Medios y métodos para contrarrestar, demorar y/o prevenir cambios adversos del metabolismo energético en enfermedades del corazón.

Una secuencia de ácidos nucleicos con una longitud de al menos 19 nucleótidos con una identidad de la secuencia de al menos el 90% con el complemento de un ácido nucleico que comprende al menos 19 nucleótidos consecutivos de la secuencia ACAGCAGGCACAGACAGGCAGU

, para uso en el tratamiento, disminución, demora y/o prevención de una enfermedad del corazón.

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E13158674.


Nacionalidad solicitante: Países Bajos.

Dirección: Minderbroedersberg 4-6 6211 LK Maastricht PAISES BAJOS.

Inventor/es: .

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/113 (Acidos nucleicos no codificantes que modulan la expresión de genes, p.ej. oligonucleótidos antisentido)

PDF original: ES-2531964_T3.pdf


google+ twitter facebook

Fragmento de la descripción:

Medios y métodos para contrarrestar, demorar y/o prevenir cambios adversos del metabolismo energético en enfermedades del corazón

La invención se refiere a los sectores de la biología molecular y la medicina, más específicamente al tratamiento, demora y prevención de enfermedades del corazón.

Las enfermedades del corazón, también denominadas enfermedades cardiovasculares, es una expresión amplia utilizada para describir una gama de enfermedades que afectan al corazón y/o vasos sanguíneos. Las afecciones incluyen enfermedad de las arterias coronarias, ataque al corazón, hipertensión sanguínea, apoplejía e insuficiencia cardíaca. La enfermedad cardiovascular es el asesino mundial número 1 de hombres y mujeres, p. ej. en los Estados Unidos de América es la responsable del 40 por ciento de todas las muertes, más que todas las formas de cáncer combinadas.

Una forma común de enfermedad cardiovascular es la enfermedad de las arterias coronarias la cual afecta a las arterias que suministran con sangre al miocardio. Aveces, conocidas como CAD (siglas en inglés), la enfermedad de las arterias coronarias es la causa principal de ataques al corazón. Generalmente, esto significa que la sangre que fluye a través de las arterias coronarias ha quedado obstruida, reducido el flujo sanguíneo al miocardio. La causa más común de obstrucciones de este tipo es una afección denominada aterosclerosis, un tipo de enfermedad vascular ampliamente prevenible. La enfermedad de las arterias coronarias y el resultante flujo sanguíneo reducido al miocardio puede conducir a otros problemas cardíacos tales como dolor de pecho (angina) y ataque al corazón (infarto de miocardio).

Un ataque al corazón es una lesión al miocardio provocada por una pérdida de suministro de sangre. La expresión médica para el ataque al corazón es infarto de miocardio, a menudo abreviado como MI (siglas en inglés). Un ataque al corazón se produce habitualmente cuando un coágulo bloquea el flujo de sangre a través de una arteria coronaria - un vaso sanguíneo que alimenta sangre a una parte del miocardio. El flujo sanguíneo interrumpido al corazón puede lesionar o destruir una parte del miocardio.

Una enfermedad del corazón que afecta al miocardio propiamente dicho es la denominada cardiomiopatía. Algunos tipos de cardiomiopatía son genéticos, mientras que otros se producen por razones que no se comprenden tan bien. Tipos de cardiomiopatía incluyen la isquémica, que es provocada por pérdida del miocardio debido a un flujo sanguíneo coronario reducido; dilatada, que significa que las cámaras del corazón están dilatadas, hipertrófica, que significa que el miocardio está engrosado; e idiopática, que significa que la causa es desconocida. Uno de los tipos más comunes de cardiomiopatía es la cardiomiopatía idiopática dilatada - un corazón dilatado sin una causa conocida.

Las enfermedades del corazón pueden ser adquiridas (en una fase posterior de la vida) o congénitas. Enfermedad del corazón congénita se refiere a una forma de enfermedad del corazón que se desarrolla antes del nacimiento (congénita). Una enfermedad del corazón congénita es una expresión amplia e incluye una amplia gama de enfermedades y afecciones. Estas enfermedades pueden afectar a la formación del miocardio o a sus cámaras o válvulas. Incluyen afecciones tales como el estrechamiento de una sección de la aorta (coartación) u orificios en el corazón (defecto septal atrial o ventricular). Algunos defectos congénitos del corazón pueden manifestarse en el nacimiento, mientras que otros pueden no detectarse hasta una etapa posterior en la vida.

Junto al miocardio propiamente dicho, las enfermedades del corazón pueden afectar también a otras estructuras tales como las válvulas del corazón. Cuatro válvulas dentro del corazón mantienen fluyendo a la sangre en la dirección correcta. Las válvulas pueden ser dañadas por una diversidad de afecciones que conducen a un estrechamiento (estenosis), filtración (regurgitación o insuficiencia) o cierre impropio (prolapso). La enfermedad valvular puede ser congénita o las válvulas pueden ser dañadas por afecciones tales como fiebre reumática, infecciones (endocarditis infecciosa), trastornos del tejido conjuntivo y determinadas medicaciones o tratamientos de radiación contra el cáncer.

Problemas del ritmo cardíaco (arritmias) se producen cuando los impulsos eléctricos en un corazón que coordina los latidos no funcionan adecuadamente, provocando que dicho corazón lata demasiado rápido, demasiado lento o de manera irregular. Otras formas de enfermedades cardiovasculares pueden provocar indirectamente arritmias.

Quizás, la forma más común de enfermedad cardiovascular en el mundo occidental, que afecta aproximadamente a uno de cuatro americanos, es la hipertensión arterial (hipertensión) que significa que la sangre es bombeada con

una fuerza excesiva a través de los vasos sanguíneos. A pesar de que potencialmente constituye una amenaza para la vida, es uno de los tipos más prevenibles y tratables de enfermedades cardiovasculares. La hipertensión también provoca muchos otros tipos de enfermedades cardiovasculares tales como apoplejía e insuficiencia cardiaca.

La insuficiencia cardíaca, un trastorno progresivo en el que la lesión del corazón provoca un debilitamiento del sistema cardiovascular, puede resultar de cualquiera de los trastornos cardíacos estructurales o funcionales antes mencionados. Se manifiesta mediante una congestión del fluido o un flujo inadecuado de la sangre a los tejidos como resultado de la incapacidad del corazón de llenar o bombear una cantidad suficiente de sangre a través del cuerpo.

Dependiendo del lado del corazón afectado, los síntomas pueden ser diversos y el diagnóstico es imposible basándose solamente en los síntomas. La insuficiencia cardiaca del lado izquierdo tiene como resultado la congestión de las venas pulmonares y síntomas que reflejan esto, asi como una deficiente circulación al cuerpo, mientras que la insuficiencia cardiaca del lado de la derecha se presenta, p. ej., con edema periférico y nocturia.

La insuficiencia cardíaca puede resultar de una o de la suma de muchas causas. Muchas insuficiencias afectan a ambos lados, tales como la enfermedad del corazón isquémica, arritmias crónicas, cardiomiopatía, fibrosis cardiaca, anemia crónica severa y enfermedad del tiroides, mientras que otras, tales como la hipertensión, enfermedad de la válvula aórtica y mitral y la coartación provocan preferiblemente una insuficiencia cardíaca en el lado izquierdo y una hipertensión pulmonar, y la enfermedad pulmonar o de la válvula tricúspide resulta a menudo en una insuficiencia cardíaca del lado de la derecha.

Estas causas de insuficiencia cardíaca tienen en común el que todas ellas reducen la eficacia del miocardio, o músculo del corazón, a través de una lesión o sobrecarga. Con el tiempo, el incremento resultante en la carga de trabajo producirá cambios en el propio corazón que incluyen, por ejemplo, una capacidad de contracción reducida, un volumen sistólico reducido, una capacidad disponible reducida, ritmo cardiaco incrementado, hipertrofia del miocardio y/o dilatación de los ventrículos. Estos cambios en el corazón tienen como resultado un gasto cardíaco reducido y una sobrecarga Incrementada del corazón, lo que aumenta el riesgo de un paro cardíaco y reduce el suministro de sangre al resto del cuerpo.

El tratamiento actual de la Insuficiencia cardíaca se centra en el tratamiento de los síntomas y signos y en la prevención del progreso de la enfermedad. El tratamiento Incluye ejercicio, comer alimentos sanos, reducir los alimentos salados y abstenerse de fumar y de beber alcohol. Además, se puede aplicar... [Seguir leyendo]



1.- Una secuencia de ácidos nucleicos con una longitud de al menos 19 nucleótidos con una identidad de la secuencia de al menos el 90% con el complemento de un ácido nucleico que comprende al menos 19 nucleótidos consecutivos de la secuencia ACAGCAGGCACAGACAGGCAGU, para uso en el tratamiento, disminución, demora y/o prevención de una enfermedad del corazón.

2.- Un vector que comprende una secuencia de ácidos nucleicos con una longitud de al menos 19 nucleótidos con una identidad de la secuencia de al menos el 90% con el complemento de un ácido nucleico que comprende al menos 19 nucleótidos consecutivos de la secuencia ACAGCAGGCACAGACAGGCAGU, para uso en el tratamiento, disminución, demora y/o prevención de una enfermedad del corazón.

3.- Un vector para uso de acuerdo con la reivindicación 2, en donde el vector es un vector retroviral, adenoviral, viral adeno-asoclado o lentiviral.

4.- Un vector para uso de acuerdo con cualquiera de las reivindicaciones 2 ó 3, en donde el vector comprende un promotor adecuado para la expresión en una célula de mamífero, en donde el promotor está enlazado de modo operativo a una secuencia de ácidos nucleicos capaz de aumentar la expresión, cantidad o actividad de PPAR6.

5.- Un vector para uso de acuerdo con la reivindicación 4, en donde la célula de mamífero es una célula del miocardio.

6.- Una célula aislada que comprende una secuencia de ácidos nucleicos con una longitud de al menos 19 nucleótidos con una identidad de la secuencia de al menos el 90% con el complemento de un ácido nucleico que comprende al menos 19 nucleótidos consecutivos de la secuencia ACAGCAGGCACAGACAGGCAGU, para uso en el tratamiento, disminución, demora y/o prevención de una enfermedad del corazón.

7 - Una célula aislada para uso de acuerdo con la reivindicación 6, en donde la célula es una célula de mamífero.

8 - Una célula aislada para uso de acuerdo con cualquiera de las reivindicaciones 6 ó 7, en donde la célula es una

célula del miocardio.

9.- Un ácido nucleico para uso de acuerdo con la reivindicación 1, un vector para uso de acuerdo con cualquiera de las reivindicaciones 2 a 5 o una célula aislada para uso de acuerdo con cualquiera de las reivindicaciones 6 a 8, en donde dicha enfermedad del corazón se selecciona del grupo que consiste en una enfermedad cardíaca hipertrófica, insuficiencia cardíaca, una afección después de isquemia del corazón, diabetes, hipertensión y una enfermedad del corazón congénita de brote temprano o tardío.

10.- Un método in vitro para determinar si un compuesto candidato es capaz de contrarrestar, demorar y/o prevenir una enfermedad del corazón, que comprende los pasos de:

- poner en contacto dicho compuesto candidato con una célula aislada y/o un animal de ensayo no humano con una expresión incrementada de miR-214 (ACAGCAGGCACAGACAGGCAGU),

medir un valor que refleje la expresión, cantidad y/o actividad de PPAR5,

- comparar dicho valor con el valor correspondiente de una célula o animal de ensayo no humano no expuesto a dicho compuesto candidato,

en donde una expresión, cantidad y/o actividad incrementada de PPAR5 con relación a dicha célula o animal no humano no expuesto a dicho compuesto candidato, indica que dicho compuesto candidato es capaz de contrarrestar, demorar y/o prevenir una enfermedad del corazón.