Inventos patentados en España.

Inventos patentados en España.

Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2013.

CEBADORES, SONDAS, PROCEDIMIENTOS Y USOS DE LOS MISMOS PARA LA DETECCIÓN DE MYCOBACTERIIUM KANSASII.

Patente Internacional (Tratado de Cooperación de Patentes). Resumen:

Un oligonucleótido específico de Mycobacterium kansasii para la detección de Mycobacterium kansasii que comprende una secuencia de nucleótidos representada en la SEQ ID Núm

. 1 o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos.

Solicitante: WAKO PURE CHEMICAL INDUSTRIES, LTD.

Nacionalidad solicitante: Japón.

Dirección: 1-2, DOSHOMACHI 3-CHOME, CHUO-KU OSAKA-SHI, OSAKA 540-8605 JAPON.

Inventor/es: ISHIKAWA, TOMOKAZU.

Fecha de Publicación de la Concesión: 3 de Mayo de 2011.

Fecha Solicitud PCT: 11 de Mayo de 2006.

Clasificación Internacional de Patentes: C12Q1/04 (..Determinación de la presencia o del tipo de microorganismo; Empleo de medios selectivos para la investigación o análisis de antibióticos o bactericidas; Composiciones para este fin que contienen un indicador químico [3]), C12Q1/68M10B, G01N33/569D4.

Clasificación PCT: C12N15/09 (.Tecnología del ADN recombinante [5]), C12Q1/68 (.en los que intervienen ácidos nucleicos [3]), C12Q1/04 (..Determinación de la presencia o del tipo de microorganismo; Empleo de medios selectivos para la investigación o análisis de antibióticos o bactericidas; Composiciones para este fin que contienen un indicador químico [3]).

Países PCT: Austria, Bélgica, Suiza, Alemania, Dinamarca, España, Francia, Reino Unido, Grecia, Italia, Liechtensein, Luxemburgo, Países Bajos, Suecia, Mónaco, Portugal, Irlanda, Eslovenia, Finlandia, Rumania, Chipre, Lituania, Letonia.

Volver al resumen de la patente.

Ilustración 1 de CEBADORES, SONDAS, PROCEDIMIENTOS Y USOS DE LOS MISMOS PARA LA DETECCIÓN DE MYCOBACTERIIUM KANSASII.
Ilustración 2 de CEBADORES, SONDAS, PROCEDIMIENTOS Y USOS DE LOS MISMOS PARA LA DETECCIÓN DE MYCOBACTERIIUM KANSASII.
Ilustración 3 de CEBADORES, SONDAS, PROCEDIMIENTOS Y USOS DE LOS MISMOS PARA LA DETECCIÓN DE MYCOBACTERIIUM KANSASII.
Descripción:

CAMPO TÉCNICO

La presente invención se refiere a un procedimiento para detectar y/o identificar M. kansasii (Mycobacterium kansasii, en adelante descrita M. kansasii) a través del uso de amplificación de ácido nucleico y un sistema de detección del mismo en un ensayo clínico de laboratorio.

ANTECEDENTES DE LA INVENCIÓN

Mycobacterium no tuberculosa (NTM) es un bacilo gram positivo que tiene características de ácido-alcohol resistentes clasificado en el género Mycobacterium, y es un tipo de bacteria ácido-alcohol resistente distinta al complejo de tuberculosis y Mycobacterium leprae.

Entre la mycobacterium no tuberculosa, es sabido que la cepa bacteriana clínicamente problemática incluye Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium gordonae, Mycobacterium szulgai, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium xenopi, Mycobacterium fortuitum, Mycobacterium chelonei, Mycobacterium abscessus, y etc. En particular, las enfermedades infecciosas afectadas por 2 tipos de bacterias, M. kansasii y complejo M. avium, representan el 90% o más de la totalidad de las enfermedades por mycobacterium no tuberculoso.

En general, se sostiene que la mycobacterium no tuberculosa es inofensiva para un individuo saludable, sin embargo, en ocasiones poco frecuentes, puede infectar a seres humanos y causar enfermedades por mycobacterium no tuberculosa. Particularmente, en los individuos inmunocomprometidos tales como pacientes infectados con el virus del SIDA puede ser un agente causativo de infecciones serias. En el pasado, las enfermedades por mycobacterium no tuberculosa han sido un trastorno poco frecuente, sin embargo, en los últimos años, la incidencia de infección demuestra una tendencia en alza, y, por lo tanto, se ha deseado ampliamente el desarrollo de un procedimiento para discriminar bacterias tuberculosas de mycobacterium no tuberculosa en un período de tiempo breve. Además, dado que el procedimiento para detectar/diagnosticar M. avium y M. intracellulare por amplificación de ácido nucleico ha sido aprobado para su inclusión en la cobertura del seguro médico y después se ha propagado rápidamente por el país, su significancia diagnóstica es, por supuesto, muy grande.

Dado que la mayoría de las mycobacteria no tuberculosas tienen una resistencia a agentes antituberculosos, cuando se sospecha que un paciente tiene una infección por una bacteria ácido-alcohol resistente, la diferencia en el diagnóstico referente a si la enfermedad es una enfermedad por mycobacterium tuberculosa o no tuberculosa será muy importante a la hora de decidir el curso del tratamiento. Además, ya que el procedimiento para el tratamiento de las enfermedades causadas por mycobacteria no tuberculosas puede variar para cada tipo de bacteria, la identificación de las especies bacterianas también será muy importante. Sin embargo, dado que la enfermedad por mycobacterium no tuberculosa no tiene un síntoma clínico específico, es muy difícil diferenciar la enfermedad por mycobacterium tuberculosa de la enfermedad por mycobacterium no tuberculosa por observación clínica y manifestación histopatológica, más aún lo es especificar las especies de la mycobacterium no tuberculosa. Por lo tanto, el diagnóstico referente a si la enfermedad es una enfermedad por mycobacterium tuberculosa o no tuberculosa debe llevarse a cabo por la identificación de la bacteria infectada.

En un diagnóstico típico, en primer lugar, se examina el frotis del esputo. Mediante este ensayo, puede reconocerse únicamente “la bacteria ácido-alcohol resistente positiva", y no puede lograrse la diferenciación de la bacteria tuberculosa de la mycobacterium no tuberculosa. Por lo tanto, cuando el examen del frotis del esputo es positivo, se lleva cabo un examen de un cultivo bacteriano por cultivo en aislamiento sobre un medio de cultivo especificado tal como medio de Ogawa para diferenciar la bacteria tuberculosa de la mycobacterium no tuberculosa. Además, a través de exámenes químicos adicionales, se identifica la especie de la bacteria. Sin embargo, en general, el crecimiento de la bacteria perteneciente al género Mycobacterium es lento, y su cultivo lleva un tiempo considerable. Por consiguiente, en los procedimientos básicos del procedimiento convencional que incluye examen del esputo y examen del cultivo, el resultado del diagnóstico por parte del cultivo en aislamiento que informa si la bacteria es tuberculosa o no, demora de 3 a 4 semanas. Además, existe otro problema, dado que requiere de 2 a 3 semanas adicionales para completar varios ensayos bioquímicos para la identificación de especies bacterianas.

Además, la identificación de M. kansasii también se lleva a cabo por ensayos bioquímicos. En el procedimiento principal para identificar M. kansasii por ensayos bioquímicos, se utiliza la propiedad específica para producir pigmentos cuando la bacteria se expone a la luz. Sin embargo, dado que otras especies pertenecientes al género Mycobacterium muestran las mismas propiedades que M. kansasii, la identificación de M. kansasii por su propiedad de coloración es en general problemática.

En los años recientes, se han desarrollado tecnologías para detectar bacterias a un nivel genético. Por ejemplo, se ha estudiado como un medio útil una técnica de diagnóstico que utiliza tecnología de amplificación de ácido nucleico tal como reacción en cadena de la polimerasa (PCR). Este procedimiento tiene ventajas de alta sensibilidad; varias células de las bacterias son suficientes para la detección; la detección puede completarse en un período de tiempo breve (de 4 días como máximo). Sin embargo, en el procedimiento de PCR usual, se detectan por igual tanto células vivas como células muertas. Además, dado que el procedimiento se juzga positivo independientemente del tamaño del recuento de bacterias, y que el número de las bacterias es desconocido, el diagnóstico de si la infección es positiva o no se proporcionará con incertidumbre. Además, el procedimiento tiene un problema, dado que cuenta con una sensibilidad demasiado alta, existe la posibilidad de falsos juicios positivos.

Respecto a M. kansasii, existe un estudio que informa que se obtuvo una sonda de ADN (pMKI-9) a partir de una librería genómica de M. kansasii (Documento de No Patente 1). Esta sonda de ADN (pMK1-9) puede formar un híbrido complementario con el ADN de M. kansasii, pero esta sonda también puede formar un híbrido con otras especies de mycobacteria, y no es específica a M. kansasii.

Asimismo, existe un estudio focalizado en el uso de una sonda de ADN comercialmente disponible (ACCUPROBE™, GenProbe, San Diego, CA) que puede hibridizarse específicamente con la sonda pMK1-9 y el gen de ARNr de M. kansasii para la identificación de M. kansasii (Documento de No Patente 2). Sin embargo, en este estudio, se ha informado que tanto la sonda pMK1-9 como la sonda de ADN comercialmente disponible (ACCU-PROBE™) fueron incapaces de detectar un número considerable de tipos de cepa de M. kartsasii.

Además, existe otro estudio en el que se evaluó la sonda de ADN comercialmente disponible (ACCUPROBE™) para la detección de M. kansasii (Documento de No Patente 3). Los investigadores de este estudio informaron que si bien ACCU-PROBE™ es 100% especie específico, y no muestra ninguna reacción cruzada con otras especies de M. kansasii, sólo podría detectarse en este experimento un 73% de las especies de M. kansasii.

Existe un informe que describe que una sonda de formación de ADN híbrido (p6123) específica a M. kansasii se ha purificado con un aislado clínico de M. kansasii (Documento de No Patente 4). La sonda (p6123) fue capaz de hibridizarse con todas las cepas de M. kansasii utilizadas en este experimento que incluyen un subgrupo que no reaccionó con una sonda de ADN (pMK1-9) informado por Ross et al. La Patente de los Estados Unidos Núm.

5.500.341 (Documento de Patente 2) ha desvelado un cebador de amplificación específico de M. kansasii purificado con una sonda p6123.

Además, B. Boddinghaus et al. han desvelado un oligonucleótido específico de Mycobacterium purificado con ARNr 16S, que específica se prolifera e hibridiza con ADN de mycobacterium (Documento de No Patente 5).

Además, por ejemplo, también se ha estudiado la identificación de la región del ADN efectiva para detectar M. kansasii (por ejemplo, Documento de Patente 1), sin embargo, la presente situación indica no se ha establecido el procedimiento de diagnóstico específico de M. kansasii.

De acuerdo con lo descrito con anterioridad, la presente situación indica que se desea el establecimiento de un nuevo procedimiento específico para detectar mycobacterium no tuberculosa.

Documento de Patente 1: JP-A-11-155589;

Documento de Patente 2: la Patente de los Estados Unidos Núm. 5.500.341;

Documento de Patente 3: JP-A-60-281;

Documento de No Patente 1: Z. H. Huang et. al., J. Clin. Microbiol., 1991, 29, p.2125;

Documento de No Patente 2: B. C. Ross et al., J. Clin. Microbiol., 1992, 30, p.2930;

Documento de No Patente 3: Tortoli et al., Eur. J. Clin. Microbiol. Infect. Dis., 1994, 13, p.264;

Documento de No Patente 4: M. Yang et al., J. Clin. Microbiol., 1993, 31, p.2769;

Documento de No Patente 5: B. Boddinghaus et al., J. Clin. Microbiol., 1990, 28, p.1751;

Documento de No Patente 6: F. Poly et al., J. Bacteriology, 2004, 186, 14, p.4781-4795.

DESVELACIÓN DE LA INVENCIÓN

PROBLEMAS A SER RESUELTOS POR LA INVENCIÓN

La presente invención se llevó a cabo en vista de la situación descrita con anterioridad, y un objetivo de la misma es proporcionar un nuevo cebador para detectar M. kansasii que pueda excluir cualquier falso resultado positivo para el diagnóstico; y proporcionar un procedimiento para detectar M. kansasii en forma más simple, rápida y con alta precisión.

MEDIOS PARA RESOLVER LOS PROBLEMAS

La presente invención se llevó a cabo con el propósito de resolver los problemas descritos con anterioridad, y comprende los siguientes aspectos:

(1) Un oligonucleótido específico de Mycobacterium kansasii para la detección de Mycobacterium kansasii que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1 o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos.

(2) Un cebador para detectar Mycobacterium kansasii, que comprende

un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada a partir de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1, y en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii.

(3) Una sonda para detectar Mycobacterium kansasii, que comprende

un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o

una secuencia de oligonucleótidos que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1,

y en el que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii.

(4) Un procedimiento para detectar Mycobacterium kansasii que comprende utilizar un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm.1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1, y en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos de Mycobacterium kansasii, como un cebador, y/o

un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm.1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm.1, y

en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos de Mycobacterium kansasii, como una sonda.

(5) Un kit para detectar Mycobacterium kansasii, que comprende

un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en SEQ ID Núm. 5 a 12, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 como un cebador, y/o

un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80 como una sonda, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii, como un cebador y/o una sonda.

(6) Uso de un oligonucleótido para diseñar un cebador o una sonda para la detección de Mycobacterium kansasii, en el que oligonucleótido comprende una secuencia de nucleótidos representada en la SEQ ID Núm.1, o una

40

45

secuencia complementaria a la secuencia de nucleótidos, y que es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii.

Los inventores de la presente han llevado a cabo verificaciones teóricas y experimentales de homología genética entre especies con respecto a los genes establecidos de varias especies que incluyen M. kansasii y otros organismos vivos, y han descubierto la presencia de una secuencia de nucleótidos en los fragmentos de ácido nucleico derivados de M. kansasii obtenidos por el procedimiento que utiliza técnicas de micromatriz, que hibridiza específicamente con una región particular de la secuencia de genes de M. kansasii y que puede ser útil para la detección de M. kansasii.

Por lo tanto, sobre la base de estos hallazgos, los inventores de la presente han estudiado intensivamente y obtuvieron un oligonucleótido específico con M. kansasii (la secuencia de nucleótidos representada en la SEQ ID Núm. 1), y hallaron utilidad de estas secuencias de nucleótidos para la detección de M. kansasii. Con base en estas secuencias, se ha desarrollado un cebador y una sonda para detectar M. kansasii, y por el uso de este cebador y sonda, se ha establecido un procedimiento para detectar M. kansasii.

EFECTO DE LA INVENCIÓN

De acuerdo con el procedimiento para detectar M. kansasii por el uso del cebador y/o sonda de la presente invención, M. kansasii puede detectarse y diagnosticarse con más rapidez y con alta precisión en comparación con un procedimiento de identificación bacteriana convencional por examinación de cultivos. Además, mediante la detección por el uso del procedimiento de la presente invención, puede excluirse cualquier falso resultado positivo para el diagnóstico en comparación con el diagnóstico llevado a cabo por PCR por el uso de un cebador y/o una sonda convencional, y como un resultado, M. kansasii puede detectarse y diagnosticarse con alta precisión. Además, por el uso del procedimiento de detección de la presente invención, también pueden cuantificarse las células de M. kansasii.

BREVE DESCRIPCIÓN DE LAS FIGURAS

La Fig. 1 muestra una secuencia de nucleótidos del clon candidato 1, y la posición en la que se ubica el cebador designado se indica por una flecha.

La Fig. 2 es un diagrama de dispersión producido con base en la intensidad fluorescente de Cy3/Cy5, obtenida por el uso del producto de PRC producido por el uso de un genoma derivado de M. kansasii en el Ejemplo Experimental 1, una secuencia KATS2 de M. kanrasii, y una secuencia mostrada como la SEQ ID Núm. 8 en la descripción de la Solicitud JP Núm. 2004-129272 (en la presente descripción, mostrada como la SEQ ID Núm. 81).

La Fig. 3 muestra los resultados de la electroforesis obtenidos en el Ejemplo 1. Además, las letras dispuestas en cada hilera indican los resultados cuando se utilizan las siguientes muestras: M4: marcador del peso molecular (Marcador 4); a: Escherichia coli; b: Mycobacterium tuberculosis; c: Mycobacterium kansasii; d: Mycobacterium marinum; e: Mycobacterium simiae; f: Mycobacterium scrofulaceum; g: Mycobacterium gordonae; h: Mycobacterium szulgai; i: Mycobacterium avium; j: Mycobacterium intracellulare; k: Mycobacterium gastri; l: Mycobacterium xenopi; m: Mycobacterium nonchromogenicum; n: Mycobacterium terrae; o: Mycobacterium triviale; p: Mycobacterium fortuitum; q: Mycobacterium chelonei; r: Mycobacterium abscessus; s: Mycobacterium peregrinum.

La Fig. 4 muestra los resultados de la detección llevada a cabo por PCR en tiempo real en el Ejemplo 2, que es una curva estándar creada por el trazado del valor Ct (eje de Y) por el número de copias del genoma (eje de X, escala logarítmica) de cada muestra de ADN para PCR.

EXPLICACIÓN DE LAS LETRAS O NÚMEROS

En la Fig. 2, cada símbolo indica el siguiente significado:

(1): Clon candidato considerado poseedor de una alta especificidad para M. kansasii;

(2): Los resultados obtenidos por el uso de la secuencia KAS de M. kansasii descrita en JP-A-11-155589;

(3): Los resultados obtenidos por el uso de la SEQ ID Núm. 8 (idéntica a la SEQ ID Núm. 81 de esta memoria) derivada de M. tuberculosis descrita en la descripción de la Solicitud JP Núm. 2004-129272.

(a): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 10,0;

(b): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 5,0;

(c): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 2,0;

(a'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 10,0;

(b'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 5,0; (c'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 2,0.

MEJOR MODO PARA LLEVAR A CABO LA INVENCIÓN

En la presente invención, el gen de M. kansasii se refiere a una unidad arbitral de la secuencia de nucleótidos (una región) en la totalidad de la secuencia genómica propiedad de Mycobacterium kansasii. Aún no se ha completado la totalidad de la secuencia genómica de M. kansasii.

Un oligonucleótido de la presente invención incluye un oligonucleótido que comprende una parte o la totalidad de la secuencia de una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de M. kansasii (en adelante, opcionalmente denominado en pocas palabras “el oligonucleótido de la presente invención").

En cuanto al tamaño de los oligonucleótidos de la presente invención, un oligonucleótido que tiene la secuencia de nucleótidos representada en la SEQ ID Núm. 1 tiene 517 bases.

El oligonucleótido que comprende una parte o la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1 de la presente invención incluye, por ejemplo, (1) un oligonucleótido que comprende una secuencia de nucleótidos que comparte homología con la secuencia de nucleótidos representada en la SEQ ID Núm. 1, en aproximadamente 70% o más, con preferencia, aproximadamente 80% o más, con más preferencia, aproximadamente 90% o más, aún con más preferencia, aproximadamente 95% o más, o (2) un oligonucleótido que comprende una cantidad consecutiva de 10 o más bases, preferentemente 20 o más bases entre la secuencia representada en la SEQ ID Núm. 1.

El oligonucleótido que comprende una parte de la secuencia de nucleótidos representada en la SEQ ID Núm. 1 incluye un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 y 53 a 56, y comprende 10 o más bases consecutivas.

Un ejemplo específico del nucleótido que comprende la parte de la secuencia de nucleótidos representada en la SEQ ID Núm. 1 incluye, por ejemplo, el oligonucleótido que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 o SEQ ID Núm. 53 a 56.

El oligonucleótido que comprende una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1 de la presente invención incluye, por ejemplo, un oligonucleótido que comprende una parte de la totalidad de la secuencia de una secuencia de nucleótidos con capacidad de hibridizarse con el oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 1 de la presente invención.

El oligonucleótido descrito con anterioridad que comprende la parte o la totalidad de la secuencia de la secuencia de nucleótidos con capacidad de hibridizarse con el oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 1 de la presente invención incluye, en particular, un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos con capacidad de hibridizarse bajo una condición altamente estricta o bajo una condición estricta con el oligonucleótido de la presente invención que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 1.

En este sentido, "condición altamente estricta" significa una condición bajo la que, específicamente, por ejemplo, la hibridación se lleva a cabo en formamida 50% de 42 a 70°C, preferentemente de 60 a 70°C, seguido por el lavado en dodecil sulfato de sodio 0,1% (SDS) de 25 a 70°C en 0,2 a 2 x SSC.

Además, "condición estricta" significa una condición bajo la que, específicamente, por ejemplo, la hibridación se lleva a cabo en 6 x SSC o la solución de hibridación con la concentración salina equivalente bajo la temperatura de 50 a 70°C durante 16 horas, y después prelavado, en caso de ser necesario, con 6 x SSC o la solución con la concentración salina equivalente, y seguido por el lavado con 1 x SSC o la solución con la concentración salina equivalente.

Un oligonucleótido con capacidad de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii en la presente invención incluye un oligonucleótido que comprende una secuencia de nucleótidos con capacidad de hibridación bajo una condición altamente estricta o una condición estricta con la secuencia de nucleótidos del gen de M. kansasii de acuerdo con lo descrito con anterioridad. La condición altamente estricta o la condición estricta son lo descrito con anterioridad.

El oligonucleótido que comprende la parte de la secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1 incluye "un oligonucleótido que comprende la parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 y 53 a 56, y 10 o más bases consecutivas".

El ejemplo específico del oligonucleótido que comprende la parte de la secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1 incluye un oligonucleótido que comprende la secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 y 53 a 56.

Además, el oligonucleótido de la presente invención puede ser ácido desoxirribonucleico (ADN) o ácido ribonucleico (ARN). En el caso del ácido ribonucleico, no hace falta decir que el residuo de timidina (T) puede leerse como un residuo de uridina (U). Además, puede utilizarse el ADN que comprende un residuo de uridina sintetizado por el intercambio de T en posición arbitral por U. También, puede utilizarse el ARN que comprende un residuo de timidina sintetizado por el intercambio de U en posición arbitral por T. Además, puede observarse la eliminación, inserción o reemplazo de uno o varios nucleótidos, o un nucleótido modificado tal como inosina (I).

Para obtener el oligonucleótido de la presente invención, puede utilizarse el producto preparado por el procedimiento de síntesis química bien conocido en la técnica per se. Por lo tanto, es posible obtener fácilmente un oligonucleótido con calidad constante, a gran escala a un costo bajo en comparación con un procedimiento de clonación para obtener un oligonucleótido o un polinucleótido.

Por ejemplo, por el uso de un sintetizador de ADN normalmente utilizado para la síntesis de ADN, un oligonucleótido se sintetiza de acuerdo con el procedimiento de fosfoamidita convencional, y se purifica por el procedimiento convencional de la cromatografía en columna de intercambio iónico. Y, así, puede obtenerse un oligonucleótido objetivo de la presente invención.

Otros medios de evaluación de un oligonucleótido de acuerdo con el propósito de la presente invención incluyen el procedimiento de sustracción descrito en FEMS Microbiology Letters 166: 63-70, 1998 o Systematic and Applied Microbiology 24: 109-112, 2001. Ésta es una metodología de concentración de una secuencia candidata por la sustracción de una secuencia de nucleótidos que reacciona con un fragmento de ADN genómico derivado de especies de organismos a diferenciar.

Además, de acuerdo con lo descrito en JP-A-11-155589 (Documento de Patente 1), puede considerarse un enfoque a través de la preparación de una exposición diferencial de productos de amplificación a partir del ADN genómico diana y un ADN genómico derivado de especies de organismos a diferenciar, esto es, la metodología por el uso de la reacción en cadena de la polimerasa arbitrariamente cebada (AP-PCR).

Además, por el uso del denominado procedimiento de micromatriz, también puede obtenerse el oligonucleótido de la presente invención. Esto significa que, por ejemplo, se prepara un clon azaroso del ADN genómico de M. kansasii, y después el ADN purificado derivado del clon azaroso se presenta sobre un portaobjetos de vidrio para formar una micromatriz. Sobre el costado, se prepara un fragmento de ADN genómico fluorescentemente marcado del M. kansasii diana (Marca-1). Por el otro lado, se prepara por separado un fragmento de ADN genómico fluorescentemente marcado de las especies de organismos a diferenciar (Marca-2) y se utiliza para un experimento comparativo. Esto significa que, la reactividad (aglutinación) de cada Marca-1 y Marca-2 con la matriz sobre la micromatriz se ensaya por hibridación competitiva por el uso de la Marca-1 y Marca-2 en el mismo sistema de reacción. En la presente, esto permite seleccionar un grupo de secuencia candidato que reaccione en forma más específica con un fragmento de ADN genómico (Marca-1) de M. kansasii diana (por ejemplo, Documento de No Patente 6), y, por lo tanto, puede seleccionarse el oligonucleótido objetivo. Se describirá en detalle a continuación un ejemplo del procedimiento de selección de un oligonucleótido por el uso del procedimiento de micromatriz de la presente invención.

(1) Preparación de la librería Aleatoria del Genoma. La preparación de la librería Aleatoria del Genoma de M. kansasii se lleva a cabo por el procedimiento modificado del procedimiento Aleatorio del Genoma descrito por Venter et al., Science 2001 Feb 16; 291 (5507): 1304-1351 mencionado a continuación.

En primer lugar, la cepa M. kansasii se trata por procedimientos convencionales (por ejemplo, el tratamiento de fracturación del cuerpo bacteriano por tratamiento en autoclave y por el uso de perlas de vidrio), después se lleva a cabo la extracción y purificación de ADN de acuerdo con los procedimientos convencionales. La muestra de ADN purificada obtenida se somete a un tratamiento de fragmentación de ADN, por ejemplo, un tratamiento durante aproximadamente 1 a 5 minutos por el uso de un nebulizador en presencia de una concentración final del 20% de glicerol bajo de 5 kPa a 9 kPa. Por este tratamiento, el tamaño objetivo de fracción de 500 a 1000 bp puede recuperarse eficientemente. La fracción obtenida se purifica por el uso de una columna de extracción comercialmente disponible.

Después de esto, la fracción obtenida (fragmento de ADN) se incorpora en un ADN vector por ligación de acuerdo con los procedimientos convencionales para obtener un ADN recombinante (librería Aleatoria del Genoma a partir de M. kansasii). El vector a utilizar para este propósito incluye, por ejemplo, en el caso de que la célula huésped para la transformación posterior sea E. coli, un vector tal como pBS (por ej., vector pBSII sk+ (Stratagene Corp.)), plásmido de pQE-TRI (QIAGEN Inc.), pBluescript, pET, pGEM-3Z, pGEX. Antes de la ligación, opcionalmente se redondea el extremo del fragmento con ADN polimerasa.

A continuación, se transforma una célula huésped adecuada para obtener un transformante por el uso del ADN recombinante obtenido. La célula huésped a utilizar para este propósito incluye, por ejemplo, E. coli, preferentemente JM109, DH5a, TOP10. Como una célula huésped, además de ésta, puede utilizarse la célula competente que tiene alta eficiencia de transducción para un plásmido y un ADN fago. Por ejemplo, se incluyen Células Competentes E. coli JM109 (Takara Bio Inc.).

La transformación puede llevarse a cabo de acuerdo con, por ejemplo, el procedimiento de D. M. Morrison (Method in Enzymology, 68, 326-331, 1979). Además, cuando se utiliza una célula competente comercialmente disponible, la transformación puede llevarse a cabo de acuerdo con el protocolo proporcionado en el producto.

Los medios para la separación del transformante que se ha introducido con un ADN recombinante en el que se ha incorporado el fragmento de ADN diana incluyen, por ejemplo, un procedimiento para utilizar propiedades del vector a utilizar para la transducción. Por ejemplo, si se utiliza el vector que contiene el gen con resistencia a ampicilina, por el cultivo del transformante sobre un medio que contiene ampicilina y la selección del clon cultivado, puede obtenerse fácilmente una librería del transformante (clon del Genoma Aleatorio del genoma de M. kansasii) con un ADN recombinante en el que fragmento de ADN diana se ha transducido.

(2) Preparación de la micromatriz. La micromatriz se prepara por el siguiente procedimiento. Esto significa que, se purifica ADN a partir del clon del Genoma Aleatorio derivado del genoma de M. kansasii obtenido en el apartado (1) descrito con anterioridad de acuerdo con los procedimientos convencionales, y después el ADN se suspende en la solución de reacción para PCR y se utiliza como una muestra para PCR. Por el uso de un cebador adecuado (puede ser un cebador comercialmente disponible, por ejemplo, M13 Cebador M1 M13 (Takara Bio Inc.) y Cebador RV M13 (Takara Bio Inc.)), el PCR se lleva a cabo de acuerdo con el procedimiento convencional, y después se purifica el producto de PCR obtenido. Después de esto, el producto de PCR se observa sobre un portaobjetos de vidrio por micromatriz; y se irradia con 150 mJ/cm2 de luz UV para inmovilizar el producto de PCR sobre el portaobjetos de vidrio; y, por lo tanto, se produce la micromatriz.

Además, en caso de ser necesario, por el uso de, por ejemplo, una secuencia de ADN específica a una bacteria tuberculosa tal como M. tuberculosis (Mycobacterium tuberculosis: bacteria tuberculosa de tipo humano) y una secuencia de ADN específica al genoma de M. kansasii como un control positivo, y por el uso de, por ejemplo, un ADN derivado de E. coli como un control negativo, la fragmentación de cada ADN; la ligación al vector; la transformación de

E. coli; la amplificación de ADN por PCR; la inmovilización del producto de PCR sobre un portaobjetos de vidrio se llevan a cabo igualmente para cada ADN, y se preparan micromatrices respectivas.

(3) Marcado con tinte fluorescente sobre el ADN genómico diana. De otra manera, se marcan un ADN genómico extraído y purificado a partir de la cepa M. kansasii y un ADN comparativo (por ejemplo, un ADN derivado de una bacteria tuberculosa tal como bacteria tuberculosa de tipo bovina) respectivamente con Cy3 y Cy5 por un procedimiento de marcado indirecto por el uso de hexilamino-UTP

El procedimiento se explicará tomando, por ejemplo, un procedimiento de marcado indirecto modificado de un protocolo publicado por DeRisi Laboratory (www.micmarray.org) como un ejemplo. En este procedimiento, por el uso de αUTP que tiene un grupo amino, y la incorporación del mismo en una molécula por una reacción de extensión enzimática, se produce la cadena de ADN con αUTP incorporado. Después, el ADN se marca por la aglutinación química de tinte fluorescente (cuerpo de succinimida) con el grupo amino del ADN.

En primer lugar, el material de inicio (ADN genómico derivado de M. kansasii y ADN genómico comparativo) se desnaturaliza por calentamiento de acuerdo con el procedimiento convencional (puede utilizarse un kit comercialmente disponible tal como un sistema de marcado de ADN BioPrime (Invitrogen Co.) can be used). Después, tras la adición de DTT 2 µl, una solución mezclada de dATP/dCTP/dGTP, dTTP, Ha-dUTP y la enzima de Klenow, la reacción de extensión se lleva cabo a 37°C durante aproximadamente 3 horas. El producto de reacción obtenido se coloca sobre una columna de ultrafiltración y se centrifuga a 14.000 rpm durante aproximadamente 4 minutos, y la solución concentrada se recupera en un microtubo, y después se seca completamente por el uso de un secador centrífugo al vacío. Después, el producto de reacción anterior se añade con NaHCO3 y se mezcla, y se deja reposar a temperatura ambiente durante 2 a 3 minutos.

Por separado, se prepara una solución de Cy3 (o Cy5) disuelta en DMSO (Solución Cy-tinte Cy3, Solución Cytinte Cy5). Esta Solución Cy-tinte Cy3 se añade al producto de reacción descrito con anterioridad obtenido por el uso de ADN genómico comparativo, y la Solución Cy-tinte Cy5 se añade al producto de reacción descrito con anterioridad obtenido por el uso de ADN genómico de M. kansasii, y cada mezcla se incuba (bajo protección lumínica) a 40°C durante aproximadamente 60 minutos. Además, cada producto de reacción se añade con NH2OH 4M (preparado inmediatamente antes del uso) y se mezcla, y se incuba (bajo protección lumínica) durante aproximadamente 15 minutos para obtener el producto marcado para cada ADN genómico. Después, el producto marcado obtenido se coloca sobre una columna de ultrafiltración y se centrifuga a 14.000 rpm durante aproximadamente 4 minutos, y la solución concentrada se recupera en un microtubo, y después se seca completamente por el uso de un secador centrífugo al vacío.

El producto marcado obtenido de cada ADN genómico en estado seco se suspende y mezcla en una solución con una composición de concentraciones finales de Tris-acetato 0,04 M (pH 8,1), acetato de potasio 0,1 M, y tetrahidrato de acetato de magnesio 0,03 M. La suspensión se trata por calor a 94°C durante 15 minutos, y se obtiene el producto de fragmentación de cada ADN genómico marcado con 100 a 300 bases (producto marcado con Cy3, producto marcado con Cy5).

Cada producto marcado con Cy3 y producto marcado con Cy5 se coloca por separado sobre una columna de ultrafiltración y se centrifuga a 14.000 rpm durante aproximadamente 4 minutos, y cada solución concentrada se recupera en un microtubo, y después se seca completamente por el uso de secador centrífugo al vacío.

Se colocan en un microtubo, 40 µl de ADN de esperma de salmón (10 mg/ml) y 0,5 µl de una solución reactiva preparada por el ajuste de 5 µl de formamida para preparar el volumen total de 40 a 50 µl por el uso del tampón de Hibridación ArrayHyb (SIGMA) (composición en un caso en el que el portaobjetos de vidrio para la micromatriz a utilizar a continuación es de 24 x 55 mm), y el producto marcado con Cy3 y el producto marcado con Cy5 obtenidos se mezclan en suspensión en la misma solución y se incuban a 95ºC durante 5 minutos para obtener una solución del producto marcado Cy3Cy5. Esta solución se mantiene a 70ºC hasta que se utiliza para la hibridación de la micromatriz en la siguiente sección (4).

(4) Hibridación de la micromatriz (Hibridación ADN-ADN sobre una matriz). Sobre una micromatriz (chip de ADN) preparada en el apartado (2) descrito con anterioridad, se coloca una solución total de la mezcla del producto marcado con Cy3Cy5 preparado en el apartado (3) descrito con anterioridad, y se recubre con una cobertura de vidrio que mantiene el interior libre de burbujas de aire. La micromatriz se dispone sobre un Hybri-cassette (una cinta de hibridación); se coloca en un Tupperware equipado con una Toalla Kim (Kim Towel) (Nippon Paper Crecia Co., Ltd.) mojada con agua destilada que se cierra con firmeza; y se hace reaccionar (bajo protección lumínica) a 65°C durante 8 horas o más para permitir la hibridación. Tras la hibridación, la micromatriz se empapa con una 2 x SSC - solución de SDS 0,1% junto con una cobertura de vidrio a temperatura ambiente, y se agita cuidadosamente en la solución para eliminar la cobertura de vidrio. Tras el lavado secuencial con 1 x SSC y solución de SDS 0,03% (60°C) durante 10 minutos, solución 0,2 x SSC (42°C) durante 10 minutos y solución 0,05 x SSC (temperatura ambiente) durante 10 minutos, la micromatriz se transfiere rápidamente a un nuevo estante seco, y se seca inmediatamente por centrifugación a 800 rpm durante 5 minutos.

(5) Medición de la intensidad fluorescente: de la detección de la señal a la cuantificación. Por el uso de un escáner lector de fluorescencias, se miden intensidades fluorescentes de 2 canales de Cy3 y Cy5 sobre la micromatriz, sobre la que se ha llevado a cabo la Hibridación de micromatriz de acuerdo con lo descrito con anterioridad en el apartado (4), para obtener datos de detección de fluorescencia. La cuantificación de la señal de fluorescencia se lleva a cabo por el uso de un software de análisis de imágenes de expresión del chip de ADN comercialmente disponible, y puede llevarse a cabo un reconocimiento automático de manchas, un cálculo del fondo, y una normalización de la proporción de intensidad fluorescente, de acuerdo con el procedimiento de operación del software.

El producto marcado con Cy5 utilizado para hibridación es el genoma marcado derivado de M. kansasii, y el producto marcado con Cy3 es ADN genómico comparativo marcado. Por lo tanto, cuando se mide la intensidad fluorescente de cada Cy3 y Cy5 y se detecta que la intensidad fluorescente de Cy5 es mayor, significa que el producto sujeto a PRC sobre la micromatriz hibridiza con M. kansasii, y se considera que tiene alta especificidad para M. kansasii. Por el otro lado, cuando se detecta que la intensidad fluorescente de Cy3 es mayor, significa que el producto sujeto a PRC sobre la micromatriz hibridiza con el ADN genómico comparativo y, además, cuando se detecta que las intensidades fluorescentes de Cy3 y Cy5 están en el mismo nivel de intensidad, o se detecta cualquier señal fluorescente de Cy3 y Cy5, puede considerarse que la especificidad para M. kansasii es baja.

Debe indicarse que si se observan un control positivo (por ejemplo, fragmento de ADN específico para M. tuberculosis, fragmento de ADN específico para M. kansasii) y un control negativo (ejemplo, fragmento de ADN derivado de E. coli) en la micromatriz, la tendencia de la intensidad fluorescente obtenida por la medición de la intensidad fluorescente de Cy3Cy5 de cada mancha puede utilizarse como un estándar para la evaluación de los datos producidos en la medición de fluorescencia de barrido.

Además, por el propósito de evaluar una secuencia candidata para uso específicamente en la detección de M. kansasii, se lleva cabo un diagrama de dispersión con base en la proporción de intensidad fluorescente de Cy3/Cy5 (Proporción) detectada sobre el chip de ADN, y se lleva a cabo un análisis de acuerdo con lo presentado a continuación.

En el análisis, entre las secuencias de control positivas utilizadas, el valor de la Proporción de Cy3/Cy5 del fragmento de ADN específico a M. kansasii será un valor estándar útil para la evaluación de especificidad. Esto significa que, entre los candidatos que se han evaluado, se seleccionan los clones que proporcionan una señal significativamente específica para M. kansasii (es decir, que la intensidad fluorescente de Cy5 es alta) como el resultado del análisis del valor de la Proporción Cy3/Cy5, y que también proporcionan un valor amplio de la Proporción en comparación con el control positivo de la mancha específica a M. kansasii.

Además, la determinación de la secuencia de nucleótidos del clon candidato obtenido puede llevarse a cabo de acuerdo con los procedimientos convencionales por el uso de equipamiento tal como, por ejemplo, secuenciador capilar ABI PRISM310 (Applied Biosystems).

Un cebador para detectar M. kansasii en la presente invención incluye el cebador que comprende un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1 o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de M. kansasii (en adelante, opcionalmente denominado cebador de la presente invención).

Además, de acuerdo con las condiciones de PCR, y de la hibridación de nucleótidos, el cebador de la presente invención puede utilizarse por la selección de una longitud apropiada en una región adecuada en consideración de la temperatura de disociación (valor Tm) a partir de los oligonucleótidos, que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos. Preferentemente, la longitud del cebador es de 10 a 50 bases, intervalo que se considera un número de bases necesario para retener especificidad como un cebador, más preferentemente 10 a 35 bases, aún más preferentemente 18 a 25 bases.

Como el procedimiento para diseñar el cebador, el cebador puede diseñarse por el uso de un software comúnmente utilizado para diseñar un cebador tal como, por ejemplo, una herramienta web para el diseño de cebadores, Primer 3 (Whitehead Institute for Biomedical Research).

Un ejemplo específico del oligonucleótido a utilizar para el cebador de la presente invención (el oligonucleótido de la presente invención) que comprende la parte o la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o la parte o la totalidad de la secuencia de la secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii es igual a la descrita en la explicación anterior del oligonucleótido de la presente invención.

Los ejemplos específicos de tal cebador incluyen, por ejemplo, el cebador que comprende un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii.

Un ejemplo más preferente del cebador de la presente invención incluye aquel que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 52 o aquel que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12. Entre estos, se incluye un cebador que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 6 o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 6.

Debe indicarse que el cebador que tiene una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 se diseña con base en la secuencia de nucleótidos representada en la SEQ ID Núm. 1.

En la Fig. 1, en la secuencia de nucleótidos representada en la SEQ ID Núm. 1, la ubicación del cebador que tiene la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 6 se indica en cada caso como 1c_plate1_Fw1 and 1c_plate1_Rv1 con una flecha.

Además, en la secuencia de nucleótidos representada en la SEQ ID Núm. 1, la ubicación del cebador que tiene la secuencia de nucleótidos representada en la SEQ ID Núm. 7 a 12 se indica en cada caso de acuerdo con lo presentado a continuación:

SEQ ID Núm. 7 (1c_plate1_Fw3): base Núm. 33 a 51;

SEQ ID Núm. 8 (1c_plate1_Fw4): base Núm. 212 a 231;

SEQ ID Núm. 9 (1c_plate1_Fw5): base Núm. 315 a 334;

SEQ ID Núm. 10 (1c_plate1_Rv3): base Núm. 185 a 204;

SEQ ID Núm. 11 (1c_plate1_Rv4): base Núm. 411 a 430;

SEQ ID Núm. 12 (1c_plate1_Rv5): base Núm. 461 a 481.

Debe indicarse que en la descripción anterior, el número del cebador denominado en la presente invención se muestra entre paréntesis junto a SEQ ID Núm.

El procedimiento para obtener el cebador de la presente invención es el descrito en el procedimiento para obtener un nucleótido de la presente invención.

Además, el cebador de la presente invención puede marcarse con una sustancia marcadora.

Como la sustancia marcadora a utilizar para marcar el cebador de la presente invención puede utilizarse cualquiera de las sustancias marcadoras bien conocidas tales como un radioisótopo, una enzima, una sustancia fluorescente, una sustancia luminiscente, biotina.

Por ejemplo, se incluyen el radioisótopo tal como 32P, 33P, 35S, la enzima tal como fosfatasa alcalina, peroxidasa de rábano, la sustancia fluorescente tal como grupos de tinte de cianina de Cy3, Cy5 (Amersham Biosciences), fluoresceína, la sustancia luminiscente tal como un reactivo quimioluminiscente que incluye éster de acridinio.

Cuando el cebador de la presente invención se marca con un radioisótopo, se incluyen un procedimiento de marcado por la incorporación de un nucleótido marcado con un radioisótopo en el cebador en el momento en que se sintetiza el cebador, o un procedimiento para marcado con un radioisótopo después de que se sintetiza el cebador. Específicamente, se incluyen un procedimiento cebador azaroso frecuentemente utilizado, un procedimiento de traslación de níquel, un procedimiento de marcado del extremo terminal 5' por el uso de T4 polinucleótido quinasa, un procedimiento para marcado del extremo terminal 3' por el uso de deoxinucleotidil transferasa del extremo terminal y un procedimiento para el marcado de ARN.

Cuando el cebador de la presente invención se marca con una enzima, puede emplearse la técnica convencional en este campo del procedimiento de marcado directo a través del que el cebador a marcar se vincula covalentemente en forma directa con una molécula de una enzima tal como fosfatasa alcalina, peroxidasa de rábano.

Cuando el cebador de la presente invención se marca con una sustancia fluorescente, por ejemplo, el nucleótido fluorescentemente marcado puede incorporarse en el cebador por una técnica de marcado convencional en este campo. Además, por un procedimiento de reemplazo de una secuencia con un nucleótido que tiene un brazo vinculante como un miembro de un oligonucleótido (Véase, por ejemplo, Nucleic Acids Res., 1986, vol. 14, p. 6115), el nucleótido también puede marcarse con la sustancia fluorescente. En tal caso, también puede existir un procedimiento en el que una uridina que tiene un brazo vinculante sobre la posición-5 se sintetiza químicamente a partir de una deoxiuridina por un procedimiento sintético desvelado en JP-A-1985-500717 y después se introduce una sustancia fluorescente en el oligonucleótido descrito con anterioridad.

En los procedimientos de marcado con una sustancia fluorescente y con biotina, el marcado puede llevarse a cabo de acuerdo con la técnica convencional de marcado luminiscente o marcado con biotina de nucleótidos normalmente desarrollada en este campo.

Una sonda para detectar M. kansasii en la presente invención incluye la sonda que comprende un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii (en adelante, opcionalmente denominada sonda de la presente invención).

Un ejemplo específico del oligonucleótido a utilizar para la sonda de la presente invención (el oligonucleótido de la presente invención) que comprende la parte o la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o la parte o la totalidad de la secuencia de la secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii es igual a la descrita en la explicación anterior del oligonucleótido de la presente invención.

De acuerdo con las condiciones de PCR, hibridación de nucleótidos, la sonda de la presente invención puede utilizarse por la selección de una longitud adecuada en una región apropiada en un cálculo de la temperatura de disociación (valor Tm) del oligonucleótido que comprende una parte o la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos. Es deseable diseñar la sonda en consideración del número de bases necesario para retener especificidad como una sonda si se pretende que la sonda tenga especificidad suficiente.

Por ejemplo, la sonda a utilizar para el procedimiento de hibridación de nucleótidos (por ejemplo, Hibridación Southern) incluye una sonda que tiene la longitud de base de 10 a 700 bases, preferentemente 100 a 600 bases y más preferentemente 200 a 500 bases.

Además, por ejemplo, la sonda a utilizar para el sistema de PCR en tiempo real (por ejemplo, procedimiento TaqMan™, procedimiento de Baliza Molecular) incluye la que tiene la longitud de base de 10 a 50 bases, preferentemente 15 a 40 bases y más preferentemente 20 a 30 bases.

Los ejemplos específicos de tal base incluyen, por ejemplo, la seleccionada de la sonda que comprende un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 y 53 a 56 o una parte de la totalidad de la secuencia de una secuencia complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii.

Un ejemplo preferente de la sonda de la presente invención incluye la que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 y 53 a 56. Entre éstas, son preferentes la sonda que comprende una secuencia seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5, 6 y 53. En particular, es preferente la sonda que comprende una secuencia seleccionada de la

5 secuencia de nucleótidos representada en la SEQ ID Núm. 53.

Debe indicarse que la secuencia de nucleótidos representada en la SEQ ID Núm. 53 a 79 es aquella a amplificar por PCR por el uso del cebador de la presente invención. La combinación de un cebador directo y un cebador inverso, y la SEQ ID Núm. del nucleótido a amplificar por PCR por el uso de estos cebadores se muestran colectivamente en la Tabla 1. La tabla muestra que, por ejemplo, la secuencia de nucleótidos representada en la SEQ ID Núm. 53 es una secuencia que se amplifica por PCR por el uso de un oligonucleótido con una secuencia de nucleótidos representada en SEQ ID Núm. 5 como un cebador directo y un oligonucleótido con una secuencia de nucleótidos representada en SEQ ID Núm. 6 como un cebador inverso.

[Tabla 1]

Cebador directo Cebador inverso Secuencia amplificada 5 6 53 7 10 54 8 11 55 9 12 56

15 El procedimiento para obtener la sonda de la presente invención es el descrito en el procedimiento para obtener un nucleótido de la presente invención.

La sonda de la presente invención puede marcarse con una sustancia marcadora.

Como la sustancia marcadora a utilizar para marcar la sonda de la presente invención puede utilizarse cualquiera de las sustancias marcadoras bien conocidas tales como radioisótipo y enzima, sustancia fluorescente, 20 sustancia luminiscente, biotina.

Un ejemplo específico de la sustancia marcadora y del procedimiento de marcado a utilizar para marcar la

sonda de la presente invención es el descrito en la explicación del procedimiento de marcado del cebador de la presente

invención.

La sonda marcada a utilizar en el procedimiento de PCR descrito a continuación incluye la sonda de la presente invención marcada con una sustancia marcadora normalmente utilizada en el procedimiento de detección en tiempo real. Por ejemplo, se incluye la sonda marcada de la presente invención en el que el extremo terminal 5' se marca con una sustancia reportera fluorescente (carboxifluoresceína (FAM), hexaclorofluoresceína (HEX), tetraclorofluoresceína (TET)) y el extremo terminal 3' se marca con un tinte inactivador (por ejemplo, una sustancia fluorescente tal como carboxitetrametilrodamina (TAMRA), una sustancia no fluorescente tal como un tinte Black Hole Quencher (BHQ) y ácido 4-((4-(dimetilamino)fenil)azo)benzoico (DABCYL).

La muestra a utilizar para detectar M. kansasii referida en la presente invención incluye especímenes clínicos tales como esputo, sangre, mucosa faríngea, jugos gástricos, fluido de lavado bronquial, especímenes transbronquiales, fluidos punzados tales como efusión pleural y pus. Además, la muestra puede ser un cuerpo bacteriano cultivado aislado de un espécimen, ácido nucleico aislado y purificado a partir de tal cuerpo bacteriano, o ácido nucleico amplificado por un sistema de detección de amplificación de ácido nucleico.

Para extraer y purificar ADN de las muestras descritas con anterioridad, la extracción y purificación pueden

llevarse a cabo de acuerdo con los procedimientos convencionales normalmente empleados para la extracción de ADN

de bacterias ácido-alcohol resistentes (bacteria tuberculosa) a partir de un material de un espécimen.

En el caso en que se utiliza el cuerpo bacteriano como una muestra, por ejemplo, se incluyen el procedimiento

40 para romper la estructura membranosa de la bacteria tuberculosa por el tratamiento del cuerpo bacteriano con un agente desnaturalizante de proteínas, por ejemplo, un agente tensioactivo tal como SDS, tiocianato de guanidina (GTC) y el procedimiento de ruptura física del cuerpo bacteriano por el uso de perlas de vidrio.

En el caso en que se utiliza el esputo expectorado como una muestra, de acuerdo con la recomendación de Center for Disease Control and Prevention (CDC), puede llevarse a cabo la homogeneización del material del 45 espécimen, como pretratamiento, por el procedimiento de NALC (N-acetil-L-cisteína)-NaOH (Kent PT, Kubica GP,

Pubric Health Mycobacteriology, A Guide for the Level III Laboratory, U.S.Department of Health and Human Services, Public Health Service, Center for Disease Control, Atlanta, U.S.A., 1985, p.31-55).

Después, por el procedimiento general para la preparación de ADN (procedimiento de extracción con fenolcloroformo, procedimiento de precipitación con etanol, de acuerdo con lo descrito en Rapid and simple method for purification of nucleic acids, J. Clin. Microbiol., 1990, Mar; 28(3), 495-503, Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J), puede llevarse a cabo la extracción y purificación del ADN.

Tomando como ejemplo el caso en que el cuerpo bacteriano cultivado aislado de un espécimen se utiliza como una muestra, se recuperan colonias en el medio de Ogawa; se suspenden en agua destilada estéril; se centrifugan para recolectar el cuerpo bacteriano; el cuerpo bacteriano se resuspende en agua destilada y se esteriliza en autoclave; tras el tratamiento de ruptura (ruptura física por el uso de perlas de vidrio), el cuerpo bacteriano alterado se centrifuga aún más para recuperar el fluido sobrenadante. El ADN puede extraerse y purificarse a partir del fluido sobrenadante obtenido. En cuanto a la extracción del ADN, dado que varios kits están comercialmente disponibles, puede utilizarse uno de tales kits, o la extracción puede llevarse a cabo de acuerdo con los procedimientos convencionales en este campo (por ejemplo, el procedimiento de extracción con fenol-cloroformo, un procedimiento de precipitación por el uso de etanol, propanol). Por ejemplo, por el uso de un kit de extracción y purificación de ADN de tipo resina de intercambio iónico Genomic-tip (QIAGEN GmbH), puede llevarse a cabo la extracción y purificación del ADN.

El procedimiento de detección de M. kansasii referido en la presente invención incluye, por ejemplo:

(A) Un procedimiento en el que se utiliza un oligonucleótido (el oligonucleótido de la presente invención) que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1,

o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii;

(B) Un procedimiento en el que se utiliza un oligonucleótido marcado de la presente invención como una sonda marcada. Cada procedimiento se explicará a continuación.

(A) Se incluye como el procedimiento (A) un procedimiento en el que se utiliza el oligonucleótido de la presente invención, "un procedimiento en el que, la reacción de amplificación de ácido nucleico se lleva a cabo por el uso del cebador de la presente invención, y se utiliza un ácido nucleico en una muestra como una plantilla, y se detecta la extensión del cebador obtenido". Específicamente, por ejemplo, se incluye un procedimiento en el que, por el uso del cebador de la presente invención, el cebador se hibridiza con un ácido nucleico en la muestra, después se lleva a cabo la amplificación de ácido nucleico por ADN polimerasa [por ejemplo, PCR; Documento de Patente 3, procedimiento LAMP (Amplificación Isotérmica Mediada por un Rizo) (Tsugunori Notomi et al., Nucleic Acid Res., 28, e63, 2000), procedimiento ICAN (Amplificación Isotérmica y Quimérica de Ácidos Nucleicos iniciada por un cebador) (Clinical Pathology, 51(11), 1061-1067, 2003, Nov), procedimiento LCR (reacción en cadena de la ligasa) (JP-A-4-211399), procedimiento SDA (amplificación por desplazamiento de hebras) (JP-A-8-19394)] para lograr la extensión del cebador. Asimismo, por este procedimiento, puede amplificarse la secuencia de la región específica de la secuencia de nucleótidos del gen de M. kansasii, y, por lo tanto, puede detectarse M. kansasii por la medición de producto de extensión del cebador obtenido.

El ejemplo específico del cebador de la presente invención a utilizar en la PCR es acorde a lo descrito con anterioridad.

Preferentemente, un cebador directo incluye un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 7 a 9, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii, y un cebador inverso incluye un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 6 y 10 a 12, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii.

Más preferentemente, el cebador directo incluye el que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 7 a 9, y el cebador inverso incluye el que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y 10 a 12.

Aún preferentemente, el cebador directo incluye el que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5, 13, 15, 27, 29, 41, 43, y el cebador inverso incluye el que comprende una secuencia seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 6.

La combinación preferente del cebador directo y el cebador inverso incluye la combinación de acuerdo con lo descrito con anterioridad en la Tabla 1.

Entre estos, una combinación particularmente preferente del cebador directo y el cebador inverso incluye una combinación en la que el cebador directo es un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 y el cebador inverso es un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 6.

Las condiciones, el procedimiento de operación de la PCR por el uso del cebador descrito con anterioridad pueden estar de acuerdo con los procedimientos de rutina convencionales normalmente utilizados en este campo.

Un procedimiento para determinar el producto de extensión del cebador incluye, (A-1) un procedimiento en el que la determinación se lleva a cabo con base en los resultados de la electroforesis del producto de extensión del cebador obtenidos por la reacción en cadena de la polimerasa, (A-2) un procedimiento en el que la determinación se lleva cabo por el procedimiento por PCR en tiempo real, y (A-3) un procedimiento en el que la determinación se lleva cabo por la medición de la señal derivada del producto de extensión del cebador obtenido por la reacción en cadena de la polimerasa por el uso de un cebador marcado.

Cada procedimiento se explicará a continuación.

(A-1) Un procedimiento en el que la determinación se lleva a cabo con base en los resultados de la electroforesis del producto de extensión del cebador obtenidos por la reacción en cadena de la polimerasa. Este procedimiento incluye, por ejemplo, "un procedimiento para detectar M. kansasii que comprende el siguiente procedimiento:

(i) llevar a cabo PCR por el uso como un cebador de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii (el cebador de la presente invención), y por el uso de un ácido nucleico en la muestra como una plantilla;

(ii) llevar a cabo electroforesis del producto de extensión del cebador obtenido en el apartado (i) anterior, y detectar M. kansasii sobre la basa del resultado obtenido".

Un procedimiento para detectar M. kansasii a partir de los resultados de electroforesis incluye, por ejemplo, (A1-1) un procedimiento en el que la determinación se lleva a cabo por la confirmación de una fracción del producto de extensión del cebador que tiene un tamaño objetivo (número de pares de base), (A-1-2) un procedimiento en el que la determinación se lleva a cabo por Hibridación por el uso de una sonda marcada.

Las condiciones, el procedimiento de operación de la electroforesis pueden llevarse a cabo de acuerdo con los procedimientos convencionales normalmente desarrollados en este campo.

(A-1-1) un procedimiento en el que la determinación se lleva a cabo por la confirmación de una fracción del producto de extensión del cebador con un número pretendido de pares de base. En cuanto al procedimiento descrito con anterioridad en el que la determinación se lleva a cabo por la confirmación de una fracción del producto de extensión del cebador que tiene un tamaño objetivo (número de pares de base), por ejemplo, se lleva en primer lugar la PCR, después, el producto de extensión del cebador obtenido se somete a la electroforesis. El tamaño (número de pares de base) del producto de amplificación se estima de antemano a partir del cebador directo y el cebador inverso a utilizar para la PCR, con base en éste, la confirmación de si la fracción obtenida de electroforesis se corresponde o no con el tamaño estimado del producto de amplificación puede llevarse a cabo por los procedimientos convencionales. Se incluye un procedimiento de detección basado en el tamaño característico del producto de amplificación medido, por ejemplo, por un modo tal que el tipo de ácido nucleico se visualice por tinción con bromuro de etidio.

Un procedimiento de determinación específico de acuerdo con el procedimiento de (A-1-1) incluye, por ejemplo, los siguientes procedimientos:

(1) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 6 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y aquel en el que una fracción de 167 pares de base o una fracción de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 56 se confirma, se determina positivo.

(2) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 7 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 10 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y en el que aquella en la que se confirma una fracción de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 54, se determina positiva.

(3) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 8 como un cebador directo y un oligonucleótido que

comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 11 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y en el que aquella en la que se confirma una fracción de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 55, se determina positiva.

(4) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 9 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 12 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y en el que aquella en la que se confirma una fracción de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 56, se determina positiva.

Entre los descritos con anterioridad, es preferente el procedimiento del apartado (1).

(A-1-2) un procedimiento en el que la determinación se lleva a cabo por hibridación por el uso de una sonda marcada. Un procedimiento en el que la determinación se lleva a cabo por hibridación por el uso de una sonda marcada incluye, por ejemplo, un procedimiento en el que, tras la electroforesis, la fracción electroforética obtenida se somete a hibridación con una sonda marcada preparada por el marcado de una sonda de la presente invención con una sustancia marcadora, y en el que aquella que ha confirmado la presencia de una fracción hibridizada con la sonda marcada mencionada con anterioridad por la detección de la señal derivada de la sonda marcada mencionada con anterioridad se determina positiva.

Los ejemplos específicos de la sonda a utilizar y la sustancia marcadora de la sonda y un procedimiento de marcado de la sonda son lo descrito con anterioridad.

Un procedimiento de determinación específico de acuerdo con el procedimiento de (A-1-2) incluye, por ejemplo, los siguientes procedimientos:

(1) Un procedimiento en el que, tras llevar a cabo la PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 6 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y en el que después una fracción electroforética obtenida se ensaya por hibridación con una sonda marcada preparada por el marcado de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 53 con una sustancia marcadora, y en el que se confirma la presencia de una fracción hibridizada con la sonda marcada mencionada con anterioridad por la detección de la señal derivada de la sonda marcada mencionada con anterioridad se determina positivo.

(2) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 7 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 10 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y después se examina la hibridación con una sonda marcada preparada por el marcado de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 54 con una sustancia marcadora, y en el que se determina positiva aquella en la que se confirma la presencia de una fracción hibridizada con la sonda marcada mencionada con anterioridad por la detección de la señal derivada de la sonda marcada mencionada con anterioridad.

(3) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 8 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 11 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y después se examina la hibridación con una sonda marcada preparada por el marcado de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 55 con una sustancia marcadora, y en el que se determina positiva aquella en la que se confirma la presencia de una fracción hibridizada con la sonda marcada mencionada con anterioridad por la detección de la señal derivada de la sonda marcada mencionada con anterioridad.

(4) Un procedimiento en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 9 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 12 como un cebador inverso, el producto de extensión del cebador obtenido se somete a electroforesis, y después se examina la hibridación con una sonda marcada preparada por el marcado de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 56 con una sustancia marcadora, y en el que se determina positiva aquella en la que se confirma la presencia de una fracción hibridizada con la sonda marcada mencionada con anterioridad por la detección de la señal derivada de la sonda marcada mencionada con anterioridad.

Entre los descritos con anterioridad, es preferente el procedimiento (1).

Tomando, por ejemplo, un caso en el que se detecta M. kansasii por el procedimiento (el procedimiento del apartado (1) anterior de (A-1-1)) en el que, tras llevar a cabo PCR por el uso de un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 como un cebador directo y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 6 como un cebador inverso y seguido por electroforesis, se confirma el producto de extensión del cebador que tiene un número de pares de base objetivo como un ejemplo, el procedimiento detallado para detectar M. kansasii referido en la presente invención es lo presentado a continuación:

En primer lugar, de acuerdo con el procedimiento descrito con anterioridad, la muestra de ADN purificado se prepara a partir de un espécimen a ensayar por la presencia de M. kansasii. Por separado, por el procedimiento descrito con anterioridad, un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 5 (en adelante, representado como 1c_plate1_Fw1) y un oligonucleótido que comprende la secuencia de nucleótidos representada en la SEQ ID Núm. 6 (en adelante, representado como 1c_plate1-Rv1) se sintetizan a partir del nucleótido de la presente invención por un procedimiento de fosfoamidita por el uso de un sintetizador de ADN.

Se prepara un tampón de Tris-HCl 10 mM (pH 8,9) que contiene 1c_plate1_Fw1 y 1c_plate1_Rv1, MgCl2 1,0 a 4,0 mM, KCl 80 mM, BSA 500 µg/ml, colato de sodio 0,1%, éter de polioxietilen octilfenilo 0,005 a 0,2%, cada 0,1 a 0,6 mM de dATP, dCTP, dGTP y dTTP, y 10 a 80 unidades/ml de Taq ADN polimerasa, y se utiliza como una solución de reacción para PCR.

El ADN purificado se añade a la solución de reacción para PCR, y por el uso de esta solución como una muestra para PCR, se llevan a cabo 20 a 40 ciclos de la PCR por el Ciclador Térmico de ADN. Tras PCR, la solución de reacción se somete a una electroforesis en gel de agarosa 1,5%. Después, tras teñir el gel con bromuro de etidio, se detecta la señal fluorescente generada por rayos UV. Asimismo, el marcador del peso molecular se somete a electroforesis en paralelo con la solución de reacción, y la longitud del fragmento de ADN detectado se calcula por la comparación de la movilidad relativa. En la PCR en que se utiliza 1c_plate1_Fw1 como un cebador directo y 1c_plate1_Rv1 como un cebador inverso, se anticipa que se replicará el fragmento de ADN con 167 pares de base (SEQ ID Núm. 53) en la secuencia de nucleótidos de M. kansasii. Por consiguiente, puede determinarse que aquella en la que se confirma la presencia de una banda fluorescente de 167 pares de base es positiva.

(A-2) Un procedimiento por PCR en tiempo real. En el procedimiento para detectar M. kansasii de la presente invención, también puede utilizarse el sistema de amplificación en tiempo real (véase, por ejemplo, las Patentes de los Estados Unidos Núm. 5.210.015 y 5.538.848).

Un ejemplo del sistema de detección por el sistema de amplificación en tiempo real incluye, por ejemplo, el sistema de detección de PCR en tiempo real.

Pueden utilizarse varios procedimientos de detección de PCR en tiempo real, por ejemplo, procedimiento de PCR en tiempo real TaqMan™ (véase, por ejemplo, la Patente de los Estados Unidos Núm. 5.538.848), procedimiento de Sistema de Sonda Eclipse MGB (véase, por ejemplo, la Patente de los Estados Unidos Núm. 5.801.155), el procedimiento de Tecnología de Sonda de Balizas Moleculares (véase, por ejemplo, la Patente de los Estados Unidos Núm. 5.925.517), el procedimiento Cebador Fluorogénico LUX (Invitrogen Corporation), el procedimiento de sonda-PCR Quenching (QP) (véase, por ejemplo, la Patente de los Estados Unidos Núm. 6.492.121) para el procedimiento para detectar M. kansasii de la presente invención.

Más específicamente, por el procedimiento de PCR en tiempo real en el que se utiliza una sonda en la que se marca el extremo terminal 5', por ejemplo, con un tinte fluorescente (reportero) tal como FAM y se marca el extremo terminal 3', por ejemplo, con un tinte inactivador tal como TAMRA (véase, por ejemplo, la Patente de los Estados Unidos Núm. 5.538.848), puede detectarse cuantitativamente una cantidad diminuta de ADN diana con alta sensibilidad.

Esto significa que, por el uso de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii como un cebador (el cebador de la presente invención), y por el uso de un oligonucleótido marcado que se marca con un tinte fluorescente reportero sobre el extremo terminal 5' y con tinte inactivador sobre el extremo terminal 3' como una sonda marcada, y que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii (el oligonucleótido de la presente invención), la PCR se lleva a cabo para el ácido nucleico en una muestra como una plantilla, y después se detecta la señal fluorescente liberada por la sonda marcada mencionada con anterioridad.

El principio de la PCR en tiempo real descrita con anterioridad es como se presenta a continuación. Esto significa que, se utiliza un oligonucleótido que se marca con un tinte fluorescente (reportero) sobre el extremo terminal 5' y con un tinte inactivador sobre el extremo terminal 3', y que es capaz de hibridizarse con una región particular del gen objetivo. La fluorescencia reportera de la sonda mencionada con anterioridad se suprime por el tinte inactivante en la condición ordinaria. Bajo el estado en que la sonda fluorescente se hibridiza completamente con el gen objetivo, la PCR se lleva a cabo por afuera del híbrido por el uso de ADN polimerasa. De acuerdo con el progreso de la reacción de extensión por ADN polimerasa, el extremo terminal 5' de la sonda fluorescente se hidroliza por su actividad de exonucleasa para liberar el tinte fluorescente y generar fluorescencia. En el procedimiento de PCR en tiempo real, por el monitoreo de esta señal fluorescente en tiempo real, puede cuantificarse correctamente la cantidad inicial de la plantilla de ADN.

La sonda a utilizar para la sonda marcada que se marca con un tinte fluorescente (reportero) sobre el extremo terminal 5' y con un tinte inactivador sobre el extremo terminal 3' y que se utiliza para el sistema de detección de PCR en tiempo real de la presente invención puede ser la sonda descrita con anterioridad de la presente invención. Prácticamente, puede utilizarse una sonda que tenga una secuencia de nucleótidos del producto de amplificación obtenido por la PCR en tiempo real por la combinación de un cebador directo y un cebador inverso, o una sonda que tenga una secuencia de nucleótidos diseñada en forma adicional a partir de la secuencia anterior. Por ejemplo, la sonda a utilizar cuando la PCR en tiempo real se lleva a cabo por el uso de cebadores de la SEQ ID Núm. 5 y SEQ ID Núm. 6 incluye un nucleótido que tiene una secuencia de nucleótidos amplificada esperada de la SEQ ID Núm. 53 por la PCR en tiempo real, o un oligonucleótido que tiene una secuencia diseñada a partir de la secuencia de nucleótidos de la SEQ ID Núm. 53 (por ejemplo, SEQ ID Núm. 80).

Además, la sustancia fluorescente reportera a utilizar para marcar el extremo terminal 5' incluye FAM, HEX, TET, Cy5, VIC, sin embargo, entre estas, es preferente FAM. El tinte inactivador a utilizar para marcar el extremo terminal 3' incluye una sustancia fluorescente tal como TAMRA y una sustancia no fluorescente tal como BHQ (por ej., BHQ2) y DABCYL, sin embargo, entre estas, es preferente TAMRA.

El cebador directo y el cebador inverso a utilizar para el sistema de detección de PCR en tiempo real referidos en la presente invención incluyen los utilizados en la PCR descrita con anterioridad, y los ejemplos específicos de cebadores y combinaciones preferentes también son lo descrito con anterioridad.

El otro trifosfato de desoxirribonucleósido (dATP, dCTP, dGTP, dTTP), el reactivo tal como ADN polimerasa a utilizar para el sistema de detección de PCR en tiempo real puede ser igual al utilizado en la PCR en tiempo real usual, excepto por el uso del cebador y la sonda de la presente invención, pueden llevarse a cabo de acuerdo con el protocolo común de la PCR en tiempo real.

Se explica a continuación un ejemplo del procedimiento para detectar M. kansasii por el sistema de detección de PCR en tiempo real de la presente invención.

En primer lugar, de acuerdo con el procedimiento descrito con anterioridad, una muestra de ADN purificado se obtiene a partir de un espécimen a ensayar por M. kansasii. Por separado, los oligonucleótidos que tienen la secuencia de nucleótidos representada en la SEQ ID Núm. 5 (1c_ plate1_Fw1) y SEQ ID Núm. 6 (1c_plate1_Rv1) se sintetizan por el procedimiento de fosfoamidita por el uso de un sintetizador de ADN.

Además, a partir de la secuencia de nucleótidos representada en la SEQ ID Núm.: 53 a amplificar por la PCR por el uso de 1c_plate1_Fw1 y 1c_plate1_Rv1 como cebadores, se diseña una secuencia a utilizar como una sonda (por ej., SEQ ID Núm.: 80), y se sintetiza un oligonucleótido de esta secuencia. El extremo terminal 5' de este oligonucleótido se marca con un tinte reportero de FAM, y el extremo terminal 3' se marca con un inactivador reportero de TAMRA por los procedimientos convencionales, y, así, se obtiene una sonda marcada con fluorescencia.

Por el uso del 1c_plate1_Fw1 preparado con anterioridad como un cebador directo y el 1c_plate1_Rv1 como un cebador inverso, se lleva a cabo la PCR en tiempo real, por ejemplo, de acuerdo con lo presentado a continuación.

Esto significa que, se prepara un tampón de Tris-HCl 10 mM (pH 8,9) que contiene cada 1 µM de cebador 1c_plate1_Fw1 y cebador 1c_plate1_Rv1, 100 a 1000 nM de sonda marcada con fluorescencia, 1,0 a 4,0 mM de MgCl2, KCl 80 mM, BSA 500 µg/ml, colato de sodio 0,1%, 0,005 a 0,2% de TritonX-100, cada 0,2 mM de dATP, dCTP, dGTP y dTTP, y 10 a 80 unidades/ml de Taq ADN polimerasa, y se utiliza como una solución de reacción. A 20 µl de la solución de reacción se añaden 1 ng de muestra de ADN purificado y se utiliza como una muestra para PCR. Esta muestra para PCR se coloca en cada pocillo de una placa de reacción de 96 pocillos, y se lleva a cabo la PCR en tiempo real por el uso de un equipamiento de detección de PCR en tiempo real adecuado. La reacción se repita en 30 a 50 ciclos, y en cada ciclo, se mide la intensidad fluorescente del tinte reportero.

En la determinación de M. kansasii, cuando se observa la señal fluorescente del tinte reportero, puede determinarse que la muestra es positiva a M. kansasii.

Además, en el procedimiento de PCR en tiempo real, dado que puede realizarse una curva estándar, puede determinarse el número de ADN genómico (número de copia) de M. kansasii en la muestra. Además, dado que este número es proporcional al número de células de M. kansasii, también puede determinarse el número de células de M. kansasii en la muestra. La preparación de la curva estándar puede llevarse a cabo de acuerdo con el procedimiento convencional comúnmente desarrollado en el procedimiento de PCR en tiempo real. Por ejemplo, por el uso de una muestra de ADN genómico de M. kansasii de un número de copia conocido como un estándar, se prepara una serie de disolución de concentración (número de copia) de la muestra de ADN para PCR. Después, por el uso de cada una de las series de disolución de la muestra de ADN para PCR, se lleva cabo la PCR en tiempo real de acuerdo con el procedimiento descrito con anterioridad, y se mide la intensidad fluorescente del tinte reportero. Para cada una de las series de disolución de la muestra de ADN para PCR, el valor medido de la intensidad fluorescente (Rn, eje de y) se traza para cada número de ciclo de PCR (eje de x) para prepara una curva de amplificación. Después, se selecciona una parte de Rn en la que la intensidad fluorescente se amplifique exponencialmente, y se traza una línea umbral (Th). El punto de cruce de la Th con una curva de amplificación de cada muestra de ADN para PRC se define como el ciclo umbral (Ct). Después, el valor Ct (eje de y) se traza por el valor logarítmico del número de copia de cada muestra de ADN para PCR (eje de x), y una curva aproximada obtenida para cada Ct puede utilizarse como una curva estándar.

Para la determinación cuantitativa del número del ADN genómico (número de copia) de M. kansasii en la muestra, en primer lugar, el ADN se aísla y purifica del espécimen a ensayar por M. kansasii, y se lleva a cabo la PCR en tiempo real de la muestra de ADN obtenida, y se prepara una curva de amplificación de igual manera. Se obtiene el valor Ct en el punto de cruce de la Th trazada al momento de preparar la curva estándar por la curva de amplificación obtenida. Por el ajuste del valor Ct a la curva estándar, puede obtenerse la cantidad (número de copia) de ADN genómico de M. kansasii en la muestra.

Además, la presente invención puede aplicarse en la etapa de amplificación de ácido nucleico con un procedimiento de detección por el uso de producto de transcripción de ARN. Por ejemplo, se incluyen el procedimiento NASBA (amplificación basada en la secuencia de ácido nucleico) (Patente JP Núm. 2650159), procedimiento 3SR (replicación de secuencia auto-sostenida) (JP-B-7-114718), procedimiento TAS (sistema de amplificación basado en transcripción) (JP-A-2-500565: Publicación Internacional de WO Núm. 88/10315), procedimiento TMA (amplificación mediada por transcripción) (JP-A-11-46778). Entre estos, los procedimientos de amplificación de ácido nucleico de temperatura constante en los que se utiliza un modo de acción concertado de transcriptasa reversa y ARN polimerasa (una condición de reacción que permite que la transcriptasa reversa y la ARN polimerasa actúen en forma coordinada) son adecuados para la automatización del sistema de determinación.

(A-3) Un procedimiento en el que la determinación se lleva cabo por la medición de la señal derivada del producto de extensión del cebador obtenido por la reacción en cadena de la polimerasa por el uso de un cebador marcado. En este procedimiento, se incluye un procedimiento tal en el que, por el uso de un cebador marcado preparado por el marcado del cebador de la presente invención de acuerdo con el procedimiento descrito con anterioridad, la PCR se lleva a cabo para el ácido nucleico en la muestra como una plantilla, y después se mide la señal derivada del producto de extensión del cebador obtenido, y cuando se detecta la señal derivada del cebador en el producto de extensión del cebador obtenido, se determina que la muestra es positive a M. kansasii. El cebador directo y el cebador inverso a utilizar en este procedimiento incluye los utilizados en el procedimiento de PCR descrito con anterioridad, y los ejemplos específicos del cebador preferente y la combinación preferente también están de acuerdo con lo descrito con anterioridad.

En el caso del procedimiento descrito con anterioridad, una vez llevada a cabo la PCR; se elimina el cebador marcado libre; se mide la señal derivada del producto de extensión del cebador; y cuando se detecta la señal, puede determinarse que la muestra es positiva a M. kansasii.

En el procedimiento para eliminar el cebador marcado libre, se incluye un procedimiento tal en el que tras la precipitación del producto de extensión del cebador en la mezcla de reacción obtenida por la PCR por el procedimiento convencional de precipitación de ácido nucleico (procedimiento de precipitación con etanol, un procedimiento de precipitación en el que se utiliza isopropanol), se elimina la solución sobrenadante que contiene un cebador marcado libre no precipitante.

Además, también se incluye un procedimiento para separar el producto de extensión del cebador del cebador marcado libre en la mezcla de reacción obtenida por PCR por el tratamiento con cromatografía en gel bajo condiciones adecuadas o por electroforesis bajo condiciones adecuadas.

(B) Un procedimiento en el que se utiliza el oligonucleótido marcado de la presente invención como una sonda marcada. Además, en el procedimiento para detectar M. kansasii de la presente invención, un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1,

o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii (el oligonucleótido de la presente invención) se marca con una sustancia marcadora, y por el uso de este oligonucleótido marcado como una sonda marcada, se permite que la sonda marcada con anterioridad se hibridice con el ácido nucleico en la muestra, y tras la eliminación de la sonda marcada libre, se detecta la señal derivada del complejo hibridizado.

Específicamente, el procedimiento incluye, por ejemplo:

(B-1) un procedimiento de detección en el que se utiliza el oligonucleótido de la presente invención inmovilizado sobre el vehículo sólido como una sonda de atrapamiento, se lleva a cabo hibridación con ácido nucleico en la muestra para inmovilizar el ácido nucleico derivado de M. kansasii sobre la fase sólida (véase, por ejemplo, JP-A-62-265999);

(B-2) un procedimiento del denominado “ensayo sándwich” en el que se utiliza la sonda de atrapamiento de (B1) y la sonda marcada preparada por el marcado de la sonda de la presente invención, se lleva a cabo hibridación con ácido nucleico en la muestra para formar un complejo de la sonda de atrapamiento y el ácido nucleico a partir de M. kansasii y la sonda marcada, después, se determina la señal derivada de la sonda marcada (véase, por ejemplo, JP-A58-40099); y

(B-3) un procedimiento en el que se utiliza la sonda marcada con biotina de la presente invención, se lleva a cabo hibridación con ácido nucleico en la muestra, y, después, se atrapa el ácido nucleico derivado de M. kansasii en la muestra por un vehículo inmovilizado con avidina.

Debe indicarse que como el reactivo utilizado para el procedimiento para detectar M. kansasii de la presente invención, puede utilizarse el reactivo normalmente utilizado en este campo, por ejemplo, agente tampón, estabilizador, conservantes que no inhiban la estabilidad del reactivo coexistente ni tampoco la PCR o la reacción de hibridación. Además, la concentración del reactivo puede seleccionarse como adecuada a partir del intervalo de concentración normalmente utilizado en este campo.

Un ejemplo específico de solución tampón incluye todas las soluciones tampón normalmente utilizadas para llevar a cabo PCR y la reacción de hibridación en este campo, por ejemplo, tampón Tris, tampón de fosfato, tampón veronal, tampón de borato, tampón de good; y el pH de la solución de tampón no se limita particularmente, pero, en general, es preferente un intervalo entre pH 5 y pH 9.

Además, de surgir la necesidad, puede utilizarse la síntesis de ácido nucleico (ADN polimerasa, ARN polimerasa, transcriptasa inversa), el sustrato correspondiente a la enzima (dNTP, rNTP), y, además, el intercalador de doble hebra (bromuro de etidio, SYBR™ Green), y, alternativamente, la sustancia de detección de señal tal como FAM y TAMRA.

Un kit para detectar M. kansasii referido en la presente invención incluye "un kit para detectar M. kansasii que comprende un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii como un cebador (el cebador de la presente invención) y/o una sonda (la sonda de la presente invención)". El cebador puede ser el que se marca con una sustancia marcadora. El ejemplo específico de la sustancia marcadora está de acuerdo con lo descrito con anterioridad.

El kit que comprende el cebador de la presente invención también comprende una composición que comprende un par de un cebador directo y un cebador inverso. Las realizaciones preferentes son un kit que comprende un cebador directo de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 5, o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii; y un cebador inverso de un oligonucleótido que comprende una parte de la totalidad de la secuencia de la secuencia de nucleótidos representada en la SEQ ID Núm. 6 o una parte o la totalidad de la secuencia de una secuencia de nucleótidos complementaria a la secuencia de nucleótidos y que es capaz de hibridizarse con la secuencia de nucleótidos del gen de M. kansasii como el reactivo constituyente.

En el kit descrito con anterioridad, además, el oligonucleótido de la presente invención marcado con una sustancia marcadora puede estar contenido como una sonda marcada.

Además, se incluye "un kit para detectar M. kansasii que comprende el oligonucleótido de la presente invención como una sonda". La sonda mencionada con anterioridad puede ser la marcada con una sustancia marcadora.

Las realizaciones preferentes y los ejemplos específicos del reactivo constituyente que comprende estos kits están de acuerdo con lo descrito con anterioridad.

Debe indicarse que el kit para detectar M. kansasii de la presente invención puede comprender, por ejemplo, agente tampón, estabilizador, conservantes que no inhiban la estabilidad del reactivo coexistente ni tampoco la PCR o la reacción de hibridación. Además, las concentraciones de los reactivos pueden seleccionarse como adecuadas a partir del intervalo de concentración normalmente utilizado en este campo.

El ejemplo específico de solución tampón incluye todas las soluciones tampón normalmente utilizadas para llevar a cabo PCR y la reacción de Hibridación en este campo, por ejemplo, tampón Tris, tampón de fosfato, tampón veronal, tampón de borato, tampón de good; y el pH de la solución de tampón no se limita particularmente, pero, en general, es preferente un intervalo entre pH 5 y pH 9.

Además, de surgir la necesidad, puede utilizarse la sintesis de ácido nucleico (ADN polimerasa, ARN polimerasa, transcriptasa inversa), el sustrato correspondiente a la enzima (dNTP, rNTP), y, además, el intercalador de doble hebra (bromuro de etidio, SYBR™ Green), y, alternativamente, la sustancia de detección de señal tal como FAM y TAMRA.

En adelante, la presente invención se explicará en detalla por referencia a los siguientes Ejemplos.

Debe indicarse que todas las bacterias utilizadas en los Ejemplos son aislados clínicos, y que sus cepas bacterianas ya se han diferenciado por la morfología de la colonia y los varios ensayos bioquímicos convencionales realizados sobre la bacteria cultivada.

EJEMPLOS

Ejemplo Experimental 1: Selección de un clon derivado del genoma de M. kansasii. (1) Preparación de una muestra de ADN. En primer lugar, se recolectan colonias de M. kansasii (Mycobacterium kansasii) cultivadas en el medio de Ogawa y se suspenden en agua purificada y se purifican en autoclave (a 120°C bajo 2 atmósferas durante 20 minutos), y por medio de tratamiento de ruptura (ruptura física por el uso de perlas de vidrio de 2 mm de diámetro) seguido por centrifugación, se obtuvo la solución sobrenadante. A partir de la solución sobrenadante obtenida, se llevó a cabo la extracción y purificación de ADN por el uso de un kit de extracción y purificación de ADN de tipo resina de intercambio iónico, Genomic-tip (fabricado por QIAGEN GmbH), y se obtuvo ADN genómico derivado de M. kansasii.

El ADN purificado obtenido se ajustó para dar una concentración final de 400 ng/µl (en tampón Tris-HCl 10 mM, pH 8,9), y se utilizó como una muestra de ADN.

Por separado, por el uso de una secuencia específica de KATS2 para M. kansasii descrita en JP-A-11-155589 y una secuencia específica de M. tuberculosis (Mycobacterium tuberculosis: bacteria tuberculosa de tipo humano) designada como la SEQ ID Núm. 8 en la descripción de JP-A-2004-129272 (en la presente descripción, mostrada como la SEQ ID Núm. 81) como control positivo, y por el uso de ADN purificado derivado de E. coli preparado de acuerdo con el procedimiento convencional de extracción y purificación de ADN de E. coli como un control negativo, se prepararon muestras de ADN de la misma manera de acuerdo con lo descrito con anterioridad, y se utilizaron similarmente para el siguiente tratamiento.

(2) Preparación de la librería Aleatoria del Genoma. Por el uso de 24 µg de la muestra de ADN obtenida en el apartado (1) anterior como un material, la librería Aleatoria del Genoma se prepara por el siguiente procedimiento (un procedimiento Aleatorio del Genoma modificado, modificado a partir del procedimiento descrito en Venter et al., Science 2001 Feb 16; 291 (5507): 1304-1351).

La muestra de ADN se trató por el uso de un nebulizador (fabricado por Invitrogen) en presencia de una concentración final 20% de glicerol bajo una presión de 5 kPa a 9 kPa durante aproximadamente 10 minutos to fraccionar el ADN, y la fracción con el tamaño objetivo de 500 a 1.000 bp se recuperó eficientemente. La fracción obtenida se purificó por el uso de una columna de extracción (fabricada por QIAGEN GmbH).

Después, por el uso de un Kit de Embotamiento de ADN fabricado por Takara Bio Inc. y a través del uso de actividad de la polimerasa 5' → 3' y actividad de la exonucleasa 3' → 5' de la T4 ADN Polimerasa, se embotó el extremo terminal del ADN obtenido. Este ADN de extremo embotado se sometió a reacción de ligación con el vector sk+ pBSII sk+ de extremo embotado (Stratagene), y se preparó un ADN recombinante del vector sk+ pBSII (ampr) incorporado con el fragmento de ADN.

Se llevó a cabo la transformación de Células Competentes de E. coli JM109 (Takara Bio Inc.) por el uso del ADN recombinante obtenido con anterioridad de acuerdo con un protocolo del producto. El transformante obtenido con anterioridad se cultivó en una placa sobre un medio de LB-agarosa que contenía 100 µg/ml de ampicilina, 0,2 mM de IPTG y 40 µg/ml de X-Gal, y se recolectaron colonias blancas, y, así, se obtuvo una librería del transformante (clon Aleatorio del Genoma del genoma de M. kansasii) que se ha introducido con el ADN recombinante incorporado con el fragmento de ADN objetivo.

(3) Preparación de micromatriz

Por el uso del clon Aleatorio del Genoma del genoma de M. kansasii obtenido en el apartado (2) anterior, se llevó a cabo la PCR por el siguiente procedimiento, y se preparó el material de la sonda para fijarla sobre un portaobjetos de vidrio.

Se preparó una solución tampón de Tris-HCl 10 mM (pH 8,9) que contenía 1 µM del Cebador M1 M13 (Takara Bio Inc.) y Cebador RV M13 (Takara Bio Inc.), MgCl2 1,5 mM, KCl 80 mM, BSA 500 µg/ml, colato de sodio 0,1%, Triton X-100 0,1% (nombre comercial de éter de polioxietilen octilfenilo, Rohm and Haas Co.), 0,2 mM de cada dATP, dCTP, dGTP y dTTP, y 40 unidades/ml de Taq ADN polimerasa (Nippon Gene Co.) y se utilizó como una solución de reacción para PCR.

El ADN se purificó a partir del clon Aleatorio del Genoma del genoma de M. kansasii obtenido en el apartado

(1) anterior de acuerdo con el procedimiento convencional, y se añadió para su suspensión en 20 µl de la solución de reacción para PCR; y por el uso de esta suspensión como una muestra para PCR (actúa como una plantilla), se llevaron a cabo 30 ciclos de PCR bajo las siguientes condiciones por el uso de Ciclador Térmico de ADN (DNA Engine PTC200; MJ Research Inc.). Las condiciones de reacción de la PCR fueron: Desnaturalización térmica: 94°C durante 0,5 minutos; Alineamiento: 55°C durante 1 minuto; Reacción de polimerización: 75°C durante 0,5 minutos.

El producto de PRC obtenido se purificó, y después se mezcló con un tampón de inmovilización (concentración final: 3 x SSC).

Por el uso de un instrumento de tipeo (GTMAS Stamp II; Nippon Laser & Electronics); la concentración final del producto de PCR a observar se ajustó para dar 300 ng/µl; la humedad en el instrumento se ajustó a 55%; el producto de PCR obtenido se observó (diámetro de observación: 150 a 250 Pm) sobre un portaobjetos de vidrio (CMT GAPS-II; Coming Inc.). Una vez finalizada la observación, el portaobjetos de vidrio se transfirió a un reticulador UV (UV Stratalinker 1800; Stratagene Co.), y se irradió con 150 mJ/cm2 de luz UV para fijar el producto de PCR (el ADN objetivo) sobre el portaobjetos de vidrio, y, así, se preparó la micromatriz.

(4) Marcado fluorescente del ADN genómico diana e hibridación de la micromatriz.

i) Marcado fluorescente del ADN genómico diana. En primer lugar, por el uso de un sistema de marcado de ADN BioPrime (Invitrogen Co.), se mezclaron 2 µg de cada ADN genómico derivado de M. kansasii (ATCC12478) y un ADN genómico comparativo (bacteria tuberculosa de tipo bovina, ATCC19274) con 20 µl de solución cebadora aleatoria contenida en el producto, y se llevó a cabo el tratamiento de desnaturalización térmica (95°C durante 5 minutos).

Después, a cada mezcla tratada térmicamente, se añadieron 2 µl de DTT 0,1 M, 2 µl de la solución mezclada de dATP/dCTP/dGTP (cada una 5 mM), 0,8 µl de dTTP 2,5 mM, 1,6 µl de Ha-dUTP 5 mM y 1 µl de enzima de Klenow (40 U/µl) y se ajustaron para dar el volumen final de 50 µl con agua desionizada estéril, y después la reacción de extensión se llevó a cabo a 37°C durante 3 horas. Se dispuso una columna de ultrafiltración Microcon YM-30 (Millipore Co.) al tubo de 1,5 ml adjunto, y después el producto de reacción descrito con anterioridad se colocó sobre la columna y se centrifugó a 14.000 rpm durante 4 minutos. La solución concentrada se recuperó en un microtubo y se secó completamente por el uso de un secador centrífugo al vacío (CentriVap concentrator; Labconco Co.).

El producto de reacción seco obtenido se añadió con 10 µl de NaHCO3 50 mM y se mezcló, después se dejó a temperatura ambiente durante 2 a 3 minutos.

Por separado, se disolvió separadamente 1 mg de cada Cy3 (Amersham Biosciences) y Cy5 (Amersham Biosciences) en 105 µl de DMSO. Se añadieron 10 µl de la Solución Cy3 Cy-tinte al producto de reacción anterior obtenido por el uso del genoma comparativo (bacteria tuberculosa de tipo bovina) y se añadieron 10 µl de la Solución Cy5 Cy-tinte al producto de reacción anterior obtenido por el uso del genoma de M. kansasii, y cada mezcla de reacción se incubó (bajo protección lumínica) a 40°C durante 60 minutos.

Además, cada producto de reacción anterior se añadió con 10 µl de NH2OH 4 M (preparada inmediatamente antes del uso) y mezcló, y se incubó (bajo protección lumínica) durante 15 minutos para obtener el producto marcado respectivo, a saber, ADN genómico comparativo marcado con Cy3 (bacteria tuberculosa de tipo bovina) y se obtuvo ADN genómico de M. kansasii marcado con Cy5.

Se dispuso una columna de ultrafiltración Microcon YM-30 (Millipore Co.) al tubo de 1,5 ml adjunto, y después el producto marcado de ADN genómico obtenido con anterioridad se colocó sobre la columna y se centrifugó a 14.000 rpm durante 4 minutos. La solución concentrada se recuperó en un microtubo y se secó completamente por el uso de un secador centrífugo al vacío (CentriVap concentrator; Labconco Co.).

ii) Procedimiento de fragmentación del producto marcado. Al producto marcado de ADN genómico en estado seco obtenido en el apartado i) de (4) anterior, se añadieron 40 µl de una solución con una composición de concentraciones finales de Tris-acetato 0,04 M (pH 8.1), acetato de potasio 0,1 M, y tetrahidrato de acetato de magnesio 0,03 M y mezclaron en suspensión. La suspensión se trató térmicamente a 94°C durante 15 minutos, y se obtuvo el producto de fragmentación de cada ADN genómico marcado con 100 a 300 bases.

Se comprobó la eficiencia del marcado (base/tinte) por el uso de ADN polimerasa BcaBEST (Takara Bio Inc.) y ADN Polimerasa rBst (EPICENTRE Biotechnologies), y se confirmó la incorporación de una molécula de tinte en aproximadamente 20 bases del ADN genómico comparativo (bacteria tuberculosa de tipo bovina), y la incorporación de una molécula de tinte en aproximadamente 10 bases del ADN genómico de M. kansasii.

Cada solución de producto marcado con Cy3 y producto marcado con Cy5 se colocó por separado sobre una columna de ultrafiltración Microcon YM-30 (Millipore Co.) y se centrifugó a 14.000 rpm durante 4 minutos, y cada solución concentrada se recuperó en un microtubo, y después se secó completamente por el uso de un secador centrífugo al vacío (CentriVap concentrator; Labconco Co.). Después, se añadieron a un microtubo los siguientes reactivos (en el caso en que el portaobjetos para la micromatriz a utilizar a continuación sea de 24 x 55 mm), y el producto marcado con Cy3 y el producto marcado con Cy5 obtenidos con anterioridad se mezclaron en suspensión en la misma solución.

Tampón de Hibridación ArrayHyb (SIGMA); ADN de esperma de salmón 40 µl (10 mg/ml); formamida 0,5 µl; 5 µl Total 40 a 50 µl. Tras la mezcla en suspensión, la mezcla se incubó a 95°C durante 5 minutos, y se mantuvo a 70°C hasta su uso para hibridación.

iii) Hibridación de la micromatriz. Sobre una micromatriz (chip de ADN) preparada en el apartado (3) descrito con anterioridad, se colocó la solución total de la mezcla del producto marcado con Cy3 y del producto marcado con Cy5 obtenidos en el apartado ii) descrito con anterioridad de (4), y se recubrió con una cobertura de vidrio que mantiene el interior libre de burbujas de aire. La micromatriz se dispuso sobre un Hybri-cassette; se colocó en un Tupperware equipado con una Toalla Kim (Kim Towel) (Nippon Paper Crecia Co., Ltd.) mojada con agua destilada, y se cerró con firmeza; y se hizo reaccionar (bajo protección lumínica) a 65°C durante 8 horas o más para permitir la hibridación. Tras la hibridación, la micromatriz se empapó con una solución de 2 x SSC - SDS 0,1% junto con una cobertura de vidrio a temperatura ambiente, y se agitó cuidadosamente en la solución para eliminar la cobertura de vidrio. Tras el lavado secuencial con 1 x SSC y solución de SDS 0,03% (60°C) durante 10 minutos, solución 0,2 x SSC (42°C) durante 10 minutos y solución 0,05 x SSC (temperatura ambiente) durante 10 minutos, la micromatriz se transfirió rápidamente a un nuevo estante seco, y se secó inmediatamente por centrifugación a 800 rpm durante 5 minutos.

(5) Medición de la intensidad fluorescente: de la detección de la señal a la cuantificación. Por el uso de un escáner lector de fluorescencias (Protein Array Scanner; Nippon Laser & Electronics), se midió la intensidad fluorescente sobre la micromatriz obtenida en el apartado iii) anterior de (4), y se obtuvieron datos de detección de fluorescencia sobre la intensidad fluorescente del canal 2 de Cy3 y Cy5. La cuantificación de la señal fluorescente se llevó a cabo por el uso de DNASIS™-Array (un software de análisis de imágenes de expresión del chip de ADN; Hitachi Software Engineering Co.), y de acuerdo con el procedimiento de operación del software, se llevó a cabo un reconocimiento automático de manchas, un cálculo del fondo, y una normalización de la proporción de intensidad fluorescente. Además, por el establecimiento de una línea límite umbral de confiabilidad, y evitando cualquier valor inferior a esta línea, se obtuvo la proporción de intensidad fluorescente normalizada confiable.

Debe indicarse que el control positivo (el fragmento de ADN específico para M. tuberculosis y el fragmento de la secuencia KATS2 de M. kansasii) y el control negativo (el fragmento de ADN derivado de E. coli) se habían observado sobre la micromatriz.

Además, por el propósito de evaluar una secuencia candidata de uso en la detección específicamente de M. kansasii, con base en la proporción de intensidad fluorescente de Cy3/Cy5 (Proporción) detectada sobre el chip de ADN, se llevó a cabo el análisis del diagrama de dispersión. Los resultados se muestran en la Fig. 2.

A modo de comparación, la secuencia KATS2 de M. kansasii descrita en JP-A-1999-155589 y la secuencia representada en la SEQ ID Núm. 8 (SEQ ID Núm. 81 en esta especificación) derivada de M. tuberculosis descrita en la descripción de JP-A-2004-129272 se trataron en la misma forma, y se determinaron las intensidades fluorescentes de Cy3 y Cy5. Los resultados se muestran colectivamente en la in Fig. 2.

En la Fig. 2, se muestran la totalidad del diagrama de dispersión y la vista explotada de una parte en la que se concentran las tinciones (señaladas con un círculo de líneas punteadas). El diagrama de dispersión se muestra un doble gráfico logarítmico, como un trazado de la intensidad fluorescente de Cy5 sobre el eje vertical para la intensidad fluorescente de Cy3 sobre el eje horizontal. En la Fig. 2, las tinciones que no son (2) y (3) muestran los resultados de cuando se utilizó el producto de PCR sobre cada micromatriz; la tinción señalada como (2) muestra los resultados de cuando se utilizó la secuencia KAS de M. kansasii descrita en JP-A-11-155589; y la tinción señalada como (3) muestra los resultados de cuando se utilizó la secuencia de nucleótidos representada en la SEQ ID Núm. 8 (SEQ ID Núm. 81 en esta memoria) derivada de M. tuberculosis descrita en la descripción de la Solicitud JP Núm. 2004-129272.

Además, cada línea de la Fig. 2 tiene el siguiente significado.

(a): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 10.

(b): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 5,0;

(c): La línea que indica: una proporción Cy5/Cy3 de intensidad fluorescente ≥ 2,0;

(a'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 10,0;

(b'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 5,0;

(c'): La línea que indica: una proporción Cy3/Cy5 de intensidad fluorescente ≥ 2,0.

Esto significa que, la tinción ubicada en una posición superior a la línea (a) indica que la intensidad fluorescente de Cy5 es 10 o más veces mayor en comparación con aquella de Cy3; la tinción ubicada en una posición superior a la línea (b) indica que la intensidad fluorescente de Cy5 es 5 a 10 veces mayor en comparación con aquella de Cy3; y la tinción ubicada en una posición superior a la línea (c) indica que la intensidad fluorescente de Cy5 es 2 a 5 veces mayor en comparación con aquella de Cy3. Además, la tinción ubicada en una posición inferior a la línea (a') indica que la intensidad fluorescente de Cy3 es 10 o más veces mayor en comparación con aquella de Cy5; la tinción ubicada en una posición inferior a la línea (b') indica que la intensidad fluorescente de Cy3 es 5 a 10 veces mayor en comparación con aquella de Cy5; y la tinción ubicada en una posición inferior a la línea (c') indica que la intensidad fluorescente de Cy3 es 2 a 5 veces mayor en comparación con aquella de Cy5.

Como se evidencia a partir de la Fig. 2, la tinción (3) ubicada entre la línea (b') y la línea (a') indica que la intensidad fluorescente de Cy3 es 5 a 10 veces mayor en comparación con aquella de Cy5, y esta tinción puede reconocerse como hibridizada con el ADN genómico de M. tuberculosis de tipo bovina. Por el otro lado, la tinción (2) ubicada entre la línea (c) y la línea (b) indica que la intensidad fluorescente de Cy5 es 2 a 5 veces mayor en comparación con aquella de Cy3, y esta tinción puede reconocerse como hibridizada con el ADN genómico de M. kansasii.

Debe indicarse que en el caso en que se utiliza el ADN genómico de E. coli como un control, la proporción de intensidad fluorescente de Cy5/Cy3 fue de aproximadamente 1, y la tinción sobre el diagrama de dispersión se ubicó en una posición muy baja, y, por lo tanto, la tinción no se muestra en la Fig. 2.

En la presente, en la Fig. 2, entre el producto de micromatriz de PCR detectado por evaluación, a las 8 tinciones señaladas con círculos como (1) (en apariencia, sólo existen 5 tinciones, pero de hecho existen 8 tinciones dado que algunas están superpuestas) se les detectó una mayor intensidad fluorescente de Cy5 que (2), y, por el hecho descrito con anterioridad, la especificidad de (1) para M. kansasii se juzgó superior a la de (2) (la secuencia KATS2 de

M. kansasii descrita en JP-A-11-155589). Por lo tanto, estos 8 clones se seleccionaron como el clon candidato.

(6) Determinación de la secuencia de nucleótidos del clon candidato. La secuencia de nucleótidos de los 8 clones candidato seleccionados en el apartado (5) anterior se llevó a cabo por el procedimiento descrito a continuación.

Esto significa que, por el uso del kit Big Dye Terminator (Applied Biosystems), el análisis de la secuencia se llevó a cabo por los siguientes procedimientos de acuerdo con el protocolo del producto.

El ADN candidato (el clon candidato); 2 µl (100 ng) Cebador M1 M13; 1 µl (5 pmol) Premezcla; 8 µl. A la mezcla anterior, se añadió agua desionizada estéril para generar el volumen total de 20 µl, y después se llevaron a cabo 30 ciclos de la reacción de secuenciación bajo las siguientes condiciones de reacción por el uso del Ciclador Térmico de ADN (DNA Engine PTC200, MJ Research Inc.): 96°C durante 2 min → (96°C durante 10 s → 50°C durante 5 s → 60°C durante 4 min) x 25 → 4°C.

El producto de reacción de secuenciación obtenido se purificó por el uso de una columna de filtración en gel (QIAGEN GmbH), y después, por el uso de un secuenciador (BaseStation, MJ Research Inc.) se llevó a cabo el mapeo de secuencia de toda la secuencia candidata de acuerdo con el manual de operación provisto por el secuenciador.

Los datos obtenidos se buscaron en la base de datos (NCBI Blast) y se halló que los 8 clones candidato eran secuencias nuevas no registradas en la base de datos. Supuestamente, esto puede atribuirse al hecho de que M. kansasii es una especie de organismo con una secuencia genómica no descifrada.

Ejemplo 1: Evaluación de la especificidad del clon candidato para M. kansasii

Los 8 clones candidato obtenidos en el Ejemplo Experimental 1 se evaluaron por la puesta en práctica de un experimento de detección por electroforesis en gel de agarosa en combinación con el sistema de amplificación por PCR para su disponibilidad para el sistema de detección específico de M. kansasii por el uso de un sistema de detección de amplificación de ácido nucleico.

(1) La síntesis del cebador para PCR

En primer lugar, con base en el resultado del análisis de la secuencia del clon candidato 1, la secuencia del cebador para la detección de la amplificación por PCR se diseñó por el uso de una herramienta web para el diseño de cebadores, Primer 3 (Whitehead Institute for Biomedical Research). Por el uso de "CGGCCATTGTTCTACAGTCT" (SEQ ID Núm. 5; en adelante denominada 1c_ plate1_FW1) y "TAGAGATCCATCGCTTTGGT" diseñadas (SEQ ID Núm. 6; en adelante denominada 1c_plate1_Rv1), la PCR se llevó a cabo de acuerdo con lo descrito a continuación. El oligonucleótido diseñado se sintetizó por el procedimiento de fosfoamidita por el uso del sintetizador de ADN ABI 392 (Applied Biosystems Inc.). Los procedimientos sintéticos se llevaron a cabo de acuerdo con el manual provisto por ABI, y la desprotección de varios tipos de oligonucleótidos se llevó a cabo por el calentamiento de la solución de amoníaco del oligonucleótido a 55ºC hasta el día siguiente. Después, el oligonucleótido sintetizado se purificó por la cromatografía en columna de intercambio iónico por el uso de Pharmacia FPLC.

Debe indicarse que la secuencia de nucleótidos obtenida a partir del resultado del análisis de la secuencia del clon candidato 1 es la secuencia representada en la SEQ ID Núm. 1.

(2) Preparación de muestras. Por el uso de las siguientes bacterias, se llevó a cabo la extracción y purificación del ADN por el procedimiento descrito a continuación, y se obtuvieron muestras de ADN. Todas las bacterias utilizadas en los Ejemplos son aislados clínicos, y sus cepas bacterianas ya se habían diferenciado por la morfología de la colonia y los varios ensayos bioquímicos convencionales realizados sobre la bacteria cultivada.

a: Escherichia coli; b: Mycobacterium tuberculosis; c: Mycobacterium kansasii; d: Mycobacterium marinum; e: Mycobacterium simiae; f: Mycobacterium scrofulaceum; g: Mycobacterium gordonae; h: Mycobacterium szulgai; i: Mycobacterium avium; j: Mycobacterium intracellulare; k: Mycobacterium gastri; l: Mycobacterium xenopi; m: Mycobacterium nonchromogenicum; n: Mycobacterium terrae; o: Mycobacterium triviale; p: Mycobacterium fortuitum; q: Mycobacterium chelonei; r: Mycobacterium abscessus; s: Mycobacterium peregrinum.

En primer lugar, en cuanto al género de bacterias Mycobacterium, se recolectaron colonias cultivadas sobre el medio de Ogawa y se suspendieron en agua purificada y se purificaron en autoclave (a 120°C bajo 2 atmósferas durante 20 minutos), y por medio de tratamiento de ruptura (ruptura física por el uso de perlas de vidrio de 2 mm de diámetro) seguido por centrifugación, se obtuvo la solución sobrenadante. A partir de la solución sobrenadante obtenida, se llevó a cabo la extracción y purificación del ADN por un kit de extracción y purificación de ADN de tipo de resina de intercambio iónico Genomic-tip (QIAGEN GmbH). En cuanto a E. coli, se llevó a cabo la extracción y purificación del ADN de acuerdo con el procedimiento convencional del procedimiento de extracción de ADN de E. coli.

El ADN purificado obtenido se ajustó para dar una concentración final de 1 ng/µl (tampón Tris-HCl 10 mM, pH 8,9), y se utilizó como una muestra de ADN.

(3) PCR. La PCR se llevó a cabo de acuerdo con lo presentado a continuación por el uso de las secuencias del cebador de 1c_plate1_Fw1 y 1c_plate1_Rv1 que se diseñaron y sintetizaron por el procedimiento descrito con anterioridad con base en la secuencia de nucleótidos (SEQ ID Núm. 1) del clon candidato. Debe indicarse que, la posición en que se ubica cada cebador sobre la secuencia de nucleótidos del clon candidato 1 es la mostrada en la Fig.

1.

Se preparó una solución tampón de Tris-HCl 10 mM (pH 8,9) que contenía 1 µM del cebador 1c_plate1_Fw1 y del cebador 1c_plate1_Rv1, MgCl2 1,5 mM, KCl 80 mM, BSA 500 µg/ml, colato de sodio 0,1%, Triton X-100 0,1% (nombre comercial de éter de polioxietilen octilfenilo; Rohm and Haas Co.), 0,2 mM de cada dATP, dCTP, dGTP and dTTP, y 40 unidades/ml de Taq ADN polimerasa (Nippon Gene Co.) y se utilizó como una solución de reacción para PCR.

A 20 µl de la solución de reacción para PCR se añadió 1 ng de la muestra de ADN, y por el uso de esta solución como una muestra para PCR, se llevaron a cabo 30 ciclos de PCR bajo la siguiente condición por el uso del Ciclador Térmico de ADN (DNA Engine PTC200; MJ Research Inc.).

Las condiciones de reacción de la PCR fueron: Desnaturalización térmica: 94°C durante 0,5 minutos; Alineamiento: 55°C durante 1 minuto; Reacción de polimerización: 75°C durante 0,5 minutos.

(4) Electroforesis. A 5 µl de la solución de reacción obtenida tras la PCR en el apartado (3) anterior se sometió a electroforesis sobre gel de agarosa 1,5%. Las condiciones de la electroforesis consistieron en un voltaje constante de 100 V durante 30 minutos. El procedimiento de operación y otras condiciones estaban de acuerdo con el procedimiento general descrito en Bio Experiment Illustrated, vol. 2, p53-63, por Hiroki Nakayama (Shujunsha Co., Ltd.). Después, tras teñir el gel con bromuro de etidio, se detectó la señal fluorescente inducida por luz UV por el uso de un dispositivo fotográfico de muestras UV FAS-III System (Toyobo Co., Ltd.). Asimismo, el marcador del peso molecular se sometió a electroforesis simultáneamente en paralelo con la solución de reacción, y, así, la longitud del fragmento de ADN detectado se calculó por la comparación de la movilidad relativa. En este respecto, digesto X174/HaeIII (Marcador 4; Nippon Gene Co., Ltd.) se utilizó como el marcador del peso molecular.

Los resultados obtenidos por la electroforesis se muestran en la Fig. 3.

En la Fig. 3, las letras presentadas sobre cada línea indican los resultados cuando se utilizaron las siguientes muestras: M4: marcador del peso molecular (Marcador 4); a: Escherichia coli; b: Mycobacterium tuberculosis; c: Mycobacterium kansasii; d: Mycobacterium marinum; e: Mycobacterium simiae; f: Mycobacterium scrofulaceum; g: Mycobacterium gordonae; h: Mycobacterium szulgai; i: Mycobacterium avium; j: Mycobacterium intracellulare; k: Mycobacterium gastri; l: Mycobacterium xenopi; m: Mycobacterium nonchromogenicum; n: Mycobacterium terrae; o: Mycobacterium triviale; p: Mycobacteriumfortuitum; q: Mycobacterium chelonei; r: Mycobacterium abscessus; s: Mycobacterium peregrinum.

Por la PCR en la que se utiliza el cebador directo 1c_plate1_Fw1 y el cebador inverso 1c_plate1_Rv1, se esperaba la replicación del fragmento de ADN con 167 pares de base (SEQ ID Núm. 53) en la secuencia candidata 1 que se ubica en el genoma de M. kansasii. Por lo tanto, aquella en la que se confirmó la banda fluorescente de 167 pares de base se determinó positiva.

Como se evidencia a partir de los resultados mostrados en la Fig. 3, en la PCR llevado a cabo por el uso del cebador 1c_plate1_Fw1 y el cebador 1c_plate_Rv1 de la presente invención, sólo cuando se utilizó M. kansasii como una muestra (c), se confirmó la banda fluorescente de 167 pares de base, y podría determinarse que la muestra es positiva. Por el contrario, cuando se utilizaron como una muestra (a, b, d-s) las otras bacterias Mycobacterium y la bacteria perteneciente a otro género tal como E. coli, no se confirmó la banda fluorescente correspondiente, y podría determinarse que la muestra es negativa.

A partir de los resultados obtenidos con anterioridad, puede probarse que el clon candidato 1 es un oligonucleótido que comprende la secuencia de nucleótidos específica de M. kansasii y por la puesta en práctica de la PCR por el uso del cebador diseñado con base en esta secuencia, puede detectarse M. kansasii específicamente. Además, dado que puede esperarse que la detección por amplificación de ácido nucleico tal como PCR sea altamente sensible, no es necesario el aislamiento de la bacteria y el espécimen clínico puede utilizarse directamente para la detección. En consecuencia, la detección de M. kansasii, que solía tomar varias semanas por el procedimiento convencional en el que es necesario el cultivo bacteriano antes de llevarse a cabo la detección, puede terminarse como máximo en un día.

Ejemplo 2: Detección de M. kansasii por el sistema de PCR en tiempo real.

(1) Síntesis del cebador PCR para la detección de M. kansasii. Por el uso del mismo equipamiento y por el mismo procedimiento descrito en el apartado (1) del Ejemplo 1, se sintetizaron los oligonucleótidos de 1c_plate1_Fw1 (SEQ ID Núm. 5) y 1c_plate1_Rv1 (SEQ ID Núm. 6).

(2) Preparación de la sonda para la detección de M. kansasii. A partir de la secuencia de nucleótidos representada en la SEQ ID Núm. 53 (167 pares de base) a amplificar por PCR por el uso de 1c_plate1_Fw1 y 1c_plate1_Rv1 como cebadores, se diseñó una secuencia a utilizar como una sonda "ACTCAATGCCCTTCGATCCCGGCGAAC", y se sintetizó un oligonucleótido que comprende esta secuencia (en adelante, denominada KAN1c_F1R1_FAMTAM; SEQ ID Núm.: 80). El extremo terminal 5' de este oligonucleótido se marcó con un tinte reportero de FAM y el extremo terminal 3' se marcó con un inactivador reportero de TAMRA, y así, se obtuvo una sonda de un oligonucleótido marcado (TaqMan™ Fluorescent Probe; Applied Biosystems Japan).

(3) Preparación de la muestra de ADN para PCR. Se midió la absorbancia de la muestra de ADN preparada a partir de un espécimen de M. kansasii en el apartado (1) del Ejemplo Experimental 1 para determinar la cantidad del ADN en la muestra. La cantidad del ADN (número de copia del genoma) en la muestra se determinó por la comparación de la cantidad obtenida de ADN con la cantidad conocida del ADN genómico de M. kansasii. Se obtuvieron 108 copias/µl del ADN genómico. Después, se preparó la serie de disoluciones de la muestra de ADN de 105, 104, 103, 102, 10, 5 y 2 copias/µl por el uso de tampón de Tris-HCl 10 mM, pH 8,9, y se utilizó como una muestra de ADN para PCR.

(4) PCR en tiempo real. Por el uso de 1c_plate1_Fw1 preparado en el apartado (1) descrito con anterioridad como el cebador directo y 1c_plate1_Rv1 preparado en el apartado (1) descrito con anterioridad como el cebador inverso, se llevó a cabo la PCR en tiempo de acuerdo con lo presentado a continuación.

Esto significa que, se preparó una solución tampón de Tris-HCl 10 mM (pH 8,9) que contenía 1 µM de cada cebador 1c_plate1_Fw1 y cebador 1c_plate1_Rv1, 195 nM de la sonda marcada con fluorescencia KAN1c_F1R1_FAMTAM preparada en el apartado (2) anterior, MgCl2 1,5 mM, KCl 80 mM, BSA 500 µg/ml, colato de sodio 0,1%, Triton X-100 0,1% (nombre comercial de éter de polioxietilen octilfenilo; Rohm and Haas Co.), 0,2 mM de cada dATP, dCTP, dGTP and dTTP, y 40 unidades/ml de Taq ADN polimerasa (Nippon Gene Co.) y se utilizó como una solución de reacción.

A 20 µl de la solución de reacción se les añadió 1 µl de cada serie de disolución de la muestra de ADN y se los utilizó como una muestra para PCR. Esta muestra para PCR se colocó en cada pocillo de una placa de reacción de 96 pocillos (MicroAmp Optical 96-well Reaction Plate; Applied Biosystems Japan Ltd.), y la PCR en tiempo real se llevó a cabo por el uso de un ciclador/detector térmico dedicado para la PCR TaqMan™ (ABI 7500, Applied Biosystems Japan Ltd.). La reacción se repitió en 50 ciclos de un ciclo de reacción compuesto por calentamiento a 95°C durante 10 minutos, seguido por calentamiento a 95°C durante 15 segundos y 60°C durante 1 minuto, y en cada ciclo, se midió la intensidad fluorescente del tinte reportero. Además, se midió la intensidad fluorescente y se digitalizó por el uso del ciclador térmico y el uso de la función provista de digitalización de la proporción de intensidad fluorescente relativa de cada uno de los 96 pocillos de la placa de reacción.

(5) Resultados. A partir de los datos obtenidos, se generó una curva estándar de acuerdo con el procedimiento convencional comúnmente empleado en el procedimiento de PCR en tiempo real.

Esto significa que, para cada una de las muestras de ADN para PCR, se trazó la intensidad fluorescente del tinte reportero (Rn, eje de y) para cada número de ciclo de PCR (eje x) para hacer una curva de amplificación. Después, se seleccionó una parte Rn en la que la intensidad fluorescente se amplifica exponencialmente, y se trazó una línea umbral (Th). El punto de cruce de la Th con la intensidad fluorescente de cada muestra de ADN para PCR se definió como ciclo umbral (Ct). Después, el valor Ct (eje de y) se trazó para el número de copia del genoma de cada muestra de ADN utilizada para PCR (eje de x), y una curva aproximada obtenida para cada Ct se utilizó como una curva estándar. La curva estándar se mostró en la Fig. 4.

**(Ver fórmula)**

A partir del hecho de que la señal fluorescente se detectó por PCR de acuerdo con lo descrito con anterioridad, se confirma que M. kansasii puede detectarse por la puesta en práctica de la PCR en tiempo real, por el uso del oligonucleótido de la presente invención para la PCR como un cebador, y por el diseño de una sonda marcada con base en la secuencia de la región a amplificar.

Además, también se confirmó que dado que puede generarse la curva estándar, la determinación de M. kansasii es posible por la PCR en tiempo real por el uso del cebador y la sonda de la presente invención. Además, puede comprenderse a partir de la Fig.7 que el procedimiento de PCR en tiempo real por el uso del cebador y la sonda de la presente invención puede detectar M. kansasii incluso bajo la condición en la que sólo estén presentes 2 copias del ADN genómico de M. kansasii como la cantidad inicial.

Además, cuando se utiliza el procedimiento de PCR en tiempo real, dado que la intensidad fluorescente se monitorea en tiempo real, la determinación cuantitativa de la cantidad inicial de la plantilla de ADN puede llevarse a cabo en forma más precisa, y el procedimiento se considera efectivo para detectar M. kansasii.

APLICABILIDAD INDUSTRIAL

5 El procedimiento para detectar Mycobacterium kansasii por el uso del cebador y/o sonda de la presente invención permite la detección de M. kansasii más rápidamente y con mayor precisión comparada con un procedimiento convencional de identificación de bacterias llevado a cabo por la examinación de cultivo sobre una bacteria. Además, el procedimiento para detectar M. kansasii de la presente invención puede excluir cualquier falso resultado positivo para el diagnóstico y también puede detectar y diagnosticar M. kansasii con mayor precisión en comparación con un procedimiento de diagnóstico llevado a cabo por PCR por el uso de un cebador y/o sonda convencional. Además, el procedimiento para detectar M. kansasii de la presente invención puede cuantificar las células M. kansasii.

LISTADO DE SECUENCIAS

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**

**(Ver fórmula)**




Reivindicaciones:

1. Un oligonucleótido específico de Mycobacterium kansasii para la detección de Mycobacterium kansasii que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1 o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos.

2. Un cebador para detectar Mycobacterium kansasii, que comprende un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada a partir de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1, y en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii.

3. El cebador de acuerdo con la reivindicación 2, en el que el cebador está marcado con una secuencia marcadora.

4. El cebador de acuerdo con la reivindicación 3, en el que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente o biotina.

5. Una sonda para detectar Mycobacterium kansasii, que comprende un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm.1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada a partir de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm. 1, y en el que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii.

6. La sonda de acuerdo con la reivindicación 5, en la que la sonda está marcada con una sustancia marcadora.

7. La sonda de acuerdo con la reivindicación 6, en la que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente o biotina.

8. La sonda de acuerdo con la reivindicación 5, en la que el extremo terminal 5' está marcado con un tinte fluorescente reportero y el extremo terminal 3' está marcado con un tinte desactivante.

9. Un procedimiento para detectar Mycobacterium kansasii que comprende utilizar un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm.1, y

en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos de Mycobacterium kansasii, como un cebador, y/o un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos representada en la SEQ ID Núm.1, o

un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en el que el oligonucleótido es una parte de un oligonucleótido que comprende una secuencia de nucleótidos complementaria a la secuencia de nucleótidos representada en la SEQ ID Núm.1, y

en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos de Mycobacterium kansasii, como una sonda.

10. El procedimiento de detección de acuerdo con la reivindicación 9, que comprende;

llevar a cabo una reacción de amplificación de ácido nucleico con el uso como un cebador de un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii; y

utilizar un ácido nucleico en una muestra como una plantilla; y

detectar un producto de extensión del cebador.

11. El procedimiento de detección de acuerdo con la reivindicación 9, en el que el procedimiento comprende los siguientes procedimientos:

(1) llevar a cabo una reacción de amplificación de ácido nucleico con el uso como un cebador de un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, en la que el oligonucleótido es capaz de hibridizarse con una secuencia de nucleótidos del gen de Mycobacterium kansasii, y utilizar un ácido nucleico en una muestra como una plantilla; y

(2) llevar a cabo electroforesis del producto de extensión del cebador obtenido en el apartado anterior (1), y detectar Mycobacterium kansasii sobre la base del resultado obtenido.

12. El procedimiento de detección de acuerdo con la reivindicación 11, que además comprende después de llevar a cabo electroforesis, confirmar una fracción del producto de extensión del cebador que tenga el número objetivo de pares de base en la fracción electroforética obtenida, en la que el número objetivo de pares de base sea el número de pares de base del producto de extensión del cebador, que se espera sea replicado por PCR por el uso del cebador directo y el cebador inverso.

13. El procedimiento de detección de acuerdo con la reivindicación 11, que además comprende, después de la electroforesis, hibridizar la fracción electroforética obtenida con una sonda marcada preparada por el marcado de un oligonucleótido con una sustancia marcadora, en la que el oligonucleótido comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, y es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii;

detectar una señal derivada de la sonda marcada, y

determinar la muestra que está confirmada que tiene una fracción hibridizada con la sonda marcada mencionada con anterioridad, que es positiva.

14. El procedimiento de detección de acuerdo con la reivindicación 13, en el que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente, una sustancia luminiscente y biotina.

15. El procedimiento para detectar Mycobacterium kansasii de acuerdo con la reivindicación 9, en el que el cebador está marcado con una secuencia marcadora; y

el procedimiento incluye un procedimiento para llevar a cabo una reacción en cadena de polimerasa por el uso de un cebador marcado y un ácido nucleico en una muestra como una plantilla, y medir una señal derivada del producto de extensión del cebador obtenido.

16. El procedimiento de detección de acuerdo con la reivindicación 15, en el que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente, una sustancia luminiscente y biotina.

17. El procedimiento de detección de acuerdo con la reivindicación 15, que además comprende después de llevar a cabo la reacción en cadena de polimerasa, eliminar un cebador marcado libre, y medir la señal derivada del producto de extensión del cebador.

18. El procedimiento de detección de acuerdo con la reivindicación 17, en el que el cebador marcado libre se elimina por la eliminación de un sobrenadante después de la precipitación del producto de extensión del cebador en el producto de reacción que se obtiene llevando a cabo una reacción en cadena de la polimerasa.

19. El procedimiento de detección de acuerdo con la reivindicación 17, en el que el cebador marcado libre se elimina por el tratamiento del producto de reacción, que se obtiene llevando a cabo una reacción en cadena de la polimerasa, con cromatografía en gel.

20. El procedimiento para detectar Mycobacterium kansasii de acuerdo con la reivindicación 9, que comprende;

hibridizar una sonda marcada preparada por la marcación del oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii con una sustancia marcadora,

eliminar una sonda marcada libre, y

detectar una señal derivada de un complejo hibridizado.

21. El procedimiento de detección de acuerdo con la reivindicación 20, en el que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente, una sustancia luminiscente y biotina.

22. Un kit para detectar Mycobacterium kansasii, que comprende un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12 como un cebador, y/o un oligonucleótido que comprende una secuencia de nucleótidos seleccionada de una secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80, o una secuencia de nucleótidos complementaria a la secuencia de nucleótidos seleccionada de la secuencia de nucleótidos representada en la SEQ ID Núm. 5 a 12, 53 a 56 y 80 como una sonda, en la que el oligonucleótido es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii gene, como un cebador y/o una sonda.

23. El kit de acuerdo con la reivindicación 22, en el que el cebador y/o la sonda están marcados con una sustancia marcadora.

24. El kit de acuerdo con la reivindicación 23, en el que la sustancia marcadora se selecciona de un radioisótopo, una enzima, una sustancia fluorescente, una sustancia luminiscente y biotina.

25. El kit de acuerdo con la reivindicación 23, en el que la sonda es aquella en la que el extremo terminal 5' está marcado con un tinte fluorescente reportero y el extremo terminal 3' está marcado con un tinte inactivador.

26. Uso de un oligonucleótido para diseñar un cebador o una sonda para la detección de Mycobacterium kansasii, en el que el oligonucleótido comprende una secuencia de nucleótidos representada en la SEQ ID Núm. 1, o una secuencia complementaria a la secuencia de nucleótidos, y que es capaz de hibridizarse con la secuencia de nucleótidos del gen de Mycobacterium kansasii.





Acerca de · Contacto · Patentados.com desde 2007 hasta 2014 // Última actualización: 30/10/2014.