Novirhabdovirus recombinantes y usos de los mismos.

Una construcción de ADN recombinante que comprende:

a) una región que comprende una secuencia de terminación de la transcripción/poliadenilación del gen M de novirhabdovirus, estando definida dicha región por la siguiente secuencia: VHHAGAYAGAAAAAAA

(SEC ID Nº: 4), en la que A, T, G, V, H e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

b) una región que comprende una secuencia de inicio de la transcripción del gen G de novirhabdovirus, definiéndose dicha región por la siguiente secuencia: GCACDWKWGTGY (SEC ID Nº: 5), en la que A, T, G, C, D, W, K e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

en la que dicha región a) está seguida o dicha región b) está precedida por un dinucleótido intergénico no transgénico de un novirhabdovirus,

c) una región que comprende una fase abierta de lectura que codifica una proteína de interés;

en la que las regiones a), b) y c) se disponen en un orden seleccionado del grupo que consiste en: a-b-c y b-c-a.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/IB2007/002756.


Nacionalidad solicitante: Francia.

Dirección: Etablissement Public à Caractère Scientifique et Technologique 147, rue de l'Université 75007 Paris FRANCIA.

Inventor/es: .

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/09 (Tecnología del ADN recombinante)

PDF original: ES-2509350_T3.pdf


google+ twitter facebookPin it
Ilustración 1 de Novirhabdovirus recombinantes y usos de los mismos.
Ilustración 2 de Novirhabdovirus recombinantes y usos de los mismos.
Ilustración 3 de Novirhabdovirus recombinantes y usos de los mismos.
Ilustración 4 de Novirhabdovirus recombinantes y usos de los mismos.
Ver la galería de la patente con 12 ilustraciones.
Novirhabdovirus recombinantes y usos de los mismos.

Fragmento de la descripción:

Novirhabdovirus recombinantes y usos de los mismos

La presente invención se refiere al uso de novirhabdovirus como un vector génico, para producir proteínas recombinantes o para producir vacunas útiles en peces o en vertebrados superiores.

Los novirhabdovirus son virus de ARN de cadena negativa de la familia Rhabdovirídae.

El género Novirhabdovirus comprende diversas especies patógenas para animales acuáticos, en particular para peces.

La estructura del genoma novirhabdoviral es similar a la de los rhabdovirus de mamíferos, pero difiere de éstos por la presencia de un gen adicional, que codifica una proteína no estructural, denominada proteína NV (de no virión), cuya función sigue siendo desconocida en el momento actual.

El genoma novirhabdoviral comprende seis genes, cuya organización puede representarse como un diagrama de la siguiente manera:


N representa el gen que codifica la nucleoproteína asociada con el ARN viral, P representa el gen que codifica la fosfoproteína asociada con la polimerasa viral, M representa el en que codifica la proteína de matriz, G representa el gen que codifica la glucoproteína de envoltura G, NV representa el en que codifica la proteína NV y L representa el gen que codifica la ARN polimerasa viral dependiente de ARN.

Estos genes se separan por regiones intergénicas: cada una de ellas comprende una señal de terminación de la transcripción/polladenllaclón y una señal de inicio de la transcripción, que permite la transcripción de los genes a ARNm individuales, separados por un dinucleótido intergénico no transcrito.

La especie tipo del género es el Virus de Necrosis Hematopoyética Infecciosa (IHNV) que es el agente etiológico de una enfermedad grave de varias especies de salmónidos, principalmente en truchas de un año. Otras especies en el género incluyen rhabdovirus Hirame (HRV), Virus de Septicemia Hemorrágica Viral (VHSV) y rhabdovirus de Cabeza de serpiente (SKRV). La secuencia genómica completa del IHNV está disponible en GenBank con el número de acceso L4883; la secuencia genómica completa del VHSV está disponible en GenBank con el número de acceso Y18236; la secuencia genómica completa del HRV está disponible en GenBank con el número de acceso AF14985; la secuencia genómica completa del SKRV está disponible en GenBank con el número de acceso AF147498.

Pueden obtenerse novirhabdovirus recombinantes por genética inversa, transfectando conjuntamente una célula huésped con un ADN complementario antigenómico ADN (ADNc antigenómico), es decir, una copia de sentido positivo de genoma viral, y con moléculas de ADN que codifican las proteínas virales N, P y L (BIACCHESI y col., J Virol, 74, 11247-53, 2), y modificarse su genoma.

Este enfoque también permitió diferentes modificaciones para el genoma novirhabdoviral. Por ejemplo, se ha mostrado que el gen NV del virus IHN puede suprimirse y reemplazarse por un gen ajeno (BIACCHESI y col., 2, citado anteriormente; THOULOUZE y col., J Virol, 78, 498-17, 24; documento PCT WO 3/979). También se ha mostrado que era posible reemplazar las proteínas estructurales principales (M y G) de IHNV con las de VHSV (BIACCHESI y col., J Virol, 76, 2881-9, 22).

También se ha intentado insertar un gen adicional en un novirhabdovirus. (BIACCHESI, Tesis Doctoral: GENERATION DE RHABDOVIRUS AQUATIQUES RECOMBINANTS PAR GENETIQUE INVERSE, UNIVERSITE PARIS XI ORSAY, 5 de abril de 22). Se insertó una construcción de ADN que contenía un gen ajeno (que codificaba IL-1-P de la trucha arco iris) flanqueado por una señal de inicio de la transcripción y una señal de terminación de la transcripción/poliadenilación reconocida por la L polimerasa viral, en el ADNc del IHNV, en la región intergénica entre los genes M y G del IHNV. Más específicamente, ya que este gen se introdujo en un sitio de restricción de Eagl de origen natural situado entre el extremo de la ORF M y la señal de terminación de la transcripción del gen M, esta construcción comprendía una secuencia (CCAAGACAGAAAAAAATGGCAC; SEC ID N2: 1) que consistía en el sitio de terminación de la transcripción/poliadenilación predicho del gen M del IHNV (CCAAGACAGAAAAAAA; SEC ID N2: 2) seguido del dinucleótido intergénico no transcrito TG y de la secuencia de inicio de la transcripción GCAC, estando dicha secuencia inmediatamente seguida de la ORF de la IL-1-(5 flanqueada en 5 por un sitio de restricción de Spel, y en 3 por un sitio de restricción de Smal.

El virus recombinante (IHNV-IL-1) obtenido de este modo fue capaz de multiplicarse de forma normal en cultivo celular y fue tan patógeno en truchas arco iris juveniles como el IHNV de tipo silvestre. Sin embargo, se detectó solamente ARNm de IL-ip, pero no proteína IL-1-p en las células infectadas. Por otro lado, un IHNV recombinante similar, que contenía un gen que codifica la proteína verde fluorescente (GFP), acompañado de la misma señal de inicio de la transcripción y la misma señal de terminación de la transcripción/poliadenilación era capaz de expresar GFP en las células infectadas (BREMONT, Current Topics in Microbiology and Immunology 292:119-141,25).

Los inventores han encontrado ahora que cuando la secuencia de inicio de la transcripción GCAC desvelada por BIAC-CHESI o BREMONT se reemplaza por la secuencia GCACTTTTGTGC (SEC ID N2: 3), el gen adicional no solamente se transcribe sino que también se traduce, independientemente de su naturaleza, permitiendo la expresión de una amplia serie de proteínas ajenas.

La presente invención proporciona por lo tanto novirhabdovirus recombinantes que tienen una o más unidades de transcripción adicionales insertadas en al menos una de las regiones intergénicas del genoma de un novirhabdovirus huésped. La invención también proporciona construcciones de ADN recombinantes que permiten obtener dichos novirhabdovirus recombinantes.

En el presente documento, una unidad de transcripción (denominada también en el presente documento como cistrón) se define como una construcción de ADN que comprende una señal de inicio de la transcripción, seguida de una ORF que codifica una proteína de interés, y una de señal de terminación de la transcripción/poliadenilación.

La invención se refiere a una construcción de ADN recombinante que comprende:

a) una región que comprende una secuencia de terminación de la transcripción/poliadenilación del gen M de novirhabdovirus, definiéndose dicha región por la siguiente secuencia: VHHAGAYAGAAAAAAA (SEC ID N2: 4), en la que A, T, G, V, H e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

b) una región que comprende una secuencia de inicio de la transcripción del gen G novirhabdovirus, definiéndose dicha región por la siguiente secuencia: GCACDWKWGTGY (SEC ID N2: 5), en la que A, T, G, C, D, W, K e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

en la que dicha región a) está seguida o dicha región b) está precedida de un dinucleótido intergénico no transgénico de un novirhabdovirus,

c) una región que comprende una fase abierta de lectura que codifica una proteína de interés.

en la que las regiones a), b) y c) están dispuestas en un orden seleccionado del grupo que consiste en: a-b-c y b-c- a.

La secuencia de terminación/poliadenilación de la región a) y la secuencia de inicio de la región b) pueden derivar de un mismo gen o de dos genes diferentes de un novirhabdovirus. Preferentemente, derivan de uno o dos genes del novirhabdovirus en los que se pretende insertar la construcción.

El dinucleótido intergénico no transcrito se selecciona preferentemente entre TG y CG.

De acuerdo con una realización preferida, la secuencia... [Seguir leyendo]



1. Una construcción de ADN recombinante que comprende:

a) una región que comprende una secuencia de terminación de la transcripción/poliadenilación del gen M de novirhabdovirus, estando definida dicha región por la siguiente secuencia: VHHAGAYAGAAAAAAA (SEC ID N2: 4), en la que A, T, G, V, H e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

b) una región que comprende una secuencia de inicio de la transcripción del gen G de novirhabdovirus, definiéndose dicha región por la siguiente secuencia: GCACDWKWGTGY (SEC ID N2: 5), en la que A, T, G, C, D, W, K e Y tienen su significado habitual en el código de nucleótidos de IUPAC;

en la que dicha región a) está seguida o dicha región b) está precedida por un dinucleótido intergénico no transgénico de un novirhabdovirus,

c) una región que comprende una fase abierta de lectura que codifica una proteína de interés;

en la que las regiones a), b) y c) se disponen en un orden seleccionado del grupo que consiste en: a-b-c y b-c-a.

2. Un ADNc antigenómico del genoma de un novirhabdovirus, caracterizado porque contiene una o más construcciones de ADN recombinantes de la reivindicación 1, insertada en una parte de dicho ADNc comprendida entre el codón de parada de una primera ORF endógena y el codón de inicio de una segunda ORF endógena del novirhabdovirus huésped.

3. Un ADNc antigenómico de la reivindicación 2, que contiene dos construcciones de la reivindicación 1.

4. Un ADNc antigenómico de la reivindicación 2, que contiene tres construcciones de la reivindicación 1.

5. Un novirhabdovirus recombinante que contiene un ARN genómico complementario de un ADNc antigenómico de cualquiera de las reivindicaciones 2 o 4.

6. Un novirhabdovirus recombinante que contiene un ARN genómico complementario de un ADNc antigenómico de la reivindicación 4.

7. Un novirhabdovirus recombinante de cualquiera de las reivindicaciones 5 o 6, que es un IHNV recombinante.

8. El uso de un novirhabdovirus recombinante de cualquiera de las reivindicaciones 5 a 7 para producir proteínas de interés en células de peces en cultivo.

9. Un novirhabdovirus recombinante de cualquiera de las reivindicaciones 6 o 7 para uso como una vacuna atenuada viva.

1. Un novirhabdovirus recombinante de cualquiera de las reivindicaciones 5 a 7 para uso como un sistema de administración de antígeno para la vacunación de aves o mamíferos.

11. El uso de un IHNV o VHSV recombinante que comprende una construcción de ADN recombinante de la reivindicación 1, que codifica una proteína antigénica de interés, para expresar dicha proteína in vitro en un sistema de expresión de baja temperatura.

12. Un sistema de expresión in vitro de baja temperatura, caracterizado porque dicho sistema de expresión comprende un IHNV o VHSV recombinante que comprende al menos una construcción de ADN recombinante de la reivindicación 1, que codifica una proteína antigénica de interés y una célula de vertebrado susceptible de infección por dicho virus recombinante y capaz de crecer a baja temperatura.

13. Un procedimiento para expresar in vitro una proteína antigénica de interés, comprendiendo dicho procedimiento: infectar una célula de vertebrado susceptible de infección por IHNV o VHSV y capaz de crecer a baja temperatura con un IHNV o VHSV recombinante que comprende al menos una construcción de ADN recombinante de la reivindicación 1, que codifica una proteína antigénica de interés;

- cultivar dicha célula a una temperatura de aproximadamente 14 2C a aproximadamente 2 2C; recuperar la proteína antigénica de interés producida por dicha célula.