Cepa del virus hemorrágico de conejo (RHDV).

Cepa del virus hemorrágico del conejo (RHDV).

El objeto de la presente invención es una nueva cepa del virus que produce la enfermedad hemorrágica del conejo

, RHD, y de una vacuna basada en la nueva cepa inactivada, de composiciones farmacéuticas que comprenden la vacuna, así como de su uso en profilaxis. La presente invención también está relacionada con un procedimiento para la preparación de la vacuna.

Tipo: Patente de Invención. Resumen de patente/invención. Número de Solicitud: P201330779.

Solicitante: ORGANIZACIÓN INTERPROFESIONAL PARA IMPULSAR EL SECTOR CUNÍCOLA - INTERCUN.

Nacionalidad solicitante: España.

Inventor/es: PARRA FERNANDEZ, JOSE FRANCISCO, DALTON,Kevin Paul, RODRÍGUEZ SERRANO,Tomás Miguel.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > C12N7/00 (Virus, p. ej. bacteriófagos; Composiciones que los contienen; Su preparación o purificación (preparaciones de uso médico que contienen virus A61K 35/76; preparación de composiciones de uso médico que contienen antígenos o anticuerpos virales, p. ej. vacunas virales, A61K 39/00))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/12 (Antígenos virales)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Virus, p. ej. bacteriófagos; Composiciones que los... > C12N7/06 (por tratamiento químico)

PDF original: ES-2523791_A1.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Cepa del virus hemorrágico de conejo (RHDV)

La presente invención está relacionada con el campo de la veterinaria en general y 5 específicamente con la inmunología. En particular, la presente invención se refiere a una nueva cepa del virus hemorrágico de conejo y a una vacuna que incluye dicha cepa así como a las aplicaciones derivadas de su uso como inmunógeno.

ESTADO DE LA TÉCNICA 10

La enfermedad hemorrágica de conejo (RHD - rabbit haemorrhagic disease) es una enfermedad de origen viral, altamente infecciosa y con un porcentaje de mortalidad muy alto, que afecta a los conejos tanto salvajes como domésticos. Las primeras descripciones de animales contagiados por este virus se remontan a 1984 en la 15 provincia de Jiangsu, en China. Desde entonces, se han descrito múltiples epidemias en varios países europeos, entre ellos España, Francia, Alemania o Italia, así como en varios países africanos y asiáticos. La infección produce grandes pérdidas económicas en el sector agropecuario.

La enfermedad, en su forma clásica, afecta primordialmente a conejos adultos. Los conejos lactantes parecen no ser susceptibles a la infección por un mecanismo desconocido. El período de incubación de la enfermedad es de 2-3 días, y la mortalidad puede llegar a ser del 90%. Los signos clínicos en animales infectados son fiebres altas, convulsiones, anorexia, y en ocasiones incoordinación, y problemas 25 respiratorios. Un porcentaje pequeño de animales infectados desarrollan un curso crónico de la enfermedad en el que se detecta ictericia, pérdida de peso y letargia, y que acaba con la muerte del animal en 1 o 2 semanas desde la infección. El análisis patológico de los animales infectados revela hemorragias internas a nivel de corazón, traquea, pulmón, hígado y riñón. 30

El virus que causa la RHD, denominado de aquí en adelante RHDV, pertenece al género Lagovirus, y a la familia Caliciviridae. El genoma del virus ha sido clonado y secuenciado en su totalidad. Es un virus de RNA de cadena única y de sentido positivo, de 7.4Kb de longitud. El genoma del virus tiene dos marcos de lectura (Open 35

Reading Frame - ORF) . El primero de ellos (ORF1) , que abarca la mayor parte del genoma, codifica una poliproteína de gran tamaño que tras su autoprocesamiento proteolítico da lugar a las proteínas no estructurales y a la proteína mayoritaria de la cápside que deriva de su región carboxilo terminal. La proteína de la cápside se denomina VP60 (la nomenclatura actualizada para esta proteína es VP1) porque tiene 5 una masa molecular aproximada de 60 KDa. Su secuencia se utiliza para determinar la filogenia y el parentesco entre las diferentes cepas conocidas del RHDV, así como la relación con otros virus relacionados. La tipificación del virus se realiza mediante técnicas inmunológicas utilizando anticuerpos monoclonales específicos, así como la aglutinación de los glóbulos rojos de la sangre humana. Se comprueba que algunos 10 calicivirus, incluidos los norovirus humanos y el RHDV, se unen a los antígenos del glóbulo rojo que determinan el grupo sanguíneo, pero el patrón varía entre las diferentes cepas (Nystrom et.al. "Histo-bood group antigens act as attachment factors of rabbit hemorrhagic disease virus infection in a virus strain-dependent manner" PLoS Pathol. 2011, vol. 7, pp. 1-22) . 15

La RHD se combate a nivel profiláctico mediante la vacunación preventiva de los animales (ver por ejemplo EP2034012B1) . Hasta el momento presente el RHDV no ha podido ser cultivado de forma reproducible en una línea celular de laboratorio, de ahí que el genoma del virus y los viriones que se utilizan para fabricar las vacunas 20 provengan de infecciones experimentales controladas en el laboratorio. Actualmente existen numerosas vacunas comerciales. Estas vacunas consisten en virus inactivados preparados a partir de extractos de hígado de animales infectados experimentalmente. El virus de estos extractos puede ser inactivado térmicamente o químicamente.

El virus RHDV, como la mayoría de los virus con genoma de RNA, tiene una tasa de mutación alta, lo que dificulta que una única vacuna proteja a toda la población y sea efectiva a lo largo del tiempo. En términos generales, las vacunas existentes protegen a los animales de las infecciones causadas por las variantes descritas hasta 2010, pero parecen no tener suficiente capacidad de protección contra otras cepas 30 circulantes en la actualidad.

Recientemente, se han detectado variantes nuevas del virus en diferentes puntos del continente europeo (ver por ejemplo Le Gall-Reculé G., et.al. "Detection of a new variant of rabbit haemorrhagic disease virus in France", Veterinar y Record 2011, vol. 35

168, pp. 137-138) . Se comprueba en esta última referencia que estas variantes nuevas parecen haber desarrollado una antigenicidad e inmunogenicidad diferente, lo que las lleva en numerosos casos a ser mortales incluso en animales previamente vacunados con vacunas basadas en cepas conocidas (Dalton KP. et. al. "Variant rabbit hemorrhagic disease virus in young rabbits, Spain" Emerg. Inf. Dis. 2012, vol. 18, pp. 5 2009-2012) . Es decir, las vacunas actualmente disponibles parecen no tener suficiente efectividad contra las infecciones de estas nuevas cepas del RHDV.

Así, existe la necesidad urgente de tener nuevas herramientas con las que hacer frente a las nuevas variantes del virus RHDV. 10

EXPLICACIÓN DE LA INVENCIÓN

La presente invención está relacionada con una nueva cepa del virus RHDV. En particular, los inventores han comprobado que esta nueva cepa tiene un 15 comportamiento funcional y un patrón infectivo diferente a otras variantes que han sido descritas en el estado de la técnica. Se ha comprobado que esta nueva cepa es capaz de infectar y producir tasas de mortalidad superiores al 50% en gazapos menores de 40 días de edad y que tiene un tropismo diferente ya que se replica y produce daños a nivel intestinal además de los órganos típicos afectados por otras cepas conocidas del 20 RHDV como son los pulmones, el hígado o el riñón. Adicionalmente, se ha comprobado que esta cepa tiene un patrón de aglutinación de glóbulos rojos diferente a las variantes conocidas. Así, las cepas descritas en la técnica aglutinan glóbulos rojos humanos del grupo 0, mientras que la cepa que es objeto de la presente invención no aglutina dicho grupo sanguíneo. Notablemente, esta nueva cepa, 25 denominada por los inventores como RHDV-N11, y cuya secuencia nucleotídica se encuentra representada según la SEQ ID NO:1 (representada también en la Tabla 1, abajo) , provoca una alta tasa de mortalidad incluso en conejos que han sido vacunados con las vacunas comerciales existentes en la actualidad.

Tabla 1. SEQ ID:1 del RHDV-N11.

GTGAAAATTATGGCGGCTATGTCGCGCCTTACTGGCATGACAACTGCTATTCTCCCAGTAAAGAAACCCT

TAAGTTTCTTCCTGGACCTCAGGGACAAGACCCCTCCCTGTTGTACTCGGGCACCCGGGAAACTGGCTTG

GCCAGTCTTCCTGGAACAAAACGGAAAAGAAGGACCTCTGGAGACATGTGACAAATGTGGCAAATGGCTT

AACGGCTTTGGTACTTTCGGACTAGAGGATCTCGGTGATGTCTGCTTGTGCTCCGTGACCAAACAGCAAC

ACAAATTTGGACCCACTTGTTTGTGTAACCGTGCATACATACACGACTGCGGCCGCTGGCGGCGCCGCAG

TCGTTTTCTTAAACACTACAAGGCATTGAACAAAGTCATCCCCTGTGCTTACCGATTCGGTGAAGGAGCC

CCCACCCCCGTCTTTGAGGGCGAGGTTGATGACTTGTTTATTGAGCTCGGGGCACCAACCAGCATGGGCT

TTATGGACAAGAAACTGCTTAAGAAAGGTAAGAAACTGATGGACAAGTTTGTTGATGTTGATGAGCCCTG

CCTGACATCAAAGGACGCCAACCTTCTCGACTCCATCGCTTCTGACAGCACCATACGCGCGAAGCTGGAG

GAGGAGTATGGTGTTGAGATGGTGCAGGCAGCACGAGACAGGAAAGACTTTATGAGGAACCTCAGACTTG

CTTTAGATAACCGGCCCGCTAACCCTATGACTTGGTACACCAGACTTGGCAATATCACGGTAAAAGGAAA

ACAGTGGGCAAAGAAGATTGTTTATGGTGTCCATAGAGTTACTGACCCACTGAAGACGTTGGCCTCAATC

TTATTGGTTGGCCTCCACAACGCTATTGCTGTGGACACAACAGTGATGCTGTCAACGTTTAAACCTGTAA... [Seguir leyendo]

 


Reivindicaciones:

1. Cepa del virus de la enfermedad hemorrágica del conejo depositada en la European Collection of Cell Cultures (ECACC) , Centre for Emergency Preparedness and Response, Porton Down, Salisbur y , SP4 OJG, Reino Unido con el número de depósito 5 13011501.

2. Cepa de virus según la reivindicación 1, en forma inactivada.

3. Cepa de virus según la reivindicación 2, en donde la inactivación del virus se realiza 10 mediante tratamiento químico.

4. Cepa de virus según la reivindicación 3, en donde la inactivación del virus mediante tratamiento químico se realiza con un agente seleccionado del grupo que consiste en [beta]-propiolactona y formaldehído. 15

5. Cepa de virus según la reivindicación 4 depositada en la European Collection of Cell Cultures (ECACC) , Centre for Emergency Preparedness and Response, Porton Down, Salisbur y , SP4 OJG, Reino Unido con el número de depósito 13042401.

6. Vacuna que comprende una cantidad inmunogénicamente efectiva de la cepa según cualquiera de las reivindicaciones 2-5 junto con un excipiente veterinariamente aceptable.

7. Vacuna según la reivindicación 6, que además comprende al menos un adyuvante 25 veterinariamente aceptable.

8. Vacuna según las reivindicaciones 6-7, en donde la vacuna es adecuada para su administración por vía intramuscular.

9. Vacuna según cualquiera de las reivindicaciones 6-8 para su uso como medicamento.

10. Vacuna para el uso según la reivindicación 9, donde el medicamento está destinado a la prevención de la enfermedad hemorrágica del conejo. 35

11. Cepa del virus según cualquiera de las reivindicaciones 2-5 para su uso como inmunógeno.

12. Método para preparar la composición de una vacuna según cualquiera de las 5 reivindicaciones 6-8, que comprende:

a) obtener una muestra de la cepa del virus de la enfermedad hemorrágica del conejo según la reivindicación 1;

b) inactivarla; y c) añadirle excipientes y opcionalmente adyuvantes veterinariamente aceptables para 10 dar un producto final administrable.

13. Método según la reivindicación 12, en donde en la etapa b) la inactivación del virus se realiza por tratamiento químico.

14. Método según la reivindicación 13, en donde la inactivación química se realiza mediante tratamiento con [beta]-propiolactona o formaldehído.