Composiciones y procedimientos para formulaciones de oligonucleótidos.

Un oligonucleótido inmunoestimulante que comprende:

un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas

, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud mediante un espaciador,

en donde el oligonucleótido incluye al menos un dinucleótido CpG no metilado, en donde el oligonucleótido tiene la fórmula 5' XP1SP2T 3', en la que X es el dominio de activación de TLR, P1 es un palíndromo, S es un espaciador, P2 es un palíndromo y T es una cola en 3' de 0-100 nucleótidos de

longitud, en la que S es un ácido nucleico que tiene una longitud de 1-50 nucleótidos,

en el que un "palíndromo" o "región palindrómica" es una secuencia de ácido nucleico que es su complemento inverso perfecto.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2007/003964.

Solicitante: AdiuTide Pharmaceuticals GmbH.

Nacionalidad solicitante: Alemania.

Dirección: Alt Fechenheim 34 60386 Frankfurt am Main ALEMANIA.

Inventor/es: KRIEG, ARTHUR, M., UHLMANN, EUGEN, DR., SAMULOWITZ,Ulrike, VOLLMER,JOERG, NOLL,BERNHARD O.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K48/00 (Preparaciones medicinales que contienen material genético que se introduce en las células del cuerpo vivo para tratar enfermedades genéticas; Terapia génica)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen ingredientes... > A61K31/70 (Hidratos de carbono; Azúcares; Sus derivados (sorbitol A61K 31/047))
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/117 (Acidos nucleicos que tienen propiedades inmunomoduladoras, p.ej. que contienen motivos CpG)
google+ twitter facebookPin it
Ilustración 1 de Composiciones y procedimientos para formulaciones de oligonucleótidos.
Ilustración 2 de Composiciones y procedimientos para formulaciones de oligonucleótidos.
Ilustración 3 de Composiciones y procedimientos para formulaciones de oligonucleótidos.
Ilustración 4 de Composiciones y procedimientos para formulaciones de oligonucleótidos.
Ver la galería de la patente con 13 ilustraciones.
Composiciones y procedimientos para formulaciones de oligonucleótidos.

Texto extraído del PDF original:

DESCRIPCIÓN

Composiciones y procedimientos para formulaciones de oligonucleótidos

Campo de la invención La presente invención se refiere en general a composiciones de ácidos nucleicos inmunoestimulantes, a composiciones de los mismos y a procedimientos para usar los ácidos nucleicos inmunoestimulantes.

Antecedentes de la invención El cáncer es la segunda causa principal de muerte en los Estados Unidos, produciendo una de cada cuatro muertes. En 1997, el número total estimado de nuevos diagnósticos de cáncer de pulmón, mama, próstata, colorrectal y de ovario era de aproximadamente dos millones. Debido a la población cada vez más envejecida en los Estados Unidos, es razonable esperar que continúen aumentando las tasas de incidencia del cáncer. El asma es una enfermedad inflamatoria crónica que afecta a 14-15 millones personas solo en los Estados Unidos. La enfermedad infecciosa es una de las principales causas de muerte en el mundo. Solo en los Estados Unidos, la tasa de muerte debida a enfermedad infecciosa aumentó al 58 % entre 1980 y 1992. Durante este tiempo, el uso de terapias anti-infecciosas para combatir la enfermedad infecciosa ha crecido significativamente y ahora es una industria de múltiples miles de millones de dólares al año. Incluso con estos aumentos en el uso de agentes anti- infecciosos, el tratamiento y la prevención de la enfermedad infecciosa sigue siendo un reto para la comunidad médica en el mundo.

El ADN bacteriano tiene efectos inmunoestimulantes para activar los linfocitos B y los linfocitos citolíticos espontáneos, pero no el ADN de vertebrado (Tokunaga, T. y col., 1988. Jpn. J. Cancer Res. 79:682-686; Tokunaga, T. y col., 1984, JNCI 72:965-962; Messina, J.P. y col., 1991, J. Immunol. 147:1759-1764; y revisado en Krieg, 1998, en: Applied Oligonucleotide Technology, C.A. Stein y A.M. Krieg, (Eds.), John Wiley and Sons, Inc., New York, NY, pág. 431-448). Ahora se ha entendido que estos efectos inmunoestimulantes del ADN bacteriano son un resultado de la presencia de dinucleótidos CpG no metilados en contextos de bases particulares (motivos CpG), que son comunes en ADN bacteriano, pero están metilados e infrarepresentados en ADN de vertebrado (Krieg y col., 1995 Nature 374:546-549; Krieg, 1999 Biochim. Biophys. Acta 93321:1-10). Los efectos inmunoestimulantes del ADN bacteriano puede ser imitados con oligodesoxinucleótidos (ODN) sintéticos que contienen estos motivos CpG. Tales ODN CpG tienen efectos altamente estimulantes sobre los leucocitos humanos y murinos, induciendo proliferación de linfocitos B; secreción de citocinas e inmunoglobulinas; actividad lítica de linfocitos citolíticos espontáneos (NK) y secreción de IFN-γ; y activación de células dendríticas (DC) y otras células presentadoras de antígeno para expresar moléculas co-estimulantes y secretar citocinas, especialmente las citocinas similares a Th1 que son importantes en promover el desarrollo de las respuestas de linfocitos T similares a Th1. Yamamoto y col (1992) J Immunol 148: 4072-4076 demostraron que las secuencias palindrómicas fosfodiéster que contienen dinucleótidos de CpG son directamente responsables de la secreción de interferones. Iho y col (1999) J Immunol 163: 3642-3652 describieron que las secuencias palindrómicas fosfodiéster que contienen dinucleótidos de CpG activan a las células NK e inducen la producción de IFN-γ. Los efectos inmunoestimulantes de ODN CpG de esqueleto de fosfodiéster nativo son altamente específicos de CpG porque los efectos se reducen espectacularmente si el motivo CpG está metilado, se cambia a un GpC, o se elimina o altera de otro modo (Krieg y col., 1995 Nature 374:546-549; Hartmann y col., 1999 Proc. Natl. Acad. Sci USA 96:9305-10). En estudios previos, se creyó que el motivo CpG inmunoestimulante siguió la fórmula purina-purina-CpG-pirimidina- pirimidina (Krieg y col., 1995 Nature 374:546-549; Pisetsky, 1996 J. Immunol. 156:421-423; Hacker y col., 1998 EMBO J. 17:6230-6240; Lipford y col., 1998 Trends in Microbiol. 6:496-500). Sin embargo, ahora está claro que los linfocitos de ratón respondieron bastante bien a motivos CpG de fosfodiéster que no siguen esta "fórmula" (Yi y col., 1998 J. Immunol. 160:5898-5906) y lo mismo es cierto de linfocitos B humanos y células dendríticas (Hartmann y col., 1999 Proc. Natl. Acad. Sci USA 96:9305-10; Liang, 1996 J. Clin. Invest. 98:1119-1129).

Recientemente se han descrito varias clases diferentes de oligonucleótidos CpG. Una clase es potente para activar linfocitos B, pero es relativamente débil en inducir IFN-α y la activación de células NK; esta clase se ha llamado la clase B. Los oligonucleótidos CpG de clase B normalmente están completamente estabilizados e incluyen un dinucleótido CpG no metilado dentro de ciertos contextos de bases preferidos. Véanse, por ejemplo, las patentes de EE.UU. n.º 6.194.388; 6.207.646; 6.214.806; 6.218.371; 6.239.116; y 6.339.068. Otra clase de oligonucleótidos CpG activan linfocitos B y células NK e inducen IFN-α; esta clase se ha llamado la clase C. Los oligonucleótidos CpG de clase C, como primero se caracterizaron, normalmente están completamente estabilizados; incluyen una secuencia tipo de clase B y un palíndromo rico en GC o casi palíndromo. Esta clase se ha descrito en la solicitud de patente provisional de EE.UU. en tramitación junto con la presente 60/313.273, presentada el 17 de agosto de 2001 y el documento US 10/224.523, presentado el 19 de agosto de 2002 y la solicitud de patente PCT PCT/US02/26468 relacionada publicada bajo el número de publicación internacional WO 03/015711. En el documento WO 2004/016805 A2 se desvelan varios oligonucleótidos CpG de Clase C. Kandimalla y col. (2002) Current Opinion in Molecular Therapeutics Vol 4 n.º 2 resume características estructurales y químicas de oligonucleótidos CpG que son importantes para el reconocimiento molecular. Las distintas actividades inmunomoduladoras de los oligonucleótidos CpG de clase A, clase B y clase C se han caracterizado en Vollmer y col. (2004) Eur. J. Immunol. 34: 251-262. Sumario de la invención La presente invención se define en las reivindicaciones adjuntas.

La presente invención se refiere en parte a oligonucleótidos que contienen CpG inmunoestimulantes, en particular a una nueva clase de oligonucleótidos inmunoestimulantes llamados la clase P. Originalmente, la estructura de los oligonucleótidos CpG no se consideró que fuera particularmente importante para la activación inmunitaria, pero posteriormente se supo que los oligonucleótidos que contienen motivos poli G en uno o ambos extremos (clase A), u oligonucleótidos con un palíndromo en 3' (clase C), indujeron mayores niveles de activación de células NK y secreción de IFN-α por pDC que los oligonucleótidos sin potencial para formar estructuras secundarias. Los oligonucleótidos de clase A pueden formar estructuras de mayor orden muy complejas tales como nanopartículas (Kerkmann y col., J. Biol Chem. (2005) 280(9):8086-93.) y la clase C puede formar dúplex intermoleculares u horquillas. La presente invención se refiere a la identificación de una nueva subclase de oligonucleótidos CpG, que contiene regiones formadoras de dúplex tales como, por ejemplo, palíndromos perfectos o imperfectos en o próximos a ambos de los extremos 5' y 3', dándoles el potencial de formar concatémeros. Estos oligonucleótidos denominados oligonucleótidos de clase P tienen la capacidad en algunos casos de inducir niveles mucho más altos de secreción de IFN-α que la clase C. Los oligonucleótidos de clase P tienen la capacidad de auto-ensamblarse espontáneamente en concatémeros tanto in vitro como in vivo. Sin desear quedar ligado a teoría particular alguna para el procedimiento de acción de estas moléculas, una posible hipótesis es que esta propiedad dota a los oligonucleótidos de clase P de la capacidad para reticular más altamente TLR9 dentro de ciertas células inmunitarias, induciendo un patrón distinto de activación inmunitaria en comparación con las clases previamente descritas de oligonucleótidos CpG.

En un aspecto de la invención el oligonucleótido inmunoestimulante contiene un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud tanto directamente como mediante un espaciador, en el que el oligonucleótido incluye al menos una CpG no metilada y en la que el nucleótido tiene la fórmula 5’ XP1SP2T 3’, en la que X es el dominio activador de TLR, P1 es un palíndromo, S es un espaciador, P2 es un palíndromo y T es una cola 3’ de 0-100 nucleótidos de longitud, en el que el "palíndromo" o "región palindrómica" es una secuencia de ácido nucleico que está en su propio complemento inverso perfecto. En otra realización, el dominio de activación de TLR es TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT o TTTT. En otra realización adicional, la región palindrómica en 5' tiene al menos 8 nucleótidos de longitud. En otra realización, la región palindrómica en 3' tiene al menos 10 nucleótidos de longitud. En otra realización, la región palindrómica en 5' tiene al menos 10 nucleótidos de longitud. En otra realización más, la región palindrómica en 3' incluye un dinucleótido CpG no metilado. En otra realización, la región palindrómica en 3' incluye dos dinucleótidos CpG no metilados. En otra realización, la región palindrómica en 5' incluye un dinucleótido CpG no metilado. En otra realización más, la región palindrómica en 5' incluye dos dinucleótidos CpG no metilados. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 25. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 30. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 35. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 40. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 45. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 50. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 55. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 60. En otra realización, las regiones palindrómicas de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 65.

En una realización, el espaciador es un ácido nucleico que tiene una longitud de 1-50 nucleótidos. En otra realización, el espaciador es un ácido nucleico que tiene una longitud de 1 nucleótido. En otra realización, el espaciador es un espaciador de no nucleótido. En una realización, el espaciador de no nucleótido es un espaciador D. En otra realización, el espaciador de no nucleótido es un conector.

En una realización, el oligonucleótido tiene la fórmula 5' XP1SP2T 3' en la que X es el dominio de activación de TLR, P1 es un palíndromo, S es un espaciador, P2 es un palíndromo y T es una cola en 3' de 0-100 nucleótidos de longitud. En una realización, X es TCG, TTCG o TTTCG. En otra realización, T tiene 5-50 nucleótidos de longitud. En otra realización más, T tiene 5-10 nucleótidos de longitud. En una realización, S es un ácido nucleico que tiene una longitud de 1-50 nucleótidos. En otra realización, S es un ácido nucleico que tiene una longitud de 1 nucleótido.

En otra realización, S es un espaciador de no nucleótido. En una realización, el espaciador de no nucleótido es un espaciador D. En otra realización, el espaciador de no nucleótido es un conector. En otra realización, el oligonucleótido no es un oligonucleótido antisentido o una ribozima. En una realización, P1 es rico en A y T. En otra realización, P1 incluye al menos 4 T. En otra realización, P2 es un palíndromo perfecto. En otra realización, P2 es rico en G-C. En otra realización adicional, P2 es CGGCGCX1GCGCCG (SEC ID Nº: 334) en la que X1 es T o nada.

En una realización, el oligonucleótido incluye al menos un enlace fosforotioato. En otra realización, todos los enlaces internucleotídicos del oligonucleótido son enlaces fosforotioato. En otra realización, el oligonucleótido incluye al menos un enlace similar a fosfodiéster. En otra realización, el enlace similar a fosfodiéster es un enlace fosfodiéster. En otra realización, un grupo lipófilo está conjugado con el oligonucleótido. En una realización, el grupo lipófilo es colesterol.

Otro aspecto de la invención es un oligonucleótido inmunoestimulante con un dominio de activación de TLR en 5' y al menos dos regiones que contienen complementariedad, una región que contiene complementariedad en 5' y una en 3', teniendo cada región que contiene complementariedad al menos 8 nucleótidos de longitud y conectadas entre sí tanto directamente como mediante un espaciador, en el que el oligonucleótido incluye al menos un dinucleótido CpG no metilado y en el que al menos una de las regiones que contienen complementariedad no es un palíndromo perfecto y en el que el dominio de activación de TLR es inmediatamente en 5’ con respecto al 5’ de la región que contiene complementariedad. En otra realización, el dominio de activación de TLR es TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT o TTTT. En otra realización la región que contiene complementariedad en 3’ tiene al menos 10 nucleótidos de longitud. En otra realización más, la región que contiene complementariedad en 5' tiene al menos 10 nucleótidos de longitud. En una realización, la región que contiene complementariedad en 3' incluye un dinucleótido CpG no metilado. En otra realización, la región que contiene complementariedad en 3' incluye dos dinucleótidos CpG no metilados. En otra realización más, la región que contiene complementariedad en 5' incluye un dinucleótido CpG no metilado. En otra realización, la región que contiene complementariedad en 5' incluye dos dinucleótidos CpG no metilados. En otra realización, las regiones que contienen complementariedad incluyen al menos un análogo de nucleótido. En otra realización, las regiones que contienen complementariedad forman un dúplex intramolecular. En una realización, el dúplex intramolecular incluye al menos un par de bases de no Watson Crick. En otra realización, el par de bases de no Watson Crick es G-T, G-A, G-G o C-A. En una realización, las regiones que contienen complementariedad forman dúplex intermoleculares. En otra realización, al menos uno de los dúplex intermoleculares incluye al menos un par de bases de no Watson Crick. En otra realización, el par de bases de no Watson Crick es G-T, G-A, G-G o C-A. En otra realización más, las regiones que contienen complementariedad contienen un desapareamiento. En otra realización adicional, las regiones que contienen complementariedad contienen dos desapareamientos. En otra realización, las regiones que contienen complementariedad contienen un nucleótido interviniente. En otra realización, las regiones que contienen complementariedad contienen dos nucleótidos intervinientes. En una realización, las regiones que contienen complementariedad de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 25. En otra realización, las regiones que contienen complementariedad de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 30. En otra realización, las regiones que contienen complementariedad de 5' y 3' tienen un valor de estabilidad del dúplex de al menos 35. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 40. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 45. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 50. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 55. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 60. En otra realización, las regiones que contienen complementariedad tienen un valor de estabilidad del dúplex de al menos 65.

En otra realización, las dos regiones que contienen complementariedad están conectadas directamente. En otra realización, las dos regiones palindrómicas están conectadas mediante un enlace 3'-3'. En otra realización más, las dos regiones que contienen complementariedad se solapan en un nucleótido. En otra realización, las dos regiones que contienen complementariedad se solapan en dos nucleótidos. En otra realización las dos regiones que contienen complementariedad no se solapan. En otra realización las dos regiones que contienen complementariedad están conectadas por un espaciador. En otra realización, el espaciador es un ácido nucleico que tiene una longitud de 1-50 nucleótidos. En otra realización, el espaciador es un ácido nucleico que tiene una longitud de 1 nucleótido. En una realización, el espaciador es un espaciador de no nucleótido. En otra realización, el espaciador de no nucleótido es un espaciador D. En otra realización más, el espaciador de no nucleótido es un conector.

En una realización, el oligonucleótido tiene la fórmula 5' XNSPT 3', en la que X es el dominio de activación de TLR, N es un palíndromo no perfecto, P es un palíndromo, S es un espaciador y T es una cola en 3' de 0-100 nucleótidos de longitud. En otra realización, X es TCG, TTCG o TTTCG. En otra realización, T tiene 5-50 nucleótidos de longitud. En otra realización, T tiene 5-10 nucleótidos de longitud. En otra realización, S es un ácido nucleico que tiene una longitud de 1-50 nucleótidos. En otra realización, S es un ácido nucleico que tiene una longitud de 1 nucleótido. En otra realización, S es un espaciador de no nucleótido. En otra realización, el espaciador de no nucleótido es un espaciador D. En otra realización, el espaciador de no nucleótido es un conector. En otra realización, el oligonucleótido no es un oligonucleótido antisentido o una ribozima. En otra realización, N es rico en A y T. En otra realización, N incluye al menos 4 T. En otra realización, P es un palíndromo perfecto. En otra realización, P es rico en G-C. En otra realización, P es CGGCGCX1GCGCCG (SEC ID Nº: 334), en la que X1 es T o nada. En otra realización, el oligonucleótido incluye al menos un enlace fosforotioato. En otra realización, todos los enlaces internucleotídicos del oligonucleótido son enlaces fosforotioato. En otra realización, el oligonucleótido incluye al menos un enlace similar a fosfodiéster. En otra realización, el enlace similar a fosfodiéster es un enlace fosfodiéster. En otra realización, un grupo lipófilo está conjugado con el oligonucleótido. En una realización, el grupo lipófilo es colesterol.

Otro aspecto de la invención proporciona composiciones terapéuticas de los oligonucleótidos anteriormente mencionados. En una realización la composición incluye una mezcla de oligonucleótidos inmunoestimulantes formadores de dúplex formulados en un tampón de baja salinidad y que incluye un soluto. En una realización, el soluto es un aminoácido. En una realización, el aminoácido tiene una cadena lateral hidrófoba. En otra realización, el aminoácido es isoleucina. En otra realización adicional, el aminoácido es glicina. En otra realización, el aminoácido tiene una cadena lateral cargada. En otra realización, el soluto es un alcohol. En una realización, el alcohol es un sacárido. En algunas realizaciones, el sacárido es dextrosa, fructosa, lactosa, sacarosa, ribosa, arabinosa o un disacárido. En una realización, los oligonucleótidos inmunoestimulantes formadores de dúplex son cualesquiera de los oligonucleótidos anteriormente mencionados. En otra realización, la composición incluye al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex diferentes que tienen secuencias de nucleótidos diferentes. En otra realización, la composición incluye al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex que tienen las mismas secuencias de nucleótidos entre sí. En otra realización, cada oligonucleótido inmunoestimulante formador de dúplex incluye al menos una secuencia formadora de dúplex. En otra realización, cada oligonucleótido inmunoestimulante formador de dúplex incluye al menos dos secuencias formadoras de dúplex. En otra realización, cada secuencia formadora de dúplex tiene un valor de estabilidad del dúplex de al menos 25. En otra realización, cada secuencia formadora de dúplex tiene un valor de estabilidad del dúplex de al menos 30. En otra realización, cada secuencia formadora de dúplex tiene un valor de estabilidad del dúplex de al menos 35. En otra realización, los oligonucleótidos inmunoestimulantes formadores de dúplex incluyen al menos una secuencia de poli G que tiene 4 nucleótidos G consecutivos.

Otro aspecto de la divulgación es un procedimiento de preparación de una mezcla sustancialmente homogénea de oligonucleótidos, identificando oligonucleótidos inmunoestimulantes formadores de dúplex y formulando los oligonucleótidos inmunoestimulantes formadores de dúplex en un tampón de baja salinidad y un soluto para producir una mezcla sustancialmente homogénea de oligonucleótidos.

Otro aspecto de la divulgación es una composición de una mezcla de al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex diferentes, en la que los al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex diferentes tienen cada uno un dominio de activación de TLR en 5' que incluye un dinucleótido CpG no metilado y una secuencia formadora de dúplex en 3' de al menos 8 nucleótidos de longitud, en la que la secuencia formadora de dúplex en 3' de cada uno de los al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex diferentes son complementarias entre sí y en la que los al menos dos oligonucleótidos inmunoestimulantes formadores de dúplex diferentes tienen 11-100 nucleótidos de longitud. En una realización la composición incluye un tampón de baja salinidad y un soluto. En otra realización, el dominio de activación de TLR es TCG, TTCG o TTTCG. En una realización, el dominio de activación de TLR está conectado directamente a la secuencia formadora de dúplex en 3'. En otra realización, las dos regiones palindrómicas están conectadas mediante un enlace 3'-3'. En otra realización, el dominio de activación de TLR y la secuencia formadora de dúplex en 3' están conectados mediante un espaciador. En una realización, el espaciador es un ácido nucleico que tiene una longitud de 1-50 nucleótidos. En otra realización, el espaciador es un ácido nucleico que tiene una longitud de 1 nucleótido. En otra realización más, el espaciador es un espaciador de no nucleótido. En otra realización más, el espaciador de no nucleótido es un espaciador D. En otra realización, el espaciador de no nucleótido es un conector. En una realización, el oligonucleótido incluye al menos un enlace fosforotioato. En otra realización, todos los enlaces internucleotídicos del oligonucleótido son enlaces fosforotioato. En otra realización, el oligonucleótido incluye al menos un enlace similar a fosfodiéster. En otra realización, el enlace similar a fosfodiéster es un enlace fosfodiéster. En otra realización, un grupo lipófilo está conjugado con el oligonucleótido. En otra realización, el grupo lipófilo es colesterol.

Otro aspecto de la divulgación es un procedimiento para tratar el cáncer administrando a un sujeto en necesidad del mismo cualquiera de los nucleótidos anteriormente mencionados o cualquiera de las composiciones anteriormente mencionadas en una cantidad eficaz para tratar el cáncer. En una realización, el tratamiento contra el cáncer se administra al sujeto. En otra realización, el tratamiento contra el cáncer es quimioterapia. En otra realización, el tratamiento contra el cáncer es radiación. En otra realización, el tratamiento contra el cáncer incluye un anticuerpo. Otro aspecto de la divulgación es un procedimiento para tratar el asma administrando a un sujeto en necesidad del mismo cualquiera de los oligonucleótidos anteriormente mencionados o cualquiera de las composiciones anteriormente mencionadas en una cantidad eficaz para tratar asma. En una realización, un tratamiento para el asma adicional se co-administra al sujeto.

Otro aspecto de la divulgación es un procedimiento para tratar la alergia administrando a un sujeto en necesidad uno cualquiera de los oligonucleótidos anteriormente mencionados o cualquiera de las composiciones anteriormente mencionadas en una cantidad eficaz para tratar alergia. En una realización, un tratamiento para la alergia adicional se administra al sujeto. En una realización, el sujeto tiene rinitis alérgica. En otra realización, el sujeto tiene alergia ocular. Otro aspecto de la divulgación es un procedimiento para modular una respuesta inmunitaria en un sujeto administrando a un sujeto en necesidad del mismo uno cualquiera de los oligonucleótidos anteriormente mencionados o cualquiera de las composiciones anteriormente mencionadas en una cantidad eficaz para modular una respuesta inmunitaria. En una realización, un inmunomodulador adicional se administra al sujeto. En otra realización, el oligonucleótido o la composición se administran al sujeto para tratar enfermedad autoinmunitaria en el sujeto. En otra realización, el oligonucleótido o la composición se administran al sujeto para tratar una enfermedad inflamatoria en el sujeto. En otra realización, el oligonucleótido o la composición se administran al sujeto para tratar remodelación de las vías respiratorias en el sujeto. En otra realización, el oligonucleótido o la composición se administran sin un antígeno al sujeto. En otra realización más, el oligonucleótido o la composición se administran por una vía seleccionada del grupo que consiste en oral, nasal, sublingual, intravenosa, subcutánea, mucosal, ocular, respiratoria, inyección directa y dérmicamente. En otra realización, el oligonucleótido o la composición se administran al sujeto en una cantidad eficaz para inducir expresión de citocinas y/o quimiocinas. En otra realización, la citocina y/o quimiocina está seleccionada del grupo que consiste en IFN-α, IFN-β, IL-28, IL-29, IFN-ω, TNF-α, IL-10, IL-6, IFN-γ, IP-10, MCP-1 y IL-12. Otro aspecto de la divulgación es un procedimiento para tratar asma agravado por infección viral administrando a un sujeto en necesidad de la misma cualquiera de los oligonucleótidos anteriormente mencionados o cualquiera de las composiciones anteriormente mencionadas en una cantidad eficaz para tratar el asma agravado por infección viral.

Otro aspecto de la divulgación es un procedimiento para tratar una enfermedad infecciosa administrando a un sujeto en necesidad de la misma uno cualquiera de los oligonucleótidos anteriormente mencionados o de las composiciones anteriormente mencionadas en una cantidad eficaz para tratar la enfermedad infecciosa. En una realización, el sujeto tiene una infección viral. En una realización la infección viral se produce por virus de la hepatitis B (VHB), virus de la hepatitis C (VHC), virus de la inmunodeficiencia humana (VIH), virus de la gripe, virus respiratorio sincitial (VRS) o virus del papiloma humano (VPH). En otra realización, un agente antiviral se co- administra al sujeto. En una realización, el agente antiviral está ligado al oligonucleótido. En otra realización, el oligonucleótido o la composición se administra por una vía seleccionada del grupo que consiste en oral, nasal, sublingual, intravenosa, subcutánea, mucosal, ocular, respiratoria, inyección directa y dérmicamente.

La presente divulgación también contempla un uso de cualquiera de los oligonucleótidos inmunoestimulantes de la invención o las composiciones de la invención para el tratamiento de enfermedades descritas en el presente documento, por ejemplo, cáncer, enfermedad infecciosa, asma, alergia, trastornos inflamatorios y enfermedades autoinmunitarias.

La invención también contempla un uso de cualquiera de los oligonucleótidos inmunoestimulantes de la invención o las composiciones de la invención en la fabricación de un medicamento para el tratamiento de enfermedades descritas en el presente documento, por ejemplo, cáncer, enfermedad infecciosa, asma, alergia, trastornos inflamatorios y enfermedades autoinmunitarias.

Breve descripción de los dibujos Los dibujos adjuntos no pretenden estar dibujados a escala. En los dibujos, cada componente idéntico o casi idéntico que se ilustra en las diversas figuras se representa por un número similar. Para fines de claridad, no cada componente puede estar marcado en cada dibujo. En los dibujos: La Figura 1 es dos gráficas que muestran la inducción de IFN-α en relación con la cantidad de oligonucleótido en una comparación de un oligonucleótido de clase P que contiene dos palíndromos con un oligonucleótido de clase C que contiene un palíndromo en 3'. Los ejes y son la cantidad de IFN-α en pg/ml y los ejes x son la concentración de oligonucleótido en µM. La Figura 2 es dos gráficas que muestran la inducción de IFN-α en relación con la cantidad de oligonucleótido en un análisis de la eficacia de la longitud del palíndromo. Los ejes y son la cantidad de IFN-α en pg/ml y los ejes x son la concentración de oligonucleótido en µM. La Figura 3 es dos gráficas que muestran la inducción de IFN-α en relación con la cantidad de oligonucleótido en un análisis de regiones formadoras de dúplex tales como palíndromos imperfectos. Los ejes y son la cantidad de IFN-α en pg/ml y los ejes x son la concentración de oligonucleótido en µM. La Figura 4 es dos gráficas que muestran la estimulación de respuestas de citocinas y quimiocinas similares a Th1 in vivo en ratones después del tratamiento con ODN de clase C convencional. La Figura 4A muestra la inducción de IL-12 y la Figura 4B muestra la inducción de IP-10. Los ejes y representan la inducción en pg/ml y el eje x representa el ODN.

La Figura 5 es dos gráficas que muestran la inducción de IFN-α in vivo en ratones en respuesta a ODN de clase C y de clase P. La Figura 5A muestra la inducción de IFN-α después de la administración subcutánea (SC) de ODN y la Figura 5B muestra la inducción de IFN-α después de la administración intravenosa (IV) de ODN. Los ejes y representan la inducción de IFN-α y los ejes x representan el ODN usado.

La Figura 6 es una gráfica que muestra una comparación de la respuesta anti-HB tras la estimulación de ODN de clase A, B, C y P in vivo. El eje y representa anti-HB y el eje x representa el ODN usado. La Figura 7 es un diagrama que representa un concatémero formado por hibridación de un oligonucleótido de clase P que contiene dos regiones palindrómicas. La Figura 8 es una gráfica que muestra la formación de dímeros de SEC ID Nº: 234 en disolución de fosfato con varios aditivos. El eje y es el % de formación de dímeros y el eje x indica los diferentes aditivos. La Figura 9 es dos gráficas que muestran la inducción de IFN-α in vivo en ratones en respuesta a ODN de clase A, B, C y P. La Figura 9A muestra la inducción de IFN-α después de la administración SC de ODN y la Figura 9B muestra la inducción de IFN-α después de la administración IV. Los ejes y representan IFN-α en pg/ml y los ejes x representan el ODN usado.

La Figura 10 es tres gráficas que muestran la inducción de IFN-α en relación con la cantidad de oligonucleótido en el análisis del efecto de la adición de conectores. La Figura 10A muestra la inducción de IFN-α, la Figura 10b muestra la inducción de IL-10 y la Figura 10c muestra la inducción de IL-6. Los ejes y son concentración de citocina en pg/ml y los ejes x son la concentración de oligonucleótido en µM. La Figura 11 es una gráfica que muestra la inducción de IFN-α en relación con la cantidad de oligonucleótido en el análisis del efecto de la modificación del azúcar del ODN de clase P. El eje y es la concentración de IFN-α en pg/ml y el eje x es la concentración de oligonucleótido en µM.

Descripción detallada de la invención

Se ha descubierto una nueva clase de oligonucleótidos inmunoestimulantes, denominados en el presente documento los oligonucleótidos de clase P, que puede inducir altos niveles de IFN-α. Los oligonucleótidos CpG de clase C, que contienen un único palíndromo en o próximo a la mitad de 3' del oligonucleótido, son conocidos por inducir tanto proliferación de linfocitos B fuerte como producción de IFN-α. Los oligonucleótidos de clase P de la invención, al igual que los oligonucleótidos de clase C, inducen la activación de linfocitos B y la producción de IFN-α, pero pueden producir, en algunos casos, niveles mucho mayores de IFN-α que los oligonucleótidos de clase C. Se cree que la secuencia palindrómica en 3' de los oligonucleótidos de clase C se requiere para el perfil inmunoestimulante específico observado para los oligonucleótidos de clase C, lo más probablemente debido a la formación de dímeros con 2 extremos 5' libres. Se cree que el extremo 5' de un ODN CpG es la región que es más importante para la activación del receptor TLR9 y dos extremos 5' libres en un único ODN pueden inducir la reticulación de dos receptores TLR9. La reticulación de receptores TLR9 puede inducir la activación de la secreción de IFN-α más fuerte mediante el bucle de retroalimentación de IFNR de tipo I en células dendríticas plasmocitoides. Sorprendentemente se descubrió que una nueva clase de oligonucleótidos, que no están optimizados para mantener extremos 5' libres, puede inducir IFN-α alto. Los oligonucleótidos de clase P de la invención tienen dos regiones formadoras de dúplex; una cerca del extremo 5' y la otra más próxima a o en mitad de 3' del ODN. Se cree que el diseño de oligonucleótidos conduce a la formación de estructuras de mayor orden complejas llamadas concatémeros. La formación de concatémeros puede observarse por cromatografía de exclusión por tamaño (SEC) del oligonucleótido en disolución bajo condiciones fisiológicas o de sal alta. Aunque la invención no está limitada por un mecanismo particular, se cree que estas estructuras pueden funcionar produciendo un alto grado de reticulación de TLK9, produciendo una activación incluso más fuerte de la secreción de IFN-α por células dendríticas plasmocitoides mediante el bucle de retroalimentación de IFNR de tipo I. También es posible que estas estructuras de mayor orden produzcan el reclutamiento de cofactores o moléculas adaptadoras adicionales al complejo de señalización de TLR9. Otra posibilidad es una distribución intracelular diferente del ODN de concatémeros debido a las estructuras de mayor orden.

Los oligonucleótidos inmunoestimulantes de la presente invención pueden usarse para tratar enfermedades en las que sería ventajosa la estimulación inmunitaria similar a Th1 o modulación inmunitaria. Aplicaciones incluyen, pero no se limitan a, enfermedades autoinmunitarias, trastornos inflamatorios, enfermedades infecciosas, cáncer, asma y alergias. Debido a la capacidad para inducir altos niveles de IFN-α y Th1 y citocinas similares a Th1, es de particular interés el tratamiento de enfermedades virales, tales como hepatitis B y C, citomegalovirus (CMV), virus del papiloma, VIH y virus del herpes simple (VHS). Los oligonucleótidos de la invención también son útiles como adyuvantes de vacuna. Los compuestos de la presente invención pueden usarse para la profilaxis y terapia, tanto como una terapia sola como en combinación con otros dispositivos terapéuticos o médicos.

En general, los oligonucleótidos inmunoestimulantes de la invención tienen varios dominios, que incluyen un dominio de activación de TLR en 5', 2 regiones formadoras de dúplex y un espaciador y cola en 3' opcionales. El término "región formadora de dúplex", como se usa en el presente documento, se define como una región que puede formar un dúplex con otra región formadora de dúplex. Tales regiones pueden comprender palíndromos, regiones que contienen complementariedad, palíndromos imperfectos o regiones no palindrómicas que pueden formar pares de bases de Watson-Crick intermoleculares o de no Watson-Crick con una región complementaria de un segundo oligonucleótido. En algunos casos, los oligonucleótidos inmunoestimulantes pueden formar estructuras secundarias que se producen a partir de la formación de dúplex intramoleculares. Como se usa en el presente documento, un "dúplex intramolecular" se forma cuando múltiples regiones formadoras de dúplex sobre una única molécula forman un dúplex entre sí. Frecuentemente, en tales casos, las regiones se conectarán mediante un espaciador. En algunos casos, los oligonucleótidos inmunoestimulantes pueden formar dúplex intermoleculares. Como se usa en el presente documento, un "dúplex intermolecular" se forma cuando las regiones formadoras de dúplex están sobre diferentes moléculas y forman interacciones de pares de bases entre sí que conectan las moléculas. En algunos casos, se forma un dúplex intermolecular entre los dos oligonucleótidos que tienen la misma secuencia. En otros casos, el dúplex intermolecular se forma entre diferentes oligonucleótidos que tienen diferentes secuencias de nucleótidos. En algunos casos, los oligonucleótidos inmunoestimulantes pueden formar tanto dúplex intermoleculares como intramoleculares.

Las regiones formadoras de dúplex pueden ser palíndromos. Un "palíndromo" y, equivalentemente, "región palindrómica", como se usan en el presente documento, se refieren a una secuencia de ácidos nucleicos que es su propio complemento inverso perfecto (es decir, una secuencia tal como ABCDEE'D'C'B'A' en la que A y A', B y B', C y C', D y D' y E y E' son bases que pueden formar los pares de bases de Watson-Crick usuales, es decir, G-C, A-T y A-U). Como se usa en el presente documento, un "palíndromo" en un sentido estricto excluye la secuencia interviniente o estructura de no nucleótidos intervinientes que no participa en la formación de los pares de bases de Watson-Crick usuales. El palíndromo puede ser un palíndromo en 3' o 5'. Los dos palíndromos pueden ser iguales o pueden ser distintos.

Así, la región palindrómica en 5' y la región palindrómica en 3' no necesitan ser complementarias entre sí. De hecho, pueden ser completamente distintas y solo emparejarse con regiones palindrómicas en otros oligonucleótidos en vez de en el mismo oligonucleótido. Alternativamente, los palíndromos pueden ser un apareamiento de forma que puedan formar una interacción de pares de bases intramoleculares. Ambos palíndromos pueden tener diversas composiciones de base (A, T, G o C), aunque en algunas realizaciones se prefiere un mayor contenido de GC para un palíndromo (tanto en 3' como en 5'). Las dos regiones palindrómicas pueden tener diferentes valores de estabilidad del dúplex. El valor de estabilidad del dúplex es indicativo de la fuerza del dúplex formado por el palíndromo con su par en un segundo oligonucleótido en un emparejamiento intermolecular o con él mismo o el segundo palíndromo en un emparejamiento intramolecular.

Como se usa en el presente documento, la "estabilidad del dúplex" es una medida de la fuerza de una región palindrómica, que contiene complementariedad o formadora de dúplex cuando forma un dúplex con su propia secuencia complementaria. La medida de la estabilidad del dúplex de una molécula bicatenaria depende de la concentración de hebra total, composición de bases, temperatura, pH y sales tampón. Puede calcularse un valor de estabilidad del dúplex por el modelo termodinámico desarrollado John SantaLucia, Jr. (1998) Proc. Natl. Acad. Sci.

95 1460 - 1465. Este programa de plegamiento está disponible, por ejemplo, en http://Ina-tm.com/ o en http://www.bioinfo.rpi.edu/applications/hybrid/twostate.php. Un ejemplo de un cálculo de la estabilidad del dúplex se basa en una concentración de hebra total del oligonucleótido de 0,1 µM y concentración de sales 140 mM (sal fisiológica aproximada). La predicción de la temperatura de fusión (Tm) es el oligonucleótido de ADN hibridado contra nucleótidos de ADN de apareamiento perfecto en disolución. Un ejemplo de cálculo usando SEC ID Nº 234 se muestra a continuación.

SEC ID Nº: 234 TCGTCGACGATCGGCGCGCGCCG palíndromo en 5' TCGTCGACGA Tm: 41 ºC palíndromo en 3' CGGCGCGCGCCG Tm: 68 ºC En el caso de modificación de fosforotioato, la Tm predicha disminuye aproximadamente 1 ºC por modificación. Así, en una molécula completamente de fosforotioato, la estabilidad del dúplex corregida para esta modificación sería palíndromo en 5' TCGTCGACGA Tm: 32 ºC palíndromo en 3' CGGCGCGCGCCG Tm: 57 ºC La Tm medida real variará dentro de un intervalo de 5-10 ºC. Por ejemplo, la Tm medida real para SEC ID Nº: 234 fue (0,04 mg/ml de ODN en PBS): palíndromo en 5' TCGTCGACGA Tm: 33,9 ºC palíndromo en 3' CGGCGCGCGCCG Tm: 65,7 ºC Aunque la fórmula de SantaLucia es útil para calcular la estabilidad del dúplex de oligonucleótidos, es artificialmente baja para algunos oligonucleótidos que forman estructuras de horquilla. Para la predicción de la estabilidad de horquillas, se usa el algoritmo Mfold para el plegamiento de ácidos nucleicos y la predicción de hibridación como se describe por M.

Zuker Nucleic Acids Res.

31(13), 3406-15, (2003), que está disponible en http://www.bioinfo.rpi.edu/applications/mfold/old/dna/form1.cgi.

SEC ID Nº: 237 TCGTCGACGTTCGGCGCCGTGCCG Palíndromo en 3' CGGCGCCGTGCCG Tm: 73 ºC para la horquilla con 4 pares de bases de Watson-Crick Palíndromo en 3' CGGCGCCGTGCCG Tm: 73 ºC para la horquilla con 4 pares de bases pb de Watson-Crick y pares de bases G-T El dímero correspondiente tiene una Tm calculada de 42 ºC y está así menos favorecido que las estructuras intramoleculares. Un "dúplex débil" se considera que tiene un valor de estabilidad del dúplex de al menos 25 a 40. Un "dúplex fuerte" se considera que tiene un valor de estabilidad del dúplex de al menos 40 a 60. Los dúplex intramoleculares, tales como horquillas, normalmente requieren menos pares de bases para obtener el mismo valor de estabilidad del dúplex en comparación con dúplex intermoleculares. Además, la estabilidad del dúplex intramolecular (por ejemplo estabilidad de una horquilla) es independiente de la concentración de hebra de ODN. En algunas realizaciones, la región palindrómica en 5' es más débil que la región palindrómica en 3' sobre la misma molécula. Así, la región palindrómica en 5' puede tener una menor estabilidad del dúplex cuando se compleja consigo misma que la región palindrómica en 3', posiblemente debido a un menor contenido de GC. Alternativamente, en algunos casos, el palíndromo en 5' puede tener una mayor estabilidad del dúplex que el palíndromo en 3'. Una "región que contiene complementariedad", como se usa en el presente documento, se refiere a una región formadora de dúplex que comprende un palíndromo perfecto o un palíndromo imperfecto. Un palíndromo imperfecto es una secuencia de ácidos nucleicos que incluye tanto nucleótidos que pueden formar los pares de bases de Watson-Crick usuales como los nucleótidos, análogos de nucleótidos u otras estructuras que no participan en la formación de los pares de bases de Watson-Crick usuales (por ejemplo, una secuencia tal como ABCDE- S-E'D'C'B'A' en la que A y A', B y B', C y C', D y D' y E y E' son bases que pueden formar los pares de bases de Watson-Crick usuales y S es una secuencia no palindrómica o un conector no nucleotídico un conector abásico (conector D)). Ejemplos de conectores no nucleotídicos incluyen, pero no se limitan a, dioles tales como 1,3- propanodiol o dodecano-1,12-diol, ciclohexanodiol, o conectores tales como colesterol, nitroindol, trietilenglicol y hexaetilenglicol. En ciertas realizaciones, los nucleótidos, análogos de nucleótidos, u otras estructuras que no participan en la formación de los pares de bases de Watson-Crick usuales, interrumpen un palíndromo de otro modo perfecto. En ciertas realizaciones, los nucleótidos que no participan en la formación de los pares de bases de Watson-Crick usuales pueden formar pares de bases de no Watson-Crick con otro nucleótido, por ejemplo, G-T. Un par de bases de no Watson-Crick como se usa en el presente documento es cualquier par de bases distinto de un par de bases de Watson-Crick, que incluye, pero no se limita a, un par de bases de Hoogsteen y un llamado par de bases de balanceo. En ciertas realizaciones, los nucleótidos que no participan en la formación de los pares de bases de Watson-Crick usuales están desapareados y no tienen base de nucleótido o análogo de bases de nucleótidos con los que formar un par de bases de Watson-Crick o de no Watson-Crick, por ejemplo, G opuesto al espaciador D. En algunas realizaciones, el par de bases de no Watson Crick es G-T, G-A, G-G o C-A. G-T tiene un par de bases de no Watson-Crick preferido debido a que tiene menos efecto desestabilizante sobre la formación del dúplex. En ciertas realizaciones, los nucleótidos que no participan en la formación de pares de bases pueden formar pares de bases no estándar con otro nucleótido, por ejemplo, la diaminopiridina puede formar un par de bases con xantosina. En algunos casos, la parte bicatenaria de la molécula también puede contener pares de bases no naturales (no estándar) (por ejemplo, diaminopiridina emparejada con xantosina). Lutz MJ y col. (1998) Recognition of a non- standard base pair by thermostable DNA polymerases. Bioorg Med Chem Lett 8:1149-52. En ciertas realizaciones, la región que contiene complementariedad puede contener un desapareamiento. Un "desapareamiento", como se usa en el presente documento, se refiere a una porción de la región que contiene complementariedad en la que una o más bases en la secuencia no forman un par de bases de Watson-Crick usual con su base opuesta en un dúplex. Un desapareamiento puede producir un "bulto" en el que una porción de la región que contiene complementariedad no participa en la formación del dúplex. En algunas realizaciones, la región que contiene complementariedad puede contener dos desapareamientos.

En una realización, un palíndromo imperfecto es una "repetición invertida que puede formar una estructura de horquilla o de tallo-lazo". Este tipo de estructura puede incluir una secuencia de nucleótidos que forma un tallo u horquilla rico en GC que tiene 3 a 10 pares de bases consecutivos de longitud, e incluye al menos una base no apareada o desapareada. En realizaciones individuales, el tallo rico en GC tiene 2, 3, 4, 5, 6, 7, 8, 9 o 10 pares de bases consecutivos de longitud. En algunas realizaciones, el tallo rico en GC incluye al menos 2, 3 o 4 pares de bases de G-C. En otra realización, una repetición invertida que puede formar una estructura de horquilla o de tallo- lazo se refiere a una secuencia de nucleótidos que forma un tallo rico en AT u horquilla que tiene 2 a 10 pares de bases consecutivos de longitud, e incluye al menos una base no apareada o desapareada. En realizaciones individuales, el tallo rico en AT tiene 3, 4, 5, 6, 7, 8, 9 o 10 pares de bases consecutivos de longitud. En algunas realizaciones, el tallo rico en AT incluye al menos 3, 4, 5 o 6 pares de bases A-T.

En algunos casos, la al menos una base no apareada o desapareada une con puentes los extremos del tallo u horquilla. Esto puede permitir la formación de la estructura secundaria, proporcionando un punto flexible en la molécula para que los tallos se emparejen con bases y formen una horquilla. Alternativamente, la(s) base(s) no apareada(s) o desapareada(s) puede(n) estar dentro del tallo. Preferentemente, si la base desapareada está dentro del tallo, entonces el tallo tiene al menos 3 pares de bases de longitud. La(s) base(s) no apareada(s) o desapareada(s) puede(n) ser cualquier nucleótido. En algunas realizaciones, la base no apareada o desapareada es una T. Los nucleótidos no apareados en el extremo de hebras dobles también se conocen como nucleótidos protuberantes o extremos colgantes que pueden estabilizar significativamente la formación del dúplex o la formación de la horquilla. Freier SM y col. (1983) Effects of 3' dangling end stacking on the stability of GGCC and CCGG double helixes. Biochemistry 22:6198-206. La región que contiene complementariedad normalmente tiene tanto un valor de estabilidad del dúplex de al menos 20, como puede incluir menos de 5 desapareamientos/región de 10 pares de bases y/o 1-5 nucleótidos extra- palindrómicos (formación de bultos/intervinientes)/región de 10 pares de bases.

Las regiones formadoras de dúplex pueden incluir uno o más dominios inmunoestimulantes tales como dominios de activación del receptor similar a Toll 9 (TLR9). El oligonucleótido incluye al menos un dominio de activación de TLR9, posicionado en el extremo 5' de la molécula. En algunas realizaciones, el dominio de activación de TLR9 en 5' está englobado parcialmente o completamente dentro de la región formadora de dúplex en 5', de manera que forma parte o toda la región formadora de dúplex. Alternativamente, el dominio de activación de TLR9 en 5' puede ser distinto de la región formadora de dúplex en 5'. Cuando estos dos dominios son distintos, pueden conectarse directamente entre sí con un enlace internucleotídico o pueden separarse por un espaciador, tal como un conector nucleotídico o conector no nucleotídico.

Un dominio de activación de TLR9 incluye cualquier motivo de secuencia que sea inmunoestimulante, produciendo un patrón de estimulación inmunitaria de acuerdo con los patrones de activación inmunitaria observados con la activación del receptor TLR9. Estos motivos incluyen, pero no se limitan a YpR, CpG, TCG, TTCG, TTTCG, TYpR, UCG, TCG, TTYpR, TTTYpR, UUCG, UUUCG, TTT, TTTT, CpG metilado y CpI. Los nucleótidos del motivo pueden incluir un esqueleto semi-blando o estereoespecífico.

Las realizaciones de los oligonucleótidos CpG de la invención pueden representarse por las siguientes fórmulas: 5' XP1SP2T3' y 5' XNSPT 3' y 5' XPSNT 3' y 5' XN1SN2T 3' X es un dominio de activación de TLR. P, P1 y P2 son palíndromos. S es un espaciador. T es una cola en 3'. N, N1 y N2 son regiones que contienen complementariedad que comprenden palíndromos imperfectos. En las fórmulas, 5' se refiere al extremo 5' libre del oligonucleótido y 3' se refiere al extremo de 3' libre del oligonucleótido.

Los oligonucleótidos inmunoestimulantes de la invención pueden incluir regiones ricas en A y T o regiones ricas en G y C. Una "región rica en A y T", como se usa en el presente documento, es una en la que los nucleótidos A y T sobrepasan en número a los nucleótidos G y C en la secuencia. Alternativamente, una "región rica en G y C", como se usa en el presente documento, es una en la que los nucleótidos G y C sobrepasan en número a los nucleótidos A y T en la secuencia. En algunos casos, los oligonucleótidos pueden tener cuatro o más nucleótidos G próximos al extremo 3' de la molécula. En algunas realizaciones, la molécula incluye una cola en 3'. La cola en 3' puede ser de cualquier longitud, pero preferentemente tiene menos de 100 nucleótidos de longitud. Esta cola en 3' puede ser de cualquier contenido de bases. En algunas realizaciones, la cola en 3' contiene uno o más dominios inmunoestimulantes tales como motivos poli T o CpG.

Puede localizarse un espaciador entre las dos regiones formadoras de dúplex. El espaciador puede ser un conector flexible que tiene tanto un conector no nucleotídico como "nucleótidos intervinientes", es decir, nucleótidos que no forman dúplex. En algunas realizaciones, los "nucleótidos intervinientes" según la invención pueden incluir de 0-100 nucleótidos. Si el espaciador es un espaciador de ácidos nucleicos, puede ser cualquier nucleótido o nucleótidos o nucleósido(s). En algunas realizaciones es un espaciador de T o rico en T. Un "conector no nucleotídico" o, equivalentemente, "espaciador no nucleotídico" como se usa en el presente documento, se refieren a cualquier elemento conector que no sea un nucleótido o polímero del mismo (es decir, un polinucleótido), en el que un nucleótido incluye una nucleobase de purina o pirimidina y un fosfato de azúcar. Así, un conector no nucleotídico es cualquier conector conocido en la técnica, que incluye, pero no se limita a, una cadena simple de carbono, un nucleótido abásico (espaciador D), es decir, una unidad de fosfato de azúcar similar a nucleótido en la que la nucleobase está sustituida con un átomo de hidrógeno, un polietilenglicol, que incluye, pero no se limita a, un trietilenglicol y un hexaetilenglicol. El espaciador puede incluir uno o más dominios inmunoestimulantes tales como motivos poli T o CpG. En algunas realizaciones, el conector es un enlace 3'-3' entre las regiones formadoras de dúplex.

Las regiones formadoras de dúplex pueden conectarse directamente o indirectamente. El término "conectado directamente", como se usa en el presente documento, se refiere a un oligonucleótido en el que los nucleósidos del palíndromo están unidos por un enlace químico fosfodiéster, similar a fosfodiéster o fosforotioato. Es posible que las dos regiones formadoras de dúplex se solapen. En algunas realizaciones las regiones formadoras dúplex se solapan en uno o dos nucleótidos. Cuando las regiones formadoras de dúplex se solapan, se considera que están conectadas directamente. En algunas realizaciones las regiones formadoras de dúplex no se solapan. El término "conectado indirectamente", como se usa en el presente documento, se refiere a un oligonucleótido en el que los nucleósidos de la región formadora de dúplex están conectados mediante un espaciador, como se ha descrito anteriormente.

Los oligonucleótidos de la invención incluyen al menos un dinucleótido YpR. Como se usa en el presente documento, un "dinucleótido YpR" es uno en el que una pirimidina va seguida de una purina. En ciertas realizaciones, la letra Y se usa para referirse a un nucleótido que contiene una citosina o una citosina modificada. Una citosina modificada, como se usa en el presente documento, es un análogo de base de pirimidina de citosina que se produce naturalmente o que no se produce naturalmente que puede sustituir esta base sin alterar la actividad inmunoestimulante del oligonucleótido. Las citosinas modificadas incluyen, pero no se limitan a, 5-citosinas sustituidas (por ejemplo, 5-metil-citosina, 5-fluoro-citosina, 5-cloro-citosina, 5-bromo-citosina, 5-yodo-citosina, 5- hidroxi-citosina, 5-hidroximetil-citosina, 5-difluorometil-citosina y 5-alquinil-citosina sin sustituir o sustituida), 6- citosinas sustituidas, N4-citosinas sustituidas (por ejemplo, N4-etil-citosina), 5-aza-citosina, 2-mercapto-citosina, isocitosina, pseudo-isocitosina, análogos de citosina con sistemas de anillos condensados (por ejemplo, N,N'- propilencitosina o fenoxazina) y uracilo y sus derivados (por ejemplo, 5-fluoro-uracilo, 5-bromo-uracilo, 5-bromovinil- uracilo, 4-tio-uracilo, 5-hidroxi-uracilo, 5-propinil-uracilo). Algunas de las citosinas preferidas incluyen 5-metil-citosina, 5-fluoro-citosina, 5-hidroxi-citosina, 5-hidroximetil-citosina y N4-etil-citosina. En otra realización de la invención, la base de citosina está sustituida con una base universal (por ejemplo, 3-nitropirrol, base de P), un sistema de anillos aromáticos (por ejemplo, fluorobenceno o difluorobenceno) o un átomo de hidrógeno (espaciador D). La letra R se usa para referirse a una purina, que incluye, por ejemplo, G y A. En algunas realizaciones, R es Z, en la que Z se usa para referirse a guanina o una base de guanina modificada. Una guanina modificada como se usa en el presente documento es un análogo de base de purina de guanina que se produce naturalmente o que no se produce naturalmente que puede sustituir esta base sin alterar la actividad inmunoestimulante del oligonucleótido. Las guaninas modificadas incluyen, pero no se limitan a, 7-deazaguanina, 7-deaza-7-guanina sustituida (tal como 7-deaza-7-alquinil (C2-C6)guanina), 7-deaza-8-guanina sustituida, hipoxantina, N2-guaninas sustituidas (por ejemplo, N2-metil-guanina), 5-amino-3-metil-3H,6H-tiazolo[4,5-d]pirimidina-2,7-diona, 2,6-diaminopurina, 2-aminopurina, purina, indol, adenina, adeninas sustituidas (por ejemplo, N6-metil-adenina, 8-oxo-adenina), 8-guanina sustituida (por ejemplo, 8-hidroxiguanina y 8-bromoguanina) y 6-tioguanina. En otra realización de la invención, la base de guanina está sustituida con una base universal (por ejemplo, 4-metil-indol, 5-nitro-indol y base de K), un sistema de anillos aromáticos (por ejemplo, bencimidazol o dicloro-bencimidazol, amida de ácido 1-metil-1H-[1,2,4]triazol-3-carboxílico) o un átomo de hidrógeno (espaciador D).

En ciertas realizaciones de la invención, los oligonucleótidos inmunoestimulantes incluyen un motivo YpR que tiene un dinucleótido CpG. Un dinucleótido CpG puede estar metilado o no metilado. Un oligonucleótido inmunoestimulante que contiene al menos un dinucleótido CpG no metilado es una molécula de ácido nucleico que contiene una secuencia de dinucleótidos de citosina-guanina no metilada (es decir, una citidina en 5' no metilada seguida de guanosina en 3' y ligada por un enlace fosfato) y que activa el sistema inmunitario; un oligonucleótido inmunoestimulante tal es un oligonucleótido CpG. Los oligonucleótidos CpG se han descrito en varias patentes concedidas, solicitudes de patente publicadas y otras publicaciones, que incluyen las patentes de EE.UU. n.º 6.194.388; 6.207.646; 6.214.806; 6.218.371; 6.239.116; y 6.339.068. Un oligonucleótido inmunoestimulante que contiene al menos un dinucleótido CpG metilado es un oligonucleótido que contiene una secuencia de dinucleótidos de citosina-guanina metilada (es decir, una citidina en 5' metilada, seguida de una guanosina en 3' y ligada por un enlace fosfato) y que activa el sistema inmunitario.

En algunas realizaciones, el oligonucleótido tiene una de las estructuras mostradas en la Tabla 1:

Tabla 1. Secuencias de oligonucleótidos

T-C-G-T-C-G-A-C-G-A-T*T*T*T-A-C-G-A-C-G-T-C-G-T-T*T*T SEC ID Nº:1 T-C-G-T-C-G-A-C-G-A-T-T-T-T-A-C-G-A-C-G-T-C-G-T-T-T-T SEC ID Nº:2 T-C-G-T-C-G-A-C-G-A-A-C-G-A-C-G-T-C-G-T SEC ID Nº:3 T-C-G-T-C-G-A-C-G-A-T*T*T*T-T-C-G-T-C-G-A-C-G-A-T*T*T SEC ID Nº:4 T-C-G-T-C-G-A-C-G-A-T-T-T-T-T-C-G-T-C-G-A-C-G-A-T-T-T SEC ID Nº:5 T-C-G-T-C-G-A-C-G-A-T-C-G-T-C-G-A-C-G-A SEC ID Nº:6 C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G SEC ID Nº:7 G*A*G*A*A*C*G*C*T*C*G*A*C*C*T*T*C*G*A*T*biot SEC ID Nº:8 A*G*C*T*C*C*A*T*G*G*T*.G*C*T*C*A*C*T*G SEC ID Nº:9 T*C*T*C*C*C*A*G*C*G*T*G*C*G*G*C*A*T SEC ID Nº:10 T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:11 T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T SEC ID Nº:12 T*C*C*A*C*G*A*C*G*T*T*T*T*C*G*A*C*G*T*T SEC ID Nº:13 T*C*G*T*C*G*T*T*T*T*G*A*C*G*T*T*T*T’G*A*C*G*T*T SEC ID Nº:14 T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*C SEC ID Nº:15 T*C*G*C*G*T*G*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*A*C*G*T*T SEC ID Nº:16 T*C*G*C*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:17 dig-C*C*G*G*C*C*G*G*C*C*G*G*.C*C*G*G*C*C*G*G SEC ID Nº:18 dig-C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G*C*G SEC ID Nº:19 T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T*T*T*T*T SEC ID Nº:20 G*T*G*C*T*C*G*A*G*G*A*T*G*C*G*C*T*T*C*G*C SEC ID Nº:21 G*C*C*G*A*G*G*T*C*C*A*T*G*T*C*G*T*A*C*G*C SEC ID Nº:22 T-C-G-C-G-T-G-C-G-T-T-T-T-G-T-C-G-T-T-T-T-G-A-C-G-T-T SEC ID Nº:23 A*C*C*G*A*T*A*C*C*G*G*T*G*C*C*G*G*T*G*A*C*G*G*C*A*C*C*A*C*G SEC ID Nº:24 A*C*C*C*A*T*A*A*C*G*T*T*G*C*C*G*G*T*G*A*C*G*G*C*A*C*C*A*C*G SEC ID Nº:25 A*C*C*G*A*T*G*A*C*G*T*C*G*C*C*G*G*T*G*A*C*G*G*C*A*C*C*A*C*G SEC ID Nº:26 C*G*G*C*G*C*G*C*G*C*C*G*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:27 T*C*G*A*T*C*G*T*T*T*T*T*C*G*T*G*C*G*T*T*T*T*T SEC ID Nº:28 T*C*G*T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T SEC ID Nº:29 T*C*G*T*C*G*T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T SEC ID Nº:30 T*C*G*T*G*A*C*G*G*G*C*G*G*C*G*C*G*C*G*C*C*C SEC ID Nº:31 A*C*G*A*C*G*T*C*G*T*tC*G*G*C*G*G*C*C*G*C*C*G SEC ID Nº:32 G*G*G-G-A-C-G-A-C-G-T-C-G-T-G-C*G*G*C*G+G*C*C*G*C*C*G SEC ID Nº:33 G*G*G*G*A*C*G*A*C*G*T*C*G*T*G*C*G*G*C*G*G*C*C*G*C*C*G SEC ID Nº:34 C*C-A*C-G*A*C-G*T*C-G*T*C-G-A-A-G*A*C-G*A*C-G*T*C-G*T-G*G SEC ID Nº:35 C*T-G*C*A*G-C*T-G-C*A*G-C*T-G-C*A*G-C*T-G*C*A*G SEC ID Nº:36 C*G*G-C*C-G*C*T-G*C*A-G-C*G-G*C*C-G*C*T-G*C*A*G SEC ID Nº:37 C*A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:38 A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:39 T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:40 A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T*G*T SEC ID Nº:41 T*C*C*A*T*G*A*C-G-T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:42 T*C*C*A*T*G*A-C-G-T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:43 T*C*C*A*T*G*A*C*G*T+T*T+T*T*G*A*T-G-T*T SEC ID Nº:44 T*C*C*A*T*G*A*C-G-T*T*T*T*T*G*A*T-G*T*T SEC ID Nº:45 T*C*C*A*T*G*A-C-G-T*T*T*T*T*G;A*T-G*T*T SEC ID Nº:46 A*T*G*A*C-G*T*T*T*T*T*G*A*T*G*T*T*G*T SEC ID Nº:47 A*T*G*A*C*G*T*t*T*T*T*G*A*T-G*T*T*G*T SEC ID Nº:48 A*T*G*A*C-G*T*T*T*T*T*G*A*T-G*T*T*G*T SEC ID Nº:49 A*T*G*A-C-G-T*T*T*T*T*G*A-T-G-T*T*G*T SEC ID Nº:50 T*C*C*A*T*G*C*G*T*T*T*T*T*G*A*A*T*G*T*T SEC ID Nº:51 T*C*C*A*T*G*A*C*G*T*C*T*T*T*G*A*T*G*T*C SEC ID Nº:52 A-C-G-A-C-G-T-C-G-T-T-C-A-C-G-A-C-G-T-C-G-T-chol SEC ID Nº:53 A-C-G-A-C-G-T-C-G-T-G-G-C-C-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:54 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:55 D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:56 D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-chol SEC ID Nº:57 G*G*G-A-C-G-A-C-G-T-C-G-T-G*G*C*C-A-C-G-A-C-G-T-C-G-T-C*C*C SEC ID Nº:58 C*C*C-A-C-G-A-C-G-T-C-G-T-G*G*G SEC ID Nº:59 C*C*C*C-A-C-G-A-C-G-T-C-G-T-G*G*G*G SEC ID Nº:60 T*C*G*A*T*C*G*T*T*T*T-T-C-G*T*G*C*G*T*T*T*T*T SEC ID Nº:61 T*C*G*A*T*C*G*T*T*T-T-T-C-G-T*G*C*G*T*T*T*T*T SEC ID Nº:62 T*C*G*A*T*C*G*T*T-T-T-T-C-G-T-G*C*G*T*T*T*T*T SEC ID Nº:63 T*C*G*A*T*C*G-T-T-T-T-T-C*G*T*G*C*G*T*T*T*T*T SEC ID Nº:64 A*T-G*A*C-G*T*T*T*T*T-G*A*C-G*T*T SEC ID Nº:65 A*C-G*A*C-G*T*T*T*T*T-G*A*T-G*T*T SEC ID Nº:66 A*C-G*A*C-G*T*T*T*T*C-G*A*C-G*T*T SEC ID Nº:67 A*T-G*A*T-G*T*T*T*T*T-G*A*T-G*T*T SEC ID Nº:68 A*T-G*A*C-G*T*T*T*T*G-A*T*G-T*T SEC ID Nº:69 A*T-G*A*C-G*T*T*T*G*T-G*A*T-G*T*T SEC ID Nº:70 T*T-G*A*C-G*T*T*T*T*T-G*A*T-G*T*T SEC ID Nº:71 A*T-G*A*T-G*T*T*T*T*T-G*A*T-G*T*T SEC ID Nº:72 A*T-G*A*G-C*T*T*T*T*G-T*A*T-G*T*T SEC ID Nº:73 T*C*G*A*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G SEC ID Nº:74 T*C*C*T*G*A*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G SEC ID Nº:75 T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*G*C*C*G*C*C*G SEC ID Nº:76 T*C*C*A*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*C SEC ID Nº:77 T*C*C*T*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C SEC ID Nº:78 T*C*G*A*C*G*T*T*T-T-C-G-G-C*G*C*G*C*G*C*C*G SEC ID Nº:79 T*C*G*A*C*G*T*T*T-T-C-G-G-C*G*G*C*C*G*C*C*G SEC ID Nº:80 T*C*G*A*C*G*T*C*G-A-C-G-T-T-A-C-G-G-T-T-A*G*G*G SEC ID Nº:81 A*C*G*A*C*G*T*C*G-T-T-A-G-G-G-T-T-A*G*G*G SEC ID Nº:82 G*T*C-G*G*C-G*T*T-G*A*C SEC ID Nº:83 A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D-C-G-G-C-C-G-C-C-G SEC ID Nº:84 A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D*C*G*G*C*C*G*C*C*G SEC ID Nº:85 T-C-G-T-C-G-A*C*G*A*C*G*T*C*G*T*C*G SEC ID Nº:86 T-C-G-T-C-G-A-C-G-A-C-G-T-C-G-T-C-G-D-D-D-D SEC ID Nº:87 A-C-G-A-C-G-T-C-G-T-T-T*T*T-A-C-G-A-C-G-T-C-G-T-teg SEC ID Nº:88 A*C*G*A*C*G*T*C*G*T*D*D*D*D*A*C*G*A*C*G*T*C*G*T*D*D*D SEC ID Nº:89 D*D*D*A*C*G*A*C*G*T*C*G*T*D*D*D*D*A*C*G*A*C*G*T*C*G*T*D*D*D SEC ID Nº:90 A-C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:91 A-C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-T-T*T*T SEC ID Nº:92 A*C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G-T-T*T*T SEC ID Nº:93 A*C-G-A-C-G-T-C-G-T-T*T*T*T-A-C-G-A-C-G-T-C-G*T SEC ID Nº:94 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-L SEC ID Nº:95 A-C-G-A-C-G-T-C-G-T-L-A-C-G-A-C-G-T-C-G-T-L SEC ID Nº:96 A-C-G-A-C-G-T-C-G-T-teg-teg-A-C-G-A-C-G-T-C-G-T-teg SEC ID Nº:97 C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-D-D-D SEC ID Nº:98 A-C-G-A-C-G-T-C-G-D-D-D-D-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:99 C-G-A-C-G-T-C-G-D-D-D-D-C-G-A-C-G-T-C-G-D-D-D SEC ID Nº:100 T-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-A-D-D-D SEC ID Nº:101 A-C-G-T-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-A-C-G-T-D-D-D SEC ID Nº:102 T-C-G-T-C-G-A-C-G-T-D-D-D-D-A-C-G-T-C-G-A-C-G-A-D-D-D SEC ID Nº:103 T-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:104 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-T-C-G-T-C-G-T-D-D-D SEC ID Nº:105 A-C-G-A-C-G-T-T-D-D-D-D-A-A-C-G-T-C-G-T-D-D-D SEC ID Nº:106 A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-D-D-D SEC ID Nº:107 G-G-C-G-G-C-C-G-D-D-D-D-C-G-G-C-C-G-C-C-D-D-D SEC ID Nº:108 G-C-G-G-C-C-G-G-D-D-D-D-C-C-G-G-C-C-G-C-D-D-D SEC ID Nº:109 A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:110 D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D SEC ID Nº:111 A*C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-A-C-G-T-C-G-T-D-D-T SEC ID Nº:112 T*C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-T-C-G-T-C-G-T-D-D-T SEC ID Nº:113 C*C*A-C-G-A-C-G-T-C-G-T-C-G-A-A-G-A-C-G-A-C-G-T-C-G-T*G*G SEC ID Nº:114 T*C*C*A*D*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:115 T*C*C*A*T*G*A*C*C,*T*T*D*T*T*G*A*T*G*T*T SEC ID Nº:116 T*C*C*A*J*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:117 T*C*C*A*T*G*A*C*G*T*T*J*T*T*G*A*T*G*T*T SEC ID Nº:118 T*C*C*A*T*G*A*C*G*T*T*T*T*T*G**T*G*T*T*cy3 SEC ID Nº:119 J*J*J*J*J*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:120 T*C*C*A*J*G*A*C*G*T*T*J*T*T*G*A*T*G*T*T SEC ID Nº:121 T*C*C*A*D*G*A*C*G*T*T*D*T*T*G*A*T*G*T*T SEC ID Nº:122 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rU SEC ID Nº:123 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rG SEC ID Nº:124 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rA SEC ID Nº:125 D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rU SEC ID Nº:126 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rA2-rA2-rA2-rA SEC ID Nº:127 T*C*G*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:128 T-T-T-A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-rU SEC ID Nº:129 (T*C-G-A-C-G-T-C-G-T-)(vitE-)doub-teg SEC ID Nº:130 T*C*G*A*C-G*T*T*T*T*C-G*G*C*G*G*C*C-G*C*C*G SEC ID Nº:131 T*C*G*A*C-G*T*T*T*T*C-G*G*C*G*C*G*C-G*C*C*G SEC ID Nº:132 T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:133 T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:134 T*C*G*C-G*A*C*G*T*T*C*G*G*C-G*C*G*C*G*C*C*G SEC ID Nº:135 T*C*G*C-G*A*C*G*T*T+C*G*G*C*G*C-G*C*G*C*C+G SEC ID Nº:136 T*C*G*C*G*A*C-G*T*T*C*G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:137 T*C*G*C*G*A*C-G*T*T*C*G*G*C-G*C*G*C*G*C*C*G SEC ID Nº:138 T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:139 T*C*G*C*G*A*C*G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:140 T*C*G*C*G*A*C-G*T*T*C*G*C*G*C-G*C*G*C*G SEC ID Nº:141 D*C*C*A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:142 T*D*C*A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:143 T*C*D*A*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:144 T*C*C*D*T*G*A*C*G*T*T*T*T*T*G*A*T*G*T*T SEC ID Nº:145 T*C*C*A*T*G*A*C*G*T*T*T*T*D*G*A*T*G*T*T SEC ID Nº:146 T*C*C*A*T*G*A*C*G*T*T*T*D*T*G*A*T*G*T*T SEC ID Nº:147 T*C*G*A*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:148 T*C*G*T*C*G*A*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:149 T*C*G*T*C*C*A*A*C-G*T*T*C*G*G*C*G*C*T*G*C*G*C*C*G SEC ID Nº:150 T*C*G*C*G*A*C-G*T*T*C*G*T*T*G*C*G*C*G*C*G*C*C*G SEC ID Nº:151 T*A*C*G*T*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:152 T*T*C*G*C*G*A*C-G*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:153 T*C*G*G*C*G*C*G*C*G*C*C-G*T*C*G*C*G*A*C*G*T SEC ID Nº:154 T*A*G*C-G*T*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:155 T*A*G*C-G*A*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:156 T*T*G*C-G*A*G*C-G*T*T’T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:157 A*T*G*C-G*T*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:158 T*T*A*C-G*T*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:159 T*T*G*C-A*T*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:160 T*T*G*C-G*T*A*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:161 T*T*G*C-G*T*G*C-A*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:162 T*T*G*C-G*T*G*G-G*A*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:163 T*T*G*C-G*C*G*C-G*T*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:164 T*T*G*C-G*T*G*C-G*C*T*T*T*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:165 T*T*G*C-G*T*G*C-G*T*T*T*C*G*A*C-G*T*T*T*T*T*T*T SEC ID Nº:166 T*C*G*T*C-G*A*A*C*G*T*T*C-G*G*C*G*C*T*G*C*G*C*C*G SEC ID Nº:167 T*C*G*T*C-G*A*A*C*G*T*T*C-G*G*C-G*C*T*G*C*G*C*C*G SEC ID Nº:168 T*C*G*T*C-G*A*A*C*G*T*T*C-G*G*C*G*C*T*G*C-G*C*C*G SEC ID Nº:169 T*C*G*T*C*G*A*A*C-G*T*T*C*G*G*C-G*C*T*G*C*G*C*C*G SEC ID Nº:170 T*C*G*T*C-G*G*A*C*G*T*T*C-G*G*C*G*C*T*G*C*G*C*C*G SEC ID Nº:171 T*C*G*C*G*A*C-G*T*T*C*G*T*T*G*C-G*C*G*C*G*C*C*G SEC ID Nº:172 T*C*G*C-G*A*C*G*T*T*C-G*T*T*G*C-G*C*G*C*G*C*C*G SEC ID Nº:173 T*C-G*C*G*A*C*G*T*T*C-G*T*T*G*C*G*C-G*C*G*C*C*G SEC ID Nº:174 T*C*G*C*G*A*C-G*T*T*T*T*G*C*G*C-G*C*G*C SEC ID Nº:175 T*C*G*C*G*A*C-G*T*C*G*T*T*G*C-G*C*G*C*G*C*C*G SEC ID Nº:176 T*C*G*C*G*A*C-G*T*T*C*G*A*A*G*C-G*C*G*C*G*C*C*G SEC ID Nº:177 T*C*G*C*G*A*C-G*A*A*C*G*T*T*G*C-G*C*G*C*G*C*C*G SEC ID Nº:178 T-C-G-A-C-G-T-C-G-T-D-D-D-D-T-C-G-A-C-G-T-C-G-T-D-D-D SEC ID Nº:179 T*C*G*T*C*G*T*T*A*G*C*T*C*G*T*T*A*G*C*T*C*G*T*T SEC ID Nº:180 T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*C*G*T*C*G*T*T SEC ID Nº:181 T*C*G*T*C*G*T*T*A*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T SEC ID Nº:182 T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*C*G*T*A*A*T*T SEC ID Nº:183 T*C*G*A*C*G*T*C*G-A-C*G*T*G*A*C*G*G*G SEC ID Nº:184 (T-C-G-A-C-G-T-C-G-T-T-)2doub-but SEC ID Nº:185 (T-C-G-A-C-G-T-C-G-T-T-)2doub-chol SEC ID Nº:186 (T-C-G-A-C-G-T-C-G-T-T-T-)2doub-chol SEC ID Nº:187 T-C-G-A-C-G-T-C-G-T-T-T-chol-T-T-C-G-A-C-G-T-C-G-T-T-but SEC ID Nº:188 T*C*G*C-G*A*C*O*T*T*C-G*G*C*G*C-G*C*T*G*C*C*G SEC ID Nº:189 T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G SEC ID Nº:190 T*C*G*C-G*A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G SEC ID Nº:191 T*C*G*C*G-.A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G SEC ID Nº:192 T*C*G*C*G-A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G SEC ID Nº:193 T*C*G-C*G*A*C*G*T*T*C-G*G*C*G*C-G*T*C*G*C*C*G SEC ID Nº:194 T*C*G-C*G*A*C*G*T*T*C-G*G*C*G*G*C-T*C*G*C*C*G SEC ID Nº:195 (T-C-G-A-C-G-T-C-G-T-)(vitE-) SEC ID Nº:196 T*C-G*A*C-G*T*C-G*A*C*G*T*G*A*C*G*G*G SEC ID Nº:197 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*G*G SEC ID Nº:198 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*G SEC ID Nº:199 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G SEC ID Nº:200 (T-C-G-A-C-G-T-C-G-A-)(vitE-) SEC ID Nº:201 T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*T*A*C*G*T*C*G*T*T SEC ID Nº:202 T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*G*A*C*G*T*C*G*T*T SEC ID Nº:203 T*C*G*T*C*G*T*T*A*C*G*T*A*A*C*G*A*C*G*A*C*G*T*T SEC ID Nº:204 T*C*G*T*C*G*T*T*A*G*C*T*A*A*T*T*A*G*C*T*C*G*T*T SEC ID Nº:205 T*C*G*T*C*G*T*T*A*C*G*T*A*A*T*T*A*G*C*T*C*G*T*T SEC ID Nº:206 C*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:207 G*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:208 A*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:209 T*G*G*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:210 T*T*T*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:211 T*A*A*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:212 C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:213 C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:214 A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:215 T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T SEC ID Nº:216 T-C-G-A-C-G-T-C-G-A-D-D-D-D-T-C-G-A-C-G-T-C-G-A-chol SEC ID Nº:217 teg-iA-jG-iC-iT-iG-iC-iA-iG-jC-iT-D-D-D-D-T-C-G-A-C-G-T-C-G-A-chol SEC ID Nº:218 T*C-G*C-G*A*C-G*T*T*C-G*G*C-G*C-G*C-G*C*C-G SEC ID Nº:219 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:220 T*C-G*G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:221 T*C-G*G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G SEC ID Nº:222 T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G SEC ID Nº:223 T*C-G*C-G*A*C-G*T*T*C-G*C-G*C-G*C-G*C-G SEC ID Nº:224 T*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:225 T*C-G*A*C-G*T*T*C-G*G*C*G*C*G*C*C*G SEC ID Nº:226 T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C*C*G SEC ID Nº:227 T*C-G*C-G*A*C-G*T*T*C-G*G*C*C*G SEC ID Nº:228 T*C-G*A*C-G*T*T*C-G*G*C*G*C*C*G SEC ID Nº:229 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G-C*G*C*C*G SEC ID Nº:230 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C-G*C*C*G SEC ID Nº:231 T*C-G*A*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:232 T*C-G*A*C-G*T*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:233 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:234 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G-C*G*C*C*G SEC ID Nº:235 T*C-G*T*C-G*A*C-G*T*T*C-G*C*C*G*C-G*C*G*G*C*G SEC ID Nº:236 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G SEC ID Nº:237 T*C-G*T*C-G*A*C-G*T*T*C-G*A*C*T*C-G*A*G*T*C*G SEC ID Nº:239 T*C-G*T*C-G*T*T*A*C-G*T*A*A*C-G*A*C*G*A*C-G*T*T SEC ID Nº:239 T*C*G*T*C-G*T*T*A*C-G*T*A*A*C-G*A*C*G*A*C*G*T*T SEC ID Nº:240 T*C*G*A*C*G*T*C*G*A*C*G*T*G*A*C*G*T*T SEC ID Nº:241 T*C*G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*G*C*C*G SEC ID Nº:242 T*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:243 A-C-G-A-C-G-T-C-G-T-D-D-D-D-A-C-G-A-C-G-T-C-G-T-D-D-D-irU SEC ID Nº:244 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G SEC ID Nº:245 T*C-G*T*C-G*A*C-G*A*C-G*G*C*G*C*C-G*T*G*C*C*G SEC ID Nº:246 T*C-G*T*C-G*A*C-G*A*C-G*C*G*C*C-G*T*G*C*G SEC ID Nº:247 T*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*C*G*T*G*C*C*G SEC ID Nº:248 T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G SEC ID Nº:249 T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G SEC ID Nº:250 T*C*G*T*C*G*A*C*G*A-T-C*G*G*C*G*C*C*G*T*G*C*C*G SEC ID Nº:251 T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:252 T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:253 T*C*G*A*C*G*A*C*G*A-T-C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:254 T*C*G*A*C*G*T*C*G-A-C*G*T*G*A*C*G*T*T SEC ID Nº:255 T*C*G*A*C-G*T*C*G*A*C-G*T*G*A*C*G*T*T SEC ID Nº:256 T*C*G*A*C-G*T*C*G*A*C*G*T-G*A*C*G*T*T SEC ID Nº:257 T*C*G*T*C-G*A*C*G*A*C-G*T*G*T*C*G*A*T SEC ID Nº:258 T*C*G*A*C*G-T*C*G*A*C*G-T*G*A*C*G*T*T SEC ID Nº:259 T*C*G*A-C*G*T*C*G-A*C*G*T*G-A*C*G*T*T SEC ID Nº:260 T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G SEC ID Nº:261 T*C*G*T*C*G*A-C*G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T SEC ID Nº:262 T*C*G*T*C*G*A*C-G*A*C*G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:263 T*C*G*T*C*G*A*C-G*A*C*G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:264 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:265 T*C-G*T*C-G*A*C-G*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:266 T*C-G*T*C-G*A*C-G*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:267 T*C*G*T*C*G* A-C*G*C*G*G*C*G-C*C*G*T*G*C*C*G*T SEC ID Nº:268 T*C*G*T*C-G*A*C*G*A-A*G*T*C-G*A*C*G*A*T SEC ID Nº:269 T*C*G*T*C-G*A*C*G*A*G*A-A*T*C*G*T*C-G*A*C*G*A*T SEC ID Nº:270 T*C*G*T*C-G*T*A*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:271 T*C*G*T*C*G*A*C-G*A*T*C*G*G*C-G*C*C*G*T*G*C*C*G SEC ID Nº:272 T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G SEC ID Nº:273 T*C*G*T*C*G*A-C*G*A*T*C*G-G*C*G*C-C*G*T*G*C*C*G SEC ID Nº:274 T*C*G*T*C*G*A-C*G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T SEC ID Nº:275 T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:276 T*C*G*T*C*G*A-C*G*A*T*C*G*G*C*G-C*C*G*T*G*C*C*G*T SEC ID Nº:277 T*C*G*T*C*G*A*C-G*A*C*G*G*C*G*C-C*G*T*G*C*C*G*T SEC ID Nº:278 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:279 T*C-G*T*C-G*A*C-G*T*C-G*G*C*G*C*C-G*T*G*C*C*G*T SEC ID Nº:280 T*C*G*T*C-G*A*C*G*A-A*G*T*C-G*A*C*G*A*T SEC ID Nº:281 T*C*G*T*C-G*A*C*G*A*G*A-A*T*C*G*T*C-G*A*C*G*A*T SEC ID Nº:282 T*C*G*T*C-G*A*C*G*A*C-G*T*G*T*C*G*A*T SEC ID Nº:283 T*C*G*A*C-G*T*C*G*A-A*G*A*C-G*T*C*G*A*T SEC ID Nº:284 T*C*G*A*C-G*T*C*G*A*G*A-A*T*C*G*A*C-G*T*C*G*A*T SEC ID Nº:285 T*C*G*T*C-G*A*C-G*A*C*G*G*C*G-A*A*G*C*C*G SEC ID Nº:286 T*C*G*T*C-G*A*C-G*A*C*G*G*C*G-A*A*G*C*C*G*T SEC ID Nº:287 T*C*G*T*C*G-A*C*G*A*C*G-T*G*T*C*G*A*T SEC ID Nº:288 T*C*G*T*C*G*A*C*G*A*C*G*T*G*T*C*G*A*T SEC ID Nº:289 T*C*G*A*C-G*T*C*G*A*C-G*T*G*A*C*G-T*T*G*T SEC ID Nº:290 T*C<G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-but SEC ID Nº:291 T*C<G*T*C<G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-but SEC ID Nº:292 T*C-G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-iT SEC ID Nº:293 iT-T*C-G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*G-iT SEC ID Nº:294 T*C-G*T*C-G*A*C-G*A*T*C-G*A*T*C-A*C*G*C-G*C*G*T*C*G SEC ID Nº:295 T*C-G*T*C-G*A*C-G*A*T*C-A*A*C*G*C-G*C*G*T*T*G SEC ID Nº:296 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*A*C-G*T*G*C*C*G SEC ID Nº:297 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*A*T-A*T*G*C*C*G SEC ID Nº:298 T*C-G*T*C-G*A*C-G*A*T*G-C*C*G*C*G-C*G*C*G*G*C SEC ID Nº:299 T*C*G*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:300 T*C-G*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:301 T*C*G*T*C-G*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:302 T*C-G*T*C*G*A*C*G*A*T*G*C*C*G*C*G*C*T*G*C*G*G*C SEC ID Nº:303 T*C-G*T*C*G*T*A*C*G*A*T*G*C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:304 T*C-G*T*C*G*T*A*C*G*A*T*G*C*C*G*C*G*C*T*G*C*G*G*C SEC ID Nº:305 T*C*G*T*C*G*A*C*G*A*T-G*C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:306 T*C*G*T*C*G*A*C*G*A*T-G-C*C*G*C*G*C*G*C*G*G*C SEC ID Nº:307 T*C*G*T*C-G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G-iT SEC ID Nº:308 T*C-G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G-iT SEC ID Nº:309 T*C*G*T*C*G*A*C*G*A*T*C-G*G*C*G*C*G*C*G*C*C*G-iT SEC ID Nº:310 T*C-G*T*G-C*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:311 T*Z-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:312 T*C-G*T*Z-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:313 T*C-G*T*C-G*A*Z-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:314 T*C-G*T*C-G*A*C-G*A*T*Z-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº:315 T*C-G*A*C*G*T*C-G*A*C*G*T*C-G*A*C*G SEC ID Nº:316 T-C-G-A-C-G-T-C-G-A-C-G-T-C-G-A-C-G SEC ID Nº:317 T*C*G*A*C*G*T*C*G*A*C*G*T*C*G*A*C*G SEC ID Nº:318 T*C-G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*G-iT SEC ID Nº:319 T*C-G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*G-iT SEC ID Nº:320 T*C-G*T*C*G*A*C*G*T*T*C*G*G*C*G*C*C*G*T*G*C*C*G-iT SEC ID Nº:321 G*C*C*G*C*G-C*G*C*G*G-C*iT*iA*iG-iC*iA*iG-iC*iT*iG-iC*iT SEC ID Nº:322 C*G*G*C*G*C-G*C*G*C*C-G* iT* iA*iG-iC*iA*iG-iC*iT* iG-iC*iT SEC ID Nº:323 G*C*C*G*C*G*C*G*C*G*G*C*iT*iA*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:324 C*G*G*C*G*C*G*C*G*C*C*G*iT*iA*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:325 C*G*G*C*G*C*C-G*T*G*C*C*G*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:326 G*C*C*G*T*G-C*C*G*C*G*G-C*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:327 C*G*G*C*G*C*C*G*T*G*C*C*G*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:328 G*C*C*G*T*G*C*C*G*C*G*G*C*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:329 T*C*G*G*C*G*C-G*C*G*C*C-G*A*iT*iA*iG-iC*iA*iG-iC*iT*iG-iC*iT SEC ID Nº:330 T*C*G*G*C*G*C*G*C*G*C*C*G*A*iT*iA*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:331 T*C*G*G*C*G*C*C-G*T*G*C*C*G*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:332 T*C*G*G*C*G*C*C*G*T*G*C*C*G*iT*iT*iG*iC*iA*iG-iC*iT*iG*iC*iT SEC ID Nº:333 CGGCGCX1GCGCCG SEC ID Nº:334 T*C G*T*C G*A*C G*T*T*C G*G*C*G*C G*C*G*C*C*G SEC ID Nº:335 T*C*G*T*C*G*A*C*G*A*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:336 T*C*G*T*C*G*A*C*G*A*J*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:337 T*C*G*T*C*G*A*C*G*A*L*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:338 T*C*G*T*C*G*A*C*G*A*D*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:339 G*G*G-G-A-C-G-A-C-G-T-C-G-T-G-G*G*G*G*G*G SEC ID Nº:340 T*C-G-A-C-G-T-C-G-T-G-G*G*G*G SEC ID Nº:341 T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A SEC ID Nº:342 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G SEC ID Nº:343 T*C* G*T*C-mG*mA*C*mG*mA*T*C*mG*mG*C*mG*C*mG*C*C*3mG SEC ID Nº:344 T*C*mG*T*C*mG*mA*C*mG*mA*T*C*mG*mG*C*mG*C*mG*C*mG*C*C*3mG SEC ID Nº:345 T*C* G*T*C-mG*mA*C-mG*mA*T*C-mG*mG*C*mG*C-mG*C*mG*C*C*3mG SEC ID Nº:346 T*C-mG*T*C-mG*mA*C-mG*mA*T*C-mG*mG*C*mG*C-mG*C*mG*C*C*3mG SEC ID Nº:347 Símbolos usados en la Tabla 1: * Enlace internucleotídico estabilizado - Enlace fosfodiéster col Colesterol vitE Vitamina E biot Biotina teg Trietilenglicol dig Digoxigenina but butirato J 1,3-propano-diol L hexaetilenglicol D Espaciador D (1'2'-didesoxirribosa, Glen Research. Sterling, VA) mN nucleósido de 2'-O-metilo iN Nucleótido inverso (orientación inversa: cambiados 3' y 5') dob- doble Z 5-metil-desoxicitidina rN ribonucleósido Cy3 Cloruro de bis-hidroxipropil-3,3,3',3'-tetrametil-4,5-bencindocarbocianina (Glen Research) Como se trata anteriormente, la medida de la estabilidad del dúplex de una molécula bicatenaria depende de la concentración de hebra total, composición de base, temperatura, pH y sales tampón. Bajo condiciones fisiológicas, se prefiere la formación de un dúplex con respecto a los estiramientos no apareados de bases. Si más de una secuencia palindrómica, que contiene complementariedad o formadora de dúplex está presente en una molécula, se preferirá la posible agregación de varias moléculas bajo condiciones fisiológicas. La agregación conduce a una mezcla compleja de estructuras de oligonucleótidos de mayor orden que son difíciles de analizar y también crean un problema con respecto a la coherencia de lote a lote de las disoluciones de dosificación del medicamento final. Para prevenir tal agregación, podrían usarse elevación de la temperatura, pH o reducción de las sales tampón. Sin embargo, cuando las moléculas se formulan para el tratamiento previsto de animales o seres humanos, no puede usarse elevación de la temperatura, pH o reducción de sales tampón, ya que tienen que mantenerse las condiciones fisiológicas (temperatura ambiente, valor osmótico fisiológico o pH neutro). La invención también incluye composiciones para tratar estos problemas.

Así, en algunos aspectos, la divulgación se refiere a una composición de oligonucleótidos formadores de dúplex que se formulan de un modo que se reduzca la agregación in vitro, sin inhibir el auto-ensamblaje in vivo en concatémeros. Se ha descubierto que pueden usarse un tampón de baja salinidad y un soluto para mantener los oligonucleótidos formadores de dúplex en un estado sustancialmente homogéneo, o no agregado. En estas formulaciones farmacéuticas, los compuestos son más útiles y más prácticos para el desarrollo terapéutico y son más aceptables para las agencias reguladoras debido a que las estructuras son más fáciles de analizar y es más simple producir lotes más coherentes para la dosificación. Tales formulaciones son más útiles para diluciones de dosificación farmacéutica debido a que evitan los complejos concatémeros que complican el análisis de fármacos y reducen la coherencia de lote a lote.

En algunas realizaciones se usan moléculas que contienen dos o más regiones palindrómicas o de formación de dúplex con temperaturas de fusión significativamente diferentes. Bajo ciertas condiciones, puede prevenirse la formación del dúplex más débil (es decir, aquel con menor estabilidad del dúplex), mientras que se mantiene la formación del dúplex más fuerte, de manera que in vitro, los compuestos formarán dúplex en lugar de concatémeros, pero puede mantenerse la actividad in vivo.

Así, los oligonucleótidos inmunoestimulantes de la invención pueden usarse en composiciones adecuadas para administración a un sujeto. Los oligonucleótidos formadores de dúplex pueden usarse en la preparación de una disolución de dosificación de oligonucleótidos que comprende disolver dichos oligonucleótidos en un tampón hipo- osmolal, tal como un tampón de baja salinidad y añadir un soluto. Un "soluto", como se usa en el presente documento, es un componente que, cuando se añade a la disolución en la concentración apropiada, produce una formulación aproximadamente isotónica en la que los oligonucleótidos están presentes en una forma sustancialmente homogénea. En algunas realizaciones, el soluto es un componente formador isotónico. Ejemplos de solutos adecuados incluyen, pero no se limitan a, alcoholes tales como aminoácidos y sacáridos. Aminoácidos útiles como solutos pueden tener una cadena lateral hidrófoba, tal como isoleucina o cadena lateral cargada, tal como lisina. En algunas realizaciones, el aminoácido es glicina. Los sacáridos incluyen, pero no se limitan a, dextrosa, fructosa, lactosa, sacarosa, ribosa, arabinosa o un disacárido. Como se usa en el presente documento, el término "sustancialmente homogénea" se refiere a una disolución en la que la mayoría de las moléculas no están presentes en concatémeros de alto peso molecular. Así, al menos el 50 % de las moléculas en la disolución no son parte de un concatémero de alto peso molecular. En otras realizaciones al menos el 40 %, 30 %, 20 %, 10 %, 5 %, 2 % o 1 % de las moléculas en la solución no son parte de un concatémero de alto peso molecular. Los oligonucleótidos que no son parte del concatémero pueden estar presentes en forma monomérica o dimérica.

En algunas realizaciones, la composición incluye oligonucleótidos que tienen todos la misma secuencia. Así, múltiples copias de la misma secuencia de oligonucleótidos están presentes en la composición. Alternativamente, la composición puede comprender una mezcla de oligonucleótidos de diferentes secuencias que tienen al menos una secuencia formadora de dúplex en común con otros oligonucleótidos en la mezcla. Normalmente, una composición que incluye diferentes secuencias de oligonucleótidos incluye al menos dos oligonucleótidos diferentes que tienen secuencias formadoras de dúplex complementarias, de forma que las secuencias formadoras de dúplex en los oligonucleótidos diferentes son complementarias entre sí y pueden formar pares de bases. Los apareamientos de bases pueden ser un apareamiento de bases perfecto o pueden incluir imperfecciones, tales como bultos o desapareamientos. Por supuesto, oligonucleótidos adicionales que no participan en la formación del concatémero pueden incluirse en la composición si la composición incluye un único oligonucleótido con secuencias formadoras de dúplex que son capaces de apareamiento de bases con secuencias formadoras de dúplex en el oligonucleótido de la misma secuencia o múltiples secuencias de oligonucleótidos. Las composiciones de la invención son ampliamente aplicables a la formulación de oligonucleótidos. No se limitan a la formulación de oligonucleótidos inmunoestimulantes. Por ejemplo, las composiciones de la invención pueden usarse para formular ADN terapéutico, tal como oligonucleótidos antisentido o ARN, tal como oligonucleótidos de ARNip. En algunas realizaciones, las composiciones son útiles para formular oligonucleótidos inmunoestimulantes. Los oligonucleótidos inmunoestimulantes generalmente tienen una longitud en el intervalo de entre 6 y 100 nucleótidos. En algunas realizaciones, la longitud está en el intervalo de 6-40, 13-100, 13-40, 13-30, 15-50 o 15-30 nucleótidos, o cualquier intervalo de números enteros entremedias. Los términos "ácido nucleico" y "oligonucleótido" se usan indistintamente para significar múltiples nucleótidos (es decir, moléculas que incluyen un azúcar (por ejemplo, ribosa o desoxirribosa) ligados a un grupo fosfato y a una base orgánica intercambiable, que es tanto una pirimidina sustituida (por ejemplo, citosina (C), timina (T) o uracilo (U)) como una purina sustituida (por ejemplo, adenina (A) o guanina (G)). Como se usa en el presente documento, los términos "ácido nucleico" y "oligonucleótido" se refieren a oligorribonucleótidos, además de a oligodesoxirribonucleótidos. Los términos "ácido nucleico" y "oligonucleótido" deben también incluir polinucleósidos (es decir, un polinucleótido menos el fosfato) y cualquier otro polímero que contenga base orgánica. Pueden obtenerse moléculas de ácidos nucleicos a partir de fuentes de ácido nucleico existentes (por ejemplo, ADN genómico o ADNc), pero son preferentemente sintéticas (por ejemplo, producidas por síntesis de ácidos nucleicos). Los términos "ácido nucleico" y "oligonucleótido", como se usan en el presente documento, deben englobar moléculas de ácidos nucleicos y oligonucleótidos de la invención, además de análogos de oligonucleótidos de la invención. Los términos "oligodesoxinucleótido" y, equivalentemente, "ODN", como se usan en el presente documento, deben englobar oligodesoxinucleótidos no modificados de la invención, además de análogos de oligodesoxinucleótidos de la invención. Los términos "ácido nucleico" y "oligonucleótido" también engloban ácidos nucleicos u oligonucleótidos con sustituciones o modificaciones, tales como en las bases y/o azúcares. Por ejemplo, incluyen ácidos nucleicos que tienen azúcares de esqueleto que están covalentemente unidos a grupos orgánicos de bajo peso molecular distintos de un grupo hidroxilo en la posición 2' y distintos de un grupo fosfato o grupo hidroxi en la posición 5'. Así, los ácidos nucleicos modificados pueden incluir un grupo ribosa 2'-O-alquilado. Además, los ácidos nucleicos modificados pueden incluir azúcares tales como arabinosa o 2'-fluoroarabinosa en lugar de ribosa. Así, los ácidos nucleicos pueden ser de composición del esqueleto heterogénea, conteniendo así cualquier posible combinación de unidades poliméricas ligadas juntas tales como péptido-ácidos nucleicos (que tienen un esqueleto similar a péptido con bases de ácido nucleico). En algunas realizaciones, el oligonucleótido puede tener una o más modificaciones, en las que cada modificación se localiza en un puente internucleosídico de fosfodiéster particular y/o en una unidad de β-D- ribosa particular y/o en una posición de base de nucleósido natural particular en comparación con un oligonucleótido de la misma secuencia que está compuesto por ADN natural. Otros ejemplos se describen más abajo en más detalle. Los oligonucleótidos inmunoestimulantes de la presente invención pueden englobar diversas modificaciones químicas y sustituciones, en comparación con ARN y ADN natural, que implican un puente internucleosídico fosfodiéster, una unidad de β-D-ribosa y/o una base de nucleósido natural (tal como adenina, guanina, citosina, timina o uracilo). Ejemplos de modificaciones químicas son conocidas para el experto y se describen, por ejemplo, en Uhlmann E y col. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; Crooke ST y col. (1996) Annu Rev Pharmacol Toxicol 36:107-29; y Hunziker J y col. (1995) Mod Synth Methods 7:331-417. Un oligonucleótido según la invención puede tener una o más modificaciones, en las que cada modificación se localiza en un puente internucleosídico de fosfodiéster particular y/o en una unidad de β-D-ribosa particular y/o en una posición de base de nucleósido natural particular en comparación con un oligonucleótido de la misma secuencia que está compuesto por ADN o ARN natural.

Por ejemplo, los oligonucleótidos pueden incluir una o más modificaciones y en los que cada modificación está seleccionada independientemente de: a) la sustitución de un puente internucleosídico de fosfodiéster localizado en el extremo 3' y/o 5' de un nucleósido con un puente internucleosídico modificado, b) la sustitución del puente de fosfodiéster localizado en el extremo 3' y/o 5' de un nucleósido con un puente de fosfo, c) la sustitución de una unidad de fosfato de azúcar del esqueleto de fosfato de azúcar con otra unidad, d) la sustitución de una unidad de β-D-ribosa con una unidad de azúcar modificada y e) la sustitución de una base de nucleósido natural con una base de nucleósido modificadora.

Ejemplos más detallados de la modificación química de un oligonucleótido son los siguientes. Los oligonucleótidos pueden incluir enlaces internucleotídicos modificados, tales como aquellos descritos en a o b anteriormente. Estos enlaces modificados pueden ser parcialmente resistentes a la degradación (por ejemplo, están estabilizados). Una molécula de oligonucleótido estabilizada debe significar un oligonucleótido que es relativamente resistente a la degradación in vivo (por ejemplo, mediante una exo- o endo-nucleasa) resultante de tales modificaciones. Los oligonucleótidos que tienen enlaces fosforotioato, en algunas realizaciones, pueden proporcionar máxima actividad y proteger al oligonucleótido de la degradación por exo- y endo-nucleasas intracelulares. Un puente internucleosídico de fosfodiéster localizado en el extremo 3' y/o 5' de un nucleósido puede sustituirse con un puente internucleosídico modificado, en el que el puente internucleosídico modificado se selecciona, por ejemplo, de puentes fosforotioato, fosforoditioato, NR1R2-fosforamidato, boranofosfato, α-hidroxibencilfosfonato, éster fosfato- (C1-C21)-O-alquílico, éster fosfato-[aril (C6-C12)-(C1-C21)-O-alquílico], alquil (C1-C8)fosfonato y/o aril (C6- C12)fosfonato, (C7-C12)-α-hidroximetil-arilo (por ejemplo, se desvela en el documento WO 95/01363), en el que arilo (C6-C12), arilo (C6-C20) y arilo (C6-C14) están dado el caso sustituidos con halógeno, alquilo, alcoxi, nitro, ciano y en las que R1 y R2 son, independientemente entre sí, hidrógeno, alquilo (C1-C18), arilo (C6-C20), aril (C6- C14)-alquilo (C1-C8), preferentemente hidrógeno, alquilo (C1-C8), preferentemente alquilo (C1-C4) y/o metoxietilo, o R1 y R2 forman, junto con el átomo de nitrógeno que llevan, un anillo heterocíclico de 5-6 miembros que puede contener adicionalmente otro heteroátomo del grupo O, S y N.

La sustitución de un puente de fosfodiéster localizado en el extremo 3' y/o 5' de un nucleósido con un puente defosfo (se describen puentes defosfo, por ejemplo, en Uhlmann E y Peyman A en "Methods in Molecular Biology", vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Capítulo 16, pág. 355 y siguientes), en la que un puente defosfo se selecciona, por ejemplo, de los puentes defosfo formacetal, 3'- tioformacetal, metilhidroxilamina, oxima, metilendimetil-hidrazo, dimetilensulfona y/o grupos sililo. Una unidad de fosfato de azúcar (es decir, un puente internucleotídico de β-D-ribosa y de fosfodiéster que juntos forman una unidad de fosfato de azúcar) del esqueleto de fosfato de azúcar (es decir, un esqueleto de fosfato de azúcar está compuesto por unidades de fosfato de azúcar) puede sustituirse con otra unidad, en la que la otra unidad es, por ejemplo, adecuada para construir un oligómero "derivado de morfolino" (como se describe, por ejemplo, en Stirchak EP y col. (1989) Nucleic Acids Res 17:6129-41), es decir, por ejemplo, la sustitución con una unidad derivada de morfolino; o para construir un ácido nucleico de poliamida ("ADN"; como se describe, por ejemplo, en Nielsen PE y col. (1994) Bioconjug Chem 5:3-7), es decir, por ejemplo, la sustitución con una unidad de esqueleto de PNA, por ejemplo, por 2-aminoetilglicina. El oligonucleótido puede tener otras modificaciones del esqueleto de hidrato de carbono y sustituciones, tales como ácidos nucleicos peptídicos con grupos fosfato (PHONA), ácidos nucleicos bloqueados (LNA) y oligonucleótidos que tienen secciones del esqueleto con conectores de alquilo o conectores de amino. El conector de alquilo puede estar ramificado o no ramificado, sustituido o sin sustituir y ser quiralmente puro o una mezcla racémica.

Una unidad de β-ribosa o una unidad de β-D-2'-desoxirribosa puede sustituirse con una unidad de azúcar modificada, en la que la unidad de azúcar modificada se selecciona, por ejemplo, de β-D-ribosa, α-D-2'- desoxirribosa, L-2'-desoxirribosa, 2'-F-2'-desoxirribosa, 2'-F-arabinosa, 2'-O-alquil (C1-C6)-ribosa, preferentemente la 2'-O-alquil (C1-C6)-ribosa es 2'-O-metilribosa, 2'-O-alquenil (C2-C6)-ribosa, 2'-[O-alquil (C1-C6)-O-alquil (C1-C6)]- ribosa, 2'-NH2-2'-desoxirribosa, β-D-xilo-furanosa, α-arabinofuranosa, 2,4-didesoxi-β-D-eritro-hexo-piranosa y análogos carbocíclicos (descritos, por ejemplo, en Froehler (1992) J Am Chem Soc 114:8320) y/o de azúcar de cadena abierta (descritos, por ejemplo, en Vandendriessche y col. (1993) Tetrahedron 49:7223) y/o análogos de bicicloazúcar (descritos, por ejemplo, en Tarkov M y col. (1993) Helv Chim Acta 76:481). En algunas realizaciones, el azúcar es 2'-O-metilribosa, particularmente para uno o ambos nucleótidos ligados por un enlace internucleosídico fosfodiéster o similar a fosfodiéster. Las moléculas de ácidos nucleicos inmunoestimulantes de la presente invención pueden incluir esqueletos quiméricos. Para los fines de la presente invención, un esqueleto quimérico se refiere a un esqueleto parcialmente estabilizado, en el que al menos un enlace internucleotídico es fosfodiéster o similar a fosfodiéster y en el que al menos otro enlace internucleotídico es un enlace internucleotídico estabilizado, en el que el al menos un enlace fosfodiéster o similar a fosfodiéster y el al menos un enlace estabilizado son diferentes. Como se ha informado que los enlaces boranofosfonato están estabilizados con respecto a enlaces fosfodiéster, para los fines de la naturaleza quimérica del esqueleto, los enlaces boranofosfonato pueden clasificarse bien como similares a fosfodiéster o bien como estabilizados, dependiendo del contexto. Por ejemplo, un esqueleto quimérico de acuerdo con la presente invención podría incluir en una realización al menos un enlace fosfodiéster (fosfodiéster o similar a fosfodiéster) y al menos un enlace boranofosfonato (estabilizado). En otra realización, un esqueleto quimérico de acuerdo con la presente invención podría incluir enlaces boranofosfonato (fosfodiéster o similares a fosfodiéster) y fosforotioato (estabilizados). Un "enlace internucleotídico estabilizado" debe significar un enlace internucleotídico que es relativamente resistente a la degradación in vivo (por ejemplo, mediante una exo- o endo-nucleasa), en comparación con un enlace internucleotídico fosfodiéster. Enlaces internucleotídicos estabilizados preferidos incluyen, sin limitación, fosforotioato, fosforoditioato, metilfosfonato y no de metilfosforotioato. Otros enlaces internucleotídicos estabilizados incluyen, sin limitación: péptido, alquilo, defosfo y otros como se han descrito anteriormente. En particular, los enlaces internucleotídicos fosfodiéster o similares a fosfodiéster implican "dinucleótidos internos".

Un dinucleótido interno en general debe significar cualquier par de nucleótidos adyacentes conectados por un enlace internucleotídico, en el que ningún nucleótido en el par de nucleótidos es un nucleótido terminal, es decir, ningún nucleótido en el par de nucleótidos es un nucleótido que defina el extremo 5' o 3' del oligonucleótido. Así, un oligonucleótido lineal que tiene n nucleótidos de longitud tiene un total de n-1 dinucleótidos y solo n-3 dinucleótidos internos. Cada enlace internucleotídico en un dinucleótido interno es un enlace internucleotídico interno. Así, un oligonucleótido lineal que tiene n nucleótidos de longitud tiene un total de n-1 enlaces internucleotídicos y solo n-3 enlaces internucleotídicos internos. Por tanto, los enlaces internucleotídicos fosfodiéster o similares a fosfodiéster dispuestos estratégicamente se refieren a enlaces internucleotídicos fosfodiéster o similares a fosfodiéster posicionados entre cualquier par de nucleótidos en la secuencia de ácidos nucleicos. En algunas realizaciones, los enlaces internucleotídicos fosfodiéster o similares a fosfodiéster no están posicionados entre ningún par de nucleótidos más próximos al extremo 5' o 3'.

Un enlace internucleotídico fosfodiéster es el tipo de enlace característico de ácidos nucleicos encontrado en la naturaleza. El enlace internucleotídico fosfodiéster incluye un átomo de fósforo flanqueado por dos átomos de oxígeno de puente y unido también por dos átomos de oxígeno adicionales, uno cargado y el otro no cargado. El enlace internucleotídico fosfodiéster es particularmente preferido cuando es importante para reducir la semivida en tejido del oligonucleótido. Un enlace internucleotídico similar a fosfodiéster es un grupo de puente que contiene fósforo que es químicamente y/o diaestereoméricamente similar a fosfodiéster. Las medidas de la similitud a fosfodiéster incluyen susceptibilidad a la digestión con nucleasa y capacidad para activar RNasa H. Así, por ejemplo, los oligonucleótidos de fosfodiéster, pero no de fosforotioato, son susceptibles a la digestión con nucleasa, mientras que tanto los oligonucleótidos fosfodiéster como fosforotioato activan RNasa H. En una realización preferida, el enlace internucleotídico similar a fosfodiéster es enlace boranofosfato (o equivalentemente boranofosfonato). Patente de EE.UU. n.º 5.177.198; patente de EE.UU. n.º 5.859.231; patente de EE.UU. n.º 6.160.109; patente de EE.UU. n.º 6.207.819; Sergueev y col., (1998) J Am Chem Soc 120:9417-27. En otra realización preferida, el enlace internucleotídico similar a fosfodiéster es Rp fosforotioato diaestereoméricamente puro. Se cree que el Rp fosforotioato diaestereoméricamente puro es más susceptible a la digestión con nucleasa y es mejor en la activación de RNasa H que el Sp fosforotioato mezclado o diaestereoméricamente puro. Los estereoisómeros de oligonucleótidos CpG son el objeto de la solicitud de patente en tramitación junto con la presente U.S. 09/361.575 presentada el 27 de julio de 1999 y la solicitud publicada PCT PCT/US99/17100 (WO 00/06588). Debe observarse que para los fines de la presente invención, el término "enlace internucleotídico similar a fosfodiéster" excluye específicamente enlaces internucleotídicos fosforoditioato y metilfosfonato. Esqueletos modificados tales como fosforotioatos pueden sintetizarse usando técnicas automatizadas que emplean tanto químicas de fosforamidato como de H-fosfonato. Los aril- y alquil-fosfonatos pueden prepararse, por ejemplo, como se describe en la patente de EE.UU. n.º 4.469.863; y alquilfosfotriésteres (en los que el resto de oxígeno cargado está alquilado como se describe en la patente de EE.UU. n.º 5.023.243 y la patente europea n.º 092.574) pueden prepararse por síntesis en fase sólida automatizada usando reactivos comercialmente disponibles. Se han descrito procedimientos de preparación de otras modificaciones y sustituciones del esqueleto del ADN. Uhlmann E y col. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1:165. También se conocen procedimientos de preparación de oligonucleótidos quiméricos. Por ejemplo, patentes concedidas a Uhlmann y col. han descrito tales técnicas. Pueden sintetizarse oligonucleótidos modificados en el esqueleto mixtos usando un sintetizador de ADN comercialmente disponible y química de fosforamidito convencional (F. E. Eckstein, "Oligonucleotides and Analogues - A Practical Approach" IRL Press, Oxford, UK, 1991 y M. D. Matteucci y M. H. Caruthers, Tetrahedron Lett. 21, 719 (1980)). Después del acoplamiento, los enlaces PS se introducen por sulfurización usando el reactivo de Beaucage (R. P. lyer, W. Egan, J. B. Regan y S. L. Beaucage, J. Am. Chem. Soc. 112, 1253 (1990)) (0,075 M en acetonitrilo) o disulfuro de fenilacetilo (PADS), seguido de remate con anhídrido acético, 2,6-lutidina en tetrahidrofurano (1:1:8; v:v:v) y N-metilimidazol (16 % en tetrahidrofurano). Esta etapa de remate se realiza después de la reacción de sulfurización para minimizar la formación de enlaces fosfodiéster (PO) no deseados en las posiciones en las que un enlace fosforotioato debe localizarse. En el caso de la introducción de un enlace fosfodiéster, por ejemplo, en un dinucleótido CpG, el producto intermedio fósforo-III se oxida mediante tratamiento con una disolución de yodo en agua/piridina. Después de la escisión del soporte sólido y la desprotección final mediante tratamiento con amoniaco concentrado (15 h a 50 ºC), los ODN se analizan por HPLC sobre una columna GenPak™ Fax (Millipore-Waters) usando un gradiente de NaCl (por ejemplo, tampón A: NaH2PO4 10 mM en acetonitrilo/agua =1:4/v:v pH 6,8; tampón B: NaH2PO4 10 mM, NaCl 1,5 M en acetonitrilo/agua = 1:4/v:v; 5 al 60 % de B en 30 minutos a 1 ml/min) o por electroforesis en gel capilar. El ODN puede purificarse por HPLC o por FPLC sobre una columna Source High Performance (Amersham Pharmacia). Se combinan las fracciones homogéneas de HPLC y se desalan mediante una columna C18 o por ultrafiltración. Los ODN se analizan por espectrometría de masas de MALDI-TOF para confirmar la masa calculada. Los ácidos nucleicos de la invención también pueden incluir otras modificaciones. Éstos incluyen análogos de ADN no iónico, tales como alquil- y aril-fosfatos (en los que el oxígeno del fosfonato cargado está sustituido con un grupo alquilo o arilo), fosfodiéster y alquilfosfotriésteres, en los que el resto de oxígeno cargado está alquilado. También se ha mostrado que los ácidos nucleicos que contienen diol, tales como tetraetilenglicol o hexaetilenglicol, en cualquiera o ambos extremos, son sustancialmente resistentes a la degradación con nucleasas.

Los ácidos nucleicos también incluyen purinas y pirimidinas sustituidas tales como propinopirimidina en C-5 y bases modificadas de 7-deaza-7-purina sustituida. Wagner RW y col. (1996) Nat Biotechnol 14:840-4. Las purinas y pirimidinas incluyen, pero no se limitan a, adenina, citosina, guanina, timina y uracilo y otras nucleobases que se producen naturalmente y no naturalmente, restos aromáticos sustituidos y sin sustituir.

Una base modificada es cualquier base que es químicamente distinta de las bases que se producen naturalmente normalmente encontradas en ADN y ARN tales como T, C, G, A y U, pero que comparten estructuras químicas básicas con estas bases que se producen naturalmente. La base de nucleósidos modificada puede seleccionarse, por ejemplo, de hipoxantina, uracilo, dihidrouracilo, pseudouracilo, 2-tiouracilo, 4-tiouracilo, 5-aminouracilo, 5-alquil (C1-C6)-uracilo, 5-alquenil (C2-C6)-uracilo, 5-alquinil (C2-C6)-uracilo, 5-(hidroximetil)uracilo, 5-clorouracilo, 5- fluorouracilo, 5-bromouracilo, 5-hidroxicitosina, 5-alquil (C1-C6)-citosina, 5-alquenil (C2-C6)-citosina, 5-alquinil (C2- C6)-citosina, 5-clorocitosina, 5-fluorocitosina, 5-bromocitosina, N2-dimetilguanina, 2,4-diamino-purina, 8-azapurina, una 7-deaza-purina sustituida, preferentemente 7-deaza-7-purina sustituida y/o 7-deaza-8-sustituida, 5- hidroximetilcitosina, N4-alquilcitosina, por ejemplo, N4-etilcitosina, 5-hidroxido-oxicitidina, 5- hidroximetildesoxicitidina, N4-alquildesoxicitidina, por ejemplo, N4-etildesoxicitidina, 6-tiodesoxiguanosina, y desoxirribonucleósidos de nitropirrol, C5-propinilpirimidina y diaminopurina, por ejemplo, 2,6-diaminopurina, inosina, 5-metilcitosina, 2-aminopurina, 2-amino-6-cloropurina, hipoxantina u otras modificaciones de una base de nucleósidos natural. Esta lista pretende ser a modo de ejemplo y no debe interpretarse que es limitante.

En fórmulas particulares descritas en el presente documento pueden incorporarse bases modificadas. Por ejemplo, una citosina puede sustituirse con una citosina modificada. Una citosina modificada como se usa en el presente documento es un análogo de base de pirimidina de citosina que se produce naturalmente o que no se produce naturalmente que pueden sustituir esta base sin alterar la actividad inmunoestimulante del oligonucleótido. Las citosinas modificadas incluyen, pero no se limitan a, citosinas 5-sustituidas (por ejemplo, 5-metil-citosina, 5-fluoro- citosina, 5-cloro-citosina, 5-bromo-citosina, 5-yodo-citosina, 5-hidroxi-citosina, 5-hidroximetil-citosina, 5-difluorometil- citosina y 5-alquinil-citosina sin sustituir o sustituida), citosinas (por ejemplo, 6-hidroxi-citosina), citosinas (por ejemplo, N4-etil-citosina), 5-aza-citosina, 2-mercapto-citosina, isocitosina, pseudo-isocitosina, análogos de citosina con sistemas de anillos condensados (por ejemplo, N,N'-propilencitosina o fenoxazina) y uracilo y sus derivados (por ejemplo, 5-fluorouracilo, 5-bromo-uracilo, 5-bromovinil-uracilo, 4-tio-uracilo, 5-hidroxi-uracilo, 5-propinil-uracilo).

Algunas de las citosinas preferidas incluyen 5-metil-citosina, 5-fluoro-citosina, 5-hidroxi-citosina, 5-hidroximetil- citosina y N4-etil-citosina. En otra realización de la invención, la base de citosina está sustituida con una base universal (por ejemplo, 3-nitropirrol, base de P), un sistema de anillos aromáticos (por ejemplo, fluorobenceno o difluorobenceno) o un átomo de hidrógeno (espaciador D).

Una guanina puede sustituirse con una base de guanina modificada. Una guanina modificada como se usa en el presente documento es un análogo de base de purina de guanina que se produce naturalmente o que no se produce naturalmente que pueden sustituir esta base sin alterar la actividad inmunoestimulante del oligonucleótido. Las guaninas modificadas incluyen, pero no se limitan a, 7-deazaguanina, 7-deaza-7-guanina sustituida (tal como 7- deaza-7-alquinil (C2-C6)guanina), 7-deaza-8-guanina sustituida, hipoxantina, N2-guaninas sustituidas (por ejemplo, N2-metil-guaninas), 5-amino-3-metil-3H,6H-tiazolo[4,5-d]pirimidina-2,7-diona, 2,6-diaminopurina, 2-aminopurina, purina, indol, adenina, sustituido adeninas (por ejemplo, N6-metil-adenina, 8-oxo-adenina), 8-guanina sustituida (por ejemplo, 8-hidroxiguanina y 8-bromoguanina) y 6-tioguanina. En otra realización de la invención, la base de guanina está sustituida con una base universal (por ejemplo, 4-metil-indol, 5-nitro-indol y base de K), un sistema de anillos aromáticos (por ejemplo, bencimidazol o dicloro-bencimidazol, amida del ácido 1-metil-1H-[1,2,4]triazol-3-carboxílico) o un átomo de hidrógeno (dSpacer). Los oligonucleótidos inmunoestimulantes también pueden contener uno o más enlaces inusuales entre los restos de nucleótidos o de análogos de nucleótidos. El enlace internucleosídico usual es el enlace 3'5'. Todos los otros enlaces se consideran enlaces internucleosídicos inusuales, tales como los enlaces 2'5', 5'5', 3'3', 2'2' y 2'3'. Así, la nomenclatura 2' con respecto a 5' se elige según el átomo de carbono de ribosa. Sin embargo, si se emplean restos de azúcar no naturales, tales como análogos de azúcar de anillos expandidos (por ejemplo, hexanosa, cilohexeno o piranosa) o análogos de azúcar bi- o tricíclicos, entonces esta nomenclatura cambia según la nomenclatura del monómero. En análogos de 3'-desoxi-β-D-ribopiranosa (también llamados p-DNA), los mononucleótidos están conectados, por ejemplo, mediante un enlace 4'2'.

En principio, pueden producirse enlaces entre diferentes partes de un oligonucleótido o entre diferentes oligonucleótidos, respectivamente, mediante todas las partes de la molécula, en tanto que esto no interfiera negativamente con el reconocimiento por su receptor. Según la naturaleza del ácido nucleico, el enlace puede implicar el resto de azúcar (Su), la nucleobase heterocíclica (Ba) o el esqueleto de fosfato (Ph). Así, son posibles enlaces del tipo Su-Su, Su-Ph, Su-Ba, Ba-Ba, Ba-Su, Ba-Ph, Ph-Ph, Ph-Su y Ph-Ba. Si los oligonucleótidos se modifican adicionalmente por ciertos sustituyentes no nucleotídicos, el enlace también puede producirse mediante las partes modificadas de los oligonucleótidos. Estas modificaciones incluyen también ácidos nucleicos modificados, por ejemplo, PNA, LNA o análogos de oligonucleótidos de morfolino.

Los enlaces están compuestos preferentemente de C, H, N, O, S, B, P y halógeno, que contienen 3 a 300 átomos. Un ejemplo con 3 átomos es un enlace acetal (ODN1-3'-O-CH2-O-3'-ODN2; Froehler y Matteucci) que conecta, por ejemplo, el grupo 3'-hidroxi de un nucleótido con el grupo 3'-hidroxi de un segundo oligonucleótido. Un ejemplo con aproximadamente 300 átomos es PEG-40 (tetracontapolietilenglicol). Enlaces preferidos son fosfodiéster, fosforotioato, metilfosfonato, fosforamidato, boranofosfonato, amida, éter, tioéter, acetal, tioacetal, urea, tiourea, sulfonamida, base de Schiff y enlaces disulfuro. Otra posibilidad es el uso de Solulink BioConjugation System (TriLink BioTechnologies, San Diego, CA). Los oligonucleótidos inmunoestimulantes de la invención también pueden conjugarse con un grupo lipófilo. Un "grupo lipófilo" como se usa en el presente documento es un grupo funcional químico con una afinidad química por moléculas de lípido o no polares. En algunas realizaciones, el grupo lipófilo es colesterol.

Los oligonucleótidos inmunoestimulantes de la presente invención son útiles para inducir una respuesta inmunitaria similar a Th1. Se cree que son de uso particular en cualquier afección que se exija para administración prolongada o repetida del oligonucleótido inmunoestimulante para cualquier fin. Por consiguiente, los oligonucleótidos inmunoestimulantes de la presente invención son útiles como adyuvantes para vacunación y son útiles para tratar enfermedades que incluyen cáncer, enfermedad infecciosa, alergia y asma. El cáncer es una enfermedad que implica el crecimiento incontrolado (es decir, división) de células. Algunos de los mecanismos conocidos que contribuyen a la proliferación incontrolada de células cancerosas incluyen independencia de factores de crecimiento, fallo en detectar la mutación genómica y señalización inapropiada de células. La capacidad de las células cancerosas para ignorar los controles del crecimiento normal puede producir un aumento de la tasa de proliferación. Aunque las causas del cáncer no se han establecido firmemente, hay algunos factores que se sabe que contribuyen, o al menos predisponen a un sujeto, al cáncer. Tales factores incluyen mutaciones genéticas particulares (por ejemplo, mutación del gen BRCA para cáncer de mama, APC para cáncer de colon), exposición a agentes sospechosos de ser causantes del cáncer, o carcinógenos (por ejemplo, asbestos, radiación UV) y disposición familiar para cánceres particulares tales como cáncer de mama. El cáncer puede ser un cáncer maligno o no maligno. Los cánceres o tumores incluyen, pero no se limitan a, cáncer de las vías biliares; cáncer cerebral; cáncer de mama; cáncer del cuello uterino; coriocarcinoma; cáncer de colon; cáncer de endometrio; cáncer de esófago; cáncer gástrico; neoplasias intraepiteliales; linfomas; cáncer de hígado; cáncer de pulmón (por ejemplo, células pequeñas y células no pequeñas); melanoma; neuroblastomas; cáncer oral; cáncer de ovario; cáncer de páncreas; cáncer de próstata; cáncer rectal; sarcomas; cáncer de piel; cáncer testicular; cáncer de tiroides; y cáncer renal, además de otros carcinomas y sarcomas. En una realización, el cáncer es leucemia de células pilosas, leucemia mielógena crónica, leucemia cutánea de linfocitos T, mieloma múltiple, linfoma folicular, melanoma maligno, carcinoma de células escamosas, carcinoma de células renales, carcinoma de próstata, carcinoma de células de la vejiga o carcinoma de colon. Un sujeto que tiene un cáncer es un sujeto que tiene células cancerosas detectables. Un "sujeto en necesidad" de tratamiento para el cáncer es un sujeto que tiene células cancerosas detectables o es un sujeto en riesgo de desarrollar un cáncer.

Un sujeto en riesgo de desarrollar un cáncer es uno que tiene una probabilidad superior a la normal de desarrollar cáncer. Estos sujetos incluyen, por ejemplo, sujetos que tienen una anomalía genética que se ha demostrado que está asociada a una mayor probabilidad de desarrollar un cáncer, sujetos que tienen una disposición familiar a cáncer, sujetos expuestos a agentes causantes del cáncer (es decir, carcinógenos) tales como tabaco, asbestos u otras toxinas químicas y sujetos previamente tratados para el cáncer y en aparente remisión. Los oligonucleótidos inmunoestimulantes CpG también pueden administrarse conjuntamente con un tratamiento contra el cáncer tradicional. "Tratamiento contra el cáncer tradicional", como se usa en el presente documento, se refiere a medicamentos para el cáncer, radiación y procedimientos quirúrgicos. Como se usa en el presente documento, un "medicamento para el cáncer" se refiere a un agente que se administra a un sujeto con el fin de tratar un cáncer. Como se usa en el presente documento, "tratar cáncer" incluye prevenir el desarrollo de un cáncer, reducir los síntomas del cáncer y/o inhibir el crecimiento de un cáncer establecido. En otros aspectos, el medicamento para el cáncer se administra a un sujeto en riesgo de desarrollar un cáncer con el fin de reducir el riesgo de desarrollar el cáncer. Diversos tipos de medicamentos para el tratamiento del cáncer se describen en el presente documento. Con el fin de esta memoria descriptiva, los medicamentos para el cáncer se clasifican como agentes quimioterapéuticos, agentes inmunoterapéuticos, vacunas para el cáncer, terapia hormonal y modificadores de la respuesta biológica. En algunas realizaciones, el medicamento para el cáncer puede ligarse al oligonucleótido inmunoestimulante.

Adicionalmente, los procedimientos de la divulgación pretenden englobar el uso de más de un medicamento para el cáncer junto con los oligonucleótidos inmunoestimulantes CpG. Como un ejemplo, cuando corresponda, los oligonucleótidos inmunoestimulantes CpG pueden administrarse con tanto un agente quimioterapéutico como un agente inmunoterapéutico o un agente antiangiogénico. La combinación de los ODN CpG de clase P y un agente antiangiogénico puede incluir múltiples combinaciones con una o varias de otras terapias contra el cáncer.

Alternativamente, el medicamento para el cáncer puede englobar un agente inmunoterapéutico y una vacuna contra el cáncer, o un agente quimioterapéutico y una vacuna contra el cáncer, o un agente quimioterapéutico, un agente inmunoterapéutico y una vacuna contra el cáncer, todos administrados a un sujeto con el fin de tratar un sujeto que tiene un cáncer o en riesgo de desarrollar un cáncer. En algunas realizaciones, el tratamiento comprende además un anticuerpo.

El agente quimioterapéutico puede seleccionarse del grupo que consiste en metotrexato, vincristina, adriamicina, cisplatino, cloroetilnitrosoureas que no contienen azúcar, 5-fluorouracilo, mitomicina C, bleomicina, doxorubicina, dacarbazina, taxol, fragilina, meglamina GLA, valrubicina, carmustaína y poliferposan, MMI270, BAY 12-9566, inhibidor de la RAS farnesil transferasa, inhibidor de la farnesil transferasa, MMP, MTA/LY231514, LY264618/lometexol, glamolec, CI-994, TNP-470, Hycamtin/topotecan, PKC412, Valspodar/PSC833, Novantrone/mitroxantrona, Metaret/suramina, batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, InceI/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/marmistat, BB2516/marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/valrubicina, Metastron/derivado de estroncio, Temodal/temozolomida, Evacet/doxorubicina liposómica, Yewtaxan/paclitaxel, Taxol/paclitaxel, Xeload/capecitabina, Furtulon/doxifluridina, Cyclopax/paclitaxel oral, taxoide oral, SPU-077/cisplatino, HMR 1275/flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/inhibidor del oncogén RAS, BMS-182751/platino oral, UFT (Tegafur/uracilo), Ergamisol/levamisol, eniluracilo/776C85/potenciador de 5FU, Campto/levamisol, Camptosar/irinotecan, Tumodex/ralitrexed, Leustatin/cladribina, Paxex/paclitaxel, Doxil/doxorubicina liposómica, Caelyx/doxorubicina liposómica, Fludara/fludarabina, Pharmarubicin/epirubicina, DepoCyt, ZD1839, LU 79553/bis- naftalimida, LU 103793/dolastaína, Caetyx/doxorubicina liposómica, Gemzar/gemcitabina, ZD 0473/anormed, YM 116, semillas de yodo, inhibidores de CDK4 y CDK2, inhibidores de PARP, D4809/dexifosamida, Ifes/Mesnex/ifosamida, Vumon/tenipósido, Paraplatin/carboplatino, Plantinol/cisplatino, Vepeside/etopósido, ZD 9331, Taxotere/docetaxel, profármaco de guanina arabinósido, análogo de taxano, nitrosoureas, agentes alquilantes tales como melfelan y ciclofosfamida, aminoglutetimida, asparaginasa, busulfano, carboplatino, clorambucilo, cisplatino, HCl de citarabina, dactinomicina, HCl de daunorubicina, fosfato sódico de estramustina, etopósido (VP16- 213), floxuridina, fluorouracilo (5-FU), flutamida, hidroxiurea (hidroxicarbamida), ifosfamida, interferón alfa-2a, alfa- 2b, acetato de leuprolida (análogo del factor de liberación de LHRH), lomustina (CCNU), HCl de mecloretamina (mostaza de nitrógeno), mercaptopurina, mesna, mitotano (o,p'-DDD), HCl de mitoxantrona, octreotida, plicamicina, HCl de procarbazina, estreptozocina, citrato de tamoxifeno, tioguanina, tiotepa, sulfato de vinblastina, amsacrina (m- AMSA), azacitidina, eritropoyetina, hexametilmelamina (HMM), interleucina 2, mitoguazona (metil-GAG; metilglioxal bis-guanilhidrazona; MGBG), pentostatina (2'-desoxicoformicina), semustina (metil-CCNU), tenipósido (VM-26) y sulfato de vindesina, pero no se limita a éstos. El agente inmunoterapéutico o antiangiogénico puede seleccionarse del grupo que consiste en Rituxan, Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, anti-CTLA-4, Avastin, anti-EGFR, Iressa, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab- H, GNI-250, EMD-72000, LinfoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab 3 ImmuRAIT-CEA, pero no se limita a éstos.

La vacuna contra el cáncer puede seleccionarse del grupo que consiste en EGF, vacunas antiidiotípicas contra el cáncer, antígeno Gp75, vacuna para el melanoma GMK, vacuna de conjugado de gangliósido MGV, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), vacuna idiotípica liposómica, Melacine, vacunas de péptido o de antígeno recombinante de proteína, vacunas de toxina/antígeno, vacuna basada en MVA, PACIS, vacuna de BCG, TA-VPH, TA-CIN, DISC-virus, conjugados de uno o más antígenos asociados al tumor con otras proteínas o moléculas inmunoestimulantes, e ImmuCyst/TheraCys, pero no se limita a éstos. El uso de oligonucleótidos inmunoestimulantes CpG conjuntamente con agentes inmunoterapéuticos tales como anticuerpos monoclonales puede aumentar la supervivencia a largo plazo mediante varios mecanismos que incluyen potenciamiento significativo de ADCC (como se trata anteriormente), activación de células NK y un aumento en los niveles de IFN-α. Los ácidos nucleicos, cuando se usan en combinación con anticuerpos monoclonales, sirven para reducir la dosis del anticuerpo requerida para lograr un resultado biológico. En los casos cuando el oligonucleótido CpG se administra con un antígeno, el sujeto puede exponerse al antígeno. Como se usa en el presente documento, el término "expuesto a" se refiere a tanto la etapa activa de poner en contacto el sujeto con un antígeno como la exposición pasiva del sujeto al antígeno in vivo. Procedimientos para la exposición activa de un sujeto a un antígeno son muy conocidos en la técnica. En general, un antígeno se administra directamente al sujeto mediante cualquier medio tal como administración intravenosa, intramuscular, oral, transdérmica, mucosa, intranasal, intratraqueal o subcutánea. El antígeno puede administrarse sistémicamente o localmente. Procedimientos de administración del antígeno y el oligonucleótido inmunoestimulante CpG se describen más abajo en más detalle. Un sujeto se expone pasivamente a un antígeno si un antígeno está disponible para la exposición a las células inmunitarias en el cuerpo. Un sujeto puede exponerse pasivamente a un antígeno, por ejemplo, por entrada de un patógeno extraño en el cuerpo o por el desarrollo de una célula tumoral que expresa un antígeno extraño sobre su superficie.

Los procedimientos en los que un sujeto se expone pasivamente a un antígeno pueden ser particularmente dependientes del momento exacto de la administración del oligonucleótido inmunoestimulante CpG. Por ejemplo, en un sujeto en riesgo de desarrollar un cáncer o una enfermedad infecciosa o una respuesta alérgica o asmática, al sujeto puede administrársele el oligonucleótido inmunoestimulante CpG regularmente cuando ese riesgo es el mayor, por ejemplo, durante la estación de alergia o después de la exposición a un agente causante del cáncer. Adicionalmente, el oligonucleótido inmunoestimulante CpG puede administrarse a viajeros antes de viajar a países extranjeros en los que están en riesgo de exposición a agentes infecciosos. Asimismo, el oligonucleótido inmunoestimulante CpG puede administrarse a soldados o civiles en riesgo de exposición a guerra bacteriológica para inducir una respuesta inmunitaria sistémica o en la mucosa al antígeno cuando y si el sujeto se expone a ella. Un antígeno, como se usa en el presente documento, es una molécula que puede provocar una respuesta inmunitaria. Los antígenos incluyen, pero no se limitan a, células, extractos celulares, proteínas, polipéptidos, péptidos, polisacáridos, conjugados de polisacáridos, miméticos de péptidos y no péptidos de polisacáridos y otras moléculas, moléculas pequeñas, lípidos, glicolípidos, hidratos de carbono, virus y extractos virales y organismos multicelulares tales como parásitos y alérgenos. El término antígeno incluye ampliamente cualquier tipo de molécula que sea reconocida por un sistema inmunitario del huésped como extraña. Los antígenos incluyen, pero no se limitan a, antígenos del cáncer, antígenos microbianos y alérgenos. Un antígeno del cáncer, como se usa en el presente documento, es un compuesto, tal como un péptido o proteína, asociado a un tumor o superficie de célula cancerosa y que puede provocar una respuesta inmunitaria cuando se expresa sobre la superficie de una célula presentadora de antígeno en el contexto de una molécula del MHC. Los antígenos del cáncer pueden prepararse a partir de células cancerosas tanto preparando extractos en bruto de células cancerosas, por ejemplo, como se describe en Cohen PA y col. (1994) Cancer Res 54:1055-8, purificando parcialmente los antígenos, por tecnología recombinante, como por síntesis de novo de antígenos conocidos. Los antígenos del cáncer incluyen, pero no se limitan a, antígenos que se expresan recombinantemente, una porción inmunogénica de los mismos, o un tumor completo o célula cancerosa. Tales antígenos pueden aislarse o prepararse recombinantemente o por cualquier otro medio conocido en la técnica. Como se usa en el presente documento, los términos "antígeno del cáncer" y "antígeno de tumor" se usan indistintamente para referirse a antígenos que se expresan diferencialmente por células cancerosas y pueden así explotarse con el fin de elegir como diana células cancerosas. Los antígenos del cáncer son antígenos que pueden estimular posiblemente aparentemente respuestas inmunitarias específicas de tumor. Algunos de estos antígenos están codificados, aunque no se expresan necesariamente, por células normales. Estos antígenos pueden caracterizarse como aquellos que normalmente son silenciosos (es decir, no se expresan) en células normales, aquellos que se expresan solo en ciertas etapas de diferenciación y aquellos que se expresan temporalmente tales como antígenos embrionarios y fetales. Otros antígenos del cáncer están codificados por genes celulares mutantes, tales como oncogenes (por ejemplo, oncogén ras activado), genes supresores (por ejemplo, p53 mutante), o proteínas de fusión resultantes de deleciones internas o translocalizaciones cromosómicas. Todavía otros antígenos del cáncer pueden codificarse por genes virales tales como aquellos llevados sobre virus tumorales de ARN y ADN. Los síntomas del asma incluyen episodios recurrentes de sibilancias, dificultad al respirar y opresión en el pecho y tos, resultante de la obstrucción del flujo de aire. La inflamación de las vías respiratorias asociada al asma puede detectarse mediante la observación de varios cambios fisiológicos, tales como denudación del epitelio de las vías respiratorias, deposición de colágeno debajo de la membrana basal, edema, activación de mastocitos, infiltración de células inflamatorias, que incluyen neutrófilos, eosinófilos y linfocitos. Como resultado de la inflamación de las vías respiratorias, los pacientes con asma frecuentemente experimentan hipersensibilidad de las vías respiratorias, limitación del flujo de aire, síntomas respiratorios y cronicidad de la enfermedad. Las limitaciones del flujo de aire incluyen broncoconstricción aguda, edema de las vías respiratorias, formación de tapón mucoso y remodelación de las vías respiratorias, características que frecuentemente conducen a obstrucción bronquial. En algunos casos de asma puede producirse fibrosis de la membrana subbasal, conduciendo a anomalías persistentes en la función pulmonar.

La investigación durante varios años pasados ha revelado que el asma probablemente resulta de complejas interacciones entre células inflamatorias, mediadores y otras células y tejidos residentes en las vías respiratorias. Los mastocitos, eosinófilos, células epiteliales, macrófagos y linfocitos T activados desempeñan todos una función importante en el proceso inflamatorio asociado al asma (Djukanovic y col., Am. Rev. Respir. Dis; 142:434-457; 1990). Se cree que estas células pueden influir en la función de las vías respiratorias mediante la secreción de mediadores previamente formados y recientemente sintetizados que pueden actuar directamente o indirectamente sobre el tejido local. También se ha reconocido que las subpoblaciones de linfocitos T (Th2) desempeñan una función importante en la regulación de la inflamación alérgica en las vías respiratorias liberando citocinas selectivas y estableciendo cronicidad de la enfermedad (Robinson y col. N. Engl. J. Med.; 326:298-304; 1992).

El asma es un trastorno complejo que se produce en diferentes etapas en el desarrollo y puede clasificarse, basándose en el grado de síntomas, en agudo, subagudo o crónico. Una respuesta inflamatoria aguda está asociada a un reclutamiento temprano de células en las vías respiratorias. La respuesta inflamatoria subaguda implica el reclutamiento de células, además de la activación de células residentes, causando un patrón de inflamación más persistente. La respuesta inflamatoria crónica se caracteriza por un nivel persistente de daño celular y un proceso de reparación continuo, que puede producir anomalías permanentes en las vías respiratorias.

Un "sujeto que tiene asma" es un sujeto que tiene un trastorno del sistema respiratorio caracterizado por inflamación, estrechamiento de las vías respiratorias y elevada reactividad de las vías respiratorias a agentes inhalados. El asma se asocia frecuentemente, aunque no exclusivamente, a síntomas atópicos o alérgicos. Un iniciador es una composición o condición medioambiental que desencadena el asma. Los iniciadores incluyen, pero no se limitan a, alérgenos, temperaturas frías, ejercicio, infecciones virales, SO2. Los oligonucleótidos también son útiles para redirigir una respuesta inmunitaria de una respuesta inmunitaria Th2 a una respuesta inmunitaria Th1. Esto produce la producción de un entorno Th1/Th2 relativamente equilibrado. La redirección de una respuesta inmunitaria de una respuesta inmunitaria de Th2 a a Th1 puede evaluarse midiendo los niveles de citocinas producidos en respuesta al ácido nucleico (por ejemplo, induciendo células monocíticas y otras células para que produzcan citocinas Th1, que incluyen IFN-α). La redirección o re-equilibrio de la respuesta inmunitaria de una respuesta Th2 a una Th1 es particularmente útil para el tratamiento de asma. Por ejemplo, una cantidad eficaz para tratar asma puede ser aquella cantidad útil para redirigir un tipo Th2 de respuesta inmunitaria que está asociada con asma a un tipo Th1 de respuesta o un entorno de Th1/Th2 equilibrado. Las citocinas Th2, especialmente IL-4 y IL-5, son elevadas en las vías respiratorias de sujetos asmáticos. Los oligonucleótidos inmunoestimulantes CpG descritos en el presente documento producen un aumento en citocinas Th1 que ayuda a re-equilibrar el sistema inmunitario, previniendo o reduciendo los efectos adversos asociados a una respuesta inmunitaria predominantemente Th2.

La redirección de una respuesta inmunitaria de una respuesta inmunitaria Th2 a una Th1 también puede evaluarse midiendo los niveles de isotipos específicos de inmunoglobulina. Por ejemplo, en ratones IgG2a está asociada a una respuesta inmunitaria Th1, e IgG1 e IgE están asociadas a una respuesta inmunitaria Th2.

Como se usa en el presente documento, "asma agravado por infección viral" se refiere al aumento en los síntomas asmáticos y/o la gravedad de los síntomas durante o tras una infección viral. Las infecciones respiratorias virales pueden agravar los síntomas y/o el desarrollo del asma, especialmente en niños pequeños, aumentando la cantidad de citocinas TH2 presentes. Las infecciones virales respiratorias producidas por rinovirus, coronavirus, virus de la gripe, paragripal y respiratorio sincitial (VRS) son desencadenantes comunes de los ataques de asma y pueden producir elevadas sibilancias y síntomas en pacientes con asma. Los oligonucleótidos inmunoestimulantes de la presente invención pueden usarse para tratar remodelación de las vías respiratorias en pacientes con asma o alergia. La remodelación de los tejidos estructurales y funcionales en los pulmones es un factor de morbilidad significativo para asmáticos crónicos. Como se usa en el presente documento, la "remodelación de las vías respiratorias" se refiere a los cambios en el tejido pulmonar que se producen con la inflamación crónica presente en los pulmones de asmáticos crónicos. Estos cambios pueden incluir elevada deposición de colágeno y masa de músculo liso de las vías respiratorias, hiperplasia de mastocitos y células caliciformes e hipertrofia de células epiteliales. Como resultado de tales cambios, la estructura de las paredes de las vías respiratorias puede cambiar, causando el bloqueo que en algunos casos no puede invertirse completamente con tratamiento. En lugar de o además del asma, un sujeto en necesidad de tratamiento para remodelación de las vías respiratorias puede tener enfermedad pulmonar obstructiva crónica o ser un fumador. En algunas realizaciones, el sujeto está libre de síntomas de asma. Los oligonucleótidos inmunoestimulantes de la presente invención pueden usarse para tratar alergia. Una "alergia" se refiere a hipersensibilidad adquirida a una sustancia (alérgeno). Las afecciones alérgicas incluyen, pero no se limitan a, eczema, "rinitis alérgica" o coriza, fiebre del heno, conjuntivitis, alergia ocular, asma bronquial, urticaria (ronchas) y alergias alimentarias y otras afecciones atópicas, dermatitis atópica; anafilaxia; alergia a los fármacos; angioedema; y conjuntivitis alérgica. Las enfermedades alérgicas en los perros incluyen, pero no se limitan a, dermatitis estacional; dermatitis perenne; rinitis: conjuntivitis; asma alérgica; y reacciones a los fármacos. Las enfermedades alérgicas en los gatos incluyen, pero no se limitan a, dermatitis y trastornos respiratorios; y alérgenos alimentarios. Las enfermedades alérgicas en los caballos incluyen, pero no se limitan a, trastornos respiratorios tales como "obstrucciones" y dermatitis. Las enfermedades alérgicas en primates no humanos incluyen, pero no se limitan a, asma alérgica, alergia ocular y dermatitis alérgica.

La alergia es una enfermedad asociada a la producción de anticuerpos de una clase particular de inmunoglobulina, IgE, contra alérgenos. El desarrollo de una respuesta mediada por IgE a aeroalérgenos comunes también es un factor que indica predisposición hacia el desarrollo de asma. Si un alérgeno encuentra una IgE específica que está unida a un receptor de IgE de Fc sobre la superficie de un basófilo (que circula en la sangre) o mastocito (disperso en todo el tejido sólido), la célula se activa, produciendo la producción y liberación de mediadores tales como histamina, serotonina y mediadores de lípido. Las enfermedades alérgicas incluyen, pero no se limitan a, rinitis (fiebre del heno), asma, urticaria y dermatitis atópica. Un sujeto que tiene una alergia es un sujeto que actualmente está experimentando o ha experimentado previamente una reacción alérgica en respuesta a un alérgeno.

Un sujeto en riesgo de desarrollar una alergia o asma es un sujeto que se ha identificado que ha tenido una alergia o asma en el pasado, pero que actualmente no está sufriendo la enfermedad activa, además de un sujeto que se considera que está en riesgo de desarrollar asma o alergia debido a factores genéticos o medioambientales. Un sujeto en riesgo de desarrollar alergia o asma también puede incluir un sujeto que tiene cualquier riesgo de exposición a un alérgeno o un riesgo de desarrollar asma, es decir, alguien que ha sufrido un ataque asmático previamente o tiene una predisposición a ataques asmáticos. Por ejemplo, un sujeto en riesgo puede ser un sujeto que está planeando viajar a un área en la que se encuentra un tipo particular de alérgeno o iniciador asmático o puede incluso ser cualquier sujeto que vive en un área en la que se ha identificado un alérgeno. Si el sujeto desarrolla respuestas alérgicas a un antígeno particular y el sujeto puede exponerse al antígeno, es decir, durante la estación del polen, entonces ese sujeto está en riesgo de exposición al antígeno. Actualmente, las enfermedades alérgicas se tratan generalmente por la inyección de pequeñas dosis de antígeno, seguido de dosificación creciente posterior de antígeno. Se cree que este procedimiento induce tolerancia inmunológica al alérgeno para prevenir posteriores reacciones alérgicas. Estos procedimientos, sin embargo, pueden tardar varios años en ser eficaces y están asociados al riesgo de efectos secundarios tales como choque anafiláctico. Los procedimientos de la divulgación de la invención pueden combinarse con tratamientos para la alergia tradicionales para aumentar su eficacia y disminuir enormemente el tiempo que se necesita para que los efectos se presenten en pacientes.

Los síntomas de la reacción alérgica varían, dependiendo de la localización dentro del cuerpo en la que la IgE reacciona con el antígeno. Si la reacción se produce a lo largo del epitelio respiratorio, los síntomas son estornudos, tos y reacciones asmáticas. Si la interacción se produce en el tubo digestivo, como en el caso de alergias alimentarias, son comunes dolor abdominal y diarrea. Las reacciones sistemáticas, por ejemplo, tras una picadura de abeja, pueden ser graves y frecuentemente potencialmente mortales.

La hipersensibilidad de tipo retardado, también conocida como reacción alérgica de tipo IV, es una reacción alérgica caracterizada por un periodo de retardo de al menos 12 horas desde la invasión del antígeno en el sujeto alérgico hasta la aparición de la reacción inflamatoria o inmunitaria. Los linfocitos T (linfocitos T sensibilizados) de individuos en una afección alérgica reaccionan con el antígeno, provocando que los linfocitos T liberen linfocinas (factor inhibidor de la migración de macrófagos (MIF), factor activante de macrófagos (MAF), factor mitogénico (MF), factor reactivo de la piel (SRF), factor quimiotáctico, factor acelerador de la neovascularización, etc.), que sirven de mediadores de la inflamación y la actividad biológica de estas linfocinas, junto con los efectos directos e indirectos de linfocitos que aparecen localmente y otras células inmunitarias inflamatorias, dan lugar a la reacción alérgica de tipo IV. Las reacciones alérgicas retardadas incluyen reacción tipo tuberculina, reacción de rechazo del homoinjerto, reacción protectora tipo dependiente de células, reacción de hipersensibilidad por dermatitis de contacto y similares, que son conocidos por ser más fuertemente suprimidos por agentes esteroideos. Por consiguiente, los agentes esteroideos son eficaces contra enfermedades que se producen por reacciones alérgicas retardadas. El uso a largo plazo de agentes esteroideos a concentraciones que se usan actualmente pueden, sin embargo, conducir al grave efecto secundario conocido como dependencia de esteroides. Los procedimientos de la divulgación resuelven algunos de estos problemas, proporcionando que se administren menos dosis y más bajas. La hipersensibilidad inmediata (o respuesta anafiláctica) es una forma de reacción alérgica que se desarrolla muy rápidamente, es decir, dentro de segundos o minutos desde la exposición del paciente al alérgeno causante y está mediada por anticuerpos IgE preparados por linfocitos B. En pacientes no alérgicos, no hay anticuerpo IgE de relevancia clínica; pero, en una persona que sufre enfermedades alérgicas, el anticuerpo IgE media en la hipersensibilidad inmediata sensibilizando mastocitos, que son abundantes en la piel, órganos linfoides, en las membranas del ojo, nariz y boca y en las vías respiratorias e intestinos. Los mastocitos tienen receptores de superficie para IgE y los anticuerpos IgE en pacientes que sufren alergia se unen a ellos. Como se ha tratado brevemente anteriormente, cuando la IgE unida se pone posteriormente en contacto por el alérgeno apropiado, se provoca que el mastocito se desgranule y libere diversas sustancias llamadas mediadores bioactivos, tales como histamina, en el tejido de alrededor. Es la actividad biológica de estas sustancias la que es responsable de los síntomas clínicos típicos de la hipersensibilidad inmediata; concretamente, la contracción de músculo liso en las vías respiratorias o el intestino, la dilatación de pequeños vasos sanguíneos y el aumento en su permeabilidad al agua y proteínas plasmáticas, la secreción de moco pegajoso espeso y en la piel, rojez, hinchazón y la estimulación de terminaciones nerviosas que produce picor o dolor. La lista de alérgenos es enorme y puede incluir polen, venenos de insecto, caspa de animales, polvo, esporas fúngicas y fármacos (por ejemplo, penicilina). Ejemplos de alérgenos naturales, animales y de plantas incluyen, pero no se limitan a, proteínas específicas para los siguientes géneros: Canine (Canis familiaris); Dermatophagoides (por ejemplo, Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia); Lolium (por ejemplo, Lolium perenne o Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (por ejemplo, Plantago lanceolata); Parietaria (por ejemplo, Parietaria officinalis o

Parietaria judaica); Blattella (por ejemplo, Blattella germanica); Apis (por ejemplo, Apis multiflorum); Cupressus (por ejemplo, Cupressus sempervirens, Cupressus arizonica y Cupressus macrocarpa); Juniperus (por ejemplo,

Juniperus sabinoides, Juniperus virginiana, Juniperus communis y Juniperus ashei); Thuya (por ejemplo, Thuya orientalis); Chamaecyparis (por ejemplo, Chamaecyparis obtusa); Periplaneta (por ejemplo, Periplaneta americana); Agropyron (por ejemplo, Agropyron repens); Secale (por ejemplo, Secale cereale); Triticum (por ejemplo, Triticum aestivum); Dactylis (por ejemplo, Dactylis glomerata); Festuca (por ejemplo, Festuca elatior); Poa (por ejemplo, Poa

pratensis o Poa compressa); Avena (por ejemplo, Avena sativa); Holcus (por ejemplo, Holcus lanatus); Anthoxanthum (por ejemplo, Anthoxanthum odoratum); Arrhenatherum (por ejemplo, Arrhenatherum elatius); Agrostis (por ejemplo, Agrostis alba); Phleum (por ejemplo, Phleum pratense); Phalaris (por ejemplo, Phalaris arundinacea); Paspalum (por ejemplo, Paspalum notatum); Sorghum (por ejemplo, Sorghum halepensis); y Bromus (por ejemplo, Bromus inermis).

El alérgeno puede estar sustancialmente purificado. El término sustancialmente purificado, como se usa en el presente documento, se refiere a un antígeno, es decir, un polipéptido que está sustancialmente libre de otras proteínas, lípidos, hidratos de carbono u otros materiales con los que está naturalmente asociado. Un experto en la materia puede purificar antígenos de polipéptido usando técnicas convencionales para la purificación de proteínas.

El polipéptido sustancialmente puro frecuentemente dará una única banda importante sobre un gel de poliacrilamida no reductor. En el caso de polipéptidos parcialmente glucosilados o aquellos que tienen varios codones de iniciación, pueden tener varias bandas sobre un gel de poliacrilamida no reductor, pero estos formarán un patrón distinto para ese polipéptido. La pureza del antígeno de polipéptido también puede determinarse por análisis de secuencias de aminoácidos del extremo amino. Otros tipos de antígenos tales como polisacáridos, molécula pequeña, miméticos, etc., están incluidos dentro de la invención y dado el caso pueden estar sustancialmente puros. Los oligonucleótidos inmunoestimulantes CpG pueden combinarse con un inmunomodulador adicional tal como un adyuvante para modular una respuesta inmunitaria. El oligonucleótido inmunoestimulante CpG y el otro agente terapéutico pueden administrarse simultáneamente o secuencialmente. Cuando los otros agentes terapéuticos se administran simultáneamente, pueden administrarse en las mismas formulaciones o formulaciones separadas, pero se administran al mismo tiempo. Los otros agentes terapéuticos se administran secuencialmente entre sí y con el oligonucleótido inmunoestimulante CpG, cuando la administración de los otros agentes terapéuticos y el oligonucleótido inmunoestimulante CpG se separan temporalmente. Más específicamente, el oligonucleótido inmunoestimulante CpG puede administrarse antes o después de la administración de (o exposición a) al menos otro agente terapéutico. La separación en el tiempo entre la administración de estos compuestos pueden ser una cuestión de minutos o puede ser más larga. Otros agentes terapéuticos incluyen, pero no se limitan a, adyuvantes, citocinas, anticuerpos, antígenos, etc. Las composiciones de la invención también pueden administrarse con adyuvantes de no ácido nucleico. Un adyuvante de no ácido nucleico es cualquier molécula o compuesto, excepto por los oligonucleótidos inmunoestimulantes CpG descritos en el presente documento, que puede estimular la respuesta inmunitaria humoral y/o celular. Los adyuvantes de no ácido nucleico incluyen, por ejemplo, adyuvantes que crean un efecto de depósito, adyuvantes inmunoestimulantes y adyuvantes que crean un efecto de depósito y estimulan el sistema inmunitario.

Los oligonucleótidos inmunoestimulantes CpG también son útiles como adyuvantes de la mucosa. Se ha descubierto previamente que tanto la inmunidad sistémica como de la mucosa se inducen por la administración a la mucosa de ácidos nucleicos CpG. Así, los oligonucleótidos pueden administrarse en combinación con otros adyuvantes de la mucosa.

Las respuestas inmunitarias también pueden inducirse o aumentarse por la co-administración o expresión colineal de citocinas (Bueler & Mulligan, 1996; Chow y col., 1997; Geissler y col., 1997; Iwasaki y col., 1997; Kim y col., 1997) o moléculas coestimulantes tales como B7 (Iwasaki y col., 1997; Tsuji y col., 1997) con los oligonucleótidos inmunoestimulantes CpG. El término citocina se usa como un nombre genérico para un diverso grupo de proteínas solubles y péptidos que actúan de reguladores humorales a concentraciones de nano- a picomolares y que, tanto bajo afecciones normales como patológicas, modulan las actividades funcionales de células y tejidos individuales. Estas proteínas también median en las interacciones entre células directamente y regulan los procesos que tienen lugar en el entorno extracelular. Ejemplos de citocinas incluyen, pero no se limitan a, interleucina-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, factor estimulante de colonias de granulocitos-macrófagos (GM-CSF), factor estimulante de colonias de granulocitos (G-CSF), IFN-γ, IFN-α, IFN-β, factor de necrosis tumoral (TNF), TGF- β, ligando Flt-3 y ligando CD40. Además de las citocinas, los oligonucleótidos CpG pueden usarse en combinación con anticuerpos contra ciertas citocinas, tales como anti-IL-10 y anti-TGF-β, además de inhibidores de la ciclooxigenasa, es decir, inhibidores de la COX-1 y COX-2. Los oligonucleótidos inmunoestimulantes CpG también son útiles para tratar y prevenir trastornos inflamatorios.

Como se usa en el presente documento, el término "trastorno inflamatorio" se refiere a una afección asociada a una reacción no específica de antígeno del sistema inmunitario innato que implica la acumulación y activación de leucocitos y proteínas plasmáticas en un sitio de infección, exposición a toxinas, o lesión celular. Las citocinas que son características de la inflamación incluyen factor de necrosis tumoral (TNF-α), interleucina 1 (IL-1), IL-6, IL-12, interferón alfa (IFN-α), interferón beta (IFN-β) y quimiocinas. Los trastornos inflamatorios incluyen, por ejemplo, asma, alergia, enfermedad cardiovascular por rinitis alérgica, enfermedad pulmonar obstructiva crónica (EPOC), bronquiectasia, colecistitis crónica, tuberculosis, tiroiditis de Hashimoto, septicemia, sarcoidosis, silicosis y otras neumoconiosis y un cuerpo extraño implantado en un herida, pero no se limitan a éstos. Los oligonucleótidos inmunoestimulantes CpG también son útiles para tratar y prevenir enfermedades autoinmunitarias. La enfermedad autoinmunitaria es una clase de enfermedades en las que los propios anticuerpos del sujeto reaccionan con tejido del huésped o en las que los linfocitos T efectores inmunitarios son auto-reactivos para los péptidos propios endógenos y producen destrucción de tejido. Así, se organiza una respuesta inmunitaria contra los propios antígenos de un sujeto, denominados los auto-antígenos. Las enfermedades autoinmunitarias incluyen, pero no se limitan a, artritis reumatoide, psoriasis, enfermedades inflamatorias del intestino, colitis ulcerosa, enfermedad de Crohn, esclerosis múltiple, lupus eritematoso sistémico (LES), encefalomielitis autoinmune, miastenia grave (MG), tiroiditis de Hashimoto, síndrome de Goodpasture, pénfigo (por ejemplo, pénfigo vulgar), enfermedad de Graves, anemia hemolítica autoinmune, púrpura trombocitopénica autoinmune, esclerodermia con anticuerpos anti- colágeno, enfermedad mixta del tejido conjuntivo, polimiositis, anemia perniciosa, enfermedad de Addison idiopática, infertilidad asociada a la autoinmunidad, glomerulonefritis (por ejemplo, glomerulonefritis crescéntica, glomerulonefritis proliferativa), penfigoide bulloso, síndrome de Sjögren, resistencia a la insulina y diabetes mellitus autoinmune. Un "auto-antígeno", como se usa en el presente documento, se refiere a un antígeno de un tejido del huésped normal. El tejido del huésped normal no incluye células cancerosas. Así, una respuesta inmunitaria organizada contra un auto-antígeno, en el contexto de una enfermedad autoinmunitaria, es una respuesta inmunitaria no deseable y contribuye a la destrucción y el daño de tejido normal, mientras que una respuesta inmunitaria organizada contra un antígeno del cáncer es una respuesta inmunitaria deseable y contribuye a la destrucción del tumor o cáncer. Así, en algunos aspectos de la invención dirigidos a tratar trastornos autoinmunitarios, no se recomienda administrar los oligonucleótidos inmunoestimulantes CpG con auto-antígenos, particularmente aquellos que son las dianas del trastorno autoinmunitario.

En otros casos, los oligonucleótidos inmunoestimulantes CpG pueden administrarse con bajas dosis de auto- antígenos. Varios estudios en animales han demostrado que la administración a la mucosa de bajas dosis de antígeno puede producir un estado de hiposensibilidad inmunitaria o "tolerancia". El mecanismo activo parece ser una desviación inmunitaria mediada por citocinas lejos de una respuesta Th1 hacia una respuesta predominantemente Th2 y Th3 (es decir, dominada por TGF-β). La supresión activa con administración de antígeno de baja dosis también puede suprimir una respuesta inmunitaria no relacionada (supresión circunstancial), que es de interés considerable en la terapia de enfermedades autoinmunitarias, por ejemplo, artritis reumatoide y LES. La supresión circunstancial implica la secreción de citocinas supresoras contrarreguladoras de Th1 en el entorno local en el que las citocinas proinflamatorias y Th1 son liberadas en tanto un modo específico de antígeno como no específico de antígeno. "Tolerancia", como se usa en el presente documento, se usa para referirse a este fenómeno. De hecho, la tolerancia oral ha sido eficaz en el tratamiento de varias enfermedades autoinmunitarias en animales que incluyen: encefalomielitis autoinmune experimental (EAE), miastenia grave autoinmune experimental, artritis inducida por colágeno (AIC) y diabetes mellitus dependiente de insulina. En estos modelos, la prevención y supresión de la enfermedad autoinmunitaria está asociada a un desplazamiento en las respuestas humorales y celulares específicas de antígeno de una respuesta Th1 a Th2/Th3. La divulgación también incluye procedimientos de inducción de la activación inmunitaria innata no específica de antígeno y resistencia de amplio espectro a la exposición infecciosa usando los oligonucleótidos inmunoestimulantes CpG. El término activación inmunitaria innata, como se usa en el presente documento, se refiere a la activación de células inmunitarias distintas de linfocitos B de memoria y, por ejemplo, puede incluir la activación de monocitos, neutrófilos, macrófagos, células dendríticas, células NK y/u otras células inmunitarias que pueden responder de un modo independiente de antígeno. Se induce una resistencia de amplio espectro a la exposición infecciosa debido a que las células inmunitarias están en forma activa y son sensibilizadas para responder a cualquier compuesto invasor o microorganismo. Las células no tienen que ser específicamente sensibilizadas contra un antígeno particular. Esto es particularmente útil en guerra bacteriológica y las otras circunstancias descritas anteriormente tales como viajeros. En otras realizaciones, el oligonucleótido se administra al sujeto en una cantidad eficaz para inducir la expresión de citocinas o quimiocinas. Dado el caso, la citocina o quimiocina está seleccionada del grupo que consiste en IL-6, TNF-α, IFN-α, IFN-γ e IP-10. En otras realizaciones, el oligonucleótido se administra al sujeto en una cantidad eficaz para desplazar la respuesta inmunitaria a una respuesta sesgada Th1 desde una respuesta sesgada Th2. Los oligonucleótidos inmunoestimulantes de la presente invención pueden usarse para tratar o prevenir enfermedad infecciosa. Una "enfermedad infecciosa", como se usa en el presente documento, se refiere a un trastorno que se produce a partir de la invasión de un huésped, superficialmente, localmente o sistémicamente, por un organismo infeccioso. Los organismos infecciosos incluyen bacterias, virus, hongos y parásitos. Por consiguiente, "enfermedad infecciosa" incluye infecciones bacterianas, infecciones virales, infecciones fúngicas e infecciones parasíticas. Las bacterias son organismos unicelulares que se multiplican asexualmente por fisión binaria. Se clasifican y se nombran basándose en su morfología, reacciones de tinción, nutrición y requisitos metabólicos, estructura antigénica, composición química y homología genética. Las bacterias pueden clasificarse en tres grupos basándose en sus formas morfológicas, esféricas (cocos), varillas rectas (bacilos) y varillas curvas o en espiral (vibrio, campylobacter, spirillum y spirochaete). Las bacterias también se caracterizan más comúnmente basándose en sus reacciones de tinción en dos clases de organismos, Gram-positivas y Gram-negativas. Gram se refiere al procedimiento de tinción que comúnmente se realiza en los laboratorios de microbiología. Los organismos Gram- positivos retienen la tinción tras el procedimiento de tinción y aparecen de un color violeta oscuro. Los organismos Gram-negativos no retienen la tinción, pero aceptan la contra-tinción y así aparecen rosas. La solicitud de patente no provisional de EE.UU. n.º 09/801.839, presentada el 8 de marzo de 2001, enumera varias bacterias, cuyas infecciones pretende prevenir y tratar la presente invención.

Las bacterias Gram-positivas incluyen, pero no se limitan a, especies de Pasteurella, especies de Staphylococci y especies de Streptococcus. Las bacterias Gram-negativas incluyen, pero no se limitan a, Escherichia coli, especies de Pseudomonas y especies de Salmonella. Ejemplos específicos de bacterias infecciosas incluyen, pero no se limitan a, Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (por ejemplo, M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae,

Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Streptococcus del grupo A), Streptococcus agalactiae (Streptococcus del grupo B), Streptococcus (grupo viridans), Streptococcus faecalis, Streptococcus bovis, Streptococcus (especies anaerobias), Streptococcus pneumoniae, Campylobacter sp. patógenas, Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae,

Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, Rickettsia y Actinomyces israelii. Ejemplos de hongos incluyen Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.

Otros organismos infecciosos (es decir, protistas) incluyen Plasmodium spp. tales como Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale y Plasmodium vivax y Toxoplasma gondii. Los parásitos transmitidos por la sangre y/o de los tejidos incluyen Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense y Trypanosoma

rhodesiense (enfermedad del sueño africana), Trypanosoma cruzi (enfermedad de Chagas) y Toxoplasma gondii. Los parásitos son organismos que dependen de otros organismos para sobrevivir y así deben entrar en, o infectar, otro organismo para continuar su ciclo de vida. El organismo infectado, es decir, el huésped, proporciona tanto nutrición como hábitat al parásito. Aunque en su sentido más amplio el término parásito puede incluir todos los agentes infecciosos (es decir, bacterias, virus, hongos, protozoos y helmintos), en términos generales, el término se usa para referirse únicamente a protozoos, helmintos y artrópodos ectoparasíticos (por ejemplo, garrapatas, ácaros, etc.). Los protozoos son organismos unicelulares que pueden replicarse tanto intracelularmente como extracelularmente, particularmente en la sangre, tubo intestinal o la matriz extracelular de tejidos. Los helmintos son organismos pluricelulares que casi siempre son extracelulares (siendo la excepción Trichinella spp.). Los helmintos normalmente requieren la salida de un huésped primario y la transmisión en un huésped secundario con el fin de replicarse. A diferencia de estas clases anteriormente mencionadas, los artrópodos ectoparasíticos forman una relación parasítica con la superficie externa del cuerpo del huésped. Se han descrito ampliamente en la bibliografía otros microorganismos médicamente relevantes, por ejemplo, véase C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983.

Los oligonucleótidos de la invención pueden administrarse a un sujeto con un agente antimicrobiano. Un agente antimicrobiano, como se usa en el presente documento, se refiere a un compuesto que se produce naturalmente o sintético que puede destruir o inhibir los microorganismos infecciosos. El tipo de agente antimicrobiano útil según la invención dependerá del tipo de microorganismo con el que el sujeto se infecte o está en riesgo de ser infectado.

Los agentes antimicrobianos incluyen, pero no se limitan a, agentes antibacterianos, agentes antivirales, agentes antifúngicos y agentes antiparasíticos. Términos tales como "agente antiinfeccioso", "agente antibacteriano", "agente antiviral", "agente antifúngico", "agente antiparasítico" y "parasiticida" tienen significados bien establecidos para aquellos expertos habituales en la materia y se definen en textos médicos estándar. Brevemente, los agentes antibacterianos destruyen o inhiben bacterias, e incluyen antibióticos, además de otros compuestos sintéticos o naturales que tienen funciones similares. Los antibióticos son moléculas de bajo peso molecular que se producen como metabolitos secundarios por células, tales como microorganismos. En general, los antibióticos interfieren con una o más funciones o estructuras bacterianas que son específicas para el microorganismo y que no están presentes en células huésped. Los agentes antivirales pueden aislarse de fuentes naturales o sintetizarse y son útiles para la destrucción o inhibición de virus. Los agentes antifúngicos se usan para tratar infecciones fúngicas superficiales, además de infecciones fúngicas oportunistas y sistémicas primarias. Los agentes antiparasíticos destruyen o inhiben parásitos. Ejemplos de agentes antiparasíticos, también denominados parasiticidas útiles para administración humana, incluyen, pero no se limitan a, albendazol, anfotericina B, benznidazol, bitionol, HCl de cloroquina, fosfato de cloroquina, clindamicina, dehidroemetina, dietilcarbamazina, diloxanida furoato, eflornitina, furazolidona, glucocorticoides, halofantrina, yodoquinol, ivermectina, mebendazol, mefloquina, antimoniato de meglumina, melarsoprol, metrifonato, metronidazol, niclosamida, nifurtimox, oxamniquina, paromomicina, isetionato de pentamidina, piperazina, praziquantel, fosfato de primaquina, proguanilo, pamoato de pirantel, pirimetamina- sulfonamidas, pirimetamina-sulfadoxina, HCl de quinacrina, sulfato de quinina, gluconato de quinidina, espiramicina, estibogluconato de sodio (gluconato de sodio y antimonio), suramina, tetraciclina, doxiciclina, tiabendazol, tinidazol, trimetroprim-sulfametoxazol y triparsamida, algunos de los cuales se usan solos o en combinación con otros. Los agentes antibacterianos destruyen o inhiben el crecimiento o la función de bacterias. Una gran clase de agentes antibacterianos es los antibióticos. Los antibióticos, que son eficaces para destruir o inhibir una amplia gama de bacterias, se denominan antibióticos de espectro amplio. Otros tipos de antibióticos son predominantemente eficaces contra las bacterias de la clase Gram-positiva o Gram-negativa. Estos tipos de antibióticos se denominan antibióticos de espectro estrecho. Otros antibióticos que son eficaces contra un único organismo o enfermedad y no contra otros tipos de bacterias se denominan antibióticos de espectro limitado. Los agentes antibacterianos se clasifican algunas veces basándose en su modo de acción primario. En general, los agentes antibacterianos son inhibidores de la síntesis de la pared celular, inhibidores de la membrana celular, inhibidores de la síntesis de proteínas, inhibidores de la síntesis de ácidos nucleicos o funcionales, e inhibidores competitivos. Los agentes antifúngicos son útiles para el tratamiento y la prevención de hongos infecciosos. Los agentes antifúngicos se clasifican algunas veces por su mecanismo de acción. Algunos agentes antifúngicos sirven de inhibidores de la pared celular, inhibiendo la glucosa sintasa. Éstos incluyen, pero no se limitan a, basiungina/ECB.

Otros agentes antifúngicos funcionan desestabilizando la integridad de la membrana. Éstos incluyen, pero no se limitan a, imidazoles, tales como clotrimazol, sertaconazol, fluconazol, itraconazol, ketoconazol, miconazol y voriconacol, además de FK 463, anfotericina B, BAY 38-9502, MK 991, pradimicina, UK 292, butenafina y terbinafina. Otros agentes antifúngicos funcionan por degradación de quitina (por ejemplo, quitinasa) o inmunosupresión (501 Cream).

En algunas realizaciones, el tratamiento antimicrobiano puede incluir un antígeno microbiano. Un antígeno microbiano es un antígeno de un microorganismo e incluye, pero no se limita a, virus, bacterias, parásitos y hongos. Tales antígenos incluyen el microorganismo intacto, además de cepas aisladas naturales y fragmentos o derivados de las mismas y también compuestos sintéticos que son idénticos o similares a antígenos de microorganismos naturales e inducen una respuesta inmunitaria específica para ese microorganismo. Un compuesto es similar a un antígeno de microorganismo natural si induce una respuesta inmunitaria (humoral y/o celular) a un antígeno de microorganismo natural. Tales antígenos se usan rutinariamente en la materia y son muy conocidos para aquellos expertos habituales en la materia.

Los oligonucleótidos inmunoestimulantes de la presente invención pueden usarse para tratar o prevenir infección viral. Los virus son agentes infecciosos pequeños que generalmente contienen un núcleo de ácido nucleico y una envuelta de proteína, pero no son organismos independientemente vivos. Los virus también pueden tomar la forma de ácidos nucleicos infecciosos que carecen de una proteína. Un virus no puede sobrevivir en ausencia de una célula viva dentro de la que pueda replicarse. Los virus entran en las células vivas específicas tanto por endocitosis como por inyección directa de ADN (fago) y se multiplican, causando la enfermedad. El virus multiplicado puede entonces liberarse e infectar células adicionales. Algunos virus son virus que contienen ADN y otros son virus que contienen ARN. Ejemplos de virus que se han encontrado en seres humanos incluyen, pero no se limitan a: Retroviridae (por ejemplo, virus de la inmunodeficiencia humana, tal como VIH-1 (también denominado HTLV-III, LAV o HTLV-III/LAV, o VIH-III; y otras cepas aisladas, tales como VIH-LP; Picornaviridae (por ejemplo, virus de la poliomielitis, virus de la hepatitis A; enterovirus, virus de Coxsackie humanos, rinovirus, ecovirus); Calciviridae (por ejemplo, cepas que producen gastroenteritis); Togaviridae (por ejemplo, virus de la encefalitis equina, virus de la rubeola); Flaviviridae (por ejemplo, virus del dengue, virus de la encefalitis, virus de la fiebre amarilla); Coronaviridae (por ejemplo, coronavirus); Rhabdoviridae (por ejemplo, virus de la estomatitis vesicular, virus de la rabia); Filoviridae (por ejemplo, virus del Ébola); Paramyxoviridae (por ejemplo, virus paragripales, virus de las paperas, virus del sarampión, virus respiratorio sincitial); Orthomyxoviridae (por ejemplo, virus de la gripe); Bunyaviridae (por ejemplo, virus de Hanta, virus de Bunya, flebovirus y virus de Nairo); Arena viridae (virus de la fiebre hemorrágica); Reoviridae (por ejemplo, reovirus, orbivirus y rotavirus); Bornaviridae; Hepadnaviridae (virus de la hepatitis B); Parvoviridae (parvovirus); Papovaviridae (virus del papiloma, virus del polioma); Adenoviridae (la mayoría de los adenovirus); Herpesviridae (virus del herpes simple (VHS) 1 y 2, virus de la varicela zóster, citomegalovirus (CMV), virus del herpes); Poxviridae (virus de la viruela, virus de la variolovacuna, poxvirus); e Iridoviridae (por ejemplo, virus de la fiebre porcina africana); y virus no clasificados (por ejemplo, el agente de la hepatitis delta (que se cree que es un satélite defectuoso del virus de la hepatitis B), hepatitis C; virus de Norwalk y relacionados y astrovirus).

Los oligonucleótidos inmunoestimulantes de la presente invención pueden administrarse simultáneamente con un tratamiento antiviral tradicional. En algunas realizaciones, el agente antiviral y el oligonucleótido CpG de la invención están ligados. Los agentes antivirales son compuestos que previenen la infección de células por virus o la replicación del virus dentro de la célula. Hay muchos menos fármacos antivirales que fármacos antibacterianos debido a que el proceso de replicación viral está tan estrechamente relacionado con la replicación de ADN dentro de la célula huésped, que agentes antivirales no específicos serían frecuentemente tóxicos para el huésped. Hay varias etapas dentro del proceso de infección viral que pueden bloquearse o inhibirse por agentes antivirales. Estas etapas incluyen unión del virus a la célula huésped (inmunoglobulina o péptidos de unión), no recubrimiento del virus (por ejemplo, amantadina), síntesis o traducción de ARNm viral (por ejemplo, interferón), replicación de ARN o ADN viral (por ejemplo, análogos de nucleósido), maduración de nuevas proteínas virales (por ejemplo, inhibidores de la proteasa) y gemación y liberación del virus. Los análogos de nucleótidos son compuestos sintéticos que son similares a los nucleótidos, pero que tienen un grupo incompleto o desoxirribosa o ribosa anormal. Una vez los análogos de nucleótidos están en la célula, se fosforilan, produciendo la forma de trifosfato que compite con los nucleótidos normales para la incorporación en el ADN o ARN viral. Una vez la forma de trifosfato del análogo de nucleótido se incorpora en la cadena de ácido nucleico en crecimiento, produce la asociación irreversible con la polimerasa viral y así la terminación de la cadena. Análogos de nucleótidos incluyen, pero no se limitan a, aciclovir (usado para el tratamiento del virus del herpes simple y virus de la varicela zóster), ganciclovir (útil para el tratamiento de citomegalovirus), idoxuridina, ribavirina (útil para el tratamiento del virus respiratorio sincitial), didesoxiinosina, didesoxicitidina, zidovudina (azidotimidina), imiquimod y resiquimod. Los interferones son citocinas que son secretadas por células infectadas por virus, además de células inmunitarias. Los interferones funcionan uniéndose a receptores específicos sobre células adyacentes a las células infectadas, causando el cambio en la célula que la protege de la infección por el virus. Los interferones α y β también inducen la expresión de moléculas del MHC de clase I y clase II sobre la superficie de células infectadas, produciendo la elevada presentación de antígenos para el reconocimiento de células inmunitarias del huésped. Los interferones α y β están disponibles como formas recombinantes y se han usado para el tratamiento de infección por hepatitis B y C crónica. A las dosificaciones que son eficaces para la terapia antiviral, los interferones tienen graves efectos secundarios tales como fiebre, malestar general y pérdida de peso.

Otros agentes antivirales útiles en la invención incluyen, pero no se limitan a, inmunoglobulinas, amantadina, interferones, análogos de nucleósido e inhibidores de la proteasa. Ejemplos específicos de antivirales incluyen, pero no se limitan a, acemanano; aciclovir; aciclovir sódico; adefovir; alovudina; alvircept sudotox; clorhidrato de amantadina; aranotina; arildona; mesilato de atevirdina; avridina; cidofovir; cipamfilina; clorhidrato de citarabina; mesilato de delavirdina; desciclovir; didanosina; disoxarilo; edoxudina; enviradeno; enviroxima; famciclovir; clorhidrato de famotina; fiacitabina; fialuridina; fosarilato; foscarnet sódico; fosfonet sódico; ganciclovir; ganciclovir sódico; idoxuridina; ketoxal; lamivudina; lobucavir; clorhidrato de memotina; metisazona; nevirapina; penciclovir; pirodavir; ribavirina; clorhidrato de rimantadina; mesilato de saquinavir; clorhidrato de somantadina; sorivudina; estatolona; estavudina; clorhidrato de tilorona; trifluridina; clorhidrato de valaciclovir; vidarabina; fosfato de vidarabina; fosfato sódico de vidarabina; viroxima; zalcitabina; zidovudina; y zinviroxima. Los oligonucleótidos inmunoestimulantes CpG pueden administrarse directamente al sujeto o pueden administrarse conjuntamente con un complejo de administración de ácido nucleico. Un complejo de administración de ácido nucleico debe significar una molécula de ácido nucleico asociada a (por ejemplo, iónicamente o covalentemente unida a; o encapsulada dentro de) un medio que elige diana (por ejemplo, una molécula que produce mayor unión por afinidad a la célula diana). Ejemplos de complejos de administración de ácidos nucleicos incluyen ácidos nucleicos asociados a un esterol (por ejemplo, colesterol), un lípido (por ejemplo, un lípido catiónico, virosoma o liposoma), o un agente de unión específico a célula diana (por ejemplo, un ligando reconocido por el receptor específico de célula diana). Los complejos preferidos pueden ser suficientemente estables in vivo para prevenir el no acoplamiento significativo antes de la internalización por la célula diana. Sin embargo, el complejo puede ser escindible bajo condiciones apropiadas dentro de la célula, de manera que el oligonucleótido se libere en una forma funcional. El oligonucleótido inmunoestimulante CpG y/o el antígeno y/u otros terapéuticos pueden administrarse solos (por ejemplo, en solución salina o tampón) o usando cualquier vehículo de administración conocido en la técnica. Por ejemplo, se han descrito los siguientes vehículos de administración: cocleatos; emulsomas; ISCOM; liposomas; vectores bacterianos vivos (por ejemplo, Salmonella, Escherichia coli, bacilo Calmette-Guerin, Shigella, Lactobacillus); vectores virales vivos (por ejemplo, variolovacuna, adenovirus, herpes simple); microesferas; vacunas de ácido nucleico; polímeros (por ejemplo, carboximetilcelulosa, quitosano); anillos de polímeros; fluoruro de sodio; plantas transgénicas; virosomas; partículas similares a virus. Otros vehículos de administración se conocen en la técnica. El término "cantidad eficaz" se refiere generalmente a la cantidad necesaria o suficiente para realizar un efecto biológico deseado. Por ejemplo, una cantidad eficaz de un oligonucleótido inmunoestimulante CpG administrado con un antígeno para inducir inmunidad a la mucosa es esa cantidad necesaria para producir el desarrollo de IgA en respuesta a un antígeno tras la exposición al antígeno, mientras que esa cantidad requerida para inducir la inmunidad sistémica es aquella cantidad necesaria para producir el desarrollo de IgG en respuesta a un antígeno tras la exposición al antígeno. Combinado con las enseñanzas proporcionadas en el presente documento, eligiendo entre los diversos compuestos activos y ponderando factores tales como la potencia, biodisponibilidad relativa, peso corporal del paciente, gravedad de los efectos secundarios adversos y modo de administración preferido, puede planearse una pauta de tratamiento profiláctico o terapéutico eficaz que no produzca toxicidad sustancial y que sea todavía completamente eficaz para tratar el sujeto particular. La cantidad eficaz para cualquier aplicación particular puede variar dependiendo de factores tales como la enfermedad o afección que está tratándose, el oligonucleótido inmunoestimulante CpG particular que se administra, el tamaño del sujeto, o la gravedad de la enfermedad o afección. Un experto habitual en la materia puede determinar empíricamente la cantidad eficaz de un oligonucleótido inmunoestimulante CpG particular y/o antígeno y/u otro agente terapéutico sin necesidad de excesiva experimentación. Las dosis objeto de los compuestos descritos en el presente documento para administración a la mucosa o local normalmente oscilan de aproximadamente 10 µg a 10 g por administración, que dependiendo de la aplicación podrían administrarse diariamente, semanalmente o mensualmente y cualquier otra cantidad de tiempo entremedias o de otro modo según se requiera. Más normalmente, las dosis a la mucosa o locales oscilan de aproximadamente 1 mg a 500 mg por administración y lo más normalmente de aproximadamente 1 mg a 100 mg, estando 2 - 4 administraciones separadas días o semanas. Más normalmente, la dosis de inmunoestimulante oscila de 10 µg a 100 mg por administración y lo más normalmente 100 µg a 10 mg, con administraciones diarias o semanales. Las dosis objeto de los compuestos descritos en el presente documento para administración parenteral (es decir, SC o IM) con el fin de inducir una respuesta inmunitaria específica del antígeno, en las que los compuestos se administran con un antígeno, pero no otro agente terapéutico, normalmente están en aproximadamente el mismo intervalo de dosis o algo menor que la dosis a la mucosa eficaz (es decir, IN, sublingual, oral, intravaginal, rectal, etc.) para adyuvante para vacuna o aplicaciones inmunoestimulantes. Las dosis de los compuestos descritos en el presente documento para administración parenteral con el fin de inducir una respuesta inmunitaria innata o para aumentar ADCC o para inducir una respuesta inmunitaria específica de antígeno cuando los oligonucleótidos inmunoestimulantes CpG se administran en combinación con otros agentes terapéuticos o en vehículos de administración especializados normalmente oscilan de aproximadamente 100 µg a 10 g por administración, que dependiendo de la aplicación podrían administrarse diariamente, semanalmente o mensualmente y cualquier otra cantidad de tiempo entremedias o de otro modo según se requiera. Más normalmente, las dosis parenterales para estos fines oscilan de aproximadamente 1 mg a 5 g por administración y lo más normalmente de aproximadamente 1 mg a 1 g, estando 2 - 4 administraciones separadas días o semanas. En algunas realizaciones, sin embargo, la dosis parenteral para estos fines puede usarse en un intervalo de 5 a 10.000 veces superior a las dosis típicas descritas anteriormente. Dependiendo de la aplicación, la duración de la dosificación requerida puede ser solo de una o algunas dosis, o para el tratamiento de afecciones crónicas, la dosificación podría ser durante muchos años diariamente, semanalmente o mensualmente. Para cualquier compuesto descrito en el presente documento, la cantidad terapéuticamente eficaz puede determinarse inicialmente a partir de modelos en animales. Una dosis terapéuticamente eficaz también puede determinarse a partir de datos humanos para otros oligonucleótidos CpG que se han probado en seres humanos (están en marcha ensayos clínicos en seres humanos) y para compuestos que se sabe que presentan actividades farmacológicas similares, tales como otros adyuvantes, por ejemplo, LT y otros antígenos para fines de vacunación. Pueden requerirse mayores dosis para administración parenteral. La dosis aplicada puede ajustarse basándose en la biodisponibilidad relativa, masa corporal y potencia del compuesto administrado. El ajuste de la dosis para lograr la máxima eficacia basándose en los procedimientos descritos anteriormente y otros procedimientos como son muy conocidos en la técnica está perfectamente dentro de las capacidades del experto en la materia. Las formulaciones de la invención se administran en disoluciones farmacéuticamente aceptables, que pueden contener rutinariamente concentraciones farmacéuticamente aceptables de sal, agentes de tamponamiento, conservantes, vehículos compatibles, adyuvantes y, dado el caso, otros componentes terapéuticos. Algunas formulaciones pueden contener un alcohol, por ejemplo, un sacárido (por ejemplo, dextrosa), o un aminoácido. Para su uso en terapia, una cantidad eficaz del oligonucleótido inmunoestimulante CpG y/u otros terapéuticos puede administrarse a un sujeto por cualquier modo que administre el compuesto a la superficie deseada, por ejemplo, local, mucosa, sistémico. La administración de la composición farmacéutica de la presente invención puede llevarse a cabo mediante cualquier medio conocido para el experto. Vías de administración preferidas incluyen, pero no se limitan a, oral, parenteral, intravenosa, intramuscular, subcutánea, intralesional, intratumoral, intranasal, sublingual, intratraqueal, inhalación, ocular, vaginal y rectal.

Para administración por vía oral, los compuestos (es decir, oligonucleótidos inmunoestimulantes CpG, antígenos y/u otros agentes terapéuticos) pueden formularse fácilmente combinando el (los) compuesto(s) activo(s) con vehículos farmacéuticamente aceptables muy conocidos en la técnica. Tales vehículos permiten formular los compuestos de la invención como comprimidos, píldoras, comprimidos recubiertos de azúcar, cápsulas, líquidos, geles, jarabes, purés, suspensiones y similares, para ingestión oral por un sujeto que va a tratarse. Las preparaciones farmacéuticas para uso oral pueden obtenerse como un excipiente sólido, dado el caso, moliendo una mezcla resultante y procesando la mezcla de gránulos, después de añadir auxiliares adecuados, si se desea, para obtener comprimidos o núcleos de comprimidos recubiertos de azúcar. Excipientes adecuados son, en particular, cargas tales como azúcares, que incluyen lactosa, sacarosa, manitol o sorbitol; preparaciones de celulosa tales como, por ejemplo, almidón de maíz, almidón de trigo, almidón de arroz, almidón de patata, gelatina, goma tragacanto, metilcelulosa, hidroxipropilmetil-celulosa, carboximetilcelulosa sódica y/o polivinilpirrolidona (PVP). Si se desea, pueden añadirse agentes disgregantes, tales como polivinilpirrolidona reticulada, agar, o ácido algínico o una sal del mismo tal como alginato de sodio. Dado el caso, las formulaciones orales también pueden formularse en solución salina o tampones para neutralizar condiciones ácidas internas o pueden administrarse sin ningún vehículo. Se proporcionan núcleos de comprimidos recubiertos de azúcar con recubrimientos adecuados. Para este fin, pueden usarse disoluciones de azúcar concentradas, que pueden contener, dado el caso, goma arábiga, talco, polivinilpirrolidona, gel carbopol, polietilenglicol y/o dióxido de titanio, disoluciones de laca y disolventes orgánicos adecuados o mezclas de disolventes. Pueden añadirse tintas o pigmentos a los comprimidos o recubrimientos de comprimidos recubiertos de azúcar para la identificación o para caracterizar diferentes combinaciones de dosis de compuestos activos.

Las preparaciones farmacéuticas que pueden usarse por vía oral incluyen cápsulas duras hechas de gelatina, además de blandas, cápsulas selladas hechas de gelatina y un plastificante, tal como glicerol o sorbitol. Las cápsulas duras pueden contener los principios activos en mezcla con carga tal como lactosa, aglutinantes tales como almidones y/o lubricantes tales como talco o estearato de magnesio y, dado el caso, estabilizadores. En cápsulas blandas, los compuestos activos pueden disolverse o suspenderse en líquidos adecuados, tales como aceites grasos, parafina líquida o polietilenglicoles líquidos. Además, pueden añadirse estabilizadores. También pueden usarse microesferas formuladas para administración por vía oral. Tales microesferas se han definido bien en la materia. Todas las formulaciones para administración por vía oral deben estar en dosificaciones adecuadas para tal administración.

Para administración por vía oral, las composiciones pueden tomar la forma de comprimidos o pastillas para chupar formuladas de manera convencional. Los compuestos pueden administrarse por inhalación a la vía pulmonar, especialmente los bronquios y más particularmente a los alvéolos del pulmón profundo, usando dispositivos de inhalación estándar. Los compuestos pueden administrarse en forma de una presentación de espray en aerosol de envases presurizados o un nebulizador, con el uso de un propulsor apropiado, por ejemplo, diclorodifluorometano, triclorofluorometano, diclorotetrafluoroetano, dióxido de carbono u otro gas adecuado. En el caso de un aerosol presurizado, la unidad de dosificación puede determinarse proporcionando una válvula para administrar una cantidad dosificada. Puede usarse un aparato de inhalación para administrar los compuestos a un sujeto. Un aparato de inhalación, como se usa en el presente documento, es cualquier dispositivo para administrar un aerosol, tal como en forma en polvo seco de los compuestos. Este tipo de equipo es muy conocido en la técnica y se ha descrito en detalle, tal como aquella descripción encontrada en Remington: The Science and Practice of Pharmacy, 19ª edición, 1995, Mac Publishing Company, Easton, Pensilvania, páginas 1676-1692. Muchas patentes de EE.UU. también describen dispositivos de inhalación, tales como la patente de EE.UU. n.º 6.116.237. "Polvo", como se usa en el presente documento, se refiere a una composición que consiste en partículas sólidas finamente dispersas. Preferentemente, los compuestos son relativamente fluidos y capaces de dispersarse en un dispositivo de inhalación y posteriormente ser inhalados por un sujeto de manera que los compuestos lleguen a los pulmones para permitir la penetración en los alvéolos. Un "polvo seco" se refiere a una composición en polvo que tiene un contenido de humedad tal que las partículas sean fácilmente dispersables en un dispositivo de inhalación para formar un aerosol. El contenido de humedad es generalmente inferior a aproximadamente el 10 % en peso ( % en p) de agua y en algunas realizaciones está por debajo de aproximadamente el 5 % en p y preferentemente inferior a aproximadamente el 3 % en p. El polvo puede formularse con polímeros u, dado el caso, puede formularse con otros materiales tales como liposomas, albúmina y/u otros vehículos. Pueden seleccionarse sistemas de dosificación y de administración en aerosol para una aplicación terapéutica particular por un experto en la materia, tal como se describe, por ejemplo, en Gonda, I. "Aerosols for delivery of therapeutic and diagnostic agents to the respiratory tract", en Critical Reviews in Therapeutic Drug Carrier Systems, 6:273-313 (1990) y en Moren, "Aerosol dosage forms and formulations" en Aerosols in Medicine. Principles, Diagnosis and Therapy, Moren y col., Eds., Elsevier, Ámsterdam, 1985. Los compuestos, cuando se desea administrarlos sistémicamente, pueden formularse para administración parenteral mediante inyección, por ejemplo, mediante inyección en bolo o infusión continua. Las formulaciones para inyección pueden presentarse en forma de dosificación unitaria, por ejemplo, en ampollas o en recipientes de múltiples dosis, con un conservante añadido. Las composiciones pueden adoptar formas tales como suspensiones, disoluciones o emulsiones en vehículos aceitosos o acuosos y pueden contener un agente de formulación tales como agentes de suspensión, estabilizantes y/o dispersantes.

Las formulaciones farmacéuticas para administración parenteral incluyen disoluciones acuosas de los compuestos activos en forma soluble en agua. Adicionalmente, las suspensiones de los compuestos activos pueden prepararse como suspensiones para inyección aceitosas apropiadas. Disolventes o vehículos lipófilos adecuados incluyen aceites grasos tales como aceite de sésamo, o ésteres de ácidos grasos sintéticos, tales como oleato de etilo o triglicéridos, o liposomas. Las suspensiones para inyección acuosas pueden contener sustancias que aumentan la viscosidad de la suspensión, tales como carboximetilcelulosa de sodio, sorbitol o dextrano. Dado el caso, la suspensión también puede contener estabilizadores o agentes que aumentan la solubilidad de los compuestos adecuados para permitir la preparación de disoluciones altamente concentradas. Alternativamente, los compuestos activos pueden estar en forma de polvo para constitución con un vehículo adecuado, por ejemplo, agua libre de pirógenos estéril, antes de uso.

Los compuestos también pueden formularse en composiciones rectales o vaginales tales como supositorios o enemas de retención, por ejemplo, que contienen bases de supositorio convencionales tales como manteca de cacao u otros glicéridos.

Además de las formulaciones descritas previamente, los compuestos también pueden formularse como una preparación de depósito. Tales formulaciones de acción prolongada pueden formularse con materiales poliméricos o hidrófobos adecuados (por ejemplo, como una emulsión en un aceite aceptable) o resinas de intercambio iónico, o como derivados moderadamente solubles, por ejemplo, como una sal moderadamente soluble.

Las composiciones farmacéuticas también pueden incluir vehículos o excipientes de fase sólida o gel adecuados. Ejemplos de tales vehículos o excipientes incluyen, pero no se limitan a, carbonato cálcico, fosfato de calcio, diversos azúcares, almidones, derivados de celulosa, gelatina y polímeros tales como polietilenglicoles. Formas de preparación farmacéuticas líquidas o sólidas adecuadas son, por ejemplo, disoluciones acuosas o soluciones salinas para inhalación, microencapsuladas, encocleadas, recubiertas sobre partículas de oro microscópicas, contenidas en liposomas, nebulizadas, aerosoles, pellas para implantación en la piel, o secadas sobre un objeto afilado para ser arañadas en la piel. Las composiciones farmacéuticas también incluyen gránulos, polvos, comprimidos, comprimidos recubiertos, (micro)cápsulas, supositorios, jarabes, emulsiones, suspensiones, cremas, gotas o preparaciones con liberación prolongada de compuestos activos, en cuya preparación se usan habitualmente excipientes y aditivos y/o auxiliares tales como disgregantes, aglutinantes, agentes de recubrimiento, agentes de hinchamiento, lubricantes, aromatizantes, edulcorantes o solubilizantes como se ha descrito anteriormente. Las composiciones farmacéuticas son adecuadas para su uso en varios sistemas de administración de fármacos. Para una breve revisión de procedimientos para la administración de fármacos véase Langer R (1990) Science 249:1527-33.

Los oligonucleótidos inmunoestimulantes CpG y, dado el caso, otros terapéuticos y/o antígenos pueden administrarse por sí mismos (puros) o en forma de una sal farmacéuticamente aceptable. Cuando se usan en medicina, las sales deben ser farmacéuticamente aceptables, pero convenientemente pueden usarse sales no farmacéuticamente aceptables para preparar sales farmacéuticamente aceptables de las mismas. Tales sales incluyen, pero no se limitan a, aquellas preparadas a partir de los siguientes ácidos: clorhídrico, bromhídrico, sulfúrico, nítrico, fosfórico, maleico, acético, salicílico, p-toluenosulfónico, tartárico, cítrico, metanosulfónico, fórmico, malónico, succínico, naftaleno-2-sulfónico y bencenosulfónico. Por tanto, tales sales pueden prepararse como sales de metal alcalino o alcalinotérreas tales como sales de sodio, potasio o calcio del grupo ácido carboxílico.

Agentes de tamponamiento adecuados incluyen: ácido acético y una sal (1-2 % en peso/volumen); ácido cítrico y una sal (1-3 % en peso/volumen); ácido bórico y una sal (0,5-2,5 % en peso/volumen); y ácido fosfórico y una sal (0,8-2 % en peso/volumen). Conservantes adecuados incluyen cloruro de benzalconio (0,003-0,03 % en peso/volumen); clorobutanol (0,3-0,9 % en peso/volumen); parabenos (0,01-0,25 % en peso/volumen) y timerosal (0,004-0,02 % en peso/volumen).

Las composiciones farmacéuticas de la invención contienen una cantidad eficaz de un oligonucleótido inmunoestimulante CpG y, dado el caso, antígenos y/u otros agentes terapéuticos, dado el caso, incluidos en un vehículo farmacéuticamente aceptable. El término vehículo farmacéuticamente aceptable significa una o más de carga sólida o líquida compatible, diluyentes o sustancias de encapsulación que son adecuados para administración a un ser humano u otro animal vertebrado. El término vehículo indica un componente orgánico o inorgánico, natural o sintético, con el que el principio activo se combina para facilitar la aplicación. Los componentes de las composiciones farmacéuticas también pueden combinarse con los compuestos de la presente invención y entre sí, de un modo tal que no haya interacción que altere sustancialmente la eficiencia farmacéutica deseada.

La presente invención se ilustra adicionalmente por los siguientes ejemplos, que de ninguna forma deben interpretarse como adicionalmente limitantes. Ejemplos

Introducción: Los nuevos oligonucleótidos CpG de clase P de la presente invención son un subconjunto de los oligonucleótidos CpG de clase C previamente descritos. Los ODN de clase P mejorados se diferencian de aquellos en virtud de la sorprendentemente alta actividad secretora de IFN-α y Th1 y citocinas y quimiocinas similares a Th1 in vitro, además de in vivo. También son superiores a las clases C previamente descritas en su potencia para inducir otra producción de citocinas/quimiocinas y activación celular. Agrawal y col. han descrito oligonucleótidos antisentido que tienen una secuencia que es complementaria a un secuencia diana de ácido nucleico más una estructura de tallo-lazo en 3', haciendo la última el ODN estable a la degradación por nucleasas. La estructura de tallo-lazo en 3' de Agrawal y col. no es parte de la secuencia de reconocimiento. Los ODN CpG de clase P de doble palíndromo de los presentes inventores son parcialmente auto-complementarios en los dos palíndromos. Aunque los palíndromos en 3' en estos ODN son capaces de forma posiblemente una estructura de horquilla en el extremo 3', se cree que la formación de concatémeros es la estructura más probablemente activa en las células y que la capacidad de que una posible horquilla en 3' potencie la estabilidad contra nucleasas no hace una contribución importante a la actividad única de ODN.

Los nuevos compuestos de la presente invención pueden usarse para tratar enfermedades en las que serían ventajosas la estimulación inmunitaria similar a Th1 o la modulación inmunitaria. Las áreas de aplicación son particularmente enfermedades infecciosas, cáncer, asma y alergias. Aunque el tratamiento de enfermedades virales, tales como hepatitis B y C, citomegalovirus (CMV), virus del papiloma, VIH y virus del herpes simple (VHS) son de particular interés, los compuestos de la presente invención pueden usarse para tratar la mayoría de las enfermedades producidas por cualquier patógeno, que incluye Leishmania, Listeria y carbunco. Además de la inducción de la secreción de IFN-alfa e IFN-gamma, los nuevos ODN pueden usarse como adyuvantes de vacuna cuando se requiere una respuesta inmunitaria Th1. Los compuestos de la presente invención pueden usarse para la profilaxis y terapia, bien como una terapia única o bien en combinación con otros dispositivos terapéuticos o médicos.

Hasta la fecha, no se han descrito composiciones que resuelvan diferencialmente la formación de dúplex o agregados de oligonucleótidos con secuencias de bases complementarias. Las especies químicas descritas previamente para la prevención de la formación de agregados se limitaron a monosacáridos y polialcoholes. No se ha descrito combinación de más de un aditivo químico de una o más de una especie química para la prevención de la formación de dúplex o agregados de oligonucleótidos. Los siguientes ejemplos ilustran oligonucleótidos novedosos y formulaciones de oligonucleótidos. Material y procedimientos

Oligodesoxinucleótidos (ODN) Todos los ODN se compraron de Biospring (Fráncfort, Alemania) o Sigma-Ark (Darmstadt, Alemania) y se controlaron para identidad y pureza por Coley Pharmaceutical GmbH (Langenfeld, Alemania). Los ODN se disolvieron en 0,5x Tris-EDTA (base Tris 5 mM, EDTA 0,5 mM, pH 8,0) y se guardaron a -20 ºC. Para la incubación de células, los ODN se diluyeron en solución salina tamponada con fosfato (Sigma, Alemania). Todas las diluciones se llevaron a cabo usando reactivos sin pirógenos. Purificación de células Se obtuvieron preparaciones de capa leucocítica de sangre periférica de donantes humanos masculinos y femeninos sanos del banco de sangre de la Universidad de Düsseldorf (Alemania) y de éstas se purificaron células mononucleares de sangre periférica (CMSP) por centrifugación sobre Ficoll®-Hypaque (Sigma). Las CMSP purificadas tanto se usaron frescas (para la mayoría de los ensayos) como se suspendieron en medio de congelación y se guardaron a -70 ºC. Si se requiere, se descongelaron alícuotas de estas células, se lavaron y se resuspendieron en medio de cultivo RPMI 1640 (BioWhittaker, Bélgica) complementado con 5 % (v/v) de suero AB humano inactivado por calor (BioWhittaker, Bélgica) o 10 % (v/v) de SBF inactivado por calor, L-glutamina 2 mM (BioWhittaker), 100 U/ml de penicilina y 100 µg/ml de estreptomicina (Invitrogen (Karlsruhe, Alemania)). Inducción de citocinas en CMSP Se incubaron células mononucleares de sangre periférica humanas con ODN CpG durante 48 horas a las concentraciones indicadas. Se midió la secreción de IFN-α por CMSP humanas. Detección de citocinas Se sembraron CMSP frescas sobre placas de fondo redondo de 96 pocillos a 5 x 106/ml y se incubaron con ODN en las concentraciones como se indican en una estufa de incubación humidificada a 37 ºC. Los sobrenadantes de cultivo se recogieron y, si no se usaron inmediatamente, se congelaron a -20 ºC hasta que se requirió. Se evaluaron las cantidades de citocinas en los sobrenadantes usando kits de ELISA comercialmente disponibles o ELISA en casa desarrollados usando anticuerpos comercialmente disponibles. Cromatografía de exclusión por tamaño (SEC) Se realizó cromatografía de exclusión por tamaño (SEC) usando una columna Superdex® 75 10/300 (n.º 17-5174- 01; GE Healthcare, Munich, Alemania) a una velocidad de flujo de 0,4 - 1 ml/min. El tampón de muestra y el tampón de electroforesis fueron idénticos. El tampón consistió en tampón fosfato 10 mM (pH 7,5) complementado con cloruro sódico 20 mM y el porcentaje indicado (peso/peso) de aditivo químico. La cromatografía se realizó a temperatura ambiente. Todos los ODN probados se inyectaron en concentraciones de 1 mg/ml a 30 mg/ml en el tampón de electroforesis respectivo. Antes de la administración a la HPLC, las muestras se calentaron a 95 ºC durante 5 minutos y se dejó que se enfriaran a temperatura ambiente. Esto se realizó para permitir condiciones de incubación similares para las muestras antes de la cromatografía. El volumen de inyección fue 0,1- 5 µl, dependiendo de la concentración de muestra.

Se usó un patrón de referencia para determinar los tiempos de ejecución de los monómeros de longitudes diferentes. Se usó un ODN formador de dímero para determinar el tiempo de ejecución de un dímero de ODN. Para cada condición de tampón, los tiempos de ejecución obtenidos con el ODN patrón se compararon con los tiempos de ejecución del ODN de prueba y los valores en porcentaje de monómero de ODN de prueba y dímero de ODN de prueba se calcularon por las integraciones del área bajo la curva.

No se observaron agregados a las condiciones investigadas para estos tampones, excepto por la dextrosa que no mostró agregados por debajo de 10 mg/ml. Los análisis de SEC de las fracciones se llevaron a cabo usando una bomba binaria de la serie 1100 (G1312A), muestreador de placas de pocillos de la serie 1100 (G1367A), desgasificador a microvacío de la serie 1100 (G1379A) y un MWD de la serie 1100 (G1365B) (todos los instrumentos fabricados por Agilent Technologies, Boeblingen, Alemania) o usando un sistema de HPLC de Beckman (módulo de disolvente System Gold® 126, inyector automático System Gold® 508 y detector System Gold® 168, fabricados por BeckmanCoulter GmbH, Krefeld, Alemania).

El análisis de datos se realizó por integración de las señales resultantes a DO 260 usando el software del instrumento.

Condiciones cromatográficas: Columna: Superdex 75 10/300 Temp. de la columna: 25 ºC Temp. del inyector automático: 25 ºC Fase móvil: Tampón fosfato 10 mM a pH 7,5; NaCl 20 mM + aditivo Longitud de onda de detección: 260 nm Velocidad de flujo: 0,4 - 1 ml/min Volumen de inyección: 0,1 - 5 µl Tiempo de ejecución: 45 minutos Gradiente: Tiempo Flujo % de A % de B Inicial 0,7 - 1 100 45 min 0,7 - 1 100 Detección de citocina plasmática Se inyectaron subcutáneamente (SC) o intravenosamente (IV) ratones BALB/c (n=5) con la concentración indicada de ODN o 100 µl de PBS. Se recogieron muestras de plasma 3 horas después de la inyección y se usaron para el ensayo de citocina/quimiocina por ELISA.

Estudios de vacunas Se inmunizaron ratones BALB/c hembra (n=10/gp) con HBsAg (1 µg) solo o con ODN (10 µg). Los animales se sangraron 4 semanas después de la inmunización y se determinaron los títulos de IgG total específica de HBsAg por ELISA de punto final. Para la comparación de diferentes vías de inyección, ODN (5 mg/ml) en PBS o disolución tamponada al 5 % de dextrosa se calentaron a 95 ºC durante 5 minutos y a continuación se enfriaron hasta temperatura ambiente. Se inyectaron IV ratones BALB/c (n=5/gp) con 500 µg de ODN, se sangraron a las 3 horas de las inyecciones y el plasma se probó para IFN-alfa.

Tabla 2: Oligonucleótidos de muestra Secuencia Tipo de oligonucleótido SEC ID Nº T*C*C*A*G*G*A**C*T*T*C*T*C*T*C*A*G*G*T*T Control de no CpG SEC ID Nº: 12 T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T Clase B SEC ID Nº: 336 5'T*C*C*T*G*G*C*G*G*G*G*A*A*G*T 3' Clase S SEC ID Nº: 337 T*C*G*T*C*G*T*T*T*T*G*A*C*G*T*T*T*T*G*T*C*G*T*T: Clase B SEC ID Nº: 338 *G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T Control de no CpG SEC ID Nº: 339 G*G*G-G-A-C-G-A-C-G-T-C-G-T-G*G*G*G*G*G*G: Clase A SEC ID Nº: 340 T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G Clase C SEC ID Nº: 341 T*C*G*C*G*A*C*G*T*T*C*G*G*C*G*C*G*C*G*C*C*G Clase C SEC ID Nº: 342 T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*T*T*T*C*G*T*T*T*T Clase B SEC ID Nº: 343 5'T*C-G-A-C-G-T-C-G-T-G-G*G*G*G 3' Clase A SEC ID Nº: 344 T*C*G*T*C-G*T*T*T*T*A*C-G*G*C*G*C*C-G*T*G*C*C*G Clase C SEC ID Nº: 345 T*C*G*T*C_G*T*T*T"T*A*C_G*G*C*G*C*C_G*T*G*C*C*G Clase C SEC ID Nº: 346 T*C-G*C-G*A*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G Clase P SEC ID Nº: 133 T*T*T*C_G*T*C_G*T*T*T*C_G*T*C_G*T*T Clase B SEC ID Nº: 347 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*-*C-G*C*G*C*C*G Clase P SEC ID Nº: 220 T*C-G*T*C-G*T*C-G*T*T*C-G*G*C*G*C-G*C*G*C*C*G SEC ID Nº: 348 T*C-G*A*C-G*T*T*C-G*G*C*G*C*C*G SEC ID Nº: 230 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C-G*C*C*G Clase P SEC ID Nº: 231 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G Clase P SEC ID Nº: 234 T*C-G*T*C-G*A*C-G*T*T*C-G*G*C*G*C*C-G*T*G*C*C*G Clase P SEC ID Nº: 237 T*C-G*T*C-G*A*C-G*T*T*C-G*A*C*T*C-G*A*G*T*C*G Clase P SEC ID Nº: 238 T*C-G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G Clase P SEC ID Nº: 245 T*C-G*T*C-G*A*C-G*A*C-G*G*C*G*C*C-G*T*G*C*C*G Clase P SEC ID Nº: 246 T*C-G*T*C-G*A*C-G*A*C*G*C-G*C*C-G*T*G*C*G Clase P SEC ID Nº: 247 T*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*C*C*G*T*G*C*C*G Clase P SEC ID Nº: 248 T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G Clase P SEC ID Nº: 249 T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C*C-G*T*G*C*C*G Clase P SEC ID Nº: 250 T*C*G*T*C*G*A*C*G*A-T-C*G*G*C*G*C*C*G*T*G*C*C*G Clase P SEC ID Nº: 251 T*C*G*T*C-G*A*C-G*A*T*C-G*G*C*G*C-G*C*G*C*C*G Clase P SEC ID Nº: 252 T*C*G*T*C-G*A*C*G*A*T*C-G*G*C*G*C-G*C*G*C*C*G Clase P SEC ID Nº: 253 T*C*G*T*C*G*A*C*G*A-T-C*G*G*C*G*C*G*C*G*C*C*G Clase P SEC ID Nº: 254 T*C*G*A*C-G*T*C*G*A*C*G*T-G*A*C*G*T*T Clase C SEC ID Nº: 257 Ejemplo 1: Inducción de IFN-α por oligonucleótidos CpG de clase P (dobles palindrómicos) en CMSP humanas Se observó que los ODN dobles palindrómicos eran inductores de IFN-α más potentes que los ODN de clase C en los estudios realizados. La Figura 1 muestra gráficas que ilustran la inducción de IFN-α con diversos ODN, que incluyen la clase B, C y P, además de controles de no CpG. En el ODN de clase P en algunos casos, las bases en 5' fueron parte de la región palindrómica, como en SEC ID Nº: 234; sin embargo, la base o bases en 5' no tuvieron que ser parte de la región palindrómica en 5', como en SEC ID Nº: 220. El ODN retuvo actividad cuando el espaciador entre palíndromos fue de tan solo 1 nucleótido. Por ejemplo, el espaciador en SEC ID Nº: 234 es 'T'. Los espaciadores D y los espaciadores de no nucleótidos también fueron eficaces. Los ODN fueron los más eficaces cuando la longitud de la región palindrómica en 3' tuvo al menos 10 nucleótidos. El palíndromo en 3' podría contener apareamientos de bases A/T y todavía ser eficaz. La Figura 2 muestra gráficas que ilustran la inducción de IFN-α con diversos ODN de clase P. Además, los ODN con un palíndromo imperfecto/región que contiene complementariedad fueron capaces de inducir IFN-α siempre y cuando fueran suficientemente largos. En los experimentos realizados, tales ODN fueron eficaces si la región que contenía complementariedad tenía 10 nucleótidos o más, como en SEC ID Nº: 247 (Figura 3). Ejemplo 2: Los ODN CpG de clase P inducen producción de citocinas y quimiocinas plasmáticas superior a las clases C convencionales. Se ha mostrado que los ODN de clase C convencionales tales como SEC ID Nº: 341 estimulan respuestas de citocinas y quimiocinas similares a Th1 in vivo en ratones. La comparación de la producción de IL-12 y IP-10 en plasma tras la administración subcutánea (SC) reveló una respuesta de IL-12 y IP-10 dependiente de la dosis para ODN CpG de clase P de SEC ID Nº: 234 y 237 que fue significativamente mayor en comparación con SEC ID Nº: 341 (Figura 4). El control de no CpG de SEC ID Nº: 339 no indujo ninguna producción de citocinas o quimiocinas. Ejemplo 3: Los ODN CpG de clase P estimulan producción de IFN-α más fuerte tras la administración in vivo.

Como se demuestra en el Ejemplo 1, los ODN CpG de clase P produjeron la mayor producción de IFN-α tras la estimulación de CMSP humanas cuando se comparó con otras clases de ODN CpG tales como las clases C y B. Se hizo una observación similar cuando los ODN CpG de diferentes clases se inyectaron en ratones y se midieron los niveles en plasma de IFN-α. En comparación con las otras clases (SEC ID Nº: 344: clase A; SEC ID Nº: 336, 347, 343: clase B; SEC ID Nº: 346, 257: clase C), los ODN de clase P estimularon la producción de IFN-α más fuerte tras la administración SC, además de intravenosa (IV) (Figura 5). El control de no CpG de SEC ID Nº: 339 no indujo ninguna producción de IFN-α.

Ejemplo 4: Los ODN CpG de clase P estimulan fuertes respuestas inmunitarias adaptativas. Los ODN CpG estimulan respuestas inmunitarias innatas y adaptativas. Los ODN CpG de clase P de SEC ID Nº: 234 y 237 estimularon fuertes respuestas de anticuerpos (Ab) cuando se añadieron a HbsAg, estimulando la clase P de SEC ID Nº: 234 las respuestas de Ab más fuertes cuando se compararon con las clases C y A (Figura 6). La respuesta de Ab fue incluso similar a la de ODN de clase B que son conocidos por estimular las respuestas de Ab más fuertes in vivo. Ejemplo 5: Formación de concatémeros y formulación de ODN CpG de clase P

En el diseño del ODN CpG de clase P de doble palíndromo, la longitud de los dos palíndromos y el contenido de GC fueron determinantes importantes de la actividad biológica. Se encontró que la destrucción de cualquier palíndromo redujo la actividad biológica del ODN. Longitudes de entre 10 y 16 bases mostraron la mayor actividad biológica, aunque los ODN entre 8 y 20 o incluso 4 y 30 bases de longitud mostraron actividad. En algunos casos, los palíndromos tienen al menos el 50 % de contenido de GC, más preferido al menos el 70 % y lo más preferido el 100 %. Sin embargo, los palíndromos con 0-49 % de contenido de GC también pueden ser eficaces, especialmente si hay modificaciones de bases o de azúcares o alteraciones a uno o más enlaces internucleotídicos que estabilizan la formación del dímero. La Figura 7 muestra un ejemplo de un ODN de clase P formador de concatémeros de doble palíndromo (SEC ID Nº: 234).

La formulación de los ODN inmunoestimulantes puede afectar el grado de formación de concatémeros. La formulación de los ODN inmunoestimulantes en 5 % de dextrosa evitó la formación de concatémeros dentro del medicamento final, que simplificará el procedimiento de desarrollo de fármacos mientras que todavía permitirá la captación y formación de células de las estructuras de concatémero con actividad biológica completa dentro de células inmunitarias. Aunque las formulaciones que evitan la formación de estructuras ordenadas superiores en el producto en vial tienen ciertas ventajas prácticas, el ODN puede administrarse en cualquier formulación farmacológica. Se describe que la SEC ID Nº: 234, que contiene dos regiones palindrómicas, muestra alta actividad inductora de IFN-α; sin embargo, la cromatografía de exclusión por tamaño (SEC) reveló la presencia de grandes agregados en disolución de PBS, previniendo la caracterización exacta de la molécula en esta disolución. La sustitución de cloruro sódico u otras sales tampón con varios productos químicos puede prevenir la agregación de estas moléculas y similares. La disolución al 5 % (peso/volumen) de dextrosa en agua es una disolución de aceptación clínica y sirvió como punto de partida para el análisis. Para reducir el contenido de sales, pero mantener ampliamente la fuerza osmótica, se sustituyó NaCl 130 mM en disolución de PBS con 5 % (peso/peso) de especies químicas tan diferentes como azúcares, alcoholes y aminoácidos. La Figura 8 muestra la formación de dúplex por SEC ID Nº: 234 en diversas disoluciones al 5 % como se mide por cromatografía de exclusión (SEC). Sorprendentemente, se previno la formación de dúplex por algunos tipos de palíndromos, mientras que se mantuvo la formación de dúplex por otros. Realizando la SEC en los tampones respectivos, se observó la prevención de la formación de dúplex en el palíndromo rico en AT en SEC ID Nº: 234 y 237, además de una desestabilización del dúplex en el palíndromo rico en GC de N.º: 234 y 341. Se concluyó que para las moléculas que contienen dos o más regiones formadoras de dúplex con estabilidad del dúplex significativamente diferente, podría prevenirse la formación del dúplex con menor estabilidad, mientras que la formación de los dúplex de alta estabilidad se mantuvo en estas disoluciones. Esta observación defendió la reducción de la estabilidad del dúplex como el principal efecto responsable de este fenómeno. En la Figura 8, las barras representan los valores en % del área del pico para el pico del dímero. El porcentaje de ODN monoméricos puede calcularse usando la fórmula: 100 - (% del área del pico del dímero). No se observaron agregados para estos tampones.

La Tabla 3 muestra datos que demuestran que SEC ID Nº: 234 muestra prevención de la formación del dúplex con menor estabilidad en tanto tampón dextrosa como tampón glicina, pero no en 1XPBS. Tampón dextrosa: 5 % de dextrosa, NaCl 20 mM, tampón fosfato 10 mM - pH ∼7,2. Tampón glicina: 5 % de glicina, NaCl 20 mM, tampón fosfato 10 mM a pH ∼7,2. La concentración de ODN fue 5x106 M (0,04 mg/ml). Longitud de onda (1): 260 nm. El intervalo de temperatura fue 20 ºC a 90 ºC *. Las temperaturas de fusión para Tm1 de los tampones dextrosa y glicina estuvieron por debajo de 25 ºC y no pudieron determinarse usando el intervalo de temperatura experimental.

Tabla 3

1xPBS

Tampón dextrosa

Tampón glicina

Tm1 Tm 2 Tm 1 Tm 2 Tm 1 Tm2 Sec. 234 33,9 ºC 65,7 ºC *) 53,6 ºC *) 53,7 ºC Los ensayos indican que este efecto no fue solo debido a la reducción en cloruro sódico, sino que al menos algunas de las especies químicas probadas (es decir, sacáridos (dextrosa; fructosa); disacáridos (lactosa); monoalcoholes (etanol; isopropanol); dioles (propanodiol); polialcoholes (glicerol, manitol, sorbitol) y aminoácidos (isoleucina; glicina; treonina)) causaron una reducción adicional en la estabilidad del dúplex. La isoleucina en particular redujo la formación del dúplex de baja fusión a concentraciones de tan solo el 1 % en peso/peso. Este efecto podría potenciarse adicionalmente combinando la adición de un bajo porcentaje de isoleucina con otros aditivos químicos de las especies descritas. Otros aminoácidos con cadenas laterales hidrófobas deberían ser similarmente eficaces, tales como, por ejemplo, valina, leucina, fenilalanina, prolina, tirosina y triptófano, o aminoácidos con cadenas laterales cargadas, tales como glutamato, aspartato y lisina. Los inesperados efectos anteriormente descritos permitieron la resolución de la formación de agregados de oligonucleótidos formadores de dúplex, produciendo propiedades de disolución homogénea. Sorprendentemente, los ODN CpG investigados retuvieron su actividad inmunoestimulante cuando se aplicaron con las nuevas formulaciones. Esto permite que moléculas que contienen dos o más regiones formadoras de dúplex con estabilidad del dúplex similar se formulen de manera que supriman completamente la hibridación, produciendo disoluciones de dosificación de medicamento en las que el oligonucleótido está presente en su forma monomérica. Además, la formación de la tétrada G de oligonucleótidos disminuyó por el nuevo tipo de formulación. Usando la formulación descrita en el presente documento, las disoluciones de dosificación homogéneas se han observado para oligonucleótidos que contienen las secuencias formadoras de la tétrada G, tales como para CpG de clase A de SEC ID Nº: 344 o CpG de clase S de SEC ID Nº: 337, que también contienen un palíndromo, que indica que las composiciones que contienen una o más de las especies químicas anteriormente mencionadas pueden usarse para prevenir la formación de agregados en estos estiramientos de bases.

Ejemplo 6: Los ODN de clase P formulados en 5 % de dextrosa que evita la formación de concatémeros dentro del medicamento final estimulan respuestas de citocinas y quimiocinas similares a Th1 más fuertes tanto tras la inducción SC como IV.

Existen diferencias entre la estimulación de citocinas similares a Th1 tras la administración in vivo mediante diferentes vías. Por ejemplo, el ODN de clase A tal como SEC ID Nº: 344 y 340 estimuló IFN-α significativo en plasma solo tras la administración IV, mientras que los niveles de IFN-α fueron bajos o próximos al nivel basal tras la inyección SC. A diferencia, los ODN de clase P estimularon los mayores niveles de IFN-α tras la administración por ambas vías, IV y SC (Figura 9). Además, la formulación de ODN de clase P de SEC ID Nº: 234 en 5 % de dextrosa estimuló una respuesta de IFN-α más fuerte en comparación con la formulación en PBS tras la inyección IV. Ejemplo 7. Los ODN de clase P con un conector entre el dominio de activación de TLR y la región formadora de dúplex pueden estimular la elevada secreción de IFN-α.

Con el fin de determinar el efecto de diversos conectores sobre la actividad inmunoestimulante de ODN de clase P, se incorporaron un espaciador abásico (espaciador D), 1,3-propano-diol, hexaetilenglicol en ODN de clase P de SEC ID Nº: 243. Se incubaron CMSP con el ODN a concentraciones entre 0,1 µM y 1 µM durante 48 horas y se realizó un ensayo de ELISA sobre los sobrenadantes. La inclusión de hexaetilenglicol produjo una ligera disminución en la potencia (Figura 10). La inclusión de 1,2-propano-diol o un espaciador abásico conduce a una ligera disminución en la potencia, pero un aumento en la producción de IFN-α con respecto al control de no CpG (SEC ID Nº: 343), clase A (SEC ID Nº: 340 y 341) y clase C (SEC ID Nº: 343) como se mide por un aumento en la producción de IFN-α (Figura 10a). Todas las modificaciones produjeron una disminución en la producción de IL-10 (Figura 10b) y IL-6 (Figura 10c).

Ejemplo 8. Los ODN de clase P con modificación de 2'-O-metilo estimulan la elevada secreción de IFN-α Las modificaciones de ribosa y desoxirribosa en oligonucleótidos pueden influir en la actividad del oligonucleótido. Con el fin de determinar el efecto de restos de azúcar modificados sobre la actividad de ODN de clase P, se añadieron grupos O-metilo a la posición 2' de los restos de azúcar en diversos sitios en la secuencia (véase la Tabla 1). Se incubaron CMSP humanas con el ODN durante 48 horas a concentraciones de ODN que oscilaban de 0,01 a 1 µM. Los sobrenadantes se analizaron por ELISA. Como se muestra en la Figura 11, todos los ODN modificados (SEC ID Nº: 344-347) mostraron una ligera disminución en la potencia, pero una elevada inducción de la producción de IFN-α en comparación con el control no modificado de la misma secuencia de bases (SEC ID Nº: 234).

LISTADO DE SECUENCIAS <110> Coley Pharmaceutical Group, Inc. Coley Pharmaceutical Group, GmbH <120> Composiciones y procedimientos para formulaciones de oligonucleótidos <130> C1041.70046WO00 <140> Aún sin asignar <141> 15-02-2007 <150> 60/773.505 <151> 15-02-2006 <150> 60/858.240 <151> 09-11-2006 <160> 348 <170> PatentIn versión 3.3 <210> 1 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 1 tcgtcgacga ttttacgacg tcgtttt 27 <210> 2 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 2 tcgtcgacga ttttacgacg tcgtttt 27 <210> 3 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 3 tcgtcgacga acgacgtcgt <210> 4 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 4 tcgtcgacga tttttcgtcg acgattt 27 <210> 5 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 5 tcgtcgacga tttttcgtcg acgattt 27 <210> 6 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 6 tcgtcgacga tcgtcgacga <210> 7 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 7 cgcgcgcgcg cgcgcgcgcg <210> 8 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 8 gagaacgctc gaccttcgat <210> 9 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 9 agctccatgg tgctcactg 19 <210> 10 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 10 tctcccagcg tgcgccat 18 <210> 11 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 11 tccatgacgt tcctgacgtt <210> 12 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 12 tccaggactt ctctcaggtt <210> 13 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 13 tccacgacgt tttcgacgtt <210> 14 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 14 tcgtcgtttt gacgttttga cgtt 24 <210> 15 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 15 tcctgacgtt cggcgcgcgc cc 22 <210> 16 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 16 tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> 17 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 17 tcgcgacgtt cggcgcgcgc cg 22 <210> 18 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 18 ccggccggcc ggccggccgg <210> 19 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 19 cgcgcgcgcg cgcgcgcgcg <210> 20 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 20 tccaggactt ctctcaggtt tttt 24 <210> 21 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 21 gtgctcgagg atgcgcttcg c 21 <210> 22 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 22 gccgaggtcc atgtcgtacg c 21 <210> 23 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 23 tcgcgtgcgt tttgtcgttt tgacgtt 27 <210> 24 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 24 accgataccg gtgccggtga cggcaccacg <210> 25 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 25 accgataacg ttgccggtga cggcaccacg <210> 26 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 26 accgatgacg tcgccggtga cggcaccacg <210> 27 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 27 cggcgcgcgc cgcggcgcgc gccg 24 <210> 28 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 28 tcgatcgttt ttcgtgcgtt ttt 23 <210> 29 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 29 tcgtccagga cttctctcag gtt 23 <210> 30 <211> 26 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 30 tcgtcgtcca ggacttctct caggtt 26 <210> 31 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 31 tcgtgacggg cggcgcgcgc cc 22 <210> 32 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(11) <223> n es a, c, g o t <400> 32 acgacgtcgt ncggcggccg ccg 23 <210> 33 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 33 ggggacgacg tcgtgcggcg gccgccg 27 <210> 34 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 34 ggggacgacg tcgtgcggcg gccgccg 27 <210> 35 <211> 29 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 35 ccacgacgtc gtcgaagacg acgtcgtgg 29 <210> 36 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 36 ctgcagctgc agctgcagct gcag 24 <210> 37 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 37 cggccgctgc agcggccgct gcag 24 <210> 38 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 38 catgacgttt ttgatgtt 18 <210> 39 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 39 atgacgtttt tgatgtt 17 <210> 40 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 40 tgacgttttt gatgtt 16 <210> 41 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 41 atgacgtttt tgatgttgt 19 <210> 42 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 42 tccatgacgt ttttgatgtt <210> 43 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 43 tccatgacgt ttttgatgtt <210> 44 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 44 tccatgacgt ttttgatgtt <210> 45 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 45 tccatgacgt ttttgatgtt <210> 46 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 46 tccatgacgt ttttgatgtt <210> 47 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 47 atgacgtttt tgatgttgt 19 <210> 48 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 48 atgacgtttt tgatgttgt 19 <210> 49 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 49 atgacgtttt tgatgttgt 19 <210> 50 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 50 atgacgtttt tgatgttgt 19 <210> 51 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 51 tccatgcgtt tttgaatgtt <210> 52 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 52 tccatgacgt ctttgatgtc <210> 53 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 53 acgacgtcgt tccgacgtcg t 21 <210> 54 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 54 acgacgtcgt ggccacgacg tcgtnnn 27 <210> 55 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 55 acgacgtcgt nnnnacgacg tcgtnnn 27 <210> 56 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(3) <223> donde n es espaciador d <220> <221> misc_feature <222> (14)..(17) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(30) <223> donde n es espaciador d <400> 56 nnnacgacgt cgtnnnnacg acgtcgtnnn <210> 57 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(3) <223> donde n es espaciador d <220> <221> misc_feature <222> (14)..(17) <223> donde n es espaciador d <400> 57 nnnacgacgt cgtnnnnacg acgtcgt 27 <210> 58 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 58 gggacgacgt cgtggccacg acgtcgtccc <210> 59 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 59 cccacgacgt cgtggg 16 <210> 60 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 60 ccccacgacg tcgtgggg 18 <210> 61 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 61 tcgatcgttt ttcgtgcgtt ttt 23 <210> 62 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 62 tcgatcgttt ttcgtgcgtt ttt 23 <210> 63 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 63 tcgatcgttt ttcgtgcgtt ttt 23 <210> 64 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 64 tcgatcgttt ttcgtgcgtt ttt 23 <210> 65 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 65 atgacgtttt tgacgtt 17 <210> 66 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 66 acgacgtttt tgatgtt 17 <210> 67 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 67 acgacgtttt cgacgtt 17 <210> 68 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 68 atgatgtttt tgatgtt 17 <210> 69 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 69 atgacgtttt gatgtt 16 <210> 70 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 70 atgacgtttg tgatgtt 17 <210> 71 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 71 ttgacgtttt tgatgtt 17 <210> 72 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 72 atgatgtttt tgatgtt 17 <210> 73 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 73 atgagctttt gtatgtt 17 <210> 74 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 74 tcgacgtttt cggcggccgc cg 22 <210> 75 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 75 tcctgacgtt ttcggcggcc gccg 24 <210> 76 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 76 tcctgacgtt cggcggccgc cg 22 <210> 77 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 77 tccatgacgt tcggcgcgcg ccc 23 <210> 78 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 78 tcctgacgtt cggcgcgcgc c 21 <210> 79 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 79 tcgacgtttt cggcgcgcgc cg 22 <210> 80 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 80 tcgacgtttt cggcggccgc cg 22 <210> 81 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 81 tcgacgtcga cgttagggtt aggg 24 <210> 82 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 82 acgacgtcgt tagggttagg g 21 <210> 83 <211> 12 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 83 gtcggcgttg ac 12 <210> 84 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(16) <223> donde n es espaciador d <400> 84 acgacgtcgt cgnnnncggc cgccg <210> 85 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(16) <223> donde n es espaciador d <400> 85 acgacgtcgt cgnnnncggc cgccg <210> 86 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 86 tcgtcgacga cgtcgtcg 18 <210> 87 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (19)..(22) <223> donde n es espaciador d <400> 87 tcgtcgacga cgtcgtcgnn nn 22 <210> 88 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 88 acgacgtcgt ttttacgacg tcgt 24 <210> 89 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 89 acgacgtcgt nnnnacgacg tcgtnnn 27 <210> 90 <211> 30 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(3) <223> donde n es espaciador d <220> <221> misc_feature <222> (14)..(17) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(30) <223> donde n es espaciador d <400> 90 nnnacgacgt cgtnnnnacg acgtcgtnnn <210> 91 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 91 acgacgtcgt ttttacgacg tcgtnnn 27 <210> 92 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 92 acgacgtcgt ttttacgacg tcgtttt 27 <210> 93 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 93 acgacgtcgt ttttacgacg tcgtttt 27 <210> 94 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 94 acgacgtcgt ttttacgacg tcgt 24 <210> 95 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <400> 95 acgacgtcgt nnnnacgacg tcgt 24 <210> 96 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 96 acgacgtcgt acgacgtcgt <210> 97 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 97 acgacgtcgt acgacgtcgt <210> 98 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (9)..(12) <223> donde n es espaciador d <220> <221> misc_feature <222> (13)..(13) <223> n es a, c, g o t <220> <221> misc_feature <222> (23)..(25) <223> donde n es espaciador d <400> 98 cgacgtcgtn nnnacgacgt cgnnn <210> 99 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (9)..(12) <223> donde n es espaciador d <220> <221> misc_feature <222> (13)..(13) <223> n es a, c, g o t <220> <221> misc_feature <222> (23)..(25) <223> donde n es espaciador d <400> 99 acgacgtcgn nnncgacgtc gtnnn <210> 100 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (8)..(11) <223> donde n es espaciador d <220> <221> misc_feature <222> (12)..(12) <223> n es a, c, g o t <220> <221> misc_feature <222> (21)..(23) <223> donde n es espaciador d <400> 100 cgacgtcgnn nncgacgtcg nnn 23 <210> 101 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <220> <221> misc_feature <222> (11)..(14) <223> n es a, c, g o t <220> <221> misc_feature <222> (25)..(27) <220> <221> misc_feature <222> (25)..(27) <223> n es a, c, g o t <400> 101 tcgacgtcgt nnnnacgacg tcgannn 27 <210> 102 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 102 acgtcgtcgt nnnnacgacg acgtnnn 27 <210> 103 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 103 tcgtcgacgt nnnnacgtcg acgannn 27 <210> 104 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature 25 <222> (25)..(27) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> n es a, c, g o t <400> 104 tcgacgtcgt nnnnacgacg tcgtnnn 27 <210> 105 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 105 acgacgtcgt nnnnacgtcg tcgtnnn 27 <210> 106 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (9)..(12) <223> donde n es espaciador d <220> <221> misc_feature <222> (21)..(23) <223> donde n es espaciador d <400> 106 acgacgttnn nnaacgtcgt nnn 23

ES 2 553 284 T3   <210> 107 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (8)..(11) <223> donde n es espaciador d <220> <221> misc_feature <222> (19)..(21) <223> donde n es espaciador d <400> 107 acgtcgtnnn nacgacgtnn n 21 <210> 108 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (9)..(12) <223> donde n es espaciador d <220> <221> misc_feature <222> (21)..(23) <223> donde n es espaciador d <400> 108 ggcggccgnn nncggccgcc nnn 23 <210> 109 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (9)..(12) <223> donde n es espaciador d <220> <221> misc_feature <222> (21)..(23) <223> donde n es espaciador d <400> 109 gcggccggnn nnccggccgc nnn 23 <210> 110 <211> 24 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (8)..(11) <223> donde n es espaciador d <220> <221> misc_feature <222> (22)..(24) <223> donde n es espaciador d <400> 110 acgtcgtnnn nacgacgtcg tnnn 24 <210> 111 <211> 26 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(1) <223> donde n es espaciador d <220> <221> misc_feature <222> (12)..(15) <223> donde n es espaciador d <220> <221> misc_feature <222> (26)..(26) <223> donde n es espaciador d <400> 111 nacgacgtcg tnnnnacgac gtcgtn 26 <210> 112 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (26)..(27) <223> donde n es espaciador d <400> 112 acgacgtcgt cgaagacgac gtcgtnnt 28 <210> 113 <211> 28 <212> ADN <213> Secuencia artificial <220>

ES 2 553 284 T3   <223> Oligonucleótido sintético <220> <221> misc_feature <222> (26)..(27) <223> donde n es espaciador d <400> 113 tcgacgtcgt cgaagacgtc gtcgtnnt 28 <210> 114 <211> 29 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 114 ccacgacgtc gtcgaagacg acgtcgtgg 29 <210> 115 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (5)..(5) <223> donde n es espaciador d <400> 115 tccangacgt ttttgatgtt <210> 116 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 116 tccatgacgt tdttgatgtt <210> 117 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 117 tccagacgtt tttgatgtt 19 <210> 118 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético

ES 2 553 284 T3   <400> 118 tccatgacgt tttgatgtt 19 <210> 119 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 119 tccatgacgt ttttgatgtt <210> 120 <211> 15 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 120 gacgtttttg atgtt <210> 121 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 121 tccagacgtt ttgatgtt 18 <210> 122 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (5)..(5) <223> donde n es espaciador d <220> <221> misc_feature <222> (12)..(12) <223> donde n es espaciador d <400> 122 tccangacgt tnttgatgtt <210> 123 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature

ES 2 553 284 T3   <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(28) <223> donde n es espaciador d <400> 123 acgacgtcgt nnnnacgacg tcgtnnnu 28 <210> 124 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(28) <223> donde g es un ribonucleósido <400> 124 acgacgtcgt nnnnacgacg tcgtnnng 28 <210> 125 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(28) <223> donde a es un ribonucleósido <400> 125 acgacgtcgt nnnnacgacg tcgtnnna 28 <210> 126 <211> 31 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(3) <223> donde n es espaciador d <220> <221> misc_feature <222> (14)..(17) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(30) <223> donde n es espaciador d <400> 126 nnnacgacgt cgtnnnnacg acgtcgtnnn u 31 <210> 127 <211> 31 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(31) <223> donde a es un ribonucleósido <400> 127 acgacgtcgt nnnnacgacg tcgtnnnaaa a 31 <210> 128 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 128 tcgatgacgt tcctgacgtt <210> 129 <211> 31 <212> ADN <213> Secuencia artificial <220>

ES 2 553 284 T3   <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(17) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(30) <223> donde n es espaciador d <400> 129 tttacgacgt cgtnnnnacg acgtcgtnnn u 31 <210> 130 <211> 10 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 130 tcgacgtcgt <210> 131 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 131 tcgacgtttt cggcggccgc cg 22 <210> 132 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 132 tcgacgtttt cggcgcgcgc cg 22 <210> 133 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 133 tcgcgacgtt cggcgcgcgc cg 22 <210> 134 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético

ES 2 553 284 T3   <400> 134 tcgcgacgtt cggcgcgcgc cg 22 <210> 135 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 135 tcgcgacgtt cggcgcgcgc cg 22 <210> 136 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 136 tcgcgacgtt cggcgcgcgc cg 22 <210> 137 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 137 tcgcgacgtt cggcgcgcgc cg 22 <210> 138 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 138 tcgcgacgtt cggcgcgcgc cg 22 <210> 139 <211> 22 <212> ADN <213> Secuencia artificial ’ <220> <223> Oligonucleótido sintético <400> 139 tcgcgacgtt cggcgcgcgc cg 22 <210> 140 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético

ES 2 553 284 T3   <400> 140 tcgcgacgtt cggcgcgcgc cg 22 <210> 141 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 141 tcgcgacgtt cgcgcgcgcg <210> 142 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(1) <223> donde n es espaciador d <400> 142 nccatgacgt ttttgatgtt <210> 143 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (2)..(2) <223> donde n es espaciador d <400> 143 tncatgacgt ttttgatgtt <210> 144 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (3)..(3) <223> donde n es espaciador d <400> 144 tcnatgacgt ttttgatgtt <210> 145 <211> 20 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (4)..(4) <223> donde n es espaciador d <400> 145 tccntgacgt ttttgatgtt <210> 146 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(14) <223> donde n es espaciador d <400> 146 tccatgacgt tttngatgtt <210> 147 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(13) <223> donde n es espaciador d <400> 147 tccatgacgt ttntgatgtt <210> 148 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 148 tcgaacgttc ggcgcgcgcc g 21 <210> 149 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 149 tcgtcgaacg ttcggcgcgc gccg 24 <210> 150

ES 2 553 284 T3   <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 150 tcgtcgaacg ttcggcgctg cgccg <210> 151 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 151 tcgcgacgtt cgttgcgcgc gccg 24 <210> 152 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 152 tacgtcgttc ggcgcgcgcc g 21 <210> 153 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 153 ttcgcgacgt tcggcgcgcg ccg 23 <210> 154 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 154 tcggcgcgcg ccgtcgcgac gt 22 <210> 155 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 155 tagcgtgcgt tttgacgttt tttt 24 <210> 156

ES 2 553 284 T3   <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 156 tagcgagcgt tttgacgttt tttt 24 <210> 157 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 157 ttgcgagcgt tttgacgttt tttt 24 <210> 158 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 158 atgcgtgcgt tttgacgttt tttt 24 <210> 159 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 159 ttacgtgcgt tttgacgttt tttt 24 <210> 160 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 160 ttgcatgcgt tttgacgttt tttt 24 <210> 161 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 161 ttgcgtacgt tttgacgttt tttt 24 <210> 162

ES 2 553 284 T3   <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 162 ttgcgtgcat tttgacgttt tttt 24 <210> 163 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 163 ttgcgtgcga tttgacgttt tttt 24 <210> 164 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 164 ttgcgcgcgt tttgacgttt tttt 24 <210> 165 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 165 ttgcgtgcgc tttgacgttt tttt 24 <210> 166 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 166 ttgcgtgcgt ttcgacgttt tttt 24 <210> 167 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 167 tcgtcgaacg ttcggcgctg cgccg <210> 168

ES 2 553 284 T3   <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 168 tcgtcgaacg ttcggcgctg cgccg <210> 169 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 169 tcgtcgaacg ttcggcgctg cgccg <210> 170 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 170 tcgtcgaacg ttcggcgctg cgccg <210> 171 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 171 tcgtcggacg ttcggcgctg cgccg <210> 172 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 172 tcgcgacgtt cgttgcgcgc gccg 24 <210> 173 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 173 tcgcgacgtt cgttgcgcgc gccg 24 <210> 174

ES 2 553 284 T3   <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 174 tcgcgacgtt cgttgcgcgc gccg 24 <210> 175 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 175 tcgcgacgtt ttgcgcgcgc <210> 176 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 176 tcgcgacgtc gttgcgcgcg ccg 23 <210> 177 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 177 tcgcgacgtt cgaagcgcgc gccg 24 <210> 178 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 178 tcgcgacgaa cgttgcgcgc gccg 24 <210> 179 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d

ES 2 553 284 T3   <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <400> 179 tcgacgtcgt nnnntcgacg tcgtnnn 27 <210> 180 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 180 tcgtcgttag ctcgttagct cgtt 24 <210> 181 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 181 tcgtcgttac gtaattacgt cgtt 24 <210> 182 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 182 tcgtcgttac gtcgttacgt aatt 24 <210> 183 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 183 tcgtcgttac gtaattacgt aatt 24 <210> 184 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 184 tcgacgtcga cgtgacggg 19 <210> 185 <211> 11 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 185 tcgacgtcgt t 11 <210> 186 <211> 11 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 186 tcgacgtcgt t 11 <210> 187 <211> 12 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 187 tcgacgtcgt tt 12 <210> 188 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 188 tcgacgtcgt ttttcgacgt cgtt 24 <210> 189 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 189 tcgcgacgtt cggcgcgctg ccg 23 <210> 190 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 190 tcgcgacgtt cggcgcgtcg ccg 23 <210> 191 <211> 23 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 191 tcgcgacgtt cggcggctcg ccg 23 <210> 192 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 192 tcgcgacgtt cggcgcgtcg ccg 23 <210> 193 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 193 tcgcgacgtt cggcggctcg ccg 23 <210> 194 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 194 tcgcgacgtt cggcgcgtcg ccg 23 <210> 195 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 195 tcgcgacgtt cggcggctcg ccg 23 <210> 196 <211> 10 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 196 tcgacgtcgt <210> 197 <211> 19 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 197 tcgacgtcga cgtgacggg 19 <210> 198 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 198 tcgacgtcga cgtgacggg 19 <210> 199 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 199 tcgacgtcga cgtgacgtc 19 <210> 200 <211> 17 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 200 tcgacgtcga cgtgacg 17 <210> 201 <211> 10 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 201 tcgacgtcga <210> 202 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 202 tcgtcgttac gtaactacgt cgtt 24 <210> 203 <211> 24 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 203 tcgtcgttac gtaacgacgt cgtt 24 <210> 204 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 204 tcgtcgttac gtaacgacga cgtt 24 <210> 205 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 205 tcgtcgttag ctaattagct cgtt 24 <210> 206 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 206 tcgtcgttac gtaattagct cgtt 24 <210> 207 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 207 cccatgacgt tcctgacgtt <210> 208 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 208 gccatgacgt tcctgacgtt <210> 209 <211> 20 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 209 accatgacgt tcctgacgtt <210> 210 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 210 tggatgacgt tcctgacgtt <210> 211 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 211 tttatgacgt tcctgacgtt <210> 212 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 212 taaatgacgt tcctgacgtt <210> 213 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 213 ccatgacgtt cctgacgtt 19 <210> 214 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 214 catgacgttc ctgacgtt 18 <210> 215 <211> 17 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 215 atgacgttcc tgacgtt 17 <210> 216 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 216 tgacgttcct gacgtt 16 <210> 217 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 217 tcgacgtcga ddddtcgacg tcga 24 <210> 218 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (1)..(10) <223> donde los nucleósidos son nucleósidos inversos <220> <221> misc_feature <222> (11)..(14) <223> n es a, c, g o t <400> 218 agctgcagct nnnntcgacg tcga 24 <210> 219 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 219 tcgcgacgtt cggcgcgcgc cg 22 <210> 220 <211> 23 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 220 tcgtcgacgt tcggcgcgcg ccg 23 <210> 221 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 221 tcggacgttc ggcgcgcgcc g 21 <210> 222 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 222 tcggacgttc ggcgcgccg 19 <210> 223 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 223 tcgcgacgtt cggcgcgccg <210> 224 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 224 tcgcgacgtt cgcgcgcgcg <210> 225 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 225 tcgacgttcg gcgcgcgccg <210> 226 <211> 18 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 226 tcgacgttcg gcgcgccg 18 <210> 227 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 227 tcgcgacgtt cggcgccg 18 <210> 228 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 228 tcgcgacgtt cggccg 16 <210> 229 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 229 tcgacgttcg gcgccg 16 <210> 230 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 230 tcgtcgacgt tcggcgcgcc g 21 <210> 231 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 231 tcgtcgacgt tcggcgccg 19 <210> 232 <211> 23 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 232 tcgacgacgt tcggcgcgcg ccg 23 <210> 233 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 233 tcgacgtcgt tcggcgcgcg ccg 23 <210> 234 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 234 tcgtcgacga tcggcgcgcg ccg 23 <210> 235 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 235 tcgtcgacga tcggcgcgcc g 21 <210> 236 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 236 tcgtcgacgt tcgccgcgcg gcg 23 <210> 237 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 237 tcgtcgacgt tcggcgccgt gccg 24 <210> 238 <211> 23 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <400> 238 tcgtcgacgt tcgactcgag tcg 23 <210> 239 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 239 tcgtcgttac gtaacgacga cgtt 24 <210> 240 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 240 tcgtcgttac gtaacgacga cgtt 24 <210> 241 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 241 tcgacgtcga cgtgacgtt 19 <210> 242 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 242 tcgtcgacgt tcggcgcgcc g 21 <210> 243 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 243 tcgtcgacga tcggcgcgcg ccg 23 <210> 244 <211> 28 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(14) <223> donde n es espaciador d <220> <221> misc_feature <222> (25)..(27) <223> donde n es espaciador d <220> <221> misc_feature <222> (28)..(28) <223> donde el ribonucleósido es un ribonucleósido inverso <400> 244 acgacgtcgt nnnnacgacg tcgtnnnu 28 <210> 245 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 245 tcgtcgacga tcggcgccgt gccg 24 <210> 246 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 246 tcgtcgacga cggcgccgtg ccg 23 <210> 247 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 247 tcgtcgacga cgcgccgtgc g 21 <210> 248 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 248 tcgtcgacga tcggcgccgt gccg 24 <210> 249

ES 2 553 284 T3   <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 249 tcgtcgacga tcggcgccgt gccg 24 <210> 250 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 250 tcgtcgacga tcggcgccgt gccg 24 <210> 251 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 251 tcgtcgacga tcggcgccgt gccg 24 <210> 252 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 252 tcgtcgacga tcggcgcgcg ccg 23 <210> 253 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 253 tcgtcgacga tcggcgcgcg ccg 23 <210> 254 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 254 tcgtcgacga tcggcgcgcg ccg 23 <210> 255

ES 2 553 284 T3   <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 255 tcgacgtcga cgtgacgtt 19 <210> 256 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 256 tcgacgtcga cgtgacgtt 19 <210> 257 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 257 tcgacgtcga cgtgacgtt 19 <210> 258 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 258 tcgtcgacga cgtgtcgat 19 <210> 259 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 259 tcgacgtcga cgtgacgtt 19 <210> 260 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 260 tcgacgtcga cgtgacgtt 19 <210> 261

ES 2 553 284 T3   <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 261 tcgtcgacga tcggcgccgt gccg 24 <210> 262 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 262 tcgtcgacga cggcgccgtg ccgt 24 <210> 263 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 263 tcgtcgacga cggcgccgtg ccgt 24 <210> 264 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 264 tcgtcgacga tcggcgccgt gccgt <210> 265 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 265 tcgtcgacgt tcggcgccgt gccgt <210> 266 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 266 tcgtcgacgt cggcgccgtg ccgt 24 <210> 267 <211> 23

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 267 tcgtcgacgc ggcgccgtgc cgt 23 <210> 268 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 268 tcgtcgacgc ggcgccgtgc cgt 23 <210> 269 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 269 tcgtcgacga agtcgacgat <210> 270 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 270 tcgtcgacga gaatcgtcga cgat 24 <210> 271 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 271 tcgtcgtacg gcgccgtgcc gt 22 <210> 272 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 272 tcgtcgacga tcggcgccgt gccg 24 <210> 273 <211> 24

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 273 tcgtcgacga tcggcgccgt gccg 24 <210> 274 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 274 tcgtcgacga tcggcgccgt gccg 24 <210> 275 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 275 tcgtcgacga cggcgccgtg ccgt 24 <210> 276 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 276 tcgtcgacga tcggcgccgt gccgt <210> 277 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 277 tcgtcgacga tcggcgccgt gccgt <210> 278 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 278 tcgtcgacga cggcgccgtg ccgt 24 <210> 279 <211> 25

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 279 tcgtcgacgt tcggcgccgt gccgt <210> 280 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 280 tcgtcgacgt cggcgccgtg ccgt 24 <210> 281 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 281 tcgtcgacga agtcgacgat <210> 282 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 282 tcgtcgacga gaatcgtcga cgat 24 <210> 283 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 283 tcgtcgacga cgtgtcgat 19 <210> 284 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 284 tcgacgtcga agacgtcgat <210> 285 <211> 24

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 285 tcgacgtcga gaatcgacgt cgat 24 <210> 286 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 286 tcgtcgacga cggcgaagcc g 21 <210> 287 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 287 tcgtcgacga cggcgaagcc gt 22 <210> 288 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 288 tcgtcgacga cgtgtcgat 19 <210> 289 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 289 tcgtcgacga cgtgtcgat 19 <210> 290 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 290 tcgacgtcga cgtgacgttg t 21 <210> 291 <211> 23

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 291 tcgtcgacga tcggcgcgcg ccg 23 <210> 292 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 292 tcgtcgacga tcggcgcgcg ccg 23 <210> 293 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (24)..(24) <223> donde t es un nucleósido inverso <400> 293 tcgtcgacga tcggcgcgcg ccgt 24 <210> 294 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(25) <223> donde t es un nucleósido inverso <400> 294 ttcgtcgacg atcggcgcgc gccgt <210> 295 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 295 tcgtcgacga tcgacgcgcg tcg 23 <210> 296 <211> 23 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 296 tcgtcgacga tcaacgcgcg ttg 23 <210> 297 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 297 tcgtcgacga tcggcacgtg ccg 23 <210> 298 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 298 tcgtcgacga tcggcatatg ccg 23 <210> 299 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 299 tcgtcgacga tgccgcgcgc ggc 23 <210> 300 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 300 tcgtcgacga tgccgcgcgc ggc 23 <210> 301 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 301 tcgtcgacga tgccgcgcgc ggc 23 <210> 302 <211> 23 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 302 tcgtcgacga tgccgcgcgc ggc 23 <210> 303 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 303 tcgtcgacga tgccgcgctg cggc 24 <210> 304 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 304 tcgtcgtacg atgccgcgcg cggc 24 <210> 305 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 305 tcgtcgtacg atgccgcgct gcggc <210> 306 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 306 tcgtcgacga tgccgcgcgc ggc 23 <210> 307 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 307 tcgtcgacga tgccgcgcgc ggc 23 <210> 308 <211> 24 <212> ADN

ES 2 553 284 T3   <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (24)..(24) <223> donde t es un nucleósido inverso <400> 308 tcgtcgacga tcggcgcgcg ccgt 24 <210> 309 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (24)..(24) <223> donde t es un nucleósido inverso <400> 309 tcgtcgacga tcggcgcgcg ccgt 24 <210> 310 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (24)..(24) <223> donde t es un nucleósido inverso <400> 310 tcgtcgacga tcggcgcgcg ccgt 24 <210> 311 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 311 tcgtgcacga tcggcgcgcg ccg 23 <210> 312 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature

ES 2 553 284 T3   <222> (2)..(2) <223> donde n es 5-metil-desoxicitidina <400> 312 tngtcgacga tcggcgcgcg ccg 23 <210> 313 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (5)..(5) <223> donde n es 5-metil-desoxicitidina <400> 313 tcgtngacga tcggcgcgcg ccg 23 <210> 314 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (8)..(8) <223> donde n es 5-metil-desoxicitidina <400> 314 tcgtcganga tcggcgcgcg ccg 23 <210> 315 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (12)..(12) <223> donde n es 5-metil-desoxicitidina <400> 315 tcgtcgacga tnggcgcgcg ccg 23 <210> 316 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 316 tcgacgtcga cgtcgacg 18 <210> 317

ES 2 553 284 T3   <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 317 tcgacgtcga cgtcgacg 18 <210> 318 <211> 18 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 318 tcgacgtcga cgtcgacg 18 <210> 319 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(25) <223> donde t es un nucleósido inverso <400> 319 tcgtcgacgt tcggcgccgt gccgt <210> 320 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(25) <223> donde t es un nucleósido inverso <400> 320 tcgtcgacgt tcggcgccgt gccgt <210> 321 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (25)..(25) <223> donde t es un nucleósido inverso

ES 2 553 284 T3   <400> 321 tcgtcgacgt tcggcgccgt gccgt <210> 322 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(23) <223> donde los nucleósidos son nucleósidos inversos <400> 322 gccgcgcgcg gctagcagct gct 23 <210> 323 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(23) <223> donde los nucleósidos son nucleósidos inversos <400> 323 cggcgcgcgc cgtagcagct gct 23 <210> 324 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(23) <223> donde los nucleósidos son nucleósidos inversos <400> 324 gccgcgcgcg gctagcagct gct 23 <210> 325 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (13)..(23) <223> donde los nucleósidos son nucleósidos inversos <400> 325 cggcgcgcgc cgtagcagct gct 23

ES 2 553 284 T3   <210> 326 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(24) <223> donde los nucleósidos son nucleósidos inversos <400> 326 cggcgccgtg ccgttgcagc tgct 24 <210> 327 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(24) <223> donde los nucleósidos son nucleósidos inversos <400> 327 gccgtgccgc ggcttgcagc tgct 24 <210> 328 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(24) <223> donde los nucleósidos son nucleósidos inversos <400> 328 cggcgccgtg ccgttgcagc tgct 24 <210> 329 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (14)..(24) <223> donde los nucleósidos son nucleósidos inversos <400> 329 gccgtgccgc ggcttgcagc tgct 24 <210> 330 <211> 25

ES 2 553 284 T3   <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (15)..(25) <223> donde los nucleósidos son nucleósidos inversos <400> 330 tcggcgcgcg ccgatagcag ctgct <210> 331 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (15)..(25) <223> donde los nucleósidos son nucleósidos inversos <400> 331 tcggcgcgcg ccgatagcag ctgct <210> 332 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (15)..(25) <223> donde los nucleósidos son nucleósidos inversos <400> 332 tcggcgccgt gccgttgcag ctgct <210> 333 <211> 25 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (15)..(25) <223> donde los nucleósidos son nucleósidos inversos <400> 333 tcggcgccgt gccgttgcag ctgct <210> 334 <211> 13 <212> ADN <213> Secuencia artificial

ES 2 553 284 T3   <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (7)..(7) <223> donde n es un conector <400> 334 cggcgcngcg ccg 13 <210> 335 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 335 tcgtcgacgt tcggcgcgcg ccg 23 <210> 336 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 336 tcgtcgacga cggcgcgcgc cg 22 <210> 337 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(11) <223> n es a, c, g o t <400> 337 tcgtcgacga ncggcgcgcg ccg 23 <210> 338 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(11) <223> n es a, c, g o t <400> 338 tcgtcgacga ncggcgcgcg ccg 23 <210> 339

ES 2 553 284 T3   <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (11)..(11) <223> donde n es espaciador d <400> 339 tcgtcgacga ncggcgcgcg ccg 23 <210> 340 <211> 21 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 340 ggggacgacg tcgtgggggg g 21 <210> 341 <211> 15 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 341 tcgacgtcgt ggggg <210> 342 <211> 16 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 342 tccaggactt ctctca 16 <210> 343 <211> 22 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 343 tcgtcgtttt cggcgcgcgc cg 22 <210> 344 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético

ES 2 553 284 T3   <220> <221> misc_feature <222> (6)..(7) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (9)..(10) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (13)..(14) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (16)..(16) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (18)..(18) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (20)..(20) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (23)..(23) <223> donde el nucleósido es 2’-O-metil nucleósido <400> 344 tcgtcgacga tcggcgcgcg ccg 23 <210> 345 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (3)..(3) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (6)..(7) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (9)..(10) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (13)..(14) <223> donde los nucleósidos son 2’-O-metil nucleósidos

ES 2 553 284 T3   <220> <221> misc_feature <222> (16)..(16) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (18)..(18) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (20)..(20) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (23)..(23) <223> donde el nucleósido es 2’-O-metil nucleósido <400> 345 tcgtcgacga tcggcgcgcg ccg 23 <210> 346 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (6)..(7) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (9)..(10) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (13)..(14) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (16)..(16) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (18)..(18) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (20)..(20) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (23)..(23) <223> donde el nucleósido es 2’-O-metil nucleósido

ES 2 553 284 T3   <400> 346 tcgtcgacga tcggcgcgcg ccg 23 <210> 347 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <220> <221> misc_feature <222> (3)..(3) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (6)..(7) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (9)..(10) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (13)..(14) <223> donde los nucleósidos son 2’-O-metil nucleósidos <220> <221> misc_feature <222> (16)..(16) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (18)..(18) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (20)..(20) <223> donde el nucleósido es 2’-O-metil nucleósido <220> <221> misc_feature <222> (23)..(23) <223> donde el nucleósido es 2’-O-metil nucleósido <400> 347 tcgtcgacga tcggcgcgcg ccg 23 <210> 348 <211> 23 <212> ADN <213> Secuencia artificial <220> <223> Oligonucleótido sintético <400> 348 tcgtcgtcgt tcggcgcgcg ccg 23

ES 2 553 284 T3  

REIVINDICACIONES

1. Un oligonucleótido inmunoestimulante que comprende: un dominio de activación de TLR en 5’ y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5’ de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3’ de al menos 8 nucleótidos de longitud mediante un espaciador, en donde el oligonucleótido incluye al menos un dinucleótido CpG no metilado, en donde el oligonucleótido tiene la fórmula 5’ XP1SP2T 3’, en la que X es el dominio de activación de TLR, P1 es un palíndromo, S es un espaciador, P2 es un palíndromo y T es una cola en 3’ de 0-100 nucleótidos de longitud, en la que S es un ácido nucleico que tiene una longitud de 1-50 nucleótidos, en el que un "palíndromo" o "región palindrómica" es una secuencia de ácido nucleico que es su complemento inverso perfecto.

2. El oligonucleótido inmunoestimulante de la reivindicación 1, en el que X es TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT o TTTT. 3. El oligonucleótido inmunoestimulante de la reivindicación 1, en el que las dos regiones palindrómicas están conectadas por un espaciador que es un ácido nucleico que tiene una longitud de 1 nucleótido. 4. Un oligonucleótido inmunoestimulante que comprende: un dominio activador de TLR en 5’ y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5’ de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3’ de al menos 8 nucleótidos de longitud mediante un espaciador, en donde el oligonucleótido incluye al menos un dinucleótido CpG no metilado, en el que el oligonucleótido tiene la fórmula 5’ XP1SP2T 3’, en la que X es el dominio activador de TLR, P1 es un palíndromo, S es un espaciador, P2 es un palíndromo y T es una cola en 3’ de 0-100 nucleótidos de longitud, en la que S es un espaciador no nucleotídico.

5. El oligonucleótido inmunoestimulante de la reivindicación 4, en el que el espaciador no nucleotídico es un espaciador D.

6. El oligonucleótido inmunoestimulante de la reivindicación 4, en el que el espaciador no nucleotídico es un adaptador que se selecciona del grupo que consiste en dioles, colesterol, nitroindol, trietilenglicol y hexaetilenglicol. 7. Un oligonucleótido inmunoestimulante que comprende: un dominio de activación de TLR en 5’ y al menos dos regiones que contienen complementariedad y una región que contiene complementariedad en 5’ y 3’, siendo cada región que contiene complementariedad de al menos 8 nucleótidos de longitud y conectándose entre sí directamente o a través de un espaciador, en el que el oligonucleótido incluye al menos un dinucleótido CpG no metilado, y en el que al menos una de las regiones que contienen complementariedad no es un palíndromo perfecto y en el que el dominio de activación de TLR es directamente 5’ con respecto a la región que contiene complementariedad 5’.

8. El oligonucleótido inmunoestimulante de la reivindicación 7, en donde el oligonucleótido tiene la fórmula 5’ XNSPT 3’, en la que X es el dominio de activación de TLR, N es un palíndromo no perfecto, P es un palíndromo, S es un espaciador y T es una cola 3’ de 0-100 nucleótidos de longitud. 9. El oligonucleótido inmunoestimulante de la reivindicación 7, en donde el oligonucleótido tiene la fórmula 5’ XPSNT 3’, en la que X es el dominio de activación de TLR, N es un palíndromo no perfecto, P es un palíndromo, S es un espaciador y T es una cola 3’ de 0-100 nucleótidos de longitud.

10. El oligonucleótido inmunoestimulante de una cualquiera de las reivindicaciones 1 o 7, en el que al menos uno de los oligonucleótidos inmunoestimulantes comprende un resto de azúcar modificado en 2’. 11. El oligonucleótido inmunoestimulante de la reivindicación 10, en el que el resto de azúcar modificado en 2’ es un resto de azúcar modificado con 2’-O-metilo. 12. Una composición que comprende: una mezcla de oligonucleótidos formadores de dúplex de una cualquiera de las reivindicaciones anteriores, formulada en un tampón de baja salinidad y que incluye un soluto.

ES 2 553 284 T3   13. Un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o una composición de la reivindicación 12 para su uso en el tratamiento del cáncer. 14. Uso de un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o de una composición de la reivindicación 12 en la fabricación de un medicamento para su uso en el tratamiento del cáncer. 15. Un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o una composición de la reivindicación 12 para su uso en el tratamiento del asma.

16. Un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o una composición de la reivindicación 12 para su uso en el tratamiento de alergias. 17. Un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o una composición de la reivindicación 12 para su uso en el tratamiento de una enfermedad infecciosa.

18. Un oligonucleótido de una cualquiera de las reivindicaciones 1-11 o una composición de la reivindicación 12 para modular una respuesta inmunitaria en un sujeto. 19. El oligonucleótido o la composición para su uso de acuerdo con la reivindicación 18, sirviendo el oligonucleótido o la composición para administrar a un sujeto en una cantidad eficaz para inducir la expresión de citocinas y/o quimiocinas.

20. El oligonucleótido o la composición para su uso de acuerdo con la reivindicación 19, seleccionándose la citocina y/o la quimiocina del grupo que consiste en IFN-α, IFN-β, IL-28, IL-29, IFN-ω, TNF-α, IL- 10, IL-6, IFN-γ, IP-10, MCP-1, IL-3 e IL-12.

ES 2 553 284 T3