación. Los sitios identificados se vuelven a modificar sustituyendo los codones por la primera, segunda, tercera o cuarta opción de los codones preferidos. Otros sitios en la secuencia que podrían afectar a la transcripción o la traducción del gen de interés son las uniones de exón:intrón (5’ o 3’), las señales de adición de poliA, o las señales de terminación de ARN polimerasa. La secuencia se vuelve a analizar y modificar para reducir la frecuencia de los dobletes TA o GC. Además de los dobletes, los bloques de secuencias G o C que tienen más de aproximadamente cuatro restos que son iguales pueden afectar a la transcripción de la secuencia. Por tanto, estos bloques también se modifican sustituyendo los codones de la primera o segunda opción, etc., por el siguiente codón preferido.

Tabla 4 - Codones de aminoácidos preferidos para proteínas expresada en el maíz

Aminoácido

Codón*

Alanina GCC/GCG Cisteína TGC/TGT Ácido aspártico GAC/GAT Ácido glutámico GAG/GAA Fenilalanina TTC/TTT Glicina GGC/GGG Histidina CAC/CAT Isoleucina ATC/ATT Lisina AAG/AAA Leucina CTG/CTC Metionina ATG Asparagina AAC/AAT Prolina CCG/CCA Glutamina CAG/CAA Arginina AGG/CGC Serina AGC/TCC Treonina ACC/ACG Valina GTG/GTC Triptófano TGG Tirosina TAC/TAT Fin TGA/TAG Se prefiere que el gen o genes optimizados en plantas que codifican una proteína bacteriana contengan aproximadamente 63% de los codones de primera opción, entre aproximadamente 22% y aproximadamente 37% de los codones de segunda opción, y entre aproximadamente 15% y aproximadamente 0% de los codones de tercera o cuarta opción, siendo el porcentaje total del 100%. Lo más preferido es que el gen o genes optimizados en plantas contengan aproximadamente 63% de los codones de primera opción, al menos aproximadamente 22% de los codones de segunda opción, aproximadamente 7,5% de los codones de tercera opción, y aproximadamente 7,5% de los codones de cuarta opción, siendo el porcentaje total del 100%. El método descrito anteriormente permite a los expertos en la técnica modificar el gen o genes que son extraños para una planta concreta, de modo que los genes se expresen óptimamente en plantas. El método se ilustra más a fondo en la solicitud PCT WO 97/13402.

Así, para diseñar genes optimizados en plantas que codifican una proteína bacteriana, se diseña una secuencia de ADN para que codifique la secuencia de aminoácidos de dicha proteína utilizando un código genético redundante establecido a partir de una tabla de sesgo de codones compilada a partir de las secuencias génicas para la planta o plantas concretas. La secuencia de ADN resultante tiene un grado mayor de diversidad de codones, una composición de bases deseable, puede contener sitios de reconocimiento de enzimas de restricción colocados estratégicamente, y carece de secuencias que puedan interferir con la transcripción del gen o la traducción del producto de ARNm. Así, pueden utilizarse genes sintéticos que sean funcionalmente equivalentes a las proteínas/genes de la presente invención para transformar hospedantes, que incluyen plantas. Pueden encontrarse más instrucciones con respecto a la producción de genes sintéticos, por ejemplo, en la patente de EEUU n.º 5.380.831.

2.2 - Análisis de la reconstrucción de plantas DSM-2

Un análisis profundo de las 513 pares de bases (pb) de la secuencia de ADN de la región codificadora de DSM-2 nativo (SEQ ID NO:1) reveló la presencia de varios motivos de secuencia que se cree que son perjudiciales para la expresión óptima en plantas, así como una composición de codones no óptima. La proteína codificada por SEQ ID NO:1 se presenta en SEQ ID NO:2. Para mejorar la producción de la proteína recombinante en monocotiledóneas y en dicotiledóneas, se desarrolló una secuencia de ADN “optimizada en plantas” DSM-2 v2 (SEQ ID NO:3) que codifica una proteína que es idéntica a la secuencia nativa indicada en SEQ ID NO:2. Por contraste, las secuencias de ADN nativas y optimizadas en plantas de las regiones codificadoras solo son 78,3% idénticas. La tabla 5 muestra las diferencias en las composiciones de codones de las secuencias nativas (columnas A y D) y optimizadas en plantas (columnas B y E), y permite la comparación con una secuencia optimizada en plantas teórica (columnas C y F).

Tabla 5 - Comparaciones de composiciones de codones de las regiones codificadoras de DSM-2 nativo, la versión optimizada en plantas (v2) y una versión optimizada en plantas teórica

A

B

C

D

E

F

Aminoácido

Codón

n.º

n.º opt.

n.º opt. Aminoácido

Codón

n.º

n.º opt.

n.º opt.

nativo

plant.

plant.

nativo

plant.

plant.

v2

teór.

v2

teór.

ALA (A) GCA LEU (L) CTA GCC 14 7 7 CTC 8 GCG 6 CTG 6 GCT 8 8 CTT ARG (R) AGA 2 4 4 TTA AGG 1 TTG 4 4 CGA 1 LYS (K) AAA 1 1 CGC 8 3 3 AAG 3 2 2 CGG 3 MET (M) ATG 1 1 1 CGT 1 4 4 PHE (F) TTC 6 2 4 ASN (N) AAC 2 1 1 TTT 4 2 AAT 1 1 PRO (P) CCA 1 6 6 ASP (D) GAC 7 4 4 CCC 4 3 3 GAT 1 4 4 CCG 8 CYS (C) TGC CCT 1 TGT SER (S) AGC 1 2 2 FIN TAA AGT TAG 1 TCA 1 2 2 TGA 1 1 TCC 4 2 2 GLN (Q) CAA 2 1 TCG 2 CAG 3 1 2 TCT 2 2 GLU (E) GAA 1 6 6 THR (T) ACA 1 2 3 GAG 14 9 9 ACC GLY (G) GGA 2 4 4 ACG 4 GGC 9 4 4 ACT 2 4 GGG 2 2 2 TRP (W) TGG 3 3 3 GGT 1 4 4 TYR (V) TAC 12 7 8 HIS (H) CAC 3 3 TAT 4 CAT 2 2 VAL (V) GTA 1 ILE (I) ATA 1 1 GTC 3 3 ATC 4 2 2 GTG 4 4 4 ATT 1 1 GTT 1 4 4 Totales 88 88 88 Totales 84 84 84 Resulta evidente tras el estudio de la tabla 5 que las regiones codificadoras nativas y optimizadas en plantas, aunque codifican proteínas idénticas, son sustancialmente diferentes entre sí. La versión optimizada en plantas (v1) tiene una composición de codones muy parecida a la de la región codificadora optimizada en plantas teórica que codifica la proteína DSM-2.

Ejemplo 3: Clonación de los vectores de transformación

3.1 - Construcción de plásmidos binarios que contienen DSM-2 (v2)

La secuencia codificadora del gen optimizado para codones DSM-2 (v2) (DASPICO45) se cortó con las enzimas de restricción BbsI (New England Biolabs, Inc., Beverly, MA, n.º de catálogo R0539s) y SacI (New England Biolabs, Inc., n.º de catálogo R0156s). El fragmento resultante se acopló en pDAB7733 en los correspondientes sitios de restricción, NcoI (New England Biolabs, n.º de catálogo R0139s) y SacI. Las colonias positivas se identificaron mediante una digestión con enzimas de restricción. Los clones resutlantes contienen el Rb7 MAR v3//promotor At Ubi10 v2//gen de interés//Atu Orf 1 3′UTR v3. El plásmido que contenía DSM-2 (v2) como gen de interés se denominó pDAB3774.

El módulo Rb7 MAR v3//promotor At Ubi10 v2//gen de interés//Atu Orf 1 3′UTR v3 se clonó en el vector binario pDAB3736 como un fragmento de restricción AgeI (New England Biolabs, n.º de catálogo R0552s). Este modulo se clonó entre los límites izquierdo y derecho del plásmido binario. Las colonias positivas se identificaron mediante una digestión con enzimas de restricción y reacciones de secuenciación. Las construcciones que contenían Rb7 MAR v3//promotor At Ubi10 v2//DSM-2 v2//Atu Orf 1 3′UTR v3 se denominaron pDAB3778.

Una construcción control que contenía el módulo Rb7 MAR v3//promotor At Ubi10 v2//PAT v3//Atu Orf 1 3′UTR v3 se completó eliminando el módulo de destino GateWay attR del pDAB3736. El pDAB3736 se digirió con la enzima de restricción PacI (New England Biolabs, n.º de catálogo R0547s). El PacI flanquea el módulo de destino GateWay attR en pDAB3736. El plásmido digerido con PacI se autoacopló y se transformó en células de Escherichia coli Top10 (Invitrogen, Carlsbad, CA, n.º de catálogo C4040-10). Las colonias positivas se identificaron mediante una digestión con enzimas de restricción y reacciones de secuenciación. La construcción resultante se denominó pDAB3779.

3.2 - Clonación de otras construcciones de transformación

Todas las demas construcciones creadas para la transformación en especies vegetales apropiadas se construyeron empleando procedimientos similares a los previamente descritos en la presente y otros métodos de clonación molecular convencionales (Maniatis et al., 1982). La tabla 6 lista todas las construcciones de transformación empleadas, definiéndose las características y promotores apropiados, así como el cultivo transformado.

ES 2 553 331 T3 Trxn Método agrobinario filamentos filamentos agrobinario agrobinario - - - - Promotor AtUbi10

Zea mays

- - - - (v1) Gen de selección vegetal AAD12 ubiquitina de 2 - - - - - Gen de selección bacteriano = Promotor 1 de E07869044 12-11-2015 Ubi1 Gen de selección bacteriano Zm espectinomicina espectinomicina espectinomicina espectinomicina espectinomicina - - - - - Promotor - - - - - GOI 2

Nicotiana tabacum

cies vegetales 2 RB7 RB7 RB7 RB7 RB7 Caract.

Mar v2 Mar v2 Mar v2 Mar v2 Mar v2 las venas de la mandioca

Nicotiana tabacum

Arabidopsis thaliana

1 - - Caract.

NtOsm NtOsm NtOsm VMV Ubi1 Ubi1 Promotor Cs Zm Zm AtUbi10 AtUbi10 PAT PAT Gen de interés (GOI) DSM2 (v2) DSM2 (v2) DSM2 (v2) en A T T CaVMV = promotor del virus del mosaico de AtUbi10 = promotor 10 de ubiquitina de RB7 Mar v2 = región asociada a la matriz de NtOsm = regiones no traducidas 5’ y 3’ de osmotina de R, Cn R, Cn Especies* transformadas n.º de pDAS 1941 1942 1861 1862 Construcciones utilizadas para la transformación de diversas espe -  

Arabidopsis

Tabla 6 n.º de pDAB 3247 3250 3251 3778 3779 *A = T = Tabaco R = Arroz Cn = Maíz

Ejemplo 4: Complementación de E. coli sensible (BL-21) con DSM-2 (v2) empleando promotores procariotas y eucariotas

4.1 - Construcción de un plásmido de expresión de Escherichia coli que contiene DSM-2 (v2)

La secuencia optimizada para codones DSM-2 (v2) se digirió con las enzimas de restricción BabsI y SacI. El fragmento resultante se clonó en pDAB779 en los correspondientes sitios de resetricción de NcoI y SacI. El pDAB779 es un vector de expresión pET28a(+) (Novagen, Madison, WI, n.º de catálogo 69864-3). Las colonias positivas que contenían la secuencia codificadora del gen DSM-2 (v2) se identificaron mediante una digestión con enzimas de restricción. Las construcciones DSM-2//pET28a(+) se denominaron pDAB4412.

Los plásmidos de expresión pET (control de vector vacío) y pDAB4412 se transformaron en la cepa de expresión de

E. coli T7 BL21-Star (DE3) (Invitrogen, Carlsbad, CA, n.º de catálogo C6010-03) empleando métodos convencionales. Los cultivos de expresión se iniciaron con 10-200 colonias recién transformadas en 250 ml de medio LB que contenía antibiótico 50 g/ml e IPTG (isopropil--D-tiogalatopiranósido) 75 M. Los cultivos se cultivaron a 28 ºC durante 24 horas a 180-200 rpm. Las células se recogieron mediante centrifugación en botellas Nalgene de 250 ml a 3.400 x g durante 10 minutos a 4 ºC. Los sedimentos se suspendieron en 4-4,5 ml de disolución fosfato de Butterfield (Hardy Diagnostics, Santa María, CA, fosfato de potasio 0,3 mM, pH 7,2). Las células suspendidas se transfirieron a tubos de centrífuga de tapón de rosca de polipropileno de 50 ml con 1 ml de esferas de vidrio de 0,1 mm de diámetro (Biospec, Bartlesville, OK, n.º de catálogo 1107901). La mezcla de esferas de vidrio-células se enfrió en hielo, y después las células se lisaron mediante sonicación con dos estallidos de 45 segundos empleando una sonda de 2 mm con un sonificador Branson Sonifier 250 (Danbury, CT) a una salida de aproximadamente 20, enfriando completamente entre estallidos. Los lisados se trasladaron a tubos Eppendorf de 2 ml y se centrifugaron durante 5 minutos a 16.000 x g. Los sobrenadantes se recogieron y se midió la concentración de proteínas. El reactivo de ensayo de tinte de proteínas Bio-Rad Protein Dye Assay Reagent se diluyó 1:5 con H2O y se añadió 1 ml a 10 l de una dilución 1:10 de cada muestra y a albúmina de suero bovina (BSA) a unas concentraciones de 5, 10, 15, 20 y 25 g/ml. Las muestras se leyeron en un espectrofotómetro, leyendo la densidad óptica a la longitud de onda de 595 nm en un espectrofotómetro Shimadzu UV160U (Kioto, Japón). La cantidad de proteína contenida en cada muestra se calculó frente a la curva patrón de BSA y se ajustó entre 3-6 mg/ml con tampón fosfato. Los lisados se ensayaron en un gel de proteínas SDS para visualizar la proteína expresada.

4.2 - Evaluación de las cepas de clonación habituales para la sensibilidad a BASTA

Se inocularon líneas celulares seleccionadas de Escherichia coli y Agrobacterium tumefaciens en medio mínimo que contenía concentraciones crecientes de glufosinato (BASTA). Las líneas celulares BL21-Star (DE3), Top10, DH5, Agrobacterium tumefaciens C58, y Agrobacterium tumefaciens LBA4404s se cultivaron inicialmente en medio complejo. Las cepas de Escherichia coli se cultivaron en LB y las cepas de Agrobacterium tumefaciens se cultivaron en YEP. Se inocularon 5 l de cultivo bacteriano y se dispersaron uniformemente sobre placas de medio mínimo que contenían diversas concentraciones de glufosinato. Las concentraciones consistían en 0 g/ml, 250 g/ml, 500 g/ml, 1000 g/ml, 2000 g/ml y 4000 g/ml de BASTA. Además, las cepas bacterianas se inocularon en una placa de medio complejo como control: las cepas de Agrobacterium tumefaciens se inocularon en placas de agar YEP, y las cepas de Escherichia coli se inocularon en placas de agar LB. Las placas que contenían las cepas de Escherichia coli se incubaron a 37 ºC durante 24 horas. Las placas que contenían Agrobacterium tumefaciens se incubaron a 25 ºC durante 48 horas. Después de los tiempos de incubación asignados, las placas se observaron para el crecimiento bacteriano. La tabla 7 ilustra la capacidad de las diversas cepas para crecer en medio mínimo que contenía glufosinato. Solo la línea celular de la cepa BL21-Star (DE3) fue sustancialmente inhibida por el glufosinato.

Tabla 7 - Respuesta variable al glufosinato de cepas bacterianas cultivadas en medio mínimo Control Control Mín.

Mín.

Mín.

Mín.

Mín.

complejo mínimo BASTA 250 BASTA 500 BASTA BASTA BASTA g/ml g/ml 1000 g/ml 2000 g/ml 4000 g/ml

E. coli Star- +++ +++ - - - - - BL21 (DE3)

E. coli DH5 +++ +++ +++ +++ +++ +++ -

E. coli Top10 +++ +++ +++ +++ +++ + -

Agrobacterium

+++ +++ +++ +++ +++ ++ - C58

Agrobacterium

+++ +++ +++ ++ ++ + - LBA4404s

E. coli fue cultivada durante 24 horas a 37 ºC. Agrobacterium fue cultivada durante 48 horas a 25 ºC. +++ = crecimiento fuerte de césped; ++ = crecimiento ligero de césped; + = crecimiento de parches de césped; - = sin crecimiento

4.3 - Expresión recombinante de DSM-2 (v2) para complementar el crecimiento celular de Escherichia coli BL21-Star (DE3)

Se construyó un plásmido de expresión pET28a(+) que contenía PAT (v3) como control positivo. El PAT (v3) se clonó como un fragmento NcoI-SacI en los correspondientes sitios de restricción de pDAB779. Los clones positivos que contenían el fragmento del gen PAT (v3) se verificaron mediante una digestión con enzimas de restricción. Esta construcción se denominó pDAB4434.

Los plásmidos pDAB4434, pDAB4412 y un vector pET vacío (control) se transformaron en células bacterianas de Escherichia coli BL21-Star (DE3). Los cultivos de expresión se iniciaron con 10-200 colonias recién transformadas en 250 ml de medio LB que contenía antibiótico 50 g/ml e IPTG (isopropil--D-tiogalatopiranósido) 75 M. Los cultivos se cultivaron a 28 ºC durante 24 horas a 180-200 rpm. Se inocularon 5 l del cultivo en un medio complejo control y en medio mínimo que contenía concentraciones crecientes de glufosinato e IPTG 20 M. Los cultivos se dispersaron uniformemente sobre las placas y se incubaron a 28 ºC durante 24 horas. Después de los tiempos de incubación asignados, las placas se observaron para el crecimiento bacteriano. La tabla 8 ilustra estos resultados.

Tabla 8 Control Control Mín.

Mín.

Mín.

Mín.

Mín.

complejo mínimo BASTA 250 BASTA 500 BASTA BASTA BASTA g/ml g/ml 1000 g/ml 2000 g/ml 4000 g/ml Control +++ +++ - - - - - PAT +++ +++ +++ +++ +++ +++ +++ DSM2 +++ +++ +++ +++ +++ +++ +++

E. coli fue cultivada durante 24 horas a 28 ºC con IPTG 20 uM. - = sin crecimiento; +++ = crecimiento evidente de colonias

4.4 - Uso de promotores vegetales para conducir la expresión recombinante de DSM-2 en células de Escherichia coli BL21-Star (DE3)

Construcciones de plásmidos en los que se expresan las secuencias codificadoras de los genes DSM-2 (v2) y PAT, bajo el control de los promotores víricos CsVMV o el promotor vegetal AtUbi10, se ensayaron para la complementación en medio mínimo que contenía glufosinato. Los plásmidos 3778 (Rb7 MARv3//promotor AtUbi10//DSM-2 (v2)//Atu Orf 1 3′UTR), 3779 (Rb7 MARv3//promotor AtUbi10//PAT//Atu Orf 1 3 ′UTR), 3264 (promotor CsVMV//DSM-2//Atu Orf24 3′UTR), 3037 (promotor CsVMV//PAT//Atu Orf 25/26 3′UTR), y 770 (plásmido control que contiene el promotor CsVMV//GUS v3//Atu Orf 24 3′UTR) se transformaron en Escherichia coli BL21-Star (DE3) y se cultivaron en medio complejo. Se cultivaron 5 l de los cultivos en medio mínimo que contenía concentraciones crecientes de glufosinato y se incubaron a 37 ºC durante 48 horas. Los resultados se ilustran en la tabla 9. Estos datos indican que los promotores vegetales y víricos tienen unos niveles moderados de funcionalidad dentro de células bacterianas y pueden utilizarse para conducir la expresión de un marcador seleccionable.

Tabla 9 Control Mín.

Mín.

Mín.

Mín.

Mín.

mínimo BASTA 250 BASTA 500 BASTA BASTA BASTA g/ml g/ml 1000 g/ml 2000 g/ml 4000 g/ml Promotor DSM-2- ++++ ++++ +++ +++ ++ ++ AtUbi10 3778 PAT-3779 ++++ ++++ +++ +++ +++ +++ AHAS-4433 ++++ (+) - - - - Promotor DSM-2- ++++ ++ + - - - CsVMV 3264 PAT-3037 ++++ ++ + - - - GUS-770 ++++ (+) - - - - BL21 ++++ (+) - - - - Control

E. coli fue cultivada durante 48 horas a 37 ºC. ++++ = crecimiento fuerte de césped; +++ = crecimiento de césped; ++ = muchas colonias patentes; + = crecimiento disperso de colonias

Ejemplo 5: Purificación de DSM-2 para la caracterización bioquímica y la producción de anticuerpos para análisis Western

5.1 - Expresión recombinante

Se emplearon células E. coli BL-21 (DE3) Star (obtenidas en Invitrogen, Carlsbad, CA) que portan el gen DSM-2 (v2)

con codones optimizados, en el plásmido pDAB4412, para inocular 3 ml de medio LB suplementado con kanamicina 50 g/ml a 37 ºC durante la noche para la preparación de semillas. Se trasladaron aproximadamente 2 ml de cultivo de siembra a 1 l de LB fresco que contenía kanamicina (50 g/ml) en un matraz Erlenmeyer con hendiduras de 2,8 l. Los cultivos se incubaron a 37 ºC en un agitador (New Brunswick Scientific, modelo Innova 44) a 250 rpm durante aproximadamente 6 horas para obtener una DO600 cercada a 0,8-1,0. Se añadió isopropil--D-1-tiogalactopiranósido (IPTG) hasta una concentración final de 75 M en los cultivos y se continuó incubando a 18 ºC para la inducción durante la noche. Las células se recolectaron mediante una centrifugación a 8.000 rpm a 4 ºC durante 15 min, y la pasta celular se conservó a -80 ºC o se procesó inmediatamente para la purificación.

Se descongelaron aproximadamente 5 g de células de E. coli en peso húmedo procedentes de 1 l de cultivo y se resuspendieron en 300 ml de tampón de extracción que contenía Tris-HCl 20 mM, pH 8,0 y 0,3 ml de cóctel de inhibidores de proteasas (Sigma, n.º de catálogo P8465) y se rompieron sobre hielo durante 15 minutos mediante sonicación. El lisado se centrifugó a 4 ºC a 24.000 rpm durante 20 min, y el sobrenadante se filtró a través de una membrana de 0,8 m y 0,45 m. Todas las posteriores separaciones de proteínas se realizaron empleando un Pharmacia AKTA Explorer 100 y se llevaron a cabo a 4 ºC. El filtrado se aplicó a 10 ml/min a una columna QXL Sepharose Fast Flow (Pharmacia HiPrep 16/10, 20 ml de tamaño del lecho) equilibrada con tampón Tris-HCl 20 mM, pH 8,0. La columna se lavó con este tampón hasta que la DO280 del eluato volvió a la línea de base, las proteínas se eluyeron con 0,5 l de un gradiente lineal de NaCl de 0 a 0,4 M con un caudal de 5 ml/min, y se recogieron fracciones de 5 ml. Se reunieron las fracciones que contenían DSM-2, según se determinó mediante SDS-PAGE con una banda de 20 kDa evidente (el peso molecular previsto de DSM-2 es de 19,3 kDa), que también se corresponden con la actividad conversora de glufosinato. La muestra se diluyó con 4 volúmenes de tampón Tris-HCl 20 mM, pH 7,5, que contenía DTT 5 mM, Triton X-100 al 0,5%, glicerol al 5%, y se volvió a aplicar a una columna Mono Q (Pharmacia 10/100 GL, 8 ml de tamaño de lecho) a 4 ml/min. Las proteínas eluyeron con un gradiente de NaCl 0,1- 0,3 M en el mismo tampón. Se reunió un pico principal que contenía DSM-2 y se añadió sulfato de amonio sólido hasta una concentración final de 1,0 M, y se aplicó a una columna Phenyl Fast Flow (Pharmacia HiTrap, 5 ml de tamaño de lecho) equilibrada en sulfato de amonio 1,0 M en Tris-HCl 20 mM, pH 7,5. Esta columna se lavó con el tampón de equilibrio a 4 ml/min hasta que la DO280 del eluato volvió a la línea de base, después las proteínas eluyeron en 50 min (3 ml/min) mediante un gradiente lineal de sulfato de amonio 1,0 M a 0 en Tris-HCl 20 mM, pH 7,5, y se recogieron fracciones de 3 ml. Se reunieron las fracciones del pico principal que contenían DSM-2 eluidas a 75 mS/cm y se concentraron hasta aproximadamente 3 mg/ml empleando un dispositivo de filtro centrífugo de membrana de valor de corte de peso molecular de 10 kDa (Millipore). La muestra después se aplicó a una columna de filtración en gel Superdex 75 (Pharmacia XK 16/60, 110 ml de tamaño de lecho) con tampón PBS a un caudal de 1 ml/min. Se reunieron las fracciones del pico que contenían DSM-2 pura y se conservaron a -80 ºC. Se determinó la concentración de proteínas mediante un ensayo Bradford o un análisis de aminoácidos totales empleando albúmina de suero bovina como patrón. Se midió la actividad de la DSM-2 purificada basándose en un procedimiento convencional para el ensayo de la fosfinotricina acetil transferasa (PAT) (Wehrmann et al., 1996).

5.2 - Producción de anticuerpos

Se produjo un anticuerpo policlonal de conejo contra DSM-2 utilizando los protocolos convencionales para anticuerpos policlonales de conejo proporcionados por Invitrogen Antibody Services (South San Francisco, CA, n.º de catálogo M0300). La DSM-2 purificada y expresada en E. coli (véase la sección previa) fue suministrada como inmunógeno. Brevemente, dos conejos de Nueva Zelanda se inyectaron por vía subcutánea (SQ) con 1 mg de proteína DSM-2 emulsionada con 0,25 mg de hemocianina de lapa y adyuvante de Freund incompleto (IFA). Los conejos se dejaron reposar durante 2 semanas y se les suministró una inmunización de refuerzo SQ tres veces con 0,5 mg de proteína DSM-2 emulsionada en IFA con un periodo de descanso de tres semanas entre cada una. Dos semanas después del refuerzo final se recogió el suero de cada conejo y se ensayó con un ELISA directo para la titulación (los datos no se muestran). Se realizaron dos refuerzos más y un sangrado final (Invitrogen, n.º de catálogo M0311 y M0313) en el conejo n.º 2, que mostró una mejor titulación de anticuerpos específicos.

5.3 - Análisis de la transferencia Western

Se colocaron aproximadamente 100 mg de tejido de callo en un tubo de microcentrífuga de 2 ml que contenía esferas BB de acero inoxidable. Se añadieron 250 l de tampón de extracción (disolución salina tamponada con fosfato que contiene Triton X-100 l 0,1%, DTT 10 mM y 5 l por ml de cóctel de inhibidores de proteasas) y los tubos se sujetaron en un Geno/Grinder (modelo 2000-115, Certiprep, Metuchen, NJ) y se agitaron durante 6 min con un ajuste de 1x de 500 rpm. Los tubos se centrifugaron a 10.000 x g durante 10 min, y el sobrenadante que contenía las proteínas solubles se pipeteó en tubos separados y se conservó en hielo. El sedimento se extrajo por segunda vez según se describió anteriormente, y el sobrenadante se reunió con la fracción previa y se ensayó.

Las proteínas extraídas de las muestras de plantas se desnaturalizaron en tampón Laemmli y se incubaron a 95 ºC durante 10 min. Las proteínas desnaturalizadas se separaron en geles premoldeados de Tris-glicina al 8-16% Novex (Invitrogen, n.º de catálogo EC60452BOX) según el protocolo del fabricante, seguido de una transferencia sobre una membrana de nitrocelulosa utilizando el protocolo convencional.

Todas las etapas de incubación de la transferencia Western se realizaron a temperatura ambiente durante una hora.

La transferencia primero se bloqueó en PBS que contenía leche al 4% (PBSM) y después se incubó con anticuerpo policlonal de conejo específico de DSM-2 (véase el anterior párrafo) diluido 5000 veces en PBSM. Después de tres lavados de 5 min en PBS que contenía Tween-20 al 0,05% (PBST), el conjugado de anticuerpo anti-conejo de cabra/peroxidasa de rábano se incubó sobre la tranferencia. Las proteínas detectadas se visualizaron empleando un sustrato quimioluminiscente (Pierce Biotecnology, Rockford, IL, n.º de catálogo 32106) y una exposición a una película de rayos X.

Ejemplo 6: Transforamción en Arabidopsis y selección

6.1 - Condiciones de crecimiento de Arabidopsis thaliana

Se suspendieron semillas de Arabidopsis de tipo salvaje en una disolución de agarosa al 0,1% (Sigma Chemical Co., St. Louis, MO). Las semillas suspendidas se conservaron a 4 ºC durante 2 días para cumplir los requisitos de latencia y asegurar una germinación sincrónica de las semillas (estratificación).

Se cubrio el sustrato Sunshine Mix LP5 (Sun Gro Horticulture, Bellevue, WA) con vermiculita fina y se subirrigó con disolución de Hoagland hasta que se humedeció. Se dejó que la mezcla de tierra drenase durante 24 horas. Las semillas estratificadas se sembraron sobre la vermiculita y se cubrieron con cúpulas para conservar la humedad (KORD Products, Bramalea, Ontario, Canadá) durante 7 días.

Las semillas germinaron y las plantas se cultivaron en un Conviron (modelos CMP4030 y CMP3244, Controlled Environments Limited, Winnipeg, Manitoba, Canadá) bajo condiciones de día largo (16 horas de luz/8 horas de oscuridad) con una intensidad lumínica de 120-150 mol/m2sg con una temperatura (22 ºC) y humedad (40-50%) constantes. Las plantas inicialmente se regaron con disolución de Hoagland y después con agua desionizada para mantener la tierra húmeda pero no empapada.

6.2 - Transformación con Agrobacterium

Se utilizó una placa de agar LB+ con eritromicina (Sigma Chemical Co., St. Louis, MO) (200 mg/l) o espectinomicina (100 mg/l) que contenía una colonia DH5 sembrada en estrías para proporcionar una colonia para inocular 4 ml de cultivos miniprep (líquido LB + eritromicina). Los cultivos se incubaron durante la noche a 37 ºC con agitación constante. Se empleó Spin Mini Preps de Qiagen (Valencia, CA), manipulados según las instrucciones del fabricante, para purificar el ADN plasmídico.

Se prepararon células de Agrobacterium tumefaciens (cepas Z707x, EHA101s, y LBA4404s) electrocompetentes utilizando un protocolo de Weigel y Glazebrook (2002). Las células de Agrobacterium competentes se transformaron utilizando un método de electroporación adaptado de Weigel y Glazebrook (2002). Se descongelaron sobre hielo 50 l de células de Agrobacterium competentes y se añadieron 10-25 ng del plásmido deseado a las células. La mezcla de células y ADN se añadió a cubetas de electroporación preenfriadas (2 mm). Se empleó un electroporador Eppendorf 2510 para la transformación con las siguientes condiciones: voltaje, 2,4 kV, longitud de pulso: 5 msg.

Después de la electroporación, se añadió 1 ml de caldo de cultivo YEP (por litro: 10 g de extracto de levadura, 10 g de bacto-peptona, 5 g de NaCl) a la cubeta, y la suspensión de células-YEP se trasladó a un tubo de cultivo de 15 ml. Las células se incubaron a 28 ºC en un baño de agua con agitación constante durante 4 horas. Después de la incubación, el cultivo se cultivó en placa con YEP+agar con eritromicina (200 mg/l) o espectinomicina (100 mg/l) y estreptomicina (Sigma Chemical Col, St. Louis, MO) (250 mg/l). Las placas se incubarón durante 2-4 días a 28 ºC.

Las colonias se seleccionaron y se cultivaron en estrías sobre placas de YEP+agar fresco con eritromicina (200 mg/l) o espectinomicina (100 mg/l) y estreptomicina (250 mg/l) y se incubaron a 28 ºC durante 1-3 días. Las colonias se seleccionaron para el análisis de PCR para verificar la presencia del gen insertado utilizando cebadores específicos de vector. Se emplearon Qiagen Spin Mini Preps, manipulados según las instrucciones del fabricante, para purificar el ADN plasmídico de las colonias de Agrobacterium seleccionadas con la siguiente excepción: se emplearon partes alícuotas de 4 ml de un cultivo miniprep de 15 ml realizado durante la noche (líquido YEP+eritromicina (200 mg/l) o espectinomicina (100 mg/l) y estreptomicina (250 mg/l)) para la purificación del ADN. Una alternativa a la utilización de ADN de Qiagen Spin Mini Prep es lisar las células de Agrobacterium

transformadas, suspendidas en 10 l de agua, a 100 ºC durante 5 minutos. El ADN plasmídico del vector binario utilizado en la transformación de Agrobacterium se incluyó como control. La reacción de PCR se completó utilizando ADN polimerasa Taq de Takar Mirus Bio Inc. (Madison, Wisconsin) según las instrucciones del fabricante a 0,5x concentraciones. Las reacciones de PCR se realizaron en un termociclador MJ Research Peltier Thermal Cycler programadao con las siguientes condiciones: 1) 94 º C durante 3 minutos, 2) 94 ºC durante 45 segundos, 3) 55 ºC durante 30 segundos, 4) 72 ºC durante 1 minuto, realizándose 29 ciclos y después 1 ciclo de 72 ºC durante 10 minutos. La reacción se mantuvo a 4 ºC después de la ciclación. La amplificación se analizó mediante una electroforesis en gel de agarosa al 1% y se visualizó mediante tinción con bromuro de etidio. Se seleccionó una colonia cuyo producto de la PCR era idéntico al control de plásmido.

6.3 - Transformación de Arabidopsis

Se transformó Arabidopsis empleando el método de inmersión floral. La colonia seleccionada se empleó para inocular uno o más precultivos de 15-30 ml de caldo de cultivo YEP que contenía eritromicina (200 mg/l) o espectinomicina (100 mg/l) y estreptomicina (250 mg/l). El cultivo o cultivos se incuban durante la noche a 28 ºC con agitacion constante a 220 rpm. Cada precultvo se empleó para inocular dos cultivos de 500 ml de caldo de cultivo YEP que contenía eritromicina (200 mg/l) o espectinomicina (100 mg/l) y estreptomicina (250 mg/l), y los cultivos se incubaron durante la noche a 28 ºC con agitación constante. Las células después se sedimentaron a aproximadamente 8700x g durante 10 minutos a temperatua ambiente, y el sobrenadante resultante se rechazó. El sedimento celular se resuspendió con suavidad en 500 ml de medio de infiltración que contenía 1/2x sales de Murashige y Skoog/vitaminas B5 de Gamborg, sacarosa al 10% (en p/v), bencilaminopurina 0,044 M (10 l/litro de una disolución madre 1 mg/ml en DMSO) y Silwet L-77 300 l/litro. Se sumergieron plantas de aproximadamente 1 mes en el medio durante 15 segundos, asegurándose de sumergir la inflorescencia más reciente. Las plantas después se tumbaron y se cubrieron (bajo una cubierta transparente u opaca) durante 24 horas, después se lavaron con agua y se colocaron en posición vertical. Las plantas se cultivaron a 22 ºC con un fotoperiodo de 16 horas de luz/8 horas de oscuridad. Aproximadamente 4 semanas después de la inmersión se recolectaron las semillas.

6.4 - Selección de las plantas transformadas

Las semillas T1 recién recolectadas (gen DSM-2 (v2)) se dejaron secar durante 7 días a temperatura ambiente. Las semillas T1 se plantaron en bandejas de germinación de 26,5 x 51 cm (T.O. Plastics, Inc., Clearwater, MN), y cada una recibió una parte alícuota de 200 mg de semillas T1 estratificadas (aproximadamente 10.000 semillas) que previamente se habían suspendido en 40 ml de disolución de agarosa al 0,1%, y se conservaron a 4 ºC durante 2 días para completar los requisitos de latencia y asegurar una germinación sincrónica de las semillas.

Se cubrio el sustrato Sunshine Mix LP5 (Sun Gro Horticulture, Bellevue, WA) con vermiculita fina y se subirrigó con disolución de Hoagland hasta que se humedeció, y después se dejó que drenase por gravedad. Cada parte alícuota de 40 ml de semillas estratificadas se sembró uniformente sobre la vermiculita con una pipeta y se cubrió con cúpulas para conservar la humedad (KORD Products, Bramalea, Ontario, Canadá) durante 4-5 días. Las cúpulas se retiraron 1 día antes de la selección inicial de los transformantes empleando un pulverizado después del brote de 2,4-D (seleccionado para el gen AAD-12 cotransformado, véase el documento USSN 60/731.044).

Siete días después de plantar (DAP) y de nuevo en 11 DAP, las plantas T1 (etapa de cotiledón y de 2-4 hojas, respectivamente) fueron pulverizadas con una disolución al 0,016% del herbicida 2,4-D (456 g ae/l de 2,4-D amina 4, Dow AgroSciences LLC, Indianápolis, IN) con un volumen de pulverizado de 10 ml/bendeja (703 l/ha) empleando una boquilla de pulverización de aire comprimido DeVilbiss para administrar una proporción eficaz de 50 g ae/ha de 2,4-D DMA por aplicación. Los supervivientes (las plantas con crecimiento activo) se identificaron 4-7 días después de la pulverización final y se transplantaron individualmente a macetas de 7,62 cm (3 pulgadas) con medio para macetas (Metro Mix 360). Las plantas transplantadas se cubrieron con cúpulas para conservar la humedad durante 3-4 días y se colocaron en una cámara de crecimiento a 22 ºC como antes o se trasladaron directamente al invernadero. Las cúpulas después se retiraron y las plantas se criaron en el invernadero (22  5 ºC, HR 50  30%, 14 h de luz:10 de oscuridad, mínimo de 500 E/m2s1 luz natural + suplementaria) al menos 1 día antes para ensayar la capacidad de DSM-2 (v2) para proporcionar resistencia al herbicida glufosinato.

Después las plantas T1 fueron asignadas aleatoriamente a diversas proporciones de glufosinato. Para Arabidopsis, 140 g ai/ha de glufosinato es una dosis eficaz para distinguir las planta sensibles de las plantas con niveles significativos de resistencia. También se aplicaron unas proporciones elevadas para determinar los niveles relativos de resistencia (280, 560 o 1120 g ai/ha). La tabla 10 muestra las comparaciones extraídas con un gen de resistencia al herbicida ariloxialcanoato (AAD-12 v1), véase el documento USSN 60/731.044.

Todas las aplicaciones del herbicida glufosinato fueron aplicadas con un pulverizador de bandejas con un volumen de pulverizacion de 187 l/ha. Se empleó la formulación del mercado Liberty (200 g ai/l, Bayer Crop Science, Research Triangle Park, NC). Las plantas T1 que mostraron tolerancia al glufosinato se volvieron a estudiar en la generación T2.

6.5 - Resultados de la selección de las plantas transformadas

Las primeras transformaciones de Arabidopsis se realizaron utilizando DSM-2 (v2) (gen optimizado en plantas). Los transformantes T1 primero se seleccionaron a partir del fondo de las semillas no transformadas utilizando un esquema de selección de 2,4-D DMA. Se seleccionaron más de 100.000 semillas T1 y se identificaron 260 plantas resistentes a 2,4-D (gen AAD-12), que equivale a una frecuencia de transformación/selección del 0,26%, que es ligeramente mayor que el intervalo normal de frecuencia de selección de construcciones en las que se emplea AAD-

12 + 2,4-D para la selección. La plantas T1 seleccionadas anteriormente se transplantaron después a macetas individuales y se pulverizaron con diversas proporciones del herbicida comercial glufosinato. La tabla 10 compara la respuesta de DSM-2 (v2) y los genes control para impartir resistencia al glufosinato a transformantes T1 de

Arabidopsis. La respuesta se presenta en términos de porcentaje de lesiones visibles 2 WAT. Los datos se presentan como un histograma de individuos que muestran pocas o ninguna lesión (<20%), lesiones moderadas (20- 40%), o lesiones graves (>40%). Puesto que cada T1 es un acontecimiento de transformación independiente, se puede esperar una significativa variación en las respuestas T1 individuales dentro de una proporción concreta. Se presenta un promedio aritmético y una desviación estándar para cada tratamiento. El Arabidopsis de tipo salvaje no transformado actúa como control sensible al glufosinato. El gen DSM-2 (v2) imparte resistena al herbicida a plantas de Arabidopsis T1 individuales. Dentro de un tratamiento concreto, el nivel de respuesta de las plantas varía mucho y puede atriburise al hecho de que cada planta representa un acontecimiento de transformación independiente. Es importante advertir que, por encima de 140 g ai/ha de glufosinato, existen individuos que no se vieron afectados, mientras que otros fueron gravemente afectados. En la tabla 10 se presenta la proporción del promedio global de lesiones en la población, simplemente para demostrar la diferencia significativa entre las plantas transformadas con DSM-2 (v2) frente al tipo salvaje o a los controles transformados con AAD-12 + PAT. Muchos individuos DSM-2 (v2) sobrevivieron a 1.120 g ai/ha de glufosinato con pocas o ninguna lesión.

Tabla 10 - Respuesta de Arabidopsis T1 transformado con DSM-2 (v2) (optimizado en plantas) a una gama de proporciones de glufosinato aplicado después de la emergencia comparado con plantas de tipo salvaje y T1 AAD-12

+ PAT

gen DSM-2 (V2) + AAD-12

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar 0 g ai/ha de glufosinato 0,0 0,0 140 g ai/ha de glufosinato 0,0 0,0 280 g ai/ha de glufosinato 19 1 3,0 5,0 560 g ai/ha de glufosinato 19 1 6,0 22,0 1120 g ai/ha de glufosinato 17 1 2 13,0 19,0

Control de tipo salvaje

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar 0 g ai/ha de glufosinato 0,0 0,0 140 g ai/ha de glufosinato 98,0 5,0 280 g ai/ha de glufosinato 100,0 0,0 560 g ai/ha de glufosinato 100,0 0,0 1120 g ai/ha de glufosinato 100,0 0,0

Gen PAT + AAD-12

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar 0 g ai/ha de glufosinato 0,0 0,0 140 g ai/ha de glufosinato 0,0 0,0 280 g ai/ha de glufosinato 0,0 0,0 560 g ai/ha de glufosinato 0,0 0,0 1120 g ai/ha de glufosinato 3,0 3,0

6.6 - DSM-2 (v2) como marcador seleccionable

Se analizó la capacidad para emplear DSM-2 (v2) como marcador seleccionable empleando glufosinato como agente de selección con Arabidopsis transformado según se describó anteriormente. Se mezclaron aproximadamente 100 semillas de Arabidopsis de la generación T1 (100-150 semillas) que contenían DSM-2 (v2) o 2 mg de plantas T5 homocigóticas que contenían PAT, en aproximadamente 10.000 semillas de tipo salvaje (sensibles). Cada bandeja de plantas recibió dos programas de aplicación de 280 g ai/ha de glufosinato en los siguientes tiempos de tratamiento: 7 DAP y 11 DAP. Los tratamientos se aplicaron con una boquilla de pulverización DeVilbiss como se ha descrito previamente. Se sembraron 2 mg más de semillas de Arabidopsis de la generación T1 y no se pulverizaron para servir como recuento de comparación. Las plantas se identificaron como resistentes o sensibles en 17 DAP. Los recuentos entre las plantas tratadas y no tratadas demostraron ser similares, como se observa en la tabla 11. Estos resultados indican que DSM-2 (v2) puede utilizarse de modo eficaz como un marcador seleccionable alternativo para una población.

Tabla 11 - Masa de semillas sembradas y recuento del número de plantas que han sobrevivido tras un tratamiento con 280 g ai/ha de glufosinato Tratamiento Masa de tipo Masa de PAT

Masa de DSM-2

n.º de plantas supervivientes después salvaje plantada plantada

(v2) plantada de la pulverización con glufosinato 1 200 mg 0 mg 0 mg 2 0 mg 2 mg 0 mg 154 3 200 mg 2 mg 0 mg 121 4 0 mg 0 mg 2 mg 117 200 mg 0 mg 2 mg 121

6.7 - Análisis molecular

6.7.1 - Recolección del ADN del tejido, aislamiento y cuantificación Xl

Se coloca tejido fresco en tubos y se liofiliza a 4 ºC durante 2 días. Después de secar completamente el tejido, se coloca una esfera de wolframio (Heavy Shot) en el tubo y las muestras se someten a 1 min de trituración en seco utilizando un molino de bolas Kelco. Entonces se sigue el procedimiento de aislamiento de ADN DNeasy convencional (Quiagen, DNeasy 69109). Después, una parte alícuota del ADN extraído se tiñe con Pico Green (Molecular Probes P7589) y se lee en un fluorómetro (longitud de onda 485/530, BioTek) con patrones conocidos para obtener la concentración en ng/l.

6.7.2 - Análisis del ensayo Invader Xl

Las muestras de ADN se diluyen hasta 0,7 ng/l y después se desnaturalizan mediante una incubación en un termociclador a 95 ºC durante 10 minutos. Después se prepara la mezcla de reacción del ensayo Invader siguiendo el procedimiento en formato de 96 pocillos publicado por Third Wave Technologies. Se dispersan 7,5 l de la mezcla de reacción preparada en cada pocillo de una placa de 96 pocillos, seguido de una parte alícuota de 7,5 l de controles y 0,7 ng/l de muestras desconocidas desnaturalizadas y diluidas. Cada pocillo se cubre con 15 l de aceite mineral (Sigma). Las placas después se incuban a 63 ºC durante 1 hora y se leen en un fluorómetro (Biotek). El cálculo de la proporción de la señal frente al fondo para la sonda diana (longitud de onda del tinte FAM 560/620) dividida entre la proporción de la señal frente al fondo para la sonda de control interno (longitud de onda del tinte RED 485/530) produce la proporción. Después la proporción se empleó para determinar la cigosidad del acontecimiento.

6.8 - Heredabilidad

Una variedad de acontecimientos T1 se autopolinizó para producir semillas T2. Estas semillas son la progenie ensayada mediante la aplicación de glufosinato (200 g ai/ha) a 100 descendientes T2 aleatorios. Cada planta T2 individual se transplantó en macetas cuadradas de 7,62 cm (3 pulgadas) antes de la aplicación del pulverizado (pulverizador de pista con una velocidad de aplicación de 187 l/ha). Se segregó 63% de las familias T1 (plantas T2) en el modelo previsto de 3 resistentes:1 sensible para un único locus de herencia dominante con herencia mendeliana, según se determina mediante el análisis de Chi cuadrado (P > 0,05).

Se realizó el ensayo Invader para la cigosidad en 16 plantas seleccionadas al azar de cada una de las líneas que segregaron como un único locus. Se recogieron semillas de los invidividuos T2 determinados como homocigóticos por Invader (semillas T3). Se ensayó la progenie de 25 descendientes T3 de cada una de las cuatro familias T2 determinadas como homocigóticas mediante Invader, tal como se describió previamente. Todas las familias T2 que se predijo que serían homocigóticas (poblaciones no segregantes) fueron no segregantes. Estos datos demuestran que DSM-2 (v2) se integra de forma estable y se hereda de una manera mendeliana hasta al menos tres generaciones.

Ejemplo 7: Transformación mediada por filamentos del maíz utilizando el herbicida Herbiace

7.1 - Clonación de DSM-2 (v2)

El gen DSM-2 (v2) se escindió del vector DASPICO45 como un fragmento BbsI/SacI. Este se acopló direccionalmente en el vector pDAB3812 cortado de modo similar que contenía el promotor de monocotiledóneas ZmUbi1. Los dos fragmentos se acoplaron utilizando ADN ligasa de T4 y se transformaron en células DH5. Se realizaron minipreps en las colonias resultantes utilizando el kit de miniprep QUIASpin de Qiagen, y las colonias de digirieron para comprobar la orientación. La construcción final se denominó pDAB3250, y contiene ZmUbi1/DSM-2 (v2)/ZmPer5. Se construyó un vector control idéntico que contenía el gen PAT, como se indicó anteriormente. Esta construcción se denominó pDAB3251.

7.2 - Iniciación del callo/suspensión

Para obtener embriones inmaduros para la iniciación del cultivo del callo se realizaron cruzamientos F1 entre los progenitores A y B Hi-II cultivados en invernadero (Armstrong et al., 1991). Cuando los embriones alcanzaron un tamaño de 1,0-1,2 mm (aproximadamente 9-10 días después de la polinización), se recolectaron las espigas y se esterilizó su superficie lavando con el jabón Liqui-Nox, se sumergieron en etanol al 70% durante 2-3 minutos, y después se sumergieron en lejía comercial al 20% (hipoclorito de sodio al 0,1%) durante 30 minutos.

Las espigas se enjuagaron en agua estéril destilada, y los embriones cigóticos inmaduros se cortaron asépticamente y se cultivaron en medio 15Ag10 (medio N6 (Chu et al., 1975), 2,4-D 1,0 mg/l, sacarosa 20 g/l, hidrolizado de caseína 100 mg/l (digestión enzimática), L-prolina 25 mM, AgNO3 10 mg/l, Gelrite 2,5 g/l, pH 5,8) durante 2-3 semanas con el escutelo en dirección contraria al medio. El tejido que mostró la morfología apropiada (Welter et al., 1995) se trasladó selectivamente cada dos semanas a medio 15Ag10 fresco durante aproximadamente 6 semanas, y después se trasladó a medio 4 (medio N6, 2,4-D 1,0 mg/l, sacarosa 20 g/l, hidrolizado de caseína 100 mg/l (digestión enzimática), L-prolina 6 mM, Gelrite 2,5 g/l, pH 5,8) cada dos semanas durante aproximadamente 2 meses.

Para iniciar los cultivos en suspensión embriogénicos, se añadió aproximadamente 3 ml de hematocrito (PCV) de tejido de callo procedente de un único embrión, a aproximadamente 30 ml de medio líquido H9CP+ (mezcla de sal basal MS (Murashige y Skoog, 1962), vitaminas MS modificadas que contenían 10 veces menos ácido nicotínico y 5 veces más tiamina-HCl, 2,4-D 2,0 gm/l, ácido -naftalenacético (NAA) 2,0 gm/l, sacarosa 30 g/l, hidrolizado de caseína 200 gm/l (digestión ácida), mioinositol 100 mg/l, L-prolina 6 mM, agua de coco al 5% en v/v (añadida justo antes del subcultivo), pH 6,0). Los cultivos en suspensión se mantuvieron en condiciones de oscuridad en matraces Erlenmeyer de 125 ml en un agitador de temperatura controlada ajustado a 125 rpm a 28 ºC. Las líneas celulares generalmente se establecieron en 2 a 3 meses después de la iniciación. Durante el establecimiento, las suspensiones se subcultivaron cada 3,5 días añadiendo 3 ml de PCV de células y 7 ml de medio acondicionado a 20 ml de medio líquido H9CP+ fresco utilizando una pipeta de orificio ancho. Cuando el tejido comenzó a duplicar su crecimiento, las suspensiones se transformaron de escala y se mantuvieron en matraces de 500 ml, tras lo cual se trasladaron 12 ml de PCV de células y 28 ml de medio acondicionado a 80 ml de medio H9CP+- Después de que la suspensiones se hubieran establecido se crioconservaron para un uso futuro.

7.3 - Crioconservación y descongelación de la suspensiones

Dos días después del subcultivo se añadieron 4 ml de PCV de células en suspensión y 4 ml del medio acondicionado a 8 ml de crioprotector (disuelto en medio H9CP+ sin agua de coco, glicerol 1 M, DMSO 1 M, sacarosa 2 M, esterilizado mediante filtración) y se dejó en agitación a 125 rpm a 4 ºC durante 1 hora en un matraz de 125 ml. Después de una hora se añadieron 4,5 ml a un criovial Corning de 5,0 ml enfriado. Tras haber sido llenados, los viales individuales se mantuvieron durante 15 minutos a 4 ºC en una nevera de velocidad de enfriamiento controlada, después se dejaron congelar a una velocidad de -0,5 ºC/minuto hasta que alcanzaron una temperatura final de -40 ºC. Después de alcanzar la temperatura final, los viales se trasladaron a cajas dentro de rejillas en el interior de una unidad de conservación Cryoplus 4 (Forma Scientific) rellena de vapores de nitrógeno íquido.

Para la descongelación, los viales se retiraron de la unidad de conservación y se colocaron en un recipiente de hielo seco cerrado, y después se introdujeron en un baño de agua mantenido a 40-45 ºC hasta que finalizó la “ebullición”.

Tras haber sido descongelado, el contenido se vertió sobre un apilamiento de aproximadamente 8 papeles de filtro Whatman de 70 mm estériles (n.º 4) en placas Petri de 100 x 25 mm cubiertas. Se dejó que el líquido se absorbiese hacia el interior de los filtros durante varios minutos, después el filtro superior que contenía las células se trasladó a medio GN6 (medio N6, 2,4-D 2,0 gm/l, sacarosa 30 g/l, Gelrite 2,5 g/l, pH 5,8) durante 1 semana. Después de esta semana, solo el tejido con una morfología prometedora fue retirado del papel de filtro directamente sobre medio GN6 fresco. Este tejido se subcultivó cada 7-14 días hasta que se obtuvieron de 1 a 3 gramos para el inicio de la suspensión en aproximadamente 30 ml de medio H9CP+ en matraces Erlenmeyer de 125 ml. Se subcultivaron 3 mililitros de PCV en medio H9CP+ fresco cada 3,5 días hasta que se obtuvo un total de 12 ml de PCV, y en este momento se realizó el subcultivo, tal como se describió previamente.

Aproximadamente 24 horas antes de la transformación, se subcultivaron 12 ml de PCV de células en suspensión de maíz embriogénicas previamente crioconservadas más 28 ml de medio acondicionado, en 80 ml de medio líquido GN6 (medio GN6 sin Gelrite) en un matraz Erlenmeyer de 500 ml, y se colocó en un agitador a 125 rpm a 28 ºC. Esto se repitió 2 veces utilizando la misma línea celular, de modo que se distribuyó un total de 36 ml de PCV en 3 matraces. Después de 24 horas, el medio líquido GN6 se retiró y se sustituyó por 72 ml de medio osmótico GN6 S/M (medio N6, 2,4-D 2,0 mg/l, sacarosa 30 g/l, sorbitol 45,5 g/l, manitol 45,5 g/l, mioinositol 100 mg/l, pH 6,0) por matraz para plasmolizar las células. Los matraces se colocaron en un agitador en la oscuridad durante 30-35 minutos, y durante este tiempo se preparó una suspensión de 50 mg/ml de filamentos de carburo de silicio añadiendo el volumen apropiado de medio líquido GN6 S/M a aproximadamente 405 mg de filamentos de carburo de silicio sometidos a autoclave (Advanced Composite Materials, Inc.).

Después de una incubación en GN6 S/M, el contenido de cada matraz se vertió en una botella de centrífuga de 250 ml. Después de que las células se hubieran sedimentado en el fondo, todo el líquido GN6 S/M excepto aproximadamente 14 ml se extrajo y se recogió en un matraz de 1 l estéril para un uso futuro. La suspensión prehumedecida de filamentos se agitó en vórtice durante 60 segundos a velocidad máxima y se añadieron 8,1 ml a la botella, añadiéndose también 170 g de ADN como etapa final. La botella se colocó inmediatamente en un mezclador de pintura comercial Red Devil 5400 y se agitó durante 10 segundos. Después de la agitación, el cóctel de células, medio, filamentos y ADN se añadió al contenido del matraz de 1 l, junto con 125 ml de medio líquido GN6 fresco para reducir el osmotizante. Se dejó que las células se recuperasen en un agitador durante 2 horas antes de filtrarse en un papel de filtro Whatman n.º 4 (5,5 cm) utilizando una unidad de recolección de células de vidrio que estaba conectada a una línea de vacío del laboratorio.

Se pipetearon aproximadamente 6 ml de suspensión dispersada sobre la superficie del filtro a medida que se producía el vacío. Los filtros se colocaron en placas de 60 x 20 mm de medio GN6. Las placas se cultivaron durante 1 semana a 28 ºC en una caja oscura.

Después de una semana, 20 papeles de filtro se trasladaron a placas de 60 x 20 mm de medio GN6 (1 Herbiace), 20 papeles de filtro se trasladaron a placas de 60 x 20 mm de medio GN6 (2 Herbiace), y 20 papeles de filtro se trasladaron a placas de 60 x 20 mm de medio GN6 (4 Herbiace) (medio N6, 2,4-D 2,0 mg/l, sacarosa 30 g/l, mioinositol 100 mg/l, bialafós 1, 2 o 4 mg/l (de Herbiace), y Gelrite 2,5 g/l, pH 5,8). Las placas se colocaron en cajas y se cultivaron durante otra semana más.

Después de otra semana, todos los papeles de filtro se trasladaron a las mismas concentraciones de medio GN6 + Herbiace (1H, 2H y/o 4H) de nuevo. Las placas se colocaron en cajas y se cultivaron durante otra semana más.

Tres semanas después de la transformación, el tejido fue embebido raspando la mitad de las células de la placa sobre 3,0 ml de medio de agarosa GN6 fundido (medio N6, 2,4-D 2,0 mg/l, sacarosa 30 g/l, mioinositol 100 mg/l, agarosa Sea Plaque 7 g/l, pH 5,8, sometido a autoclave solo durante 10 minutos a 121 ºC) que contenía bialafós 1, 2 o 4 mg/l de Herbiace. El tejido se disoció y 3 ml de agarosa y tejido se vertió uniformemente sobre la superficie de una placa de 100 x 15 mm de GN6 (1H, 2H o 4H), dependiendo de la concentración en la que las células fueron cultivadas originariamente. Esto se repitió con la otra mitad de las células de cada placa. Tras haber sido embebidas, las placas se sellaron individualmente con Nescofilm o Parafilm M, y después se cultivaron durante aproximadamente 4 semanas a 28 ºC en cajas oscuras.

7.4 - Protocolo para la regeneración de plantas

Los aislados putativamente transformados generalmente son visibles a las 5-8 semanas después de la transformación. Cualquier aislado potencial se retira de la placa embebida y se traslada a medio de selección fresco a la misma concentración en placas de 60 x 20 mm. Si resulta evidente un crecimiento sostenido después de aproximadamente 2 semanas, se considera que el acontecimiento es resistente. Después un subconjunto de los acontecimientos resistentes se somete a un análisis molecular.

La regeneración se inicia trasladando tejido de callo a un medio de inducción basado en citoquinas, 28 (1H), que contiene sales MS y vitaminas, sacarosa 30,0 g/l, BAP 5 mg/l, 2,4-D 0,25 mg/l, bialafós 1 mg/l, Gelrite 2,5 g/l, pH 5,7. Se deja que las células crezcan con una luz baja (13 Em-2s-1) durante una semana, y después con una luz más intensa (40 Em-2s-1) durante otra semana, antes de trasladarlas a un medio de regeneración, 36 (1H), que es idéntico a 28 (1H) excepto porque carece de reguladores del crecimiento vegetal. Se retirán las plántulas pequeñas (3-5 cm) y se colocan en tubos de cultivo de 150 x 25 mm que contienen medio SHGA sin selección (vitaminas y sales basales de Schenk y Hildebrandt, 1972, mioinositol 1 g/l, sacarosa 10 g/l, Gelrite 2,0 g/l, pH 5,8). Cuando las plántulas desarrollaron un sistema de raíces y brotes suficiente se transplantaron a tierra en el invernadero.

7.5 - Análisis molecular: materiales y métodos en maíz

7.5.1 - Recolección del ADN del tejido, aislamiento y cuantificación

Se coloca tejido fresco en tubos y se liofiliza a 4 ºC durante 2 días. Después de secar completamente el tejido, se coloca una esfera de wolframio (Valenite) en el tubo y las muestras se someten a 1 min de trituración en seco utilizando un molino de bolas Kelco. Entonces se sigue el procedimiento de aislamiento de ADN DNeasy convencional (Quiagen, DNeasy 69109). Después, una parte alícuota del ADN extraído se tiñe con Pico Green (Molecular Probes P7589) y se lee en un fluorómetro (BioTek) con patrones conocidos para obtener la concentración en ng/l.

7.5.2 - Análisis del ensayo Invader de PAT

Las muestras de ADN se diluyen hasta 20 ng/l y después se desnaturalizan mediante una incubación en un termociclador a 95 ºC durante 10 minutos. Después se prepara la mezcla Signal Probe utilizando la mezcla de oligos proporcionada y MgCl2 (Third Wave Technologies). Se dispersa una parte alícuota de 7,5 l en cada pocillo de la placa del ensayo Invader, seguido de una parte alícuota de 7,5 l de controles, los patrones, y 20 ng/l de muestras desconocidas diluidas. Cada pocillo se cubre con 15 l de aceite mineral (Sigma). Las placas después se incuban a 63 ºC durante 1 hora y se leen en un fluorómetro (Biotek). El cálculo de la proporción de la señal frente al fondo para la sonda diana, dividida entre la proporción de la señal frente al fondo para la sonda de control interno produce la proporción. Se emplea la proporción de patrones de número de copias conocido desarrollados y validados con un análisis de la transferencia Southern para identificar el número de copias calculado de los acontecimientos desconocidos.

7.5.3 - Reacción en cadena de polimerasa para PAT

Se empleó un total de 100 ng de ADN total como molde. Se emplean 20 mM de cada cebador con el kit de Taq polimerasa para PCR Takara Ex Taq PCR Polymerase (Mirus TAKRR001A). Los cebadores para el PTU de PAT

son: directo, MAS123-GAACAGTTAGACATGGTCTAAAGG (SEQ ID NO:5); e inverso, Per5-4- GCTGCAACACTGATAAATGCCAACTGG (SEQ ID NO:6). La reacción de PCR se realiza en el termociclador 9700 Geneamp (Applied Biosystems), sometiendo las muestras a 94 ºC durante 3 minutos y 35 ciclos de 94 ºC durante 30 segundos, 62 ºC durante 30 segundos, y 72 ºC durante 3 minutos y 15 segundos, seguido por 72 ºC durante 10 minutos.

Los cebadores para la PCR de la región codificadora de

PAT

son: directo, ATGGCTCATGCTGCCCTCAGCC (SEQ ID NO:7); e inverso, CGGGCAGGCCTAACTCCACCAA (SEQ ID NO:8). La reacción de PCR se realiza en el termociclador 9700 Geneamp (Applied Biosystems), sometiendo las muestras a 94 ºC durante 3 minutos, y 35 ciclos de 94 ºC durante 30 segundos, 65° C durante 30 segundos, y 72 ºC durante 1 minuto y 45 segundos, seguido por 72 ºC durante 10 minutos. Los cebadores para la PCR de la región codificadora de DSM-2 son: directo, ATGCCTGGAACTGCTGAGGT (SEQ ID NO:9); e inverso TGAGCGATGCCAGCATAAGCT (SEQ ID NO:10). La reacción de PCR se realiza en el termociclador 9700 Geneamp (Applied Biosystems), sometiendo las muestras a 94 ºC durante 3 minutos, y 35 ciclos de 94 ºC durante 30 segundos, 65 ºC durante 30 segundos, y 72 ºC durante 45 segundos, seguido de 72 ºC durante 10 minutos. Los productos de la PCR se analizan mediante electroforesis en un gel de agarosa al 1% teñido con EtBr.

7.5.4 - Análisis de la transferencia Southern

Se realiza un análisis de la transferencia Southern con el ADN total obtenido con el kit Qiagen DNeasy. Un total de 5 g de ADN genómico total se somete a una digestión durante la noche con NcoI y SwaI para obtener los datos de integración. Se empleó una digestión de 5 g con la enzima de restricción SspI para obtener los datos de PTU. Después de analizar los datos de digestión de SspI, se empleó la enzima de restricción MfeI para digerir el resto de las muestras, porque parecía que esta enzima era mejor. Después de la digestión durante la noche, una parte alícuota de aproximadamente 100 ng se ensaya en un gel al 1% para asegurar la digestión completa. Después de asegurarse de esto, las muestras se ensayan en un gel grande de agarosa al 0,85% durante la noche a 40 voltios. El gel después se desnaturaliza en NaOH 0,2 M, NaCl 0,6 M durante 30 minutos. El gel entonces se neutraliza en Tris- HCl 0,5 M, NaCl 1,5 M, pH 7,5, durante 30 minutos. Entonces se monta un aparato de gel que contiene 20x SSC para obtener un gel de gravedad para conseguir una transferencia hacia una membrana de nailon (Millipore INYC00010) durante la noche. Después de la transferencia realizada durante la noche, la membrana después se somete a luz UV con un reticulador (Stratagene UV Stratalinker 1800) a 120.000 microjulios. La membrana después se lava en SDS al 0,1%, SSC 0,1 durante 45 minutos. Después del lavado de 45 minutos, la membrana se hornea durante 3 horas a 80 ºC y después se conserva a 4 ºC hasta la hibridación. Se prepara el fragmento del molde de hibridación empleando una PCR de la región codificadora utilizando ADN plasmídico. El producto se ensaya en un gel de agarosa al 1% y se corta, y después el gel se extrae utilizando el procedimiento de extracción de Qiagen (28706). La membrana después se somete a una etapa de prehibridación a 60 ºC durante 1 hora en tampón Perfect Hyb (Sigma H7033). Se emplea el procedimiento de reacción de marcaje con dCTP Prime it RmT (Stratagene 300392) para desarrollar la sonda basada en p32 (Perkin Elmer). La sonda se limpia utilizando las columnas Probe Quant G50 (Amersham 27-5335-01). Se emplean 2 x 106 de cuentas CPM por ml de tampón de hibridación para hibridar las transferencias Southern durante la noche. Después de una hibridación durante la noche, las transferencias después se someten a dos lavados de 20 minutos a 65 ºC en SDS al 0,1%, SSC 0,1. Las transferencias después se exponen a una película durante la noche con una incubación a -80 ºC.

7.6 - Resultados

Se realizaron tres transformaciones mediadas por filamentos del maíz con cada una de las dos contrucciones (PAT y

DSM-2) descritas anteriormente. A partir de estos experimentos colectivos se recuperaron 230 aislados. En los medios que contenían bialafós 1 y 2 mg/l (de Herbiace), la recuperación del acontecimiento entre PAT y DSM-2 fue muy similar, aunque la recuperación del acontecimiento en el medio que contenía bialafós 4 mg/l fue mayor para PAT que para DSM-2.

Tabla del ejemplo 7.6-1 Acontecimientos globales recuperados por botella Construcción Gen de interés 1 Herbiace 2 Herbiace 4 Herbiace pDAB3250 DSM-2 46 41 17 pDAB3251 PAT 44 37 Cuarenta y ocho de los acontecimientos de DSM-2 seleccionados tras 1 o 2 Herbiace se sometieron a un análisis del número de copias y la presencia de una unidad de transcripción vegetal (PTU) intacta mediante una transferencia Southern. Los 48 acontecimientos contenían al menos una copia del gen DSM-2. A continuación se presenta un subconjunto de los resultados de los acontecimientos con menor número de copias (3 o menos).

Tabla del ejemplo 7.6-2 Integración PTU n.º de la muestra Transferencia Southern de DMS2 Transferencia Southern de DMS2 1941[1]-005 2 mayor de esperado 1941[1]-006 3 sí 1941[1]-008 1 sí 1941[1]-009 2 sí 1941[1]-021 2 sí 1941[1]-023 2 sí 1941[2]-012 2 sí 1941[2]-014 2 sí 1941[2]-016 3 sí 1941[2]-017 2 sí 1941[2]-029 2 sí 1941[4]-038 1 sí 1941[5]-044 2 sí 1941[5]-045 2 sí 1941[5]-047 3 sí Cuarenta y ocho de los acontecimientos de PAT seleccionados tras 1, 2 o 4 Herbiace se sometieron a un cálculo del número de copias y la presencia de una unidad de transcripción vegetal (PTU) intacta mediante el ensayo Invader y PCR, respectivamente. Los 48 acontecimientos contenían al menos una copia del gen PAT. A continuación se presenta un subconjunto de los resultados de los acontecimientos con menor número de copias (3 o menos).

Tabla del ejemplo 7.6-3

ID de la planta

n.º de copias

PCR de PTU

1942[1]-001 1 + 1942[1]-007 3 + 1942[2]-017 2 + 1942[3]-018 1 + 1942[3]-021 1 + 1942[3]-022 1 + 1942[3]-024 3 + Se regeneraron aproximadamente 6-10 plantas T0 a partir de cada uno de los 15 acontecimientos que contienen DSM-2, y se regeneraron 7-8 plantas a partir de cada uno de los 7 acontecimientos que contienen PAT listados anteriormente para evaluar la tolerancia a Liberty.

Se analizaron muestras de tejido de callo procedentes de 31 acontecimientos diferentes, junto con un callo no transformado (control negativo) con un experimento de transferencia Western. Todas las muestras, excepto el control negativo, presentaron una banda observada con un peso molecular relativo de 20 kDa con respecto al marcador. Esto concuerda con el tamaño previsto de la proteína de 19,7 kDa. Además, la banda también tiene el mismo tamaño que el patrón, concretamente proteína DSM-2 purificada a partir de E. coli. Con 0,7 g/ml del patrón en el gel y dada una puntuación arbitraria de 5 (+++++), las bandas de los diferentes acontecimientos se clasificaron relativamente y se listan en la siguiente tabla.

Tabla del ejemplo 7.6-4 Recuento n.º de acontecimiento Gramos totales Detección con transferencia Western 1 1941[1]-018 0,090 ++ 2 1941[1]-019 0,070 ++++ 3 1941[1]-020 0,080 ++ 4 1941[1]-021 0,060 ++ 1941[1]-022 0,070 ++++ 6 1941[1]-023 0,050 + 7 1941[1]-024 0,080 ++ 8 1941[1]-025 0,050 ++ 9 1941[1]-026 0,070 + 1941[1]-027 0,060 ++ 11 1941[2]-028 0,080 ++++ 12 1941[2]-029 0,090 +++ 13 1941[2]-030 0,110 ++ 14 1941[2]-031 0,140 +++ 1941[2]-032 0,130 +++ 16 1941[2]-033 0,120 +++ 17 1941[2]-034 0,070 +++ 18 1941[2]-035 0,140 + 19 1941[4]-036 0,160 + 1941[4]-037 0,140 ++ 21 1941[4]-038 0,140 +/- 22 1941[4]-039 0,130 + 23 1941[4]-040 0,100 +/- 24 1941[4]-041 0,130 ++ 1941[4]-042 0,090 +/- 26 1941[4]-043 0,110 + 27 1941[5]-044 0,090 +++ 28 1941[5]-045 0,090 ++ 29 1941[5]-046 0,100 +++ 1941[5]-047 0,090 +++ 31 1941[5]-048 0,110 +

7.6.1 - Comparación directa con pintura de hojas en maíz T0

Se pintaron plantas DSM-2 (v2) T0 con una descarga del herbicida glufosinato. Se ensayaron 4 descendientes de cada uno de los 15 acontecimientos T0, y 4 hojas en cada planta individual recibieron una descarga de glufosinato aproximadamente en la etapa V8. Los tratamientos de descarga se aleatorizaron para cada proporción, lo cual permite la variación de la localización del tratamiento en cada hoja. Para el maíz, la dosis eficaz mínima para distinguir las plantas sensibles frente a las que presentan un nivel significativo de resistencia es de glufosinato al 0,25% en v/v. También se aplicaron unas proporciones elevadas para determinar los niveles relativos de resistencia (al 0,5%, al 1,0%y al 2,0% en v/v). Los tratamientos con glufosinato se aplicaron utilizando aplicadores con punta de algodón a un área de tratamiento de aproximadamente 2,5 cm de diámetro.

La tabla 11 compara la respuesta de los genes DSM-2 (v2) y control para impartir resistencia al glufosinato a transformantes T0 de maíz. La respuesta se presenta en términos de porcentaje de lesiones visibles 2 WAT. Los datos se presentan como un histograma de individuos que muestran pocas o ninguna lesión (<20%), lesiones moderadas (20-40%) o lesiones graves (>40%). Puesto que cada T0 es un acontecimiento de transformación independiente, se puede esperar una variación significativa de las respuestas T0 individuales dentro de una proporción concreta. Se presenta un promedio aritmético y una desviación estándar para cada tratamiento. El maíz de tipo salvaje no transformado actúa como control sensible al glufosinato. El gen DSM-2 (v2) imparte resistencia al herbicida a plantas de maíz T0 individuales. Dentro de un tratamiento concreto, el nivel de respuesta de la planta varía en gran medida y puede atribuirse al hecho de que cada planta representa un acontecimiento de transformación independiente. Debe advertirse, de modo importante, que hasta 2% en v/v de glufosinato, las plantas transformadas con DSM-2 (v2) actúan mejor globalmente que las plantas transformadas con PAT. En la tabla 11 se presenta un promedio de lesiones global en la población en proporción, simplemente para demostrar la diferencia significativa entre las plantas transformadas con DSM-2 (v2) frente al tipo salvaje o los controles transformados con PAT.

Tabla 11 - Respuesta de plantas de maíz transformadas con DSM-2 (v2) (optimizado en plantas) T0 a una gama de proporciones de glufosinato aplicado como pintura en las hojas a plantas después de la emergencia, comparado con plantas de tipo salvaje y transformadas con PAT

Tipo salvaje

PAT

DSM-2 (v2)

Tratamiento

% de lesiones % de lesiones % de lesiones al 2% en v/v 90 9 4 al 1% en v/v 84 6 2 al 0,5% en v/v 3 1 al 0,25% en v/v 33 1

7.6.2 - Verificación de la alta tolerancia al glufosinato en maíz T2

Las semillas del cruzamiento de T1 DSM-2 (v2) x 5XH751 se plantan en macetas de 10,16 cm (4 pulgadas) que contenían medio Metro Mix, y en la etapa de 2 hojas se pulverizaron con un pulverizador de pista ajustado a 187 l/ha con 560 g ai/ha de glufosinato para eliminar los no resistentes. En 7 DAT se eliminaron los no resistentes, y las plantas resistentes se pulverizaron con el pulverizador de pista tal como se describió anteriormente con las siguientes proporciones: 0,560, 1120, 2240 y 4480 g ai/ha de glufosinato. Las plantas se clasificaron en 3 y 14 DAT, y se compararon con plantas control 5XH751 x Hi II. La siguiente tabla del ejemplo 7.6.2-1 muestra que existen plantas DSM-2 (v2) individuales que aguantan hasta 2240 g ai/ha de glufosinato con menos de 20% de lesiones. El DSM-2 (v2) también proporcionó una tolerancia similar a 4480 g ai/ha de glufosinato en los controles transformados con PAT.

Tabla del ejemplo 7.6.2-1 - Respuesta del maíz T2 a una gama de proporciones de glufosinato aplicado después de la emergencia (14 DAT)

DSM-2 (V2) (pDAS1941)

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar control sin tratar 4 3 3 560 g ai/ha de glufosinato 4 6 3 1120 g ai/ha de glufosinato 2 2 18 6 2240 g ai/ha de glufosinato 1 3 21 4480 g ai/ha de glufosinato 4 29

PAT (pDAS1942)

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar control sin tratar 4 560 g ai/ha de glufosinato 4 6 1120 g ai/ha de glufosinato 1 3 2240 g ai/ha de glufosinato 2 1 1 12 4480 g ai/ha de glufosinato 3 1 33

Tipo salvaje

% de lesiones % de lesiones Promedios <20% 20-40% >40% Promedio Desviación estándar control sin tratar 4 3 3 560 g ai/ha de glufosinato 4 100 1120 g ai/ha de glufosinato 4 100 2240 g ai/ha de glufosinato 4 100 4480 g ai/ha de glufosinato 4 100

7.6.3 - Heredabilidad de DSM-2 (v2) en maíz

Las semillas del cruzamiento de T1 DSM-2 (v2) x 5XH751 se plantan en macetas de 10,16 cm (4 pulgadas) que contenían medio Metro Mix, y en la etapa de 2 hojas se pulverizaron con un pulverizador de pista ajustado a 187 l/ha con 0, 280, 560, 1120, 2240 y 4480 g ai/ha de glufosinato. Las plantas se clasificaron en 3 y 14 DAT, y se compararon con plantas control 5XH751 x Hi II. Las plantas se clasificaron como antes en base a lesiones visibles globales del 0-100%. Para determinar la segregación de cada población, se eligió la proporción de 1120 g ai/ha y mayores. Las plantas resistentes y sensibles se contaron y se determinó que todas las familias T1 se segregaban como un rasgo medeliano dominante de un único locus (1R:1S), según se determina mediante un ensayo de Chi cuadrado. Las plantas supervivientes se autofecundaron para producir la generación T2. El DSM-2 (v2) se hereda como un gen de resistencia al glufosinato robusto en múltiples especies cuando se cruza recíprocamente con un híbrido comercial.

También se realizó un ensayo de progenie en cinco familias DSM-2 (v2) T2. Las semillas se plantaron en macetas de 7,62 cm (3 pulgadas) como se describió anteriormente. En la etapa de 3 hojas, todas las plantas se pulverizaron con 560 g ai/ha de glufosinato con un pulverizador de pista tal como se describió anteriormente. Después de 7 DAT se contaron las plantas resistentes y sensibles. Cuatro de las cinco líneas ensayadas se segregaron como un rasgo medeliano dominante de un único locus (3R:1S), según se determina mediante un ensayo de Chi cuadrado.

7.6.4 - Apilamiento de DSM-2 (v2) para aumentar el espectro de herbicidas

Se realizó el cruzamiento de plantas T1 con BE1146RR. Las plantas transformadas con DSM-2 (v2) pueden cruzarse del modo convencional con otras líneas de maíz que contengan otros rasgos de interés. Una planta endogámica (BE1146RR) que contiene el rasgo de tolerancia al glifosato CP4 se cruzó con plantas T1 que contienen

DSM-2 (v2). Las plantas de la siguiente generación pueden ensayarse para la eficacia de ambos rasgos de tolerancia a herbicidas mediante la aplicación de glufosinato y glifosato en secuencia o en una mezcla en tanque a una proporciones iguales o mayores que las proporciones normalmente letales del herbicida (por ejemplo, las plantas pueden pulverizarse con 280, 560, 1120 g ae/ha o más de ambos herbicidas). Esto identifica la capacidad de utilizar ambos herbicidas en combinación o en aplicaciones secuenciales para la gestión de la resistencia a herbicidas.

Ejemplo 8: Detección de proteínas en las plantas transformadas mediante anticuerpos

8.1 - Producción de anticuerpos policlonales

Se enviaron 5 miligramos de DSM-2 purificada (véase la sección anterior) a Invitrogen Custom Antibody Services (South San Francisco, CA) para la producción de anticuerpos policlonales de conejo. El conejo recibió 4 inyecciones en un periodo de 12 semanas, conteniendo cada inyección 0,5 mg de la proteína purificada suspendida en 1 ml de adyuvante de Freund incompleto. Los sueros se ensayaron en experimentos de ELISA directos y de transferencia Western para confirmar la especificidad y la afinidad.

8.2 - Extracción de DSM-2 de tejido de callo

Se colocaron cuatro discos de hojas de maíz (Hi-II), obtenidos utilizando un troquel de una sola abertura, en tubos de microcentrífuga que contenían 2 esferas de acero inoxidable (4,5 mm, Daisy Co., n.º de catálogo 145462-000) y 500 l de tampón de extracción vegetal (PBS que contiene Triton X-100 al 0,1% y 5 l por ml de cóctel de inhibidores de proteasas (Sigma, n.º de catálogo P9599). Los tubos se sujetaron en un Geno/Grinder (modelo 2000- 115, Certiprep, Metuchen, NJ) y se agitaron durante 6 min con un ajuste de 1x de 500 rpm. Los tubos se centrifugaron a 5000 x g durante 10 min, y el sobrenadante que contenía las proteínas solubles se ensayó en experimentos de transferencia Western para detectar la presencia de DSM-2.

8.3 - Análisis de la transferencia Western

El extracto de hojas se sembró con diversas concentraciones de DSM-2 purificada y se incubó con tampón de muestras Laemmli a 95 ºC durante 10 min, seguido de una separación electroforética en un gel premoldeado de Tris-glicina al 8-16%. Las proteínas después se electrotransfirieron a una membrana de nitrocelulosa utilizando un protocolo convencional. Después de bloquear en leche desnatada al 4% en PBS, la proteína DSM-2 se detectó mediante un antisuero anti-DSM-2, seguido de conjugados de anti-conejo de cabra/HRP. La proteína detectada se visualizó mediante un reactivo de análisis Western ECl de sustrato quimioluminiscente (Amersham, n.º de catálogo RPN 21058).

8.4 - Resultados

Se generaron anticuerpos policlonales para DSM-2 utilizando una proteína expresada en células de E. coli y purificada de estas. Después de cuatro inyecciones, los antisueros presentaban una alta titulación de anticuerpos anti-DSM-2, según se observó en un ELISA directo. A una dilución de 100.000 veces, el suero aún proporcionaba una señal seis veces mayor que el fondo.

En el análisis de la transferencia Western (de DSM-2 en una matriz de hojas de maíz de tipo salvaje (Hi-II)), el suero podría detectar una banda principal de aproximadamente 22 kDa, que es comparable al peso molecular previsto basado en el gen DSM-2 (v2). La misma banda también puede detectarse cuando el extracto se siembra a 5 ng/ml, la menor concentración ensayada. También se observaron bandas más pequeñas a altas concentraciones de DSM- 2, que se cree que son agregados de la proteína diana, puesto que no se observan a concentraciones menores. Se observa una única banda principal con un peso molecular comparable al previsto (los carriles ensayados en este gel fueron un marcador de peso molecular y extractos de hojas que contienen la proteína DSM-2 a una concentración de 0,005, 0,05, 0,5 y 5 g/ml, respectivamente). Además, el anticuerpo policlonal no presentó reacción cruzada con ninguna de las proteínas de la hoja de maíz, puesto que se observó muy poca señal de fondo.

Se determinó la expresión de DSM-2 de tejido de callo de tabaco transformado utilizando un análisis de la transferencia Western. Se observó una banda detectada con un tamaño comparado al patrón (aproximadamente 22 kDa) en diferentes acontecimientos, lo cual indica que DSM-2 ha sido expresada en tejido de tabaco transgénico.

Ejemplo 9: Transformacióndel tabaco (cultivo celular)

Cuatro días antes de la transformación, una suspensión de tabaco NT-1 de una semana de edad, que se había estado subcultivando cada 7 días, se subcultivó en medio fresco añadiendo 2 ml del cultivo NT-1 o 1 ml de concentrado celular a 40 ml de medio NT-1 B. La suspensión subcultivada se mantuvo en la oscuridad a 25  1 ºC en un agitador a 125 rpm.

Tabla del ejemplo 9-1 - Receta del medio NT-1 B Reactivo Por litro Sales MS (10X) 100 ml MES 0,5 g Tiamina-HCl (1 mg/ml) 1 ml mioinositol 100 mg K2HPO4 137,4 mg 2,4-D (10 mg/ml) 222 l Sacarosa 30 g pH hasta 5,7  0,03 Se empleó una disolución madre de glicerol al 50% de Agrobacterium tumefaciens (cepa LBA4404) que porta un vector binario de interés para iniciar un cultivo líquido durante la noche añadiendo 20, 100 0 500 l a 30 ml de líquido YEP (extracto de levadura 10 g/l, peptona 10 g/l, NaCl 5 g/l, sacarosa 0-10 g/l) que contenía espectinomicina 50-100 mg/l. El cultivo bacteriano se incubó en la oscuridad a 28 ºC en un agitador incubador a 150-2050 rpm hasta que la DO600 fue de 1,5  0,2. Esto llevó aproximadamente 18-20 horas.

Para cada vector ensayado, se trasladaron 20-70 ml de células en suspensión de cuatro días de edad a un recipiente estéril, al cual se le añadieron 500-1750 l de suspensión de Agrobacterium con la DO apropiada. Para asegurar una mezcla uniforme, las células se pipetearon hacia arriba y hacia abajo 5 veces con una pipeta de orificio ancho de 10 ml. La suspensión uniforme después se extrajo hacia el barril de 25 ml de una pipeteador de repetición y se dispensaron 250 l de la suspensión por pocillo en placas de 24 pocillos; esto continuó hasta que se hubo acabado la suspensión. Las placas de pocillos se envolvieron en papel Parafilm y se cultivaron en la oscuridad a 25  1 ºC sin agitación durante 3 días de cocultivo.

Después del cocultivo se retiró el exceso de líquido de los pocillos individuales con una boquilla de pipeta de 1 ml y el resto de las células se resuspendieron en 1 ml de líquido NTC (medio NT-1 B que contenía carbenicilina 500 mg/l, añadida después de someter a un autoclave). El contenido de cada pocillo individual se dispersó a lo largo de la superficie completa de placas de selección de 100 x 25 mm empleando pipetas de transferencia desechables. El medio de selección consistió en medio NTC solidificado con agar TC 8 g/l suplementado con bialafós 7,5 a 15 mg/l o glufosinato amonio de calidad técnica, añadidos después de someter a un autoclave.

Los transformantes putativos aparecen como pequeños agrupamientos de callos sobre un fondo de células muertas no transformadas. Los callos se aislaron aproximadamente 2-6 semanas después de la transformación. Cada aislado de callo se trasladó a su propia placa de 60 x 20 mm que contenía el mismo medio de selección y se dejó crecer durante aproximadamente 2 semanas antes de someterse al análisis.

9.1 - Resultados

Se completó un experimento paralelo que compara DSM-2 (v2) con PAT. En el estudio, 100% de las placas de selección de PAT produjeron al menos un aislado positivo en PCR en medio de bialafós 10 mg/l, mientras que 79% de las placas de selección de DSM-2 (v2) produjeron al menos un aislado positivo en PCR. Todos los acontecimientos se ensayaron para la presencia del gen DSM-2 (v2) o PAT por medio de una PCR de región codificadora, y fueron positivos.

Tabla para el ejemplo 9-2 Construcción Gen de interés Frecuencia de transformación en bialafós 10 mg/ml después de la verificación mediante PCR pDAB3778 DSM-2 79% pDAB3779 PAT 100% Se realizaron transferencias Western con un pequeño subconjunto de los acontecimientos seleccionados con DSM-2 (v2), y se identificaron tres acontecimientos positivos, tal como se observa en los siguientes datos. En un segundo experimento, las células de tabaco tratadas con DSM-2 (v2) se seleccionaron con bialafós 7,5, 10, 12,5 o 15 mg/l o glufosinato amonio de calidad técnica. En la siguiente tabla se listan las frecuencias de transformación (porcentaje de las placas de selección que producen al menos un callo) tras la verificación mediante una PCR de región codificadora.

Tabla del ejemplo 9-3 Concentración en mg/l Glufosinato Bialafós 7,5 55,6% 38,9% 50,0% 44,4% 12,5 44,4% 38,9% 38,9% 22,2%

Ejemplo 10: Transformación con Agrobacterium de otros cultivos

A la luz de la presente descripción, otros cultivos pueden transformarse según la presente invención utilizando técnicas que son conocidas en la técnica. Para la transformación del centeno mediada por Agrobacterium, véase, por ejemplo, Popelka y Altpeter (2003). Para la transformación de la soja mediada por Agrobacterium, véase, por ejemplo, Hinchee et al., 1988. Para la transformación del sorgo mediada por Agrobacterium, véase, por ejemplo, Zhao et al., 2000. Para la transformación de la cebada mediada por Agrobacterium, véase, por ejemplo, Tingay et

al., 1997. Para la transformación del trigo mediada por Agrobacterium, véase, por ejemplo, Cheng et al., 1997. Para la transformación del arroz mediada por Agrobacterium, véase, por ejemplo, Hiei et al., 1997.

A continuación se indican los nombres latinos de estas y otras plantas. Debe quedar claro que pueden utilizarse estas y otras técnicas de transformación (que no utilicen Agrobacterium) para transformar DSM-2 (v1), por ejemplo, en estas y otras plantas, que incluyen, pero no se limitan al maíz (Gramineae, Zea mays), trigo (Pooideae, Triticum

spp.), arroz (Gramineae, Oryza spp. y Zizania spp.), cebada (Pooideae, Hordeum spp.), algodón (Abroma, Dicotyledoneae, Abroma augusta, y Malvaceae, Gossypium spp.), soja (soja, Leguminosae, Glycine max), remolacha azucarera (Chenopodiaceae, Beta vulgaris altissima), caña de azúcar (Arenga pinnata), tomate (Solanaceae, Lycopersicon esculentum y otras spp., Physalis ixocarpa, Solanum incanum y otras spp., y Cyphomandra betacea), patata, batata, cebada (Pooideae, Secale spp.), pimientos (Solanaceae, Capsicum annuum,

sinense, y frutescens), lechuga (Compositae, Lactuca sativa, perennis, y pulchella), repollo, apio (Umbelliferae, Apium graveolens), berenjena (Solanaceae, Solanum melongena), sorgo (todas las especies de Sorghum), alfalfa (Leguminosae, Medicago sativum), zanahoria (Umbelliferae, Daucus carota sativa), judías (Leguminosae, Phaseolus spp. y otros géneros), avena (Avena sativa y Strigosa), guisantes (Leguminosae, Pisum, Vigna, y Tetragonolobus spp.), girasol (Compositae, Helianthus annuus), calabaza (Dicotyledoneae, Cucurbita spp.), pepino (géneros de

Dicotyledoneae), tabaco (Solanaceae, Nicotiana spp.), Arabidopsis (Cruciferae, Arabidopsis thaliana), césped (Lolium, Agrostis, y otras familias), y trébol (Leguminosae). Estas plantas, con genes DSM-2 (v2), por ejemplo, se incluyen en la presente invención. El control de la vegetación en plantas que presentan resistencia al glufosinato o bialafós como resultado de una transformación con DSM-2 (v2), puede mejorar mediante la aplicación selectiva de glufosinato.

El DSM-2 (v2) tiene el potencial para aumentar la aplicabilidad de herbicidas, que pueden ser inactivados por DSM- 2, por ejemplo, glufosinato, bialafós y/o fosfinotricina, para su uso dentro de temporada en muchos sistemas de cultivos madereros de hoja caduca y perenne. Las especies madereras resistentes al glufosinato o al bialafós pueden aumentar la flexibilidad del uso excesivo de estos herbicidas sin problemas de lesiones. Estas especies incluyen, pero no se limitan a aliso, fresno, álamo temblón, haya, abedul, cerezo, eucalipto, nogal americano, arce, roble, pino y álamo. El uso de la resistencia al glufosinato o al bialafós para el control selectivo en especies ornamentales también es posible. Los ejemplos pueden incluir, pero no se limitan a rosas, Euonymus, petunias, begonias y margaritas.

Ejemplo 11: DSM-2 (v2) apilado con el rasgo de tolerancia al glifosato en cualquier cultivo

La inmensa mayoría de las hectáreas de algodón, canola y soja plantadas en Norteamérica contienen un rasgo de tolerancia al glifosato (GT), y la adopción de maíz GT está aumentando. Otros cultivos GT (por ejemplo, trigo, arroz, remolacha azucarera y césped) están en desarrollo, pero aún no han sido lanzados al mercado. Muchas otras especies resistentes al glifosato están en un estado de experimental a desarrollado (por ejemplo, alfalfa, caña de azúcar, girasol, remolacha, guisantes, zanahorias, pepino, lechuga, cebolla, fresas, tomates y tabaco; especies forestales, como el álamo y el liquidámbar; y especies hortícolas, como las margaritas, las petunias y las begonias; isb.vt.edu/cfdocs/fieldtestsl.cfm, 2005 en la web). Los GTC son herramientas valiosas para ampliar en gran medida el control de las plantas adventicias y aumentar la comodidad y disminuir los costes, que proporciona este sistema. Sin embargo, la utilidad del glifosato como un tratamiento de base actual está provocando la selección de plantas adventicias resistentes al glifosato. Además, las plantas adventicias en las que el glifosato es inherentemente menos eficaz están desplazando a las especies predominantes en los campos en los que se están utilizando programas de agroquímicos que solo emplean glifosato. Mediante el apilamiento de DSM-2 (v2) con un rasgo GT, a través de cruzamiento convencional o conjuntamente como un nuevo acontecimiento de transformación, puede mejorar la eficacia del control de la plantas adventicias, la flexibilidad y la capacidad de gestionar el desplazamiento por plantas adventicias y el desarrollo de resistencias a herbicidas. Pueden preverse varios escenarios para las opciones mejoradas de control de plantas adventicias, en los que el DSM-2 (v2) y un rasgo GT se apilan en cualquier especie de cultivo monocotiledónea o dicotiledónea: a) El glifosato puede aplicarse a una proporción de aplicación después del brote convencional (de 420 a 2160 g ae/ha, preferiblemente de 560 a 840 g ae/ha) para el control de la mayoría de las especies de plantas adventicias herbáceas y de hoja ancha. Para el control de las plantas adventicias de hoja ancha resistentes al glifosato, como Conyza canadensis o plantas adventicias que son inherentemente difíciles de controlar con el glifosato (por ejemplo, Commelina spp, Ipomoea spp, etc.), pueden aplicarse 280-2240 g ae/ha (preferiblemente 350-1700 g ae/ha) de glufosinato secuencialmente, mezclarse en tanque o como una premezcla con glifosato para proporcionar un control eficaz.

b) En la actualidad, las proporciones de glifosato en GTC generalmente varían de 560 a 2240 g ae/ha por momento de aplicación. El glifosato es mucho más eficaz sobre especies herbáceas que sobre especies de plantas adventicias de hoja ancha. Los rasgos apilados de DSM-2 (v2) + GT permiten unas proporciones de glifosato eficaces para plantas adventicias (105-840 g ae/ha, más preferiblemente 210-420 g ae/ha). El glufosinato (a 280- 2240 g ae/ha, más preferiblemente a 350-1700 g ae/ha) después puede aplicarse secuencialmente, mezclarse en tanque o como una premezcla con proporciones de glifosato eficaces para plantas adventicias para proporcionar el necesario control de las plantas adventicias de hoja ancha.

Los expertos en la técnica reconocerán que pueden utilizarse otros herbicidas (por ejemplo, bialafós) para la transformación de plantas con DSM-2 (v2). Las proporciones específicas pueden ser determinadas consultando las etiquetas de herbicidas compiladas en el libro de CPR (Crop Protection Reference) u otra compilación similar, las etiquetas compiladas en línea (por ejemplo, cdms.net/manuf/manuf.asp), o cualquiera de las guías de protección de cultivos comerciales o académicas, tales como the Crop Protection Guide from Agriliance (2003). Es posible conseguir cualquier herbicida alternativo para su uso en HTC mediante DSM-2 (v2), tanto si se emplea por sí solo, se mezcla en tanque, o secuencialmente.

Ejemplo 12: DSM-2 (v2) apilado con el rasgo AHAS en cualquier cultivo

La tolerancia al herbicida imidazolinona (AHAS, et al.) está actualmente presente en una serie de cultivos plantados en Norteamérica que incluyen, pero no se limitan a maíz, arroz y trigo. Otros cultivos tolerantes a la imidazolinona (por ejemplo, algodón y remolacha azucarera) están en desarrollo, pero aún no han sido lanzados al mercado.

Muchos herbicidas de imidazolinona (por ejemplo, imazamox, imazetapir, imazaquin, e imazapic) se emplean en la actualidad selectivamente en diversos cultivos convencionales. Se ha podido utilizar el imazetapir, imazamox y el herbicida no selectivo imazapir gracias a los rasgos de tolerancia a la imidazolinona, como AHAS, etc. Hasta la fecha, los HTC tolerantes a la imidazolinona comerciales han tenido la ventaja de no ser transgénicos. Esta clase de compuestos químicos también presentan una significativa actividad residual en la tierra, y así son capaces de proporcionar un control de plantas adventicias extendido más allá del momento de aplicación, a diferencia de los sistemas basados en glifosato o glufosinato. Sin embargo, el espectro de plantas adventicias controladas por los herbicidas de imidazolinona no es tan amplio como el glifosato (Agriliance, 2003). Además, los herbicidas de imidazolinona tienen un modo de acción (inhibición de la acetolactato sintasa, ALS) contra el cual muchas plantas adventicias han desarrollado resistencia (Heap, 2004). Mediante el apilamiento de DSM-2 (v2) con un rasgo de tolerancia a la imidazolinona, a través de cruzamiento convencional o conjuntamente como un nuevo acontecimiento de transformación, puede mejorar la eficacia del control de la plantas adventicias, la flexibilidad y la capacidad de gestionar el desplazamiento por plantas adventicias y el desarrollo de resistencias a herbicidas. Pueden preverse varios escenarios para las opciones mejoradas de control de plantas adventicias, en los que el DSM-2 (v2) y un rasgo de tolerancia a la imidazolinona se apilan en cualquier especie de cultivo monocotiledónea o dicotiledónea: a) El imazetapir puede aplicarse a una proporción de aplicación después del brote convencional (de 35 a 280 g ae/ha, preferiblemente de 70-140 g ae/ha) para el control de muchas especies de plantas adventicias herbáceas y de hoja ancha.

i) Pueden controlarse las plantas adventicias de hoja ancha resistentes al inhibidor ALS, tales como Amaranthus rudis, Ambrosia trifida, Chenopodium album (entre otras, Heap, 2004) mezclando en tanque 280-2240 g ae/ha, más preferiblemente 350-1700 g ae/ha de glufosinato.

ii) También pueden controlarse las especies de hoja ancha inherentemente más tolerantes a los herbicidas de imidazolinona, tales como Ipomoea spp., mezclando en tanque 280-2240 g ae/ha, más preferiblemente 350-1700 g ae/ha de glufosinato.

Los expertos en la técnica del control de plantas adventicias reconocerán que el uso de cualquiera de los diversos herbicidas de imidazolinona del mercado, y de herbicidas basados en el glufosinato, solos o en múltiples combinaciones, puede lograrse mediante la transformación de DSM-2 (v2) y el apilamiento con cualquier rasgo de tolerancia a la imdazolinona, mediante cruzamiento convencional o ingeniería genética. Las proporciones específicas de otros herbicidas representativos de estas químicas pueden ser determinadas por medio de las etiquetas de herbicidas compiladas en el libro de CPR (Crop Protection Reference) u otra compilación similar, las etiquetas compiladas en línea (por ejemplo, cdms.net/manuf/manuf.asp), o cualquiera de las guías de protección de cultivos comerciales o académicas, tales como the Crop Protection Guide from Agriliance (2003). Es posible conseguir cualquier herbicida alternativo para su uso en HTC mediante DSM-2 (v2), tanto si se emplea por sí solo, se mezcla en tanque, o secuencialmente.

Ejemplo 13: DSM-2 (v2) en el arroz

13.1 - Descripción de los medios

Los medios de cultivo empleados se ajustaron a pH 5,8 con KOH 1 M y se solidificaron con Phytagel 2,5 g/l (Sigma). Los callos embriogénicos se cultivaron en placas Petri de 100 x 20 mm que contenían 40 ml de medio semisólido.

Las suspensiones celulares se mantuvieron en matraces cónicos de 125 ml que contenían 35 ml de medio líquido y se hicieron rotar a 125 rpm. La inducción y el mantenimiento de los cultivos embriogénicos se produjo en la oscuridad a 25-26 ºC (Zhang et al., 1996).

La inducción y el mantenimiento de los callos embriogénicos se produjo en medio basal NB tal como se ha descrito previamente (Li et al., 1993), pero se adaptó para que contuviera glutamina 500 mg/l. Se iniciaron los cultivos en suspensión y se mantuvieron en medio líquido SZ (Zhang et al., 1998) con la inclusión de sacarosa 30 g/l en lugar de maltosa. El medio osmótico (NBO) consistía en medio NB con la adición de manitol y sorbitol 0,256 M cada uno. Los callos resistentes al herbicida se seleccionaron en medio NB suplementado con bialafós 8 mg/l durante 9 semanas con un subcultivo cada 3 semanas.

13.2 - Desarrollo del cultivo de tejido

Se esterilizaron semillas desecadas maduras de Oryza sativa L. japonica cv. Taipei 309 tal como se describe en Zhang et al., 1996. Los tejidos embriogénicos se indujeron mediante el cultivo de semillas de arroz maduras estériles en medio NB en la oscuridad. Los callos primarios, con un diámetro de aproximadamente 1 mm, se retiraron del escutelo y se emplearon para iniciar la suspensión celular en medio líquido SZ. Las suspensiones después se mantuvieron tal como se describe en Zhang, 1995. Los tejidos embriogénicos procedentes de la suspensión se retiraron del cultivo líquido de 3-5 días después del subcultivo previo, y se colocaron en medio osmótico NBO para formar un círculo de aproximadamente 2,5 cm de diámetro en una placa Petri y se cultivaron durante 4 h antes del bombardeo. De 16 a 20 h después del bombardeo, los tejidos se trasladaron desde el medio MBO a un medio de selección de Herbiace NBH8, asegurándose de que la superficie bombardeada mirase hacia arriba, y se incubaron en la oscuridad durante 3 semanas. Los callos recién formados se subcultivaron en medio NBH8 fresco dos veces cada 3 semanas.

13.3 - Bombardeo de microproyectiles

Todos los bombardeos se realizaron con el sistema Biolistic PDS-1000/He (Bio-Rad Laboratories, Inc.). Se lavaron una vez 3 miligramos de partículas de oro con un diámetro de 1,0 micrómetros con etanol al 100%, dos veces con agua destilada estéril y se resuspendieron en 50 l de agua en un tubo Eppendorf siliconizado. Se añadieron 5 microgramos de ADN plasmídico, 20 l de espermidina (0,1 M) y 50 l de cloruro de calcio (2,5 M) a la suspensión de oro. La mezcla se incubó a la temperatura ambiente durante 10 min, se sedimentó a 10000 rpm durante 10 sg, se resuspendió en 60 l de etanol al 100% frío y se distribuyeron 8-9 l en cada macrovehículo. Las muestras de tejido se bombardearon a 7584,233 kPa (1100 psi) y 685,8 mm de Hg (27 pulgadas de Hg), según se describe en Zhang et al. (1996).

Ejemplo 14: DSM-2 (v2) apilado con AAD-1 (v3) en cualquier cultivo

El glufosinato, al igual que el glifosato, es un herbicida relativamente no selectivo, de amplio espectro para especies herbáceas y de hoja ancha. El modo de acción de glufosinato se diferencia de el del glifosato. Su acción es más rápida, produciendo la desecación y el “quemado” de las hojas tratadas de 24-48 horas después de la aplicación del herbicida. Esto resulta ventajoso para un control rápido de la aparición de plantas adventicias. Sin embargo, también limita la translocación del glufosinato a las regiones meristemáticas de las plantas diana, lo cual produce un menor control de las plantas adventicias, según se prueba por la clasificación relativa de la actuación del control de las plantas adventicias de los dos compuestos en muchas especies (Agriliance, 2003).

Mediante el apilamiento de AAD-1 (v3) (véase el documento U.S. n.º de serie 11/587.893; documento WO 2005/107437) con un rasgo de tolerancia al glufosinato, a través de cruzamiento convencional o conjuntamente como un nuevo acontecimiento de transformación, puede mejorar la eficacia del control de la plantas adventicias, la flexibilidad y la capacidad de gestionar el desplazamiento por plantas adventicias y el desarrollo de resistencias a herbicidas. Tal como se mencionó en ejemplos previos, mediante la transformación de cultivos con AAD-1 (v3) se pueden aplicar selectivamente herbicidas de AOPP en cultivos de monocotiledóneas, los cultivos de monocotiledóneas tendrán un alto margen de seguridad frente a fenoxiauxinas, y las fenoxiauxinas pueden aplicarse selectivamente en cultivos de dicotiledóneas. Pueden preverse varios escenarios para las opciones mejoradas de control de plantas adventicias, en los que el AAD-1 (v3) y un rasgo de tolerancia al glufosinato se apilan en cualquier especie de cultivo monocotiledónea o dicotiledónea: a) El glufosinato puede aplicarse a una proporción de aplicación después del brote convencional (de 200 a 1700 g ae/ha, preferiblemente de 350 a 500 g ae/ha) para el control de muchas especies de plantas adventicias herbáceas y de hoja ancha. Hasta la fecha no se ha confirmado ninguna planta adventicia resistente al glufosinato; sin embargo, para el glufosinato existe un mayor número de plantas adventicias que son inherentemente más tolerantes que para el glifosato.

i) Pueden controlarse las especies de plantas adventicias herbáceas inherentemente tolerantes (por ejemplo, Echinochloa spp o Sorghum spp) mezclando en tanque 10-200 g ae/ha (preferiblemente 20-100 g ae/ha) de quizalofop.

ii) Pueden controlarse las especies de plantas adventicias de hoja ancha inherentemente tolerantes (por ejemplo,

Cirsium arvensis y Apocynum cannabinum) mezclando en tanque 280-2240 g ae/ha, más preferiblemente 560-2240 g ae/ha de 2,4-D para el control eficaz de estas especies de hoja perenne más difíciles de controlar y para mejorar la robustez del control de las especies de plantas adventicias de hoja ancha anuales.

b) Una combinación de tres vías de glufosinato (200-500 g ae/ha) + 2,4-D (280-1120 g ae/h) + quizalofop (10-100 g ae/ha), por ejemplo, puede proporcionar un espectro de control de plantas adventicias más robusto y solapante.

Además, un espectro solapante proporciona un mecanismo adicional para la gestión o el retraso en la aparición de plantas adventicias resistentes a herbicidas.

Ejemplo 15: DSM-2 (v2) apilado con AAD-12 (v2) en cualquier cultivo

El glufosinato, al igual que el glifosato, es un herbicida relativamente no selectivo, de amplio espectro para especies herbáceas y de hoja ancha. El modo de acción de glufosinato se diferencia de el del glifosato. Su acción es más rápida, produciendo la desecación y el “quemado” de las hojas tratadas de 24-48 horas después de la aplicación del herbicida. Esto resulta ventajoso para un control rápido de la aparición de plantas adventicias. Sin embargo, también limita la translocación del glufosinato a las regiones meristemáticas de las plantas diana, lo cual produce un menor control de las plantas adventicias, según se prueba por la clasificación relativa de la actuación del control de las plantas adventicias de los dos compuestos en muchas especies (Agriliance, 2003).

Mediante el apilamiento de AAD-12 (v1) con un rasgo de tolerancia al glufosinato, a través de cruzamiento convencional o conjuntamente como un nuevo acontecimiento de transformación, puede mejorar la eficacia del control de la plantas adventicias, la flexibilidad y la capacidad de gestionar el desplazamiento por plantas adventicias y el desarrollo de resistencias a herbicidas. Pueden preverse varios escenarios para las opciones mejoradas de control de plantas adventicias, en los que el AAD-12 (v1) y un rasgo de tolerancia al glufosinato se apilan en cualquier especie de cultivo monocotiledónea o dicotiledónea: a) El glufosinato puede aplicarse a una proporción de aplicación después del brote convencional (de 200 a 1700 g ae/ha, preferiblemente de 350 a 500 g ae/ha) para el control de muchas especies de plantas adventicias herbáceas y de hoja ancha. Hasta la fecha no se ha confirmado ninguna planta adventicia resistente al glufosinato; sin embargo, para el glufosinato existen un mayor número de plantas adventicias que son inherentemente más tolerantes que para el glifosato.

i) Pueden controlarse las especies de hoja ancha inherentemente tolerantes (por ejemplo, Cirsium arvensis, Apocynum cannabinum y Conyza cadensis) mezclando en tanque 280-2240 g ae/ha, más preferiblemente 560-2240 g ae/ha de 2,4-D para el control eficaz de estas especies de hoja perenne más difíciles de controlar y para mejorar la robustez del control de las especies de plantas adventicias de hoja ancha anuales. El triclopir y el fluroxipir son componentes aceptables a considerar en el régimen de control de plantas adventicias. Para el triclopir, las proporciones de aplicación varían generalmente de 70-1120 g ae/ha, más generalmente 140-420 g ae/ha. Para el fluroxipir, las proporciones de aplicación varían generalmente de 35-560 g ae/ha, más generalmente 70-280 g ae/ha.

b) Una combinación múltiple de glufosinato (200-500 g ae/ha) + 2,4-D (280-1120 g ae/h) +/- triclopir o fluroxipir (a las proporciones listadas anteriormente), por ejemplo, puede proporcionar un espectro de control de plantas adventicias más robusto y solapante. Además, un espectro solapante proporciona un mecanismo adicional para la gestión o el retraso en la aparición de plantas adventicias resistentes a herbicidas.

Ejemplo 16: DSM-2 (v2) apilado con rasgos de resistencia a insectos (IR) u otros rasgos introducidos en cualquier cultivo

La resistencia a insectos en los cultivos suministrada por un rasgo transgénico está muy extendida en la producción de maíz y algodón en Norteamérica y en todo el mundo. Múltiples compañías de semillas han desarrollado productos comerciales con rasgos combinados IR y HT. Estos incluyen los rasgos Bt IR (por ejemplo, las toxinas Bt listadas en el sitio web lifesci.sussex.ac.uk, 2006) y cualquiera o todos los rasgos HTC mencionados anteriormente. Así, el valor que conlleva esta oferta incluye la capacidad para controlar múltiples problemas de plagas por medios genéticos en una sola oferta. La comodidad de esta oferta se verá limitada si el control de plantas adventicias y el control de insectos se realizan independientemente. El DSM-2 (v2) solo o apilado con uno o más rasgos HTC adicionales puede apilarse con uno o más rasgos introducidos adicionales (por ejemplo, resistencia a insectos, resistencia a hongos, o tolerancia al estrés, etc.) (isb.vt.edu/cfdocs/fieldtestsl.cfm, 2005), mediante cruzamiento convencional o conjuntamente como un acontecimiento nuevo de transformación. Las ventajas incluyen la comodidad y la flexibilidad descritas en los anteriores ejemplos 11-15, junto con la capacidad para gestionar plagas de insectos y/u otros estreses agronómicos, además del mejor control de plantas adventicias proporcionado por DSM-2 (v2) y la tolerancia a herbicidas asociada. Así, la presente invención puede utilizarse para proporcionar un paquete agronómico completo de mejor calidad del cultivo, con la capacidad para controlar, de forma flexible y barata, cualquier problema agonómico.

Los rasgos combinados de IR y HT tienen aplicación en la mayoría de los cultivos agronómicos y hortícolas/ornamentales y forestales. La combinación de DSM-2 (v2) y su correspondiente tolerancia a herbicidas y resistencia a insectos proporcionada por cualquiera de los genes IR Bt o no Bt, puede aplicarse a las especies de cultivos listadas (pero no se limitan a estas) en el ejemplo 10. Los expertos en la técnica del control de las plantas adventicias reconocerán que el apilamiento de DSM-2 con el correspondiente rasgo HT o rasgo IR puede realizarse mediante cruzamiento convencional o mediante ingeniería genética, por ejemplo.

Ejemplo 17: Otras combinaciones de genes

La presente invención también incluyen plantas que producen una o más enzimas de la presente invención “apiladas” junto con uno o más genes de resistencia a herbicidas que incluyen, pero no se limitan a genes de resistencia al glifosato, ALS (imidazolinona, sulfonilurea), ariloxialcanoato, HPPD, PPO, y glufosinato, para proporcionar plantas tolerantes a herbicidas compatibles con unas opciones de gestión de la resistencia a herbicidas y de control de plantas adventicias más amplias y robustas. La presente invención incluyen también métodos y composiciones que utilizan homológos de los genes y las proteínas ejemplificadas en la presente.

En algunas realizaciones, la invención proporciona plantas monocotiledóneas y dicotiledóneas tolerantes al bialafós, fosfinotricina, o glufosinato, y uno o más herbicidas disponibles en el mercado (por ejemplo, glifosato, glufosinato, paraquat, inhibidores de ALS (por ejemplo, sulfonilureas, imidazolinonas, triazolopirimidinsulfonanilidas, etc.), inhibidores de HPPD (por ejemplo, mesotriona, isoxaflutol, etc.), 2,4-D, fluroxipir, tricoplir, dicamba, bromoxinilo, ariloxifenoxipropionatos, y otros). También se describen vectores que comprenden secuencias de ácidos nucleicos responsables de dicha tolerancia a herbicidas, así como los métodos para utilizar estas plantas tolerantes y combinaciones de herbicidas para el control de hierbas adventicias y la prevención de los desplazamientos por poblaciones de plantas adventicias. La presente invención permite utilizar nuevas combinaciones de herbicidas de unas formas nuevas. Además, la presente invención proporciona nuevos métodos para prevenir el desarrollo y controlar razas de plantas adventicias que sean resistentes a uno o más herbicidas, tales como el glifosato. La presente invención permite nuevos usos de nuevas combinaciones de herbicidas y cultivos, que incluyen la aplicación antes de la presencia de la planta, en un área que se va a plantar inmediatamente antes de ser plantada con semillas de plantas que, de otra forma, serían sensibles a ese herbicida (tal como el glufosinato).

Los presentes genes DSM-2 pueden apilarse con uno o más genes pat/bar, para lograr otro mecanismo de tolerancia al glufosinato, lo cual es conocido en la técnica.

Para el uso de un gen en plantas que codifican una HPPD (hidroxilfenil piruvato dioxigenasas), véanse, por ejemplo, las patentes de EEUU n.os 6.268.549 y 7.297.541. Estas plantas “apiladas” pueden combinarse con otro gen o genes para la resistencia al glufosinato, y estas plantas apiladas (y diversas otras plantas y plantas apiladas de la presente invención) pueden emplearse para prevenir el desarrollo de resistencia al glifosato.

También pueden utilizarse genes que codifican enzimas con actividad glifosato N-acetiltransferasa (GAT) (apilados) con uno o más genes DSM-2 de la presente invención. Véase, por ejemplo, Castle et al. (2004), “Discovery of Directed Evolution of a Glyphosate Tolerance Gene,” Science, ,ol. 34, pp. 1151-1154; y el documento WO 2002/36782.

Los presentes genes DSM-2 también pueden apilarse con los genes AAD-1 y AAD-12, y AAD-13 de los documentos WO 2005/107437, WO 2007/053482, y U.S. n.º de serie 60/928.303, respectivamente, y pueden utilizarse para combatir la resistencia al glifosato en algunas realizaciones preferidas, tal como se describe en estas referencias.

Lista de Secuencias

<110> Dow AgroSciences LLC Lira, Justin M.

Wright, Terry R. Robinson, Andrew Russell, Sean M. Merlo, Donald J. Webb, Steven Robert Arnold, Nicole Smith, Kelley <120> Nuevos genes marcadores seleccionables <130> DAS-136XC1 <140> 60/873,602 <141> 2006-12-07 <160> 10 <170> PatentIn versión 3.3 <210> 1 <211> 516 <212> DNA <213> Streptomyces coelicolor A3 <400> 1 <210> 2 <211> 171 <212> PRT <213> Streptomyces coelicolor A3 <400> 2 <210> 3 <211> 516 <212> DNA <213> Streptomyces coelicolor A3 <400> 3 <210> 4 <211> 171 <212> PRT <213> Streptomyces coelicolor A3 <400> 4 <210> 5 <211> 24 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo de PTU "MAS123" <400> 5 gaacagttag acatggtcta aagg 24 <210> 6 <211> 27 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso de PTU "Per5-4" <400> 6 gctgcaacac tgataaatgc caactgg 27 <210> 7 <211> 22 <212> DNA <213> Secuencia Artificial <220> <223> cebador directo de la región codificante <400> 7 atggctcatg ctgccctcag cc 2 2 <210> 8 <211> 22 <212> DNA <213> Secuencia Artificial <220> <223> cebador inverso de la región codificante <400> 8 cgggcaggcc taactccacc aa 22 <210> 9 <211> 21 <212> DNA <213> Secuencia Artificial <220> <223> Cebador directo para la PCR de la Región Codificante para DSM-2 <400> 9 atgcctggaa ctgctgaggt c 21 <210> 10 <211> 21 <212> DNA <213> Secuencia Artificial <220> <223> Cebador inverso para la PCR de la Región Codificante para DSM-2 <400> 10 tgagcgatgc cagcataagc t 21

REIVINDICACIONES

1.- Una célula vegetal transgénica que comprende un polinucleótido que codifica una proteína que tiene actividad fosfinotricina acetiltransferasa, en la que dicha proteína tiene al menos 90% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:2.

2.- La célula de la reivindicación 1, en la que dicha proteína tiene al menos 95% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:2.

3.- Un vector que comprende un promotor operable en una célula vegetal, y un polinucleótido unido operablemente a dicho promotor, en el que dicho polinucleótido codifica una proteína que tiene actividad fosfinotricina acetiltransferasa, en el que dicha proteína tiene al menos 90% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID NO:2.

4.- Una planta que comprende una pluralidad de células de la reivindicación 1.

5.- Una semilla de una planta de la reivindicación 4, comprendiendo dicha semilla el polinucleótido de la reivindicación 1.

6.- Una célula vegetal de la reivindicación 1, en la que dicha célula comprende además un segundo gen de resistencia a herbicidas.

7.- La célula vegetal transgénica de la reivindicación 1, en la que dicha célula comprende además un gen de resistencia a herbicidas seleccionado del grupo que consiste en AAD-1, AAD-12, un gen de resistencia al glifosato, y un gen de resistencia a imidazolinona.

8.- Un método para utilizar un gen de resistencia a fosfinotricina como marcador de resistencia en células vegetales, comprendiendo dicho método las etapas de someter una pluralidad de células vegetales a una transformación con el polinucleótido de la reivindicación 1, cultivar las células en un medio, exponer las células a fosfinotricina, y determinar si las células son resistentes a la fosfinotricina.