Detección de eventos de plantas transgénicas.

Un método para examinar en una muestra la presencia o ausencia de material derivado de uno o más eventos de una planta transgénica que comprende las etapas de:

(1) detectar la presencia o ausencia en la muestra de ácidos nucleicos que comprende:

- uno, más de uno o todos los ácidos nucleicos elegidos entre:

a) "Zm": un ácido nucleico derivado de y específico para el taxón Zea mays, preferentemente Zea mays ssp. mays,

b) "Bn": un ácido nucleico derivado de y específico para el taxón Brassica napus,

c) "Gm": un ácido nucleico derivado de y específico para el taxón Glycine max,

o) "Or": un ácido nucleico derivado de y específico para el taxón Oryza sativa,

p) "Bv": un ácido nucleico derivado de y específico para el taxón Beta vulgaris,

q) "Gs": un ácido nucleico derivado de y específico para el taxón Gossypium, y

t) "St": un ácido nucleico derivado de y específico para el taxón Solanum tuberosum; y - todos los ácidos nucleicos d) - i):

d) "p35S": un ácido nucleico derivado del promotor 35S del Virus del mosaico de la coliflor,

e) "tNOS": un ácido nucleico derivado del terminator 3' del gen de la nopalina sintetasa de Agrobacterium tumefaciens,

f) "Cry1Ab": un ácido nucleico derivado del gen de la proteína cristal Cry1Ab de Bacillus thuringiensis,

g) "PAT/bar": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) bar de Streptomyces hygroscopicus,

h) "PAT/pat": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) pat de Streptomyces viridochromogenes, y

i) "CP4-EPSPS": un ácido nucleico derivado del gen de la 5-enol-piruvilshikimato-3-fosfato sintasa EPSPS de Agrobacterium sp. CP4; y

(2) concluir la presencia o ausencia en la muestra de material derivado de uno o más eventos de plantas transgénicas elegidos entre el grupo que comprende: eventos Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, cruces de los mismos, y eventos relacionados de los mismos; eventos Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, cruces de los mismos incluyendo MS1/RF1, MS1/RF2, MS8/RF3, y eventos relacionados de los mismos; eventos MON 40-3-2, MON89788, A2704-12, A5547-127, cruces de los mismos, y eventos relacionados de los mismos, eventos LL62, LL06 y LL601, cruces de los mismos, y eventos relacionados de los mismos; eventos T120- 7, H7-1 y A5-15, cruces de los mismos, y eventos relacionados de los mismos; eventos LL cotton 25, MON 1445, MON 531, MON 15985, cruces de los mismos, y eventos relacionados de los mismos; y evento EH92-527-1 y eventos relacionados del mismo,

en el cual dichos eventos relacionados se han generado introduciendo en el mismo taxón que el del evento con el cual están relacionados la misma construcción transformante que la del evento con el cual están relacionados, en el cual en la etapa (1) la presencia o ausencia de ácidos nucleicos en una muestra se detecta usando amplificación por PCR, preferentemente amplificación por PCR a tiempo real, en el cual la amplificación por PCR de los ácidos nucleicos se realiza simultáneamente a las mismas condiciones de temperatura de ciclación, usando los respectivos pares de cebadores de la siguiente tabla, o variantes que muestran al menos un 85% de identidad de secuencia con dichos pares de cebadores:**Tabla**

"Zm" Dir: 5' TCTCTTCCTCCTTTAGAGCTACCACTA 3' (SEC ID Nº 56)

Inv: 5' AATCGATCCAAAGCGAGATGA 3' (SEC ID Nº 57)

"Bn" Dir: 5' CAGCTCAACAGTTTCCAAACGA 3' (SEC ID Nº 24)

Inv: 5' CGACCAGCCTCAGCCTTAAG 3' (SEC ID Nº 25)

"Gm" Dir: 5' AACCGGTAGCGTTGCCAG 3' (SEC ID Nº 58)

Inv': 5' AGCCCATCTGCAAGCCTTT 3' (SEC ID Nº 59)

"p35S" Dir: 5' AAAGCAAGTGGATTGATGTGATA 3' (SEC ID Nº 60)

Inv: 5' GGGTCTTGCGAAGGATAGTG 3' (SEC ID Nº 61)

"tNOS" Dir: 5'-GATTAGAGTCCCGCAATTATACATTTAA-3' (SEC ID Nº 9)

Inv: 5'-TTATCCTAGKTTGCGCGCTATATTT-3' (SEC ID Nº 10)

"Cry1Ab" Dir: 5'-ACCGGTTACACTCCCATCGA-3' (SEC ID Nº 11)

Inv: 5'-CAGCACCTGGCACGAACTC-3' (SEC ID Nº 12)

"PAT/bar" Dir: 5'-CGTCAACCACTACATCGAGACAA-3' (SEC ID Nº 13)

Inv: 5'-GTCCACTCCTGCGGTTCCT-3' (SEC ID Nº 14)

"PAT/pat" Dir: 5'-CCGCGGTTTGTGATATCGTT-3' (SEC ID Nº 15)

Inv: 5'-TCTTGCAACCTCTCTAGATCATCAA-3' (SEC ID Nº 16)

"CP4-EPSPS" Dir: 5' GCATGCTTCACGGTGCAA 3' (SEC ID Nº 22)

Inv: 5' GGACCTGTGGGAGATAGACTTGTC 3' (SEC ID Nº 23)

Inv 1: 5' TGAAGGACCGGTGGGAGAT 3' (SEC ID Nº 62)

Inv 2: 5' TGAAGGACCTGTGGGAGAT 3' (SEC ID Nº 63)

"Or" Dir': 5' GCTTAGGGAACAGGGAAGTAAAGT 3' (SEC ID Nº 51)

Inv: 5' CTTAGCATAGTCTGTGCCATCCA 3' (SEC ID Nº 21)

"Bv" Dir: 5' GACCTCCATATTACTGAAAGGAAG 3' (SEC ID Nº 64)

Inv: 5' GAGTAATTGCTCCATCCTGTTCA 3' (SEC ID Nº 65)

"Gs" Dir: 5' AGTTTGTAGGTTTTGATGTTACATTGAG 3' (SEC ID Nº 66)

Inv: 5' GCATCTTTGAACCGCCTACTG 3' (SEC ID Nº 67)

"St" Dir: 5' GGACATGTGAAGAGACGGAGC 3' (SEC ID Nº 68)

Inv: 5' CCTACCTCTACCCCTCCGC 3' (SEC ID Nº 69)

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2008/051059.

Solicitante: SCIENTIFIC INSTITUTE OF PUBLIC HEALTH (IPH).

Nacionalidad solicitante: Bélgica.

Dirección: RUE JULIETTE WYTSMANSTRAAT 14 1050 BRUXELLES BELGICA.

Inventor/es: VAN DEN BULCKE,MARC HENRI GERMAIN, LIEVENS,ANTOON PIET NELLY RAOUL, LEUNDA,AMAYA, MBONGOLO MBELLA,ETONDOH GUILLAUME, BARBAU-PIEDNOIR,ELODIE, SNEYERS,MYRIAM JACQUELINE SYLVIANE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2531664_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Detección de eventos de plantas transgénicas

Campo de la invención [0001] La presente memoria se refiere a la detección de materiales derivados de eventos de plantas transgénicas. En particular, la memoria proporciona métodos, reactivos, kits y materiales de referencia para detectar la presencia o ausencia en una muestra de material genético derivado de y atribuible a eventos seleccionados de plantas transgénicas.

Antecedentes de la invención [0002] Los organismos modificados genéticamente (GMO) , en particular las plantas modificadas genéticamente, 15 están adquiriendo importancia en la agricultura así como en la producción y comercialización de alimentos y piensos.

Sin embargo, debido a cuestiones existentes respecto al impacto de los GMO sobre el medioambiente y sobre la salud de los consumidores, la introducción de nuevos GMO requiere comúnmente la aprobación reglamentaria y, en muchos países incluyendo la Unión Europea, los productos alimentarios y de piensos que contienen o se producen a partir de GMO están en sí mismos sometidos a autorización y etiquetado obligatorio (véase, por ejemplo, Normativa (EC) nº 1829/2003, Off J Eur Communities: Legis. 2003, L268: 1-23; Normativa (EC) nº 1830/2003, Off J Eur Communities: Legis. 2003, L268: 24-28) .

Por consiguiente, el rastreo de los GMO en el medioambiente y a través de los procesos de cultivo y la cadena de producción de alimentos o piensos es fundamental para la evaluación de riesgos medioambientales, así como necesario para conservar la confianza de los consumidores y para satisfacer o verificar el cumplimiento de las normativas obligatorias, incluyendo el etiquetado de productos con GMO.

Esto requiere la disponibilidad de métodos que puedan determinar la presencia, identidad y/o cantidad de GMO o materiales originados o derivados a partir de los mismos en, por ejemplo, fuentes de alimentos y piensos, ingredientes y/o consumibles procesados. Los métodos basados en ADN son muy útiles a este respecto, entre otras razones porque el ADN a menudo soporta los tratamientos de procesamiento físico y químico de los alimentos mejor que otras moléculas, tales como las proteínas. Por ejemplo, la reacción en cadena de la polimerasa a tiempo real (PCR) ha demostrado ser una técnica específica y sensible para la cuantificación de ácidos nucleicos, indicativos de la presencia de ADN originado a partir de GMO.

Se describen métodos de selección para uno o más eventos de plantas transgénicas a través de la detección de uno o más elementos de secuencia en Delano et al. 2003, J. Agr. Food Chem. 51: 5829-5834; Vesna et al. 2002, Acta Veterinaria 52: 201-210; Permingeat et al. 2002, J. Agr. Food Chem. 50: 4431-4436; Saxena et al. 40 2002, Soil Biol. Biochem. 34: 133-137; La Paz et al. 2006, J AOAC Int. 89: 1347-1352; Nadal et al. 2001, Electrophoresis 27: 3879-3888; documento US 2006/070139; documento WO 2006/108674; Hernandez et al. 2004, J Cereal Sci 39: 99-107; Heck et al. 2005, Crop Science 45: 329-339; documento US 2006/282915; Hernandez et al. 2001, J. Agr. Food Chem. 48: 3622-3627; documento WO 2005/103301; Yang et al. 2005, Transgenic Res. 14: 817831; Watanabe et al. 2004, Biol Pharm Bull. 27: 1333-1339; documento WO 2001/032919; documento DE 19906169;

documento EP 1724360; y documento DE 10005808.

Se dispone de ensayos que deducen, de forma inequívoca, la presencia o ausencia de material genético derivado de un evento seleccionado de transformación vegetal en una muestra. Comúnmente, dichos ensayos pueden detectar la presencia de una secuencia única de nucleótidos específica de evento hallada en el evento de 50 transformación vegetal de interés pero ausente de otros eventos. Por ejemplo, dichas secuencias distintivas de nucleótidos pueden estar presentes en las uniones entre la secuencia genómica endógena del GMO y la secuencia de la construcción génica transformante en el sitio de inserción genómica de la última; la detección puede implicar, por ejemplo, la amplificación por PCR a través de dicha unión usando cebadores específicos que flanqueen la unión (véase, por ejemplo, Hernandez et al. 2003, Transgenic Res 12: 179-189; Hernandez et al. 2004, J Cereal Sci 39:

99-107; Berdal et al. 2001, Eur Food Res Technol 213: 432-438; Nielsen et al. 2004, Eur Food Res Technol 219: 421-427; o Ronning et al. 2003, Eur Food Res Technol 216: 347-354) .

Sin embargo, estos ensayos específicos de evento a menudo pueden conseguirse solamente como kits de elevado precio que permiten una cantidad limitada de ensayos, están restringidos a la detección de material de un 60 único evento, y habitualmente emplean condiciones de reacción muy particulares. Pese a ello, la cantidad de GMO generados, autorizados y comercializados sigue aumentando. Por tanto, una determinación inequívoca de la composición de GMO de una muestra en principio requeriría aplicar una batería siempre creciente de ensayos diferentes de detección específica de evento sobre cada muestra, lo que es exigente tanto en dificultad como en costes.

Por lo tanto, aunque sigue siendo deseable emplear ensayos específicos de evento debido a la naturaleza inequívoca de su resultado, existe la necesidad de usar estos ensayos de un modo más efectivo y dirigido, tal como para mejorar la detección de GMO, por ejemplo, en términos de consumo de tiempo, costes e intensidad de trabajo.

Descripción resumida de la invención [0010] La presente memoria proporciona métodos, reactivos, kits y materiales de referencia que abordan una o más de las necesidades de la técnica analizadas anteriormente.

En general, la memoria por tanto proporciona métodos, reactivos, kits y materiales de referencia mejorados para detectar material derivado de GMO, y preferentemente de plantas modificadas genéticamente, en muestras.

Más particularmente, los inventores han reconocido que eligiendo cuidadosamente ciertas características de secuencia a ensayar en la muestra -en la cual dichas características de secuencia no tienen que ser específicas de evento y pueden, de hecho, compartirse entre dos o más eventos -se puede concluir si la muestra contiene potencialmente material derivado de uno o más eventos de transformación o, por el contrario, si la muestra no contiene material derivado de uno o más de estos eventos de transformación. Los ensayos de la invención pueden así proporcionar una indicación valiosa de los contenidos potenciales de GMO de la muestra y de ese modo reducir ventajosamente la cantidad de ensayos posteriores (tales como, por ejemplo, ensayos específicos de evento) , necesarios para verificar la presencia de material derivado de uno o más eventos de transformación particulares en la muestra; esto puede a su vez mejorar la eficiencia de costes, tiempo y/o trabajo de los métodos de detección de GMO. Por ejemplo, los ensayos de la invención pueden permitir la reducción considerable de la cantidad de ensayos específicos de evento necesarios para caracterizar la composición de GMO de la muestra.

Los inventores también evaluaron meticulosamente los eventos de transformación conocidos, comercialmente significativos y/o autorizados para seleccionar características de secuencia a ensayar en una muestra, tal como para reducir la cantidad de reacciones individuales de ensayo necesarias por muestra asegurando todavía capacidad informativa adecuada del perfil de GMO según la invención.

La presente invención integra la realización relevante anterior en sus diversos aspectos.

En particular, la presente invención proporciona la materia expuesta en todos y cada uno de los siguientes (i) a (xviii) :

(i) . Un método para examinar una muestra para la presencia o ausencia de material derivado de uno... [Seguir leyendo]

 


Reivindicaciones:

1. Un método para examinar en una muestra la presencia o ausencia de material derivado de uno o más eventos de una planta transgénica que comprende las etapas de: 5

(1) detectar la presencia o ausencia en la muestra de ácidos nucleicos que comprende:

- uno, más de uno o todos los ácidos nucleicos elegidos entre:

a) "Zm": un ácido nucleico derivado de y específico para el taxón Zea mays, preferentemente Zea mays ssp. mays, b) "Bn": un ácido nucleico derivado de y específico para el taxón Brassica napus, c) "Gm": un ácido nucleico derivado de y específico para el taxón Glycine max, o) "Or": un ácido nucleico derivado de y específico para el taxón Or y za sativa,

p) "Bv": un ácido nucleico derivado de y específico para el taxón Beta vulgaris, q) "Gs": un ácido nucleico derivado de y específico para el taxón Gossypium, y t) "St": un ácido nucleico derivado de y específico para el taxón Solanum tuberosum; y

- todos los ácidos nucleicos d) -i) :

d) "p35S": un ácido nucleico derivado del promotor 35S del Virus del mosaico de la coliflor, e) "tNOS": un ácido nucleico derivado del terminator 3' del gen de la nopalina sintetasa de Agrobacterium tumefaciens, f) "Cr y 1Ab": un ácido nucleico derivado del gen de la proteína cristal Cr y 1Ab de Bacillus thuringiensis,

g) "PAT/bar": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) bar de Streptomyces hygroscopicus, h) "PAT/pat": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) pat de Streptomyces viridochromogenes, y i) "CP4-EPSPS": un ácido nucleico derivado del gen de la 5-enol-piruvilshikimato-3-fosfato sintasa EPSPS de Agrobacterium sp. CP4; y

(2) concluir la presencia o ausencia en la muestra de material derivado de uno o más eventos de plantas transgénicas elegidos entre el grupo que comprende: eventos Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, cruces de los mismos, y eventos relacionados de los 35 mismos; eventos Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, cruces de los mismos incluyendo MS1/RF1, MS1/RF2, MS8/RF3, y eventos relacionados de los mismos; eventos MO.

4. 3-2, MON89788, A2704-12, A5547-127, cruces de los mismos, y eventos relacionados de los mismos, eventos LL62, LL06 y LL601, cruces de los mismos, y eventos relacionados de los mismos; eventos T1207, H7-1 y A5-15, cruces de los mismos, y eventos relacionados de los mismos; eventos LL cotton 25, MON 1445,

MON 531, MON 15985, cruces de los mismos, y eventos relacionados de los mismos; y evento EH92-527-1 y eventos relacionados del mismo, en el cual dichos eventos relacionados se han generado introduciendo en el mismo taxón que el del evento con el cual están relacionados la misma construcción transformante que la del evento con el cual están relacionados, en el cual en la etapa (1) la presencia o ausencia de ácidos nucleicos en una muestra se detecta usando 45 amplificación por PCR, preferentemente amplificación por PCR a tiempo real, en el cual la amplificación por PCR de los ácidos nucleicos se realiza simultáneamente a las mismas condiciones de temperatura de ciclación, usando los respectivos pares de cebadores de la siguiente tabla, o variantes que muestran al menos un 85% de identidad de secuencia con dichos pares de cebadores:

"Zm" Dir: 5' TCTCTTCCTCCTTTAGAGCTACCACTA 3' (SEC ID Nº 56) Inv: 5' AATCGATCCAAAGCGAGATGA 3' (SEC ID Nº 57)

"Bn" Dir: 5' CAGCTCAACAGTTTCCAAACGA 3' (SEC ID Nº 24) Inv: 5' CGACCAGCCTCAGCCTTAAG 3' (SEC ID Nº 25)

"Gm" Dir: 5' AACCGGTAGCGTTGCCAG 3' (SEC ID Nº 58) Inv': 5' AGCCCATCTGCAAGCCTTT 3' (SEC ID Nº 59)

"p35S" Dir: 5' AAAGCAAGTGGATTGATGTGATA 3' (SEC ID Nº 60) Inv: 5' GGGTCTTGCGAAGGATAGTG 3' (SEC ID Nº 61)

"tNOS" Dir.

5. GATTAGAGTCCCGCAATTATACATTTAA-3' (SEC ID Nº 9) Inv.

5. TTATCCTAGKTTGCGCGCTATATTT-3' (SEC ID Nº 10)

"Cr y 1Ab" Dir.

5. ACCGGTTACACTCCCATCGA-3' (SEC ID Nº 11) Inv.

5. CAGCACCTGGCACGAACTC-3' (SEC ID Nº 12)

"PAT/bar" Dir.

5. CGTCAACCACTACATCGAGACAA-3' (SEC ID Nº 13) Inv.

5. GTCCACTCCTGCGGTTCCT-3' (SEC ID Nº 14)

"PAT/pat" Dir.

5. CCGCGGTTTGTGATATCGTT-3' (SEC ID Nº 15) Inv.

5. TCTTGCAACCTCTCTAGATCATCAA-3' (SEC ID Nº 16)

"CP4-EPSPS" Dir: 5' GCATGCTTCACGGTGCAA 3' (SEC ID Nº 22) Inv: 5' GGACCTGTGGGAGATAGACTTGTC 3' (SEC ID Nº 23) Inv 1: 5' TGAAGGACCGGTGGGAGAT 3' (SEC ID Nº 62) Inv 2: 5' TGAAGGACCTGTGGGAGAT 3' (SEC ID Nº 63)

"Or" Dir': 5' GCTTAGGGAACAGGGAAGTAAAGT 3' (SEC ID Nº 51) Inv: 5' CTTAGCATAGTCTGTGCCATCCA 3' (SEC ID Nº 21)

"Bv" Dir: 5' GACCTCCATATTACTGAAAGGAAG 3' (SEC ID Nº 64) Inv: 5' GAGTAATTGCTCCATCCTGTTCA 3' (SEC ID Nº 65)

"Gs" Dir: 5' AGTTTGTAGGTTTTGATGTTACATTGAG 3' (SEC ID Nº 66) Inv: 5' GCATCTTTGAACCGCCTACTG 3' (SEC ID Nº 67)

"St" Dir: 5' GGACATGTGAAGAGACGGAGC 3' (SEC ID Nº 68) Inv: 5' CCTACCTCTACCCCTCCGC 3' (SEC ID Nº 69)

2. El método según la reivindicación 1, en el cual la etapa (1) implica la detección de la presencia o ausencia en la muestra de ácidos nucleicos que comprenden todos los ácidos nucleicos enumerados en a) -c) y d) -i) .

3. El método según cualquiera de las reivindicaciones 1 ó 2, en el cual la amplificación por PCR de dos o más de los ácidos nucleicos es multiplex.

4. El método según cualquiera de las reivindicaciones 1 a 3, en el cual los cebadores o pares de cebadores están marcados para permitir la detección. 10

5. El método según cualquiera de las reivindicaciones 1 a 4,

-en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra del ácido nucleico j) "mCr y 3A": un ácido nucleico derivado del gen modificado de la proteína cristal Cr y 3A de Bacillus

thuringiensis; y/o -en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra de uno o ambos ácidos nucleicos k) "cordapA": un ácido nucleico derivado del gen de la dihidrodipicolinato sintasa insensible a lisina (cDHDPS) cordapA de Cor y nebacterium glutamicum y/o l) "Glb1": un ácido nucleico derivado del promotor Glb1 de maíz; y/o -en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra del ácido nucleico m) "Cr y 3Bb1": un ácido nucleico derivado del gen de la proteína cristal Cr y 3Bb1 de Bacillus thuringiensis; y/o -en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra del ácido nucleico n) "Bxn": un ácido nucleico derivado del gen de la nitrilasa Bxn de Klebsiella pneumoniae ssp. ozaenae;

y/o -en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra de uno o ambos ácidos nucleicos r) "Cr y 1Ac": un ácido nucleico derivado del gen de la proteína cristal Cr y 1Ac de Bacillus thuringiensis y/o s) "Cr y 2Ab2": un ácido nucleico derivado del gen de la proteína cristal Cr y 2Ab2 de Bacillus thuringiensis; y/o -en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra del ácido nucleico u) "GBSS": un ácido nucleico derivado del gen de la sintasa de almidón unido a gránulo Gbss de Solanum tuberosum.

6. El método según cualquiera de las reivindicaciones 1 a 5, en el cual la etapa (1) comprende adicionalmente detectar la presencia o ausencia en la muestra de un ácido nucleico genérico derivado de planta, preferentemente derivado de la subunidad pequeña de cloroplastos del gen de Rubisco o del gen de la CHL-ARNt sintetasa, más preferentemente en el cual la presencia o ausencia de dicho ácido nucleico genérico derivado de planta se detecta usando amplificación por PCR, preferentemente amplificación por PCR a tiempo real, usando el par de cebadores 5' AGGTCTAADGGRTAAGCTAC 3' (SEC ID Nº 26) y 5' AGYCTTGATCGTTACAAAGG 3' (SEC ID Nº 27) , o variante que muestra al menos un 85% de identidad de secuencia con dicho par de cebadores, opcionalmente en el cual el cebador o par de cebadores está marcado para permitir la detección.

7. El método según cualquiera de las reivindicaciones 1 a 6, en el cual los productos de amplificación se detectan usando un método de detección que es sustancialmente no específico de secuencia, preferentemente usando un 45 colorante fluorescente de unión a ADN, más preferentemente usando SYBR Green o PicoGreen, o en el cual los productos de amplificación se detectan mediante un marcador fluoróforo presente en al menos un cebador del par de cebadores, tal como usando la tecnología Light Upon Extension (LUX™) .

8. El método según cualquiera de las reivindicaciones 1 a 7, en el cual la muestra comprende plantas o partes de las 50 mismas, incluyendo flores, tépalos, pétalos, sépalos, anteras, polen, semillas, frutos, pericarpios, vainas, hojas,

peciolos, tallos, raíces, rizomas, estolones, tubérculos o brotes, o partes de los mismos, células vegetales, protoplastos vegetales y/o tejidos vegetales, y/o material derivado de plantas, preferentemente material para alimentos o pienso, incluyendo material procesado para alimentos o pienso.

9. El método según cualquiera de las reivindicaciones 1 a 8, en el cual en la etapa (1) la presencia o ausencia de ácidos nucleicos en una muestra se detecta usando amplificación por PCR, preferentemente amplificación por PCR a tiempo real, usando los respectivos pares de cebadores de la siguiente tabla, o variantes que muestran al menos un 85% de identidad de secuencia con dichos pares de cebadores:

"Zm" Dir: 5' CgTCgTTTCCCATCTCTTCCTCC 3' (SEC ID Nº 1) Inv: 5' CCACTCCgAgACCCTCAgTC 3' (SEC ID Nº 2)

"Zm" Dir: 5' TCTCTTCCTCCTTTAGAGCTACCACTA 3' (SEC ID Nº 56) Inv: 5' AATCGATCCAAAGCGAGATGA 3' (SEC ID Nº 57)

"Bn" Dir1: 5' GAGAATGAGGAGGACCAAGCTC 3' (SEC ID Nº 4) Dir2: 5'GGTGAGCTGTATAATCGAGCGA 3' (SEC ID Nº 79) Inv: 5' GGCGCAGCATCGGCT 3' (SEC ID Nº 3)

"Bn" Dir: 5' CAGCTCAACAGTTTCCAAACGA 3' (SEC ID Nº 24) Inv: 5' CGACCAGCCTCAGCCTTAAG 3' (SEC ID Nº 25)

"Gm" Dir: 5' CATTACCTATgATgCCTCCACC 3' (SEC ID Nº 5) Inv: 5' AAgCACgTCATgCgATTC 3' (SEC ID Nº 6) Inv': 5' AAqCACgTCATgCgATTCC 3' (SEC ID Nº 49)

"Gm" Dir: 5' AACCGGTAGCGTTGCCAG 3' (SEC ID Nº 58) Inv': 5' AGCCCATCTGCAAGCCTTT 3' (SEC ID Nº 59)

"p35S" Dir.

5. GACAGTGGTCCCAAAGATGG-3' (SEC ID Nº 7) Inv.

5. GTCTTGCGAAGGATAGTGGG-3' (SEC ID Nº 8)

"p35S" Dir: 5' AAAGCAAGTGGATTGATGTGATA 3' (SEC ID Nº 60) Inv: 5' GGGTCTTGCGAAGGATAGTG 3' (SEC ID Nº 61)

"tNOS" Dir.

5. GATTAGAGTCCCGCAATTATACATTTAA-3' (SEC ID Nº 9) Inv.

5. TTATCCTAGKTTGCGCGCTATATTT-3' (SEC ID Nº 10)

"tNOS" Dir: 5' CGTTCAAACATTTGGCAATAAAG 3' (SEC ID Nº 28) Inv: 5' AAATGTATAATTGCGGGACTCTAATC 3' (SEC ID Nº 29)

"Cr y 1Ab" Dir.

5. ACCGGTTACACTCCCATCGA-3' (SEC ID Nº 11) Inv.

5. CAGCACCTGGCACGAACTC-3' (SEC ID Nº 12)

"Cr y 1Ab" Dir: 5' GACATCATCTGGGGYATCTT 3' (SEC ID Nº 30) Inv: 5' GCGCTGTTCATGTCGTTGAA 3' (SEC ID Nº 31)

"Cr y 1Ab" Dir: 5' ACGCCTTCCTGGTGCAAA 3' (SEC ID Nº 47) Inv: 5' CCTGGTTCCTGGCGAACTC 3' (SEC ID Nº 48)

"PAT/bar" Dir.

5. CGTCAACCACTACATCGAGACAA-3' (SEC ID Nº 13) Inv.

5. GTCCACTCCTGCGGTTCCT-3' (SEC ID Nº 14)

"PAT/pat" Dir.

5. CCGCGGTTTGTGATATCGTT-3' (SEC ID Nº 15) Inv.

5. TCTTGCAACCTCTCTAGATCATCAA-3' (SEC ID Nº 16)

"CP4-EPSPS" Dir1.

5. GGCTCTGAGCTTCGTCCTCCTAAGG-3' (SEC ID Nº 17) Dir1'.

5. GGCTCTGAGCTTCGTCCTCTTAAGG-3' (SEC ID Nº 50) Dir2.

5. ATCAGTGGCTACAGCCTGCAT-3' (SEC ID Nº 18) Inv.

5. GAATGCGGACGGTTCCGGAAAG-3' (SEC ID Nº 19)

"CP4-EPSPS" Dir: 5' GCATGCTTCACGGTGCAA 3' (SEC ID Nº 22) Inv: 5' GGACCTGTGGGAGATAGACTTGTC 3' (SEC ID Nº 23) Inv 1: 5' TGAAGGACCGGTGGGAGAT 3' (SEC ID Nº 62) Inv 2: 5' TGAAGGACCTGTGGGAGAT 3' (SEC ID Nº 63)

"Or" Dir: 5' GCTTAGGGAACAGGGAAGTAAAGTT 3' (SEC ID Nº 20) Dir': 5' GCTTAGGGAACAGGGAAGTAAAGT 3' (SEC ID Nº 51) Inv: 5' CTTAGCATAGTCTGTGCCATCCA 3' (SEC ID Nº 21)

"Bv" Dir: 5' GACCTCCATATTACTGAAAGGAAG 3' (SEC ID Nº 64) Inv: 5' GAGTAATTGCTCCATCCTGTTCA 3' (SEC ID Nº 65)

"Gs" Dir: 5' AGTTTGTAGGTTTTGATGTTACATTGAG 3' (SEC ID Nº 66) Inv: 5' GCATCTTTGAACCGCCTACTG 3' (SEC ID Nº 67)

"St" Dir: 5' GGACATGTGAAGAGACGGAGC 3' (SEC ID Nº 68) Inv: 5' CCTACCTCTACCCCTCCGC 3' (SEC ID Nº 69)

planta genérica Dir: 5' AGGTCTAADGGRTAAGCTAC 3' (SEC ID Nº 26) Inv: 5' AGYCTTGATCGTTACAAAGG 3' (SEC ID Nº 27)

10. El método según cualquiera de las reivindicaciones precedentes, en el cual la etapa (2) comprende las etapas de:

(i) definir un conjunto de ácidos nucleicos, referido como conjunto "GSAM", que consiste en ácidos nucleicos detectados en la etapa (1) como presentes en la muestra;

(ii) definir uno o más conjuntos de ácidos nucleicos, mencionados como conjunto "GX", elegidos entre el grupo de conjuntos que comprenden o consisten en conjuntos "GBt176", "GBt11", "GBt10", "GMON810", "GMON863", "GTC1507", 5"GNK603", "GT25", "GGA21", "GDAS-59122", "GMIR604", "GLY038", "GMON88017", "GTopas 19/2", "GMS1", "GRF1", "GRF2", "GMS1/RF1", "GMS1/RF2", "GMS8", "GRF3", "GMS8/RF3", "GG773", "GT45", "GLiberator pHoe6/Ac", "GGS40/90pHoe6/Ac", "GOXY235"; "GMON40-3-2", "GMON89788", "GA2704-12", "GA5547-127", "GLL62", "GLL06", "GLL601", "GT120-7", "GH7-1", "GA5-15", "GLL cotton 25", "GMON1445", "GMON531", "GMON15985"y "GEH92-527-1"; correspondientes a uno o más eventos de plantas transgénicas respectivos de interés ("X") elegidos entre el grupo que comprende o que consiste en eventos Bt176, Bt11, Bt10, MON810,

MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, Topas 19/2, MS1, RF1, RF2, MS1/RF1, MS1/RF2, MS8, RF3, MS8/RF3, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235; MON40-3-2, MON89788, A2704-12, A5547-127, LL62, LL06, LL601, T120-7, H7-1, A5-15, LL cotton 25, MON1445, MON531, MON15985 y EH92-527-1, en los cuales:

-GBt176  {Zm; p35S; Cr y 1Ab; PAT/bar}, -GBt11  {Zm; p35S; tNOS; Cr y 1Ab; PAT/pat}, -GBt10  {Zm; p35S; tNOS; Cr y 1Ab; PAT/pat}, -GMON810  {Zm; p35S; tNOS; Cr y 1Ab}, -GMON863  {Zm; p35S; tNOS},

-GTC1507  {Zm; p35S; PAT/pat}, -GNK603  {Zm; p35S; tNOS; CP4-EPSPS}, -GT25  {Zm; p35S; PAT/pat}, -GGA21  {Zm; tNOS}, -GDAS-59122  {Zm; p35S; PAT/bar},

-GMIR604  {Zm; tNOS; mCr y 3A}, o GMIR604  {Zm; tNOS} -GLY038  {Zm; p35S; tNOS; cordapA; Glb1}, o GLY038  {Zm; p35S; tNOS}, -GMON88017  {Zm; p35S; tNOS; CP4-EPSPS; Cr y 3Bb1}, o GMON88017  {Zm; p35S; tNOS; CP4-EPSPS}, -GTopas 19/2  {Bn; p35S; PAT/pat}, -GMS1  {Bn; tNOS; PAT/bar},

-GRF1  {Bn; tNOS; PAT/bar}, -GRF2  {Bn; tNOS; PAT/bar}, -GMS1/RF1  {Bn; tNOS; PAT/bar}, -GMS1/RF2  {Bn; tNOS; PAT/bar}, -GMS8  {Bn; tNOS; PAT/bar},

-GRF3  {Bn; tNOS; PAT/bar}, -GMS8/RF3  {Bn; tNOS; PAT/bar}, -GGT73  {Bn; CP4-EPSPS}, -GT45  {Bn; p35S; PAT/pat}, -GLiberator pHoe6/Ac  {Bn; p35S; PAT/pat},

-GGS40/90pHoe6/Ac  {Bn; p35S; PAT/pat}, -GOXY235  {Bn; p35S; Bxn}, o GOXY235  {Bn; p35S}; -GMON40-3-2  {Gm; p35S; tNOS; CP4-EPSPS}, -GMON89788  {Gm; CP4-EPSPS} -GA2704-12  {Gm; p35S; PAT/pat},

-GA5547-127  {Gm; p35S; PAT/pat}, -GLL62  {Or; p35S; PAT/bar}, -GLL06  {Or; p35S; PAT/bar} -GLL601  {Or; p35S; tNOS; PAT/bar}, -GT120-7  {Bv; p35S; PAT/pat},

-GH7-1  {Bv; p35S; CP4-EPSPS}, -GA5-15  {Bv; p35S; tNOS; CP4-EPSPS}, -GLL cotton 25  {Gs; p35S; tNOS; PAT/bar}, -GMON1445  {Gs; p35S; tNOS; CP4-EPSPS}, -GMON531  {Gs; p35S; tNOS; cr y 1Ac}, o GMON531  {Gs; p35S; tNOS}

-GMON15985  {Gs; p35S; tNOS; cr y 1Ac; cr y 2Ab2} o GMON15985  {Gs; p35S; tNOS}, y -GEH92-527-1  {St; tNOS; Gbss} o GEH92-527-1  {St; tNOS};

(iii) realizar para cada conjunto de interés GX operaciones lógicas:

-si GX es igual a GSAM (GX = GSAM) , entonces el material derivado del evento de planta transgénica X o de un cruce del mismo, o de un evento relacionado con el mismo, está potencialmente presente en la muestra; -si GX es un subconjunto apropiado de GSAM (GX  GSAM) , entonces el material derivado del evento de planta

transgénica X o de un cruce del mismo, o de un evento relacionado con el mismo, está potencialmente presente en la muestra; -si GX no es igual a GSAM y GX no es un subconjunto apropiado de GSAM, (GX ≠ GSAM y GX  GSAM) , entonces el material derivado del evento de planta transgénica X o de un cruce del mismo, o de un evento relacionado con el

mismo, está ausente de la muestra.

11. Un método para examinar en una muestra la presencia o ausencia de material derivado de uno o más eventos de plantas transgénicas que comprende las etapas de:

(1) detectar la presencia o ausencia en la muestra de ácidos nucleicos que comprenden:

-uno, más de uno o todos los ácidos nucleicos elegidos entre:

a) "Zm": un ácido nucleico derivado de y específico para el taxón Zea mays, preferentemente Zea mays ssp.

mays, b) "Bn": un ácido nucleico derivado de y específico para el taxón Brassica napus, c) "Gm": un ácido nucleico derivado de y específico para el taxón Glycine max, o) "Or": un ácido nucleico derivado de y específico para el taxón Or y za safiva, p) "Bv": un ácido nucleico derivado de y específico para el taxón Beta vulgaris, q) "Gs": un ácido nucleico derivado de y específico para el taxón Gossypium, y t) "St": un ácido nucleico derivado de y específico para el taxón Solanum tuberosum;

-uno, más de uno o todos los ácidos nucleicos elegidos entre:

d) "p35S": un ácido nucleico derivado del promotor 35S del virus del mosaico de la coliflor, e) "tNOS": un ácido nucleico derivado del terminador 3' del gen de la nopalina sintetasa de Agrobacterium tumefaciens, f) "Cr y 1Ab": un ácido nucleico derivado del gen de la proteína cristal Cr y 1Ab de Bacillus thuringiensis, g) "PAT/bar": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) bar de Streptomyces hygroscopicus, f) "PAT/pat": un ácido nucleico derivado del gen de la fosfinotricina acetiltransferasa (PAT) pat de Streptomyces viridochromogenes, y i) "CP4-EPSPS": un ácido nucleico derivado del gen de la 5-enol-piruvilshikimato-3-fosfato sintasa EPSPS de Agrobacterium sp. CP4; y

- opcionalmente, uno, más de uno o todos los ácidos nucleicos elegidos entre:

j) "mCr y 3A": un ácido nucleico derivado del gen modificado de la proteína cristal Cr y 3A de Bacillus thuringiensis, k) "cordapA": un ácido nucleico derivado del gen de la dihidrodipicolinato sintasa insensible a lisina (cDHDPS) cordapA de Cor y nebacterium glutamicum, l) "Glb1": un ácido nucleico derivado del promotor Glb1 de maíz, m) "Cr y 3Bb1": un ácido nucleico derivado del gen de la proteína cristal Cr y 3Bb1 de Bacillus thuringiensis, n) "Bxn": un ácido nucleico derivado del gen de la nitrilasa Bxn de Klebsiella pneumoniae ssp. ozaenae,

r) "Cr y 1Ac": un ácido nucleico derivado del gen de la proteína cristal Cr y 1Ac de Bacillus thuringiensis, s) "Cr y 2Ab2": un ácido nucleico derivado del gen de la proteína cristal Cr y 2Ab2 de Bacillus thuringiensis, y u) "GBSS": un ácido nucleico derivado del gen de la sintasa de almidón unido a gránulo Gbss de Solanum tuberosum; y

(2) concluir la presencia o ausencia en la muestra de material derivado de uno o más eventos de una planta transgénica de interés elegido entre el grupo que comprende: eventos Bt176, Bt11, Bt10, MON810, MON863, TC1507, NK603, T25, GA21, DAS-59122, MIR604, LY038, MON88017, cruces de los mismos, y eventos relacionados de los mismos; eventos Topas 19/2, MS1, RF1, RF2, RF3, MS8, GT73, T45, Liberator pHoe6/Ac, GS40/90pHoe6/Ac, OXY235, cruces de los mismos incluyendo MS1/RF1, MS1/RF2, MS8/RF3, y eventos 55 relacionados de los mismos; eventos MO.

4. 3-2, MON89788, A2704-12, A5547-127, cruces de los mismos, y eventos relacionados de los mismos, eventos LL62, LL06 y LL601, cruces de los mismos, y eventos relacionados de los mismos; eventos T120-7, H7-1 y A5-15, cruces de los mismos, y eventos relacionados de los mismos; eventos LL cotton 25, MON 1445, MON 531, MON15985, cruces de los mismos, y eventos relacionados de los mismos; y el evento EH92-527-1 y eventos relacionados del mismo, en el cual dichos eventos relacionados se han generado introduciendo en el mismo taxón que el del evento con el cual están relacionados la misma construcción transformante que la del evento con el cual están relacionados; en el cual en la etapa (1) la presencia o ausencia de ácidos nucleicos en una muestra se detecta usando amplificación por PCR, preferentemente amplificación por PCR a tiempo real, usando los respectivos pares de cebadores de la siguiente tabla, o variantes que muestran al menos un 85% identidad de secuencia con dichos 65 pares de cebadores:

"Zm" Dir: 5' TCTCTTCCTCCTTTAGAGCTACCACTA 3' (SEC ID Nº 56) Inv: 5' AATCGATCCAAAGCGAGATGA 3' (SEC ID Nº 57)

"Bn" Dir: 5' CAGCTCAACAGTTTCCAAACGA 3' (SEC ID Nº 24) Inv: 5' CGACCAGCCTCAGCCTTAAG 3' (SEC ID Nº 25)

"Gm" Dir: 5' AACCGGTAGCGTTGCCAG 3' (SEC ID Nº 58) Inv': 5' AGCCCATCTGCAAGCCTTT 3' (SEC ID Nº 59)

"p35S" Dir: 5' AAAGCAAGTGGATTGATGTGATA 3' (SEC ID Nº 60) Inv: 5' GGGTCTTGCGAAGGATAGTG 3' (SEC ID Nº 61)

"tNOS" Dir.

5. GATTAGAGTCCCGCAATTATACATTTAA-3' (SEC ID Nº 9) Inv.

5. TTATCCTAGKTTGCGCGCTATATTT-3' (SEC ID Nº 10)

"Cr y 1Ab" Dir.

5. ACCGGTTACACTCCCATCGA-3' (SEC ID Nº 11) Inv.

5. CAGCACCTGGCACGAACTC-3' (SEC ID Nº 12)

"PAT/bar" Dir.

5. CGTCAACCACTACATCGAGACAA-3' (SEC ID Nº 13) Inv.

5. GTCCACTCCTGCGGTTCCT-3' (SEC ID Nº 14)

"PAT/pat" Dir.

5. CCGCGGTTTGTGATATCGTT-3' (SEC ID Nº 15) Inv.

5. TCTTGCAACCTCTCTAGATCATCAA-3' (SEC ID Nº 16)

"CP4-EPSPS" Dir: 5' GCATGCTTCACGGTGCAA 3' (SEC ID Nº 22) Inv: 5' GGACCTGTGGGAGATAGACTTGTC 3' (SEC ID Nº 23) Inv 1: 5' TGAAGGACCGGTGGGAGAT 3' (SEC ID Nº 62) Inv 2: 5' TGAAGGACCTGTGGGAGAT 3' (SEC ID Nº 63)

"Or" Dir': 5' GCTTAGGGAACAGGGAAGTAAAGT 3' (SEC ID Nº 51) Inv: 5' CTTAGCATAGTCTGTGCCATCCA 3' (SEC ID Nº 21)

"Bv" Dir: 5' GACCTCCATATTACTGAAAGGAAG 3' (SEC ID Nº 64) Inv: 5' GAGTAATTGCTCCATCCTGTTCA 3' (SEC ID Nº 65)

"Gs" Dir: 5' AGTTTGTAGGTTTTGATGTTACATTGAG 3' (SEC ID Nº 66) Inv: 5' GCATCTTTGAACCGCCTACTG 3' (SEC ID Nº 67)

"St" Dir: 5' GGACATGTGAAGAGACGGAGC 3' (SEC ID Nº 68) Inv: 5' CCTACCTCTACCCCTCCGC 3' (SEC ID Nº 69)

y en el cual la etapa (2) comprende las etapas de:

(i) asignar a ácidos nucleicos elegidos entre el grupo que comprende o que consiste en "Zm", "Bn", "Gm", "p35S", "tNOS", "Cr y 1Ab", "PAT/bar", "PAT/pat", "CP4-EPSPS", "mCr y 3A", "cordap A", "Glb1", "Cr y 3Bb1", "Bxn", "Or", "by", "Gs", "Cr y 1Ac", "Cr y 2ab2", "St" y "Gbss" valores primos únicos "VZm", "VBn", "VGm", "Vp35S", "VtNOS", "VCr y 1Ab", "VPAT/bar", "VPAT/pat", "VCP4-EPSPS", "VmCr y 3A", "VcordapA", "VGlb1", "VCr y 3Bb1", "VBxn", "VOr", "VBv", "VGs", "VCr y 1Ac", "VCr y 2ab2", "Vst" y "VGbss", respectivamente,

(ii) asignar a cada evento de planta transgénica de interés ("X") un valor "VGX" elegido entre el grupo que comprende o que consiste en valores "VGBt176", "VGBt11", "VGBt10", "VGMON810", "VGMON863", "VGTC1507", "VGNK603", "VGT25", "VGGA21", "VGDAS-59122", "VGMIR604", "VGLY038", "VGMON88017", "VGTopas 19/2", "VGMS1", "VGRF1", "VGRF2", "VGMS1/RF1", "VGMS1/RF2", "VGMS8", "VGRF3", "VGMS8/RF3", "VGGT73", "VGT45", "VGLiberatorpHoe6/Ac", "VGGS40/90pHoe6/Ac", "VGOXY235", "VGMON40-3-2", "VGMON89788", "VGA2704-12", "VGA5547-127", "VGLL62", "VGLL06", "VGLL601", "VGT120-7", "VGH7

1", "VGA5-15", "VGLLcotton25", "VGMON1445", "VGMON531", "VGMON15985" y "VGEH92-527-1", en los cuales:

- VGBt176 = VZm X Vp35S X VCr y 1Ab X VPAT/bar, -VGBt11 = VZm X Vp35S X VtNOS X VCr y 1Ab X VPAT/pat, -VGBt10 = VZm x Vp35S x VtNOS x VCr y 1Ab X VPAT/pat,

-VGMON810 = VZm X Vp35S X VtNOS X VCr y 1Ab, -VGMON863 = VZm X Vp35S X VtNOS, -VGTC1507 = VZm X Vp35S X VPAT/pat, -VGNK603 = VZm X Vp35S X VtNOS X VCP4-EPSPS, -VGT25 = VZm X Vp35S X VPAT/pat,

-VGGA21 = VZm X VtNOS,

- VGDAS-59122 = VZm X Vp35S X VPAT/bar, -VGMIR604 = VZm X VtNOS XVmCr y 3A, o VGMIR604 = VZm X VtNOS, -VGLY038 = VZm X Vp35S XVtNOS XVcordapA XVGlb1 o VGLY038 = VZm X Vp35S X VtNOS, -VGMON88017 = VZm X Vp35S X VtNOS X VCP4-EPSP XVCr y 3Bb1, o VGMON88017 = VZm X Vp35S XVtNOS XVCP4-EPSP,

-VGTopas 19/2 = VBn X Vp35S XVPAT/pat, -VGMS1 = VBn X VtNOS X VPAT/bar, -VGRF1 = VBn X VtNOS X VPAT/bar, -VGRF2 = VBn X VtNOS X VPAT/bar, -VGMS8 = VBn X VtNOS X VPAT/bar,

-VGRF3= VBnX VtNOSX VPAT/bar, -VGMS1/RF1 = VBn X VtNOS X VPAT/bar,

- VGMS1/RF2 = VBn X VtNOS X VPAT/bar, -VGMS8/RF3 = VBn X VtNOS X VPAT/bar, -VGGT73 = VBn X VCP4-EPSPS, -VGT45 = VBn X Vp35S X VPAT/pat,

-VGLiberator pHoe6/Ac = VBn X Vp35S X VPAT/pat, -VGGS40/90pHoe6/Ac = VBn X Vp35S X VPAT/pat, -VGOXY235 = VBn X Vp35S X VBxn, o VGOXY235 = VBn X Vp35S,

- VGMON40-3-2 = VGm X Vp35S X VtNOS X VCP4-EPSPS, -VGMON89788 = VGm X VCP4-EPSPS,

-VG2704-12 = VGm X VP35S X VPAT/pat, -VGA5547-127 = VGm X Vp35S X VPAT/pat, -VGLL62 = VOr X Vp35S X VPAT/bar, -VGLL06 = VOr X Vp35S X VPAT/bar, -VGLL601 = VOr X Vp35S X VtNOS X VPAT/bar,

-VGT1720-7 = VBv X Vp35S X VPAT/pat, -VGH7-1 = VBv X Vp35S X VCP4-EPSPS, -VGA5-15 = VBv X Vp35S X VtNOS X VCP4-EPSPS, -VGLL cotton 25 = VGs X Vp35S X VtNOS X VPAT/bar, -VGMON1445 = VGs X Vp35S X VtNOS X VCP4-EPSPS,

-VGMON531 = VGs X Vp35S X VtNOS X VCr y 1Ac, o VGMON531 = VGs X Vp35s X VtNOS,

-VGMON15985 = VGs X Vp35S X VtNOS X VCr y 1Ac X VCr y 2Ab2, o VGMON15985 = VGs X Vp35S X VtNOS, -y VGEH92-527-1 = VSt X VtNOS X VGbss, o VGEH92-527-1 = VSt X VtNOS,

(iii) proporcionar un valor "VGSAM" que es un múltiplo de los valores primos únicos asignados a los ácidos 25 nucleicos detectados en la etapa (1) como presentes en la muestra,

(iv) realizar para cada evento de interés ("X") operaciones lógicas:

-si VGSAM / VGX es igual a 1, entonces el material derivado del evento de planta transgénica X o de un cruce del mismo, o de un evento relacionado con el mismo, está potencialmente presente en la muestra;

-si VGSAM / VGX es un número entero mayor de 1, entonces el material derivado del evento de planta transgénica X o de un cruce del mismo, o de un evento relacionado con el mismo, está potencialmente presente en la muestra; -si VGSAM / VGX no es un número entero, entonces el material derivado del evento de planta transgénica X o de un cruce del mismo, o de un evento relacionado con el mismo, está ausente de la muestra. 35

12. El método según la reivindicación 11 que incluye adicionalmente las características de cualquiera de las reivindicaciones 2, 3, 4 o 6 a 9.

13. Un método para determinar la presencia o ausencia de dos o más eventos, preferentemente eventos de plantas

transgénicas, o material de los mismos en una muestra, en el cual dicho evento se caracteriza por uno o más rasgos, que comprende las etapas de:

(1) detectar la presencia o ausencia en la muestra de dicho uno o más rasgos,

(2) concluir la presencia o ausencia en la muestra de dicho uno o más eventos mediante un dispositivo de 45 computación programable, que comprende:

(a) asignar un valor numérico primo único a cada rasgo,

(b) representar cada evento como un producto de los valores numéricos primos asignados a rasgos característicos de dicho evento,

(c) representar la muestra como un producto de los valores numéricos primos asignados a rasgos detectados como presentes en la muestra, y

(d) dividir el producto que representa la muestra definido en (c) por el producto que representa un evento definido en (b) , de manera que:

-si el valor obtenido por dicha división es igual a 1, entonces dicho evento o material del mismo está potencialmente presente en la muestra; -si el valor obtenido por dicha división es un número entero mayor de 1, entonces dicho evento o material del mismo está potencialmente presente en la muestra; -si el valor obtenido por dicha división no es un número entero, entonces dicho evento o material del

mismo está ausente de la muestra.

14. El método según cualquiera de las reivindicaciones 1 a 12, en el cual la etapa (2) se realiza mediante un dispositivo de computación.

15. Un dispositivo de computación programable que comprende un medio adaptado para realizar la etapa (2) del método según cualquiera de las reivindicaciones 1 a 13.

16. Un soporte de datos que comprende un programa informático adaptado para realizar la etapa (2) del método 5 según cualquiera de las reivindicaciones 1 a 13.

17. Una combinación de pares de cebadores o variantes que muestra al menos un 85% identidad de secuencia con dichos pares de cebadores, opcionalmente en la cual los cebadores o pares de cebadores están marcados para permitir la detección, que comprende:

- un par de cebadores para la amplificación del ácido nucleico d) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico e) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico f) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico g) como se define en la reivindicación 1,

-un par de cebadores para la amplificación del ácido nucleico h) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico i) como se define en la reivindicación 1, y -uno, más de uno o todos los pares del cebadores seleccionados entre: un par de cebadores para la amplificación del ácido nucleico a) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico b) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico c) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico o) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico p) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico q) como se define en la reivindicación 1, y un par de cebadores para la amplificación del ácido nucleico t) como se define en la reivindicación 1,

en la cual los pares de cebadores o variantes de los mismos son como se definen en las reivindicaciones 1 ó 9, en donde opcionalmente la combinación comprende adicionalmente un par de cebadores para la amplificación de un ácido nucleico genérico derivado de plantas como se define en la reivindicación 6.

18. Un kit para examinar en una muestra la ausencia o presencia potencial de material derivado de uno o más eventos de una planta transgénica, comprendiendo el kit una combinación de pares de cebadores o variantes que muestran al menos un 85% de identidad de secuencia con dichos pares de cebadores, en donde los cebadores o pares de cebadores están opcionalmente marcados para permitir la detección, que comprende:

-un par de cebadores para la amplificación del ácido nucleico d) como se define en la reivindicación 1,

-un par de cebadores para la amplificación del ácido nucleico e) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico f) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico g) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico h) como se define en la reivindicación 1, -un par de cebadores para la amplificación del ácido nucleico i) como se define en la reivindicación 1, y

-uno, más de uno o todos los pares del cebadores seleccionados entre: un par de cebadores para la amplificación del ácido nucleico a) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico b) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico c) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico o) como se define en la reivindicación 1, un par de cebadores para la 45 amplificación del ácido nucleico p) como se define en la reivindicación 1, un par de cebadores para la amplificación del ácido nucleico q) como se define en la reivindicación 1, y un par de cebadores para la amplificación de ácido nucleico t) como se define en la reivindicación 1, en el cual los pares de cebadores o variantes de los mismos son como se definen en las reivindicaciones 1 ó 9, en donde el kit opcionalmente comprende además un par de cebadores para la amplificación de un ácido 50 nucleico genérico derivado de plantas como se define en la reivindicación 6.

REFERENCIAS CITADAS EN LA DESCRIPCIÓN

Esta lista de referencias citadas por el solicitante es únicamente para la comodidad del lector. No forma parte del documento de la patente europea. A pesar del cuidado tenido en la recopilación de las referencias, no se pueden excluir errores u omisiones y la EPO niega toda responsabilidad en este sentido.

Documentos de patentes citados en la descripción Literatura diferente de patentes citada en la descripción