Detección de estafilococos áureos resistentes a la meticilina.

Un procedimiento para la detección de estafilococos áureos resistentes a la penicilina

("MRSA"), en una muestra, la cual contiene ácidos nucleicos, comprendiendo, el procedimiento:

amplificar los ácidos nucleicos, en la muestra; y

detectar ácidos nucleicos, en la muestra, los cuales comprendan genes amplificados de mecA y ldh1, en donde, la presencia de genes amplificados de mecA y de ldh1, en un factor de relación de 1 : 1, indica la presencia de estafilococos áureos resistentes a la meticilina.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2012/039275.

Solicitante: Elitech Holding B.V.

Nacionalidad solicitante: Países Bajos.

Dirección: Van Rensselaerweg 4 6956 AV Spankeren PAISES BAJOS.

Inventor/es: AFONINA,IRINA,A, BELOUSOV,Yevgeniy S, MAHONEY,WALT.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2537189_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Detección de estafilococos áureos resistentes a la meticilina ANTECEDENTES

La presente Invención, reivindica la prioridad de la serle de solicitudes de patentes estadounidenses provisionales correspondientes a los números 61 /489. 614, registrada en fecha 24 de Mayo del 211, 61 / 532. 454, registrada en fecha 8 de Septiembre del 28 y 61 / 614. 381, registrada en fecha 22 de Marzo del 212, todas ellas tituladas "Detectlon of Methlclllln-Reslstant Staphylococcus Aureus," [Detección de estafilococos áureus resistentes a la meticilina].

Esta revelación, se refiere a diagnósticos bacterianos y, de una forma más particular, a la detección de estafilococos áureos resistentes a la meticilina.

La aparición generalizada del estafilococo áureo resistente a la meticilina ("MRSA" - [de sus siglas en Inglés, correspondientes a methicillin-resistant Staphylococcus aureus] -), representa un serio problema de índole mundial. El S. áureo (del Inglés, Staphylococcus aureus), y de una forma especial, el MRSA, se ve, hoy en día, como siendo una de la causas mayores causas de ambas, las infecciones asociadas con el cuidado de la salud, y las infecciones asociadas con la población. El S. aureus (estafilococo áureo), es una bacteria comensal, la cual coloniza a las cavidades o fosas nasales, a la vagina, a las axilas y / o las superficies dañadas de las piel. Las Infecciones, pueden acontecer mediante una brecha en la piel ó en las mucosas, la cual permita el acceso a los tejidos contiguos y al sistema sanguíneo. El riesgo, se incrementa mediante la presencia de catéteres. El S. aureus, es único, en cuanto a lo referente a su capacidad de invadir los tejidos normales, y provocar enfermedades, en tejidos los cuales han sido previamente tejidos normales, de una forma virtual, en todos los lugares (véase, a dicho efecto, Boucher et al., CID, 51 (Suplemento 2): S183 - S197, 21). El MRSA (estafilococo áureo resistente a la meticilina) causa varias infecciones, tales como, por ejemplo, las consistentes en las Infecciones de la piel y de los tejidos blandos, las infecciones de origen hemático o sanguíneo y la pneumonía (véase a dicho efecto Gemmel et al., J. Antlmlcrob. Chemother., 57: 589 - 68, 26). La aparición de las cepas de estafilococos áureos, las cuales son resistentes a los antibióticos, plantea un reto para la búsqueda de un tratamiento el cual sea exitoso. Se ha observado el hecho consistente en que, los pacientes hospitalizados, los cuales se encuentran afectados de la cepa de S. áureus bacteriana, tienen una tasa de mortalidad la cal es inaceptablemente alta. La literatura especializada en el arte especializado de la técnica, la cual se encuentra hoy en día a disposición, ha indicado el hecho de que, la selección del tratamiento antibacteriano que sea el más apropiado, a tiempo, puede reducir la mortalidad. Una herramienta la cual puede ser de ayuda en la selección, es la consistente en la rápida distinción del MRSA, de la S. aureus susceptible a la meticilina ("MSSA" - [del inglés, methicillin-susceptible S. aureus] -) (véase, a dicho efecto, Brown et al., Pharmacoeconomics, - Farmacoeconomía -, 28: 567 - 575, 21).

Si bien existen, hoy en día, existen algunas herramientas y algunos ensayos, para la Identificación de la MRSA, éstos son, sin embargo, no obstante, de una eficacia inferior a la que sería ideal. Se ha reportado una cantidad de falsos positivos, correspondiente a un porcentaje tan alto como el de un 12,9 %, para ensayos comercialmente disponibles en el mercado del tipo locus único o individual (véase, a dicho efecto, Blanc et al., J. Clin. Microbiol., 49: 722 - 724, 211). Una evaluación, mediante la utilización de ensayos de PCR a tiempo real, consistentes en dos ensayos de PCR de dos locus individuales, y de un ensayo de PCR de doble locus, para el MRSA, advierten sobre el alto predominio de "falsos negativos" y de "falsos positivos" (véase, a dicho efecto, Kolman et al., BMC Res. Notes, 3; 11, 21). Existe por lo tanto una clara necesidad, en cuanto a lo referente al hecho de poder disponer de ensayos mejorados para la evaluación del MRSA.

RESUMEN DE LA INVENCIÓN

La presente revelación, proporciona procedimientos, sondas y cebadores, para la detección de los estafilococos áureos ("SA" - [de sus siglas, en Idioma inglés, correspondientes a Staphylococcus aureus) -), y del estafilococo áureo resistente a la meticilina ("MRSA" - [del inglés methicillin - resistant Staphylococcus aureus] -), en muestras, las cuales incluyen a las muestras biológicas (tales como, por ejemplo, las muestras de sangre, de una torunda nasofaríngea o de la garganta, de una torunda de las heces, de una torunda de una herida, o de otros tejidos).

La producción de L-lactato, permite el que los S. aureus, mantengan la homeostasis redox, durante el estrés nitrosativo y éste esencial para la virulencia. La actividad lactato deshidrogenasa inducible por óxido nítrico (NO*) y la resistencia al NO*, distingue a los S. aureus de las especies íntimamente comensales íntimamente relacionadas, consistentes en las especies S. epidermidis y S. saprophyticus (véase, a dicho efecto, Richardson et al., Science, 319: 1672, 28).

La resistencia a los antibióticos de (3- lactamasa (betalactámicos), viene causada por una proteína de unión a la penicilina, modificada (PBP2a), la cual se codifica mediante el gen mecA (véase, a dicho efecto, Hartman & Tomasz, J. Bacteriol., 158: 513 - 516, 1984). Esta determinante resistencia, reside en un elemento genético móvil, al cual se le denomina como casete cromosómico estafilocócico mee (SCOmee - [del inglés staphylococcal cassette

chromosome mee] -), el cual se integra aguas debajo de un marco de lectura especifico (orFX) del S. aureus (orFx, son las siglas, en inglés, de open reading trame) (véase, a dicho efecto, Hiramatsu et al., Int. J. Me. MIcrobiol., 292 : 67 - 74, 22). La detección del MRSA, mediante PCR, para objetivizar como diana, se propuso la unión de SSCmec / orfX, por parte de Huletsky et al (véase, a dicho efecto, J. Clin. Microbiol., 42: 1875 - 1884, 24). Puesto que, la mecA, reside en el SCCmee, la detección de la unión de SCCmee / orfX, se considera como siendo un sustituto para la detección del MRSA. Se encuentran comercialmente disponibles, en el mercado un gran número de ensayos de MRSA, los cuales están basados en el sitio específico de integración del SCCmec, en el orfX, a saber, los ensayos consistentes en los de la clase GENEXPERT, Cepheid, Sunnyvale, CA (véase, a dicho efecto, Rossney et al., J. Clin. Microbiol., 46 : 3285 - 329, 28), el ensayo IDI-MRSA (véase, a dicho efecto, Warren et al., J. Clin Microbiol., 42 : 5578 - 5581, 24), y el ensayo de MRSA consistente en el "Hain GENOQUICK MRSA assay", de la firma Hain Lifescience GmbH, Nehren, Dinamarca (véase, a dicho efecto, Sherlock et al., Clin. Microbiol. Infect. 16 : 955 - 959, 21). Poco después de la introducción de estos ensayos, se reportó la existencia de "falsos positivos". Esto sucede, cuando los ensayos identifican, como siendo MRSA-positivos, a los especímenes los cuales contienen únicamente cepas de S. aureus susceptibles a la meticilina (véase, a dicho efecto, Wong et al. J. Clin. Microbiol., 48 : 3525 - 3531, 21). Se conoce ahora el hecho consistente en que, los "falsos positivos", los cuales resultan en los ensayos de PCR de locus único o individual, son debidos a las eliminaciones del SCCmec.

En la presente revelación, se procede a extraer los ácidos nucleicos los cuales se encuentran presentes en una muestra de ensayo, obtenida a partir de un muestra biológica o de un tejido, del cual se sospeche que tenga los SA ó MRSA, de las muestras en cuestión, por mediación de procedimientos los cuales son conocidos en el arte especializado de la técnica. De una forma más específica,... [Seguir leyendo]

 


Reivindicaciones:

1.- Un procedimiento para la detección de estafilococos áureos resistentes a la penicilina ("MRSA"), en una muestra, la cual contiene ácidos nucleicos, comprendiendo, el procedimiento:

amplificar los ácidos nucleicos, en la muestra; y

detectar ácidos nucleicos, en la muestra, los cuales comprendan genes amplificados de mecA y Idh1, en donde, la presencia de genes amplificados de mecA y de Idh1, en un factor de relación de 1 : 1, indica la presencia de estafilococos áureos resistentes a la metlclllna.

2.- El procedimiento de la reivindicación 1, el cual comprende, de una forma adicional, la etapa de calcular las concentraciones, a tiempo real, de los genes amplificados de los mecA y Idh1, en donde, una diferencia de la concentración, Indica el hecho de una Infección mixta de Estafilicocos áureos y un soporte coagualasa - negativo del mecA, en la muestra.

3.- El procedimiento de la reivindicación 1, el cual comprende, de una forma adicional, la etapa de detectar ácidos nucleicos, en la muestra, que comprende por lo menos un gen específico de Estafilicocos áureos ("SA"), adicionalmente al Idh1.

4.- Un procedimiento para la detección de ácidos nucleicos de Estafilicocos áureos ("SA"), y de Estafilicocos áureos resistentes a la metlclllna ("MRSA"), en una muestra, mediante la utilización detección combinada de genes de Idh1 y de mecA, en la muestra, el cual comprende:

(a) contactar la muestra, con un primer cebador de aleta y un segundo cebador de aleta, que tienen la fórmula:

5-(X)n Y-3 (I),

en donde, X representa la porción 5 de los cebadores de aleta, la cual no es complementaria al gen Idh1, n es 1, Y representa la porción 3 de los cebadores de aleta, la cual es complementaria al ácido nucleico al gen Idh1, y X es de aprox. 3-3 nucleótldos de longitud,

b) contactar la muestra, después de la etapa (a), con un tercer cebador de aleta y un cuarto cebador de aleta, que tienen la fórmula:

5-(X)nY-3 (II),

en donde, X representa la porción 5 de los cebadores de aleta, la cual no es complementaria al gen mecA, n es 1, Y, representa la porción 3 de los cebadores de aleta, la cual es complementaria al gen mecA, y, X, es de aprox. 3 - 3 nucleótldos de longitud;

c) incubar la muestra, a continuación de las etapas (a) y (b), bajo unas condiciones, las cuales sean suficientes, como para amplificar los genes Idh1 y mecA, generando, y (d) detectar los genes Idh1 y mecA, amplificados.

5.- El procedimiento de las reivindicaciones 1 ó 4, en donde, el gen Idh1 amplificado, comprende la SEQ ID NO:1, y el gen mecA amplificado, comprende la SEQ ID NO:2

6.- El procedimiento de la reivindicación 4, en donde, X, es de aproximadamente 9 hasta aproximadamente 15 nucleótldos de longitud; y / o comprende la SEQ ID NO:3, AATAAATCATAA.

7.- El procedimiento de la reivindicación 4, en donde, Y, comprende una secuencia de SEQ ID NO:4,

GGT*GA*ACA*TGGTGACACTGAAT, en donde, T*, es 5-(4-hidroxi-but-1-inil)-1 H-pirimidin-2,4-diona y, A*, es 4-(4,6- Diamino-1 H-pirazolo[3,4-d]p¡rimid¡n-3-il)-but-3-in-1 -ol.; y / o una secuencia de SEQ ID NO:5,

GCGCTTT GCCCT CAGGACG.

8.- El procedimiento de la reivindicación 4, en donde, el primer cebador de aleta, comprende una primera secuencia de la SEQ ID NO:6, 5-AATAAATCATAAGGT*GA*ACA*TGGTGACACTGAAT-3 la cual tiene una primera secuencia subrayada, la cual no es complementaria a la secuencia del gen Idh1, en donde, T*, es 5-(4-hidroxi-but-1 -inil)-1 H- pirimidin-2,4-diona y, A*, es 4-(4,6-Diamino-1 H-pirazolo[3,4-d]pirimidin-3-il)-but-3-in-1 -ol, y en donde, el segundo cebador de aleta, comprende una segunda secuencia de la SEQ ID NO:7,

5AATAAATCATAAGCGCTTTGCCCTCAGGACG-3 la cual tiene una segunda secuencia, la cual no es complementarla a la secuencia del gen Idh1.

9.- El procedimiento de la reivindicación 4, en donde, el tercer cebador de aleta, comprende una tercera secuencia de la SEQ ID NO:8, GTGCGTTAATATTGCCATTATTTTCTAATGCG-3 (), en donde, n = , y en donde, el cuarto cebador de aleta, comprende una cuarta secuencia de la SEQ ID NO:9,

GGTTACGGACAAGGTGAAATAITGATTAACC-3, en donde, x es , e I es 3-alquinil-1 H-pirazolo[3,4-d]pirimidin- 4(5H)-ona.

1.- El procedimiento, según las reivindicaciones 1 ó 4, en donde, la muestra, es una muestra la cual procede de un animal, el cual es sospechoso de tener una Infección de MRSA, de una forma opcional, en donde, el animal, es un ser humano; y / o en donde, la muestra se recoge de una torunda de una herida, de una torunda nasofaríngea, de una torunda de la garganta, de una torunda rectal, o ésta se trata de una muestra de sangre, o de una muestra de las heces.

11.- El procedimiento de la reivindicación 4, en donde, los genes amplificados, se someten continuamente a un control de seguimiento, en la etapa de detección.

12.- El procedimiento de las reivindicaciones 1 ó 4, en donde, los genes mecA y Idh1 amplificados, se detectan mediante la hibridación a una sonda específica de mecA, ó una sonda específica de Idh1, de una forma opcional, en donde, las sondas, son sondas de generación de florescencia; y / o,

en donde, la sonda de generación de fluorescencia, especifica para el Idh1, comprende una secuencia de la SEQ ID NO:1, 5-Ra-G*ACATTACT*T*GA*ACAA*CG-Rb-5, en donde, Ra, es (M)a-FI ó (M)a-Q, M es un ligando de surco menor, a es ó 1, F1 es un fluoróforo con una longitud de onda de emisión, correspondiente a un valor comprendido dentro de unos márgenes situados entre los 4 nm y los 9 nm, Q es un extintor no fluorescente, T*, es 5-(4- hidroxi-but-1-inil)-1 H-pirimidin-2,4-diona, A*, es 4-(4,6-D¡am¡no-1H-p¡razolo[3,4-d]p¡r¡m¡d¡n-3-il)-but-3-in-1-ol, y G*, es 6-amlno-1H-pirazolo[3,4-d]pirimidin-4(5H)-ona, en donde, uno de las Ra ó Rb, comprende un fluoróforo, y la otra, comprende un extintor, y en donde, el extintor, permite la extinción de la fluorescencia, cuando la sonda se encuentra hibridada; y / o,

en donde, la sonda de generación de fluorescencia, específica para el mecA, comprende una secuencia de la SEQ ID NO:11, 5-Ra- G*AAAGGATCTGTACTGG*G-Rb-5, en donde, Ra, es (M)a-FI ó (M)a-Q, M es un ligando de surco menor, a es ó 1, F1 es un fluoróforo con una longitud de onda de emisión, correspondiente a un valor comprendido dentro de unos márgenes situados entre los 4 nm y los 9 nm, Q es un extintor no fluorescente, y G*, es 6- am¡no-1/-/-p¡razolo[3,4-d]pirimidin-4(5H)-ona, en donde, uno de las Ra ó Rb, comprende un fluoróforo, y la otra, comprende un extintor, y en donde, el extintor, permite la extinción de la fluorescencia, cuando la sonda no se encuentra hibridada.

13 - El procedimiento de las reivindicaciones 1 ó 4, en donde, los genes mecA y Idh1, amplificados, se detectan mediante cebadores marcados, específicos para el mecA, ó mediante cebadores marcados, específicos para el Idh1, de una forma opcional, en donde, los cebadores, son cebadores de generación de fluorescencia; y / o, el cual comprende, de una forma opcional, la etapa de detectar ácidos nucleicos, en la muestra, comprendiendo por lo menos un sitio de integración o región puente de SSCmec, amplificado.

14.- El procedimiento de la reivindicación 4, en donde, la etapa de detección, comprende, de una forma adicional, el proceder a calcular, las concentraciones de los genes mecA y Idh1 amplificados, a tiempo real, y en donde, una diferencia en la concentración, la cual sea mayor o Igual a 2, indica el hecho de la existencia de una Infección mixta de Estafilococos áureos y un portador de mecA, en la muestra.