Métodos y composiciones para el diagnostico de tumores del estroma gastrointestinal.

Un método in vitro para el diagnóstico y/o el seguimiento en un sujeto un tumor del estroma gastrointestinal, que comprende:

detectar en una muestra de ensayo derivada del sujeto una o más mutaciones a nivel de ADN en uno cualquiera o ambos de los genes marcadores cKIT cuya secuencia se representa en la Figura 9

(Núm. acc. GenBank NM_000222.2) y PDGFRA cuya secuencia se representa en la Figura 10 (Núm. acc. Genbank NM_006206.4) y determinar la cantidad de ADN mutado, en donde la cantidad de ADN mutado se determina comparando directamente las fracciones de ADN mutadas y de tipo salvaje;

en donde ADN es ADN circulante;

en donde la presencia de una cualquiera de las mutaciones detectadas en la muestra de ensayo es indicativa de un tumor del estroma gastrointestinal en el sujeto, y

en donde una cantidad elevada de ADN mutado es indicativa de progreso del tumor del estroma gastrointestinal.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2011/060846.

Solicitante: Albert-Ludwigs-Universität Freiburg.

Nacionalidad solicitante: Alemania.

Dirección: Fahnenbergplatz 79085 Freiburg ALEMANIA.

Inventor/es: VON BUBNOFF,NIKOLAS, LANGE,THORALF, MAIER,JACQUELINE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2546883_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Métodos y composiciones para el diagnostico de tumores del estroma gastrointestinal Campo de la invención La presente invención se refiere a métodos para el diagnóstico y/o seguimiento de tumores del estroma gastrointestinal. El enfoque metodológico se basa en la detección y/o el análisis de una o más mutaciones específicas del tumor en los genes marcadores cKit y PDGFRA en muestras de ADN circulante.

Antecedentes Los tumores del estroma gastrointestinal (GIST) son uno de los tumores mesenquimales más comunes del tracto gastrointestinal (aproximadamente 1-3% de todas las neoplasias gastrointestinales) . Aproximadamente 85% de los GIST albergan mutaciones activadoras (es decir de ganancia de función) en el gen cKit que codifica un receptor del factor de células madre que tiene actividad tirosina quinasa. Además, aproximadamente 35% de los GIST con un gen cKit de tipo salvaje tienen en cambio mutaciones en otro gen, PDGFRA (receptor-alfa del factor de crecimiento derivado de plaquetas) , que es una tirosina quinasa relacionada (revisado, p. ej., por Corless, C. L. y Heinrich, M.C. (2008) Annu. Rev. Pathol. 3, 557-586) . Estas mutaciones son un evento temprano en la progresión de GIST.

Las onco-proteínas cKit y PDGFRA sirven como dianas para los inhibidores de tirosina quinasa de molécula pequeña tales como imatinib y sunitinib. Notablemente, el tratamiento con imatinib no es curativo a menos que esa posible la resección completa del tumor. En los GIST avanzados, metastasizados o irresecables, se puede lograr una remisión parcial en aproximadamente 50% de los pacientes tratados con imatinib. Sin embargo, la mayoría de los pacientes aún experimentan progresión de la enfermedad durante la recepción de imatinib (véase, p. ej., Verweij, J. et al. (2004) Lancet 364, 1127-34; Blanke, C. D. et al. (2008) J. Clin. Oncol. 26, 626-632) . Además, también se encontró que estos pacientes responden solo transitoriamente a sunitinib (Demetri, G. D. et al. (2006) Lancet 368, 1329-1338) .

A pesar de que imatinib y sunitinib exhibieron efectos clínicos notables, sus eficacias dependen en gran medida el genotipo del GIST. Los fármacos encontraron resistencia intrínseca o adquirida durante el tratamiento, cuyos mecanismos moleculares eran dependientes también en gran medida del genotipo de GIST, incluyendo mutaciones primarias o mutaciones secundarias en los dominios quinasa de los correspondientes genes diana, respectivamente. Por lo tanto, los GIST avanzados pueden requerir un tratamiento multidisciplinar.

A partir de lo anterior, es evidente de inmediato que un requisito previo necesario para una terapia satisfactoria de los GIST es la provisión de métodos precisos para el diagnóstico, estadificación y/o seguimiento del progreso de este tipo de tumores, lo que, a su vez, permite un pronóstico y evaluación de riesgos fiables, y por lo tanto, la selección de una terapia apropiada.

Un enfoque de diagnóstico se basa en la inmunohistoquímica, en particular, en la tinción de cKit por medio de anticuerpos específicos. Sin embargo, aproximadamente 5-10% de los GIST son cKit negativos. Por consiguiente, la tinción cKit no da como resultado la detección fiable de todos los GIST; se requieren métodos adicionales y/o alternativos.

Se utilizan métodos de diagnóstico médico por imagen para la estadificación o el seguimiento del progreso de GIST incluyendo la tomografía por emisión de positrones- (PET) , la tomografía computarizada (CT) , la tomografía de resonancia magnética, y combinaciones de las mismas tales como PET-CT. La técnica de diagnóstico médico por imagen más sensible disponible en la actualidad es la tomografía de emisión por positrones con 2-desoxi-2 (18F) fluoro-D-glucosa (FDG-PET) . Sin embargo, la especificidad y la sensibilidad de este método están limitadas de manera que, por ejemplo, se pueden pasar por alto pequeños tumores o actividad tumoral residual después del comienzo de la terapia (Gambhir, S. S. et al. (2001) J. Nucl. Med. 42, 1S-93S; Antoch, G. et al. (2004) J. Nucl. Med. 45, 357-365) . Además, incluso en los casos con respuesta completa a una terapia dada, las lesiones en la mayoría de los casos todavía contienen tumor viable (Bauer, S. et al. (2005) Int. J. Cancer 117, 316-25) . De este modo, en este momento no es posible medir la enfermedad residual en respondedores mediante PET-CT, y el desencadenante para cambiar el tratamiento es clínico o por la progresión morfológica del PET/CT. Además, FDG-PET (así como otros métodos de diagnóstico médico por imagen) requiere instrumentación analítica sofisticada, que es costosa tanto en términos de coste inicial y de mantenimiento, así como personal capacitado. Esto hace que este tipo de sistemas sean inadecuados para las prácticas médicas de rutina, las pruebas de "cabecera", o en lugares remotos.

Por consiguiente, todavía sigue existiendo una necesidad de métodos y composiciones mejorados que permitan el diagnóstico rápido, fiable y con ahorro de costes, la estadificación, y el seguimiento de tumores del estroma gastrointestinal.

El documento US 2007/0254295 publicado el 1 de Noviembre de 2007 cedido a Prometheus Laboratories Inc. proporciona métodos para analizar una combinación de biomarcadores para individualizar la terapia con inhibidores

de tirosina quinasa en pacientes que han sido diagnosticados de cáncer (véase el resumen del documento US 2007/0254295) .

Las siguientes publicaciones están relacionadas con mutaciones en los genes cKIT y PDGFRA y tumores del estroma gastrointestinal: Lux Marcia et al. "KIT extracellular and kinase domain mutations in gastrointestinal stromal tumors", American Journal of Pathology Vol. 156, Núm. 3, Marzo de 2000, páginas 791-795; Rubin Brian et al., "KIT activation is a ubiquitous feature of gastrointestinal stromal tumors", Cancer Research, Vol. 61, Núm. 22, 15 de Noviembre de 2001, páginas 8118-8121; Corless Christopher et al., "PDGFRA Mutations in gastrointestinal stromal tumors: Frequency Spectrum and in vitro sensitivity to imatinib", Journal of Clinical Oncology: Official Journal of the American society of clinical oncology, vol. 23, núm. 23, 10 de Agosto de 2005, páginas 5357-5364.

Las siguientes publicaciones y solicitudes de patente están relacionadas con el ADN circulante: Shapiro et al., "Determination of circulating DNA levels in patients with benign or malignant gastrointestinal disease", Cancer, American Cancer Society, vol. 15, Núm. 11, 1 de Enero de 1983, páginas 2116-2120; Gormally Emmanuelle et al., "Circulating free DNA in plasma or serum as biomarker of carcinogenesis: practical aspects and biological significance", Mutation Research, vol. 635, Núm. 2-3, Mayo 2007, páginas 105-117; y documento WO 01/42504.

Por lo tanto, un objeto de la presente invención es proporcionar tales métodos para el diagnóstico y el seguimiento de los GIST.

Compendio de la invención En un aspecto, la presente invención se refiere a un método in vitro para el diagnóstico y/o el seguimiento en un sujeto un tumor del estroma gastrointestinal como se reivindica en la reivindicación independiente 1.

En algunas realizaciones, la muestra de ensayo utilizada es una muestra de sangre, preferiblemente una muestra de plasma.

En realizaciones específicas, el método comprende adicionalmente la comparación de los resultados obtenidos en la muestra de ensayo con los obtenidos en una muestra de control.

En realizaciones específicas, el ADN es ADN circulante en plasma.

El método comprende cuantificar la cantidad de ADN mutado presente en la muestra de ensayo; en donde una cantidad elevada de ADN mutado en la muestra de ensayo es indicativa de progreso del tumor del estroma gastrointestinal.

Preferiblemente, las... [Seguir leyendo]

 


Reivindicaciones:

1. Un método in vitro para el diagnóstico y/o el seguimiento en un sujeto un tumor del estroma gastrointestinal, que comprende:

detectar en una muestra de ensayo derivada del sujeto una o más mutaciones a nivel de ADN en uno cualquiera o ambos de los genes marcadores cKIT cuya secuencia se representa en la Figura 9 (Núm. acc. GenBank NM_000222.2) y PDGFRA cuya secuencia se representa en la Figura 10 (Núm. acc. Genbank NM_006206.4) y determinar la cantidad de ADN mutado, en donde la cantidad de ADN mutado se determina comparando directamente las fracciones de ADN mutadas y de tipo salvaje;

en donde ADN es ADN circulante;

en donde la presencia de una cualquiera de las mutaciones detectadas en la muestra de ensayo es indicativa de un tumor del estroma gastrointestinal en el sujeto, y en donde una cantidad elevada de ADN mutado es indicativa de progreso del tumor del estroma gastrointestinal.

2. El método de la reivindicación 1, en donde la muestra de ensayo es una muestra de sangre, preferiblemente una muestra de plasma.

3. El método de la reivindicación 1 o 2, en donde las una o más mutaciones se localizan en una o más cualesquiera de las regiones correspondientes a los codone.

45. 508.

54. 599.

64. 654.

67. 709.

78. 823, y 829 del gen marcador cKIT (Núm. de acc. GenBank NM_000222.2) y/o en una o más cualesquiera de las regiones correspondientes a los codones 478.

56. 571, 687.

82. 846 y en el gen marcador de PDGFRA (Núm. acc. Genbank NM_006206.4) .

4. El método de la reivindicación 3, en donde las una o más mutaciones en el gen marcador cKIT (Núm. acc.

Genbank NM_000222.2) se seleccionan del grupo que consiste en: una deleción de una o más cualesquiera de las secuencias de nucleótidos correspondientes a los codone.

55. 558.

55. 554.

55. 559.

55. 572.

55. 558.

55. 571.

55. 558.

55. 559, .

55. 560.

56. 578.

57. 580, 578;

una deleción de una o más cualesquiera de las secuencias de nucleótidos correspondientes a los codone.

55. 561

combinada con la inserción de nucleótidos CTT; una deleción de una o más cualesquiera de las secuencias de nucleótidos correspondientes a los codone.

55. 572 combinada con la inserción del nucleótido G;

una deleción de la secuencia de nucleótidos correspondiente a los codone.

55. 560 combinada con la sustitución de nucleótidos AAG AGC en el codón 558; una duplicación de una o más cualesquiera de las secuencias de nucleótidos correspondientes a los codones 502503 .

57. 591;

una inserción de la secuencia de nucleótidos ACCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGG en los codones 573592; una inserción de la secuencia de nucleótidos GCAAACAACACAACTTCCTTATGATCACAAATGGGAGTTTCC en el codón 585; una inserción de la secuencia de nucleótidos TCCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCA en el codón 586; una inserción de la secuencia de nucleótidos ACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCT en el codón 589; y una o más cualesquiera de las sustituciones de nucleótidos TGG CGG y TGG GGG en el codón 557; AAG

CCG, AAG AAC/T, AAG ACG, y AAG AGG en el codón 558; GTT GAT, GTT GCT, GTT GGT y GTT GAA/G en el codón 559; GTT GAT, GTT GAA/G y GTT GGT en el codón 560; AAA GAA en el codón 642; GTG GCG en el codón 654; y GAC GTC y GAC TTC en el codón 816.

5. El método de la reivindicación 3, en donde una o más mutaciones en el gen marcador PDGFRA (Núm. acc. Genbank NM_006206.4) se selecciona del grupo que consiste en: la sustitución de nucleótidos GAC GTC en el codón 842; y una deleción de la secuencia de nucleótidos correspondiente a los codone.

54. 546.

6. El método de una cualquiera de las reivindicaciones 1 a 5, en donde la detección y/o análisis de las una o más mutaciones se realiza mediante una técnica de PCR específica de alelo, preferiblemente mediante PCR con ligación.

7. El método de una cualquiera de las reivindicaciones 1 a 6, en donde el método se realiza en un formato múltiplex.

8. El uso de un kit de partes para el diagnóstico y/o seguimiento de un tumor del estroma gastrointestinal en un

método de la reivindicación 1, en donde dicho kit de partes comprende medios para detectar y determinar la cantidad de ADN mutado que comprende una o más mutaciones en uno cualquiera o ambos de los genes marcadores cKIT (Núm. de acc. GenBank NM_000222.2) y PDGFRA (Núm. acc. Genbank NM_006206.4) .

9. El uso de una o más mutaciones como se define en una cualquiera de las reivindicaciones 3 a 5 en uno cualquiera o ambos de los genes marcadores cKIT (Núm. acc. Genbank NM_000222.2) y PDGFRA (Núm. acc.

Genbank NM_006206.4) en forma de un panel de marcadores moleculares para la obtención de información cuantitativa para el diagnóstico y/o seguimiento de un tumor del estroma gastrointestinal, en donde dicha información cuantitativa se obtiene comparando directamente fracciones de ADN mutado y de tipo salvaje y en donde una cantidad elevada de ADN mutado es indicativa del progreso del tumor del estroma gastrointestinal.