Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.

Un procedimiento para diagnosticar si un sujeto tiene cáncer de pulmón, que comprende la medición del nivel de los productos génicos de miR en una muestra de ensayo de tejido pulmonar dicho sujeto

, en el que una alteración del nivel del producto génico de miR en la muestra de ensayo, con respecto al nivel correspondiente de los productos génicos de miR en una muestra de control, es indicativa de que el sujeto tiene cáncer de pulmón en el que los productos génicos de miR comprenden un grupo de productos génicos de miR, consistiendo dicho grupo en miR- 21, miR-191, miR-155, miR-210, miR-126* y miR-224; y.en el que el nivel de los productos génicos miR-21, miR-191, miR-155 and miR-210 en la muestra de ensayo es mayor que el correspondiente producto génico de miR en la muestra de control y en el que el nivel de los productos génicos miR-126* and miR-224 en la muestra de ensayo es menor que el nivel del correspondiente producto géico de miR en la muestra de control.

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E12165740.

Solicitante: THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION.

Inventor/es: CROCE, CARLO, YANAIHARA,NOZOMU, HARRIS,CURTIS.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K38/00 (Preparaciones medicinales que contienen péptidos (péptidos que contienen ciclos beta-lactama A61K 31/00; dipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina 2,5-dionas, A61K 31/00; péptidos basados en la ergolina A61K 31/48; que contienen compuestos macromoleculares que tienen unidades aminoácido repartidas estadísticamente A61K 31/74; preparaciones medicinales que contienen antígenos o anticuerpos A61K 39/00; preparaciones medicinales caracterizadas por los ingredientes no activos, p. ej. péptidos como soportes de fármacos, A61K 47/00))
google+ twitter facebookPin it
Ilustración 1 de Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.
Ilustración 2 de Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.
Ilustración 3 de Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.
Ilustración 4 de Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.
Ver la galería de la patente con 8 ilustraciones.
Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón.

Texto extraído del PDF original:

DESCRIPCIÓN

Procedimientos basados en los microARN para el diagnóstico, pronóstico y tratamiento del cáncer de pulmón

Apoyo Gubernamental Esta invención se llevó a cabo con el apoyo, en todo o en parte, con la subvención CA76259 y los fondos propios de CCR/NCI/NIH y por los fondos Federales de NCI/NIH bajo el Contrato Nº NO1-CO-12400. El Gobierno tiene ciertos derechos en esta invención.

Antecedente de la invención El cáncer de pulmón causa más muertes en todo el mundo que cualquier otra forma de cáncer (Goodman, G.E., Thorax 57: 994-999 (2002)). En los Estados Unidos, el cáncer de pulmón es la primera causa de muerte por cáncer tanto entre hombres como entre mujeres. En 2002, la tasa de mortalidad por cáncer de pulmón se estimó en 134.900 muertes. El cáncer de pulmón también encabeza las muertes por cáncer en todos los países europeos y el número de muertes relacionadas con el cáncer de pulmón está aumentando rápidamente en los países en desarrollo. La tasa de supervivencia a los cinco años entre todos los pacientes de cáncer de pulmón, sin tener en cuenta el estadio de la enfermedad en el momento del diagnóstico, es solo de aproximadamente el 13 %. Esto contrasta con una tasa de supervivencia a los cinco años del 46 % entre los casos detectados cuando la enfermedad está aún localizada. Sin embargo, solo el 16 % de los cánceres de pulmón se descubren antes de que la enfermedad se haya extendido. La detección precoz es difícil porque los síntomas clínicos a menudo no se observan hasta que la enfermedad alcanza un estadio avanzado. Normalmente, el diagnóstico se ayuda del uso de radiografías de tórax, el análisis del tipo de células que contiene el esputo y el examen del tracto bronquial con fibra óptica. Los regímenes de tratamiento se determinan por el tipo y estadio del cáncer, e incluyen la cirugía, la radioterapia y/o la quimioterapia. A pesar de las considerables investigaciones en terapias para este y otros tipos de cáncer, el cáncer de pulmón sigue siendo difícil de diagnosticar y tratar eficazmente. Por lo tanto, existe una gran necesidad de mejores procedimientos para detectar y tratar tales cánceres.

El análisis sistemático del ARNm y los niveles de expresión de proteínas entre miles de genes ha contribuido a definir la red molecular de la carcinogénesis pulmonar (Meyerson y Carbone, J Clin. Oncol. 23: 3219-3226 (2005); Granville y Dennis, Cell Mol. Biol. 32: 169-176 (2005)). Por ejemplo, son comunes los defectos en las rutas p53 y RB/p16 en el cáncer de pulmón. Varios genes distintos, tales como K-ras, PTEN, FHIT y MYO18B, están alterados genéticamente en los cánceres de pulmón, aunque menos frecuentemente (Minna y col., Cancer Cell 1: 49-52 (2002); Sekido y col., Annu. Rev. Med. 54:73-87 (2003); Yokota y Kohno, Cancer Sci. 95: 197-204 (2004)). Aunque centrarse en los genes y proteínas conocidos ha dado una información útil, también se puede prestar atención a marcadores de cáncer de pulmón desconocidos previamente en la biología del cáncer de pulmón.

Los microARN (miARN) son una clase de ARN pequeños, no codificantes que controlan la expresión génica hibridándose con y desencadenando la represión traduccional o, menos frecuentemente, la degradación de un ARN mensajero (ARNm) diana. El descubrimiento y estudio de los miARN han revelado mecanismos génicos reguladores mediados por miARN que tienen papeles importantes en el desarrollo de organismos y varios procesos celulares, tales como diferenciación celular, crecimiento celular y muerte celular (Cheng, A.M. y col., Nucleic Acids Res. 33: 1290-1297 (2005)). Los estudios recientes sugieren que la expresión aberrante de miARN particulares puede estar implicada en enfermedades humanas, tales como trastornos neurológicos (Ishizuka, A. y col., Genes Dev. 16: 2497- 2508 (2002)) y cáncer. En particular, se ha descubierto una expresión errónea de miR-16-1 y/o miR-15a en leucemias linfocíticas crónicas (Calin, G.A. y col., Proc. Natl. Acad. Sci. U.S.A. 99: 15524-15529 (2002)). El documento WO 2005/118806 divulga procedimientos y composiciones para aislar, enriquecer y / o marcar las moléculas de miARN y para preparar y usar matrices u otras técnicas de detección para el análisis miARN. Además, el documento WO 2005/118806 se refiere a procedimientos y composiciones para la generación de perfiles de miARN y el empleo de tales perfiles para aplicaciones terapéuticas, diagnósticas y de pronóstico. El documento WO 2005/078139 describe la asociación entre los genes miARN y las características cromosómicas implicadas en la etiología de diferentes tipos de cáncer y sugiere que el cáncer puede tratarse mediante la restauración del nivel de expresión génica de miR a la normalidad. Takamizawa J et al. divulgan la expresión reducida en el ARMn de let-7 en los cánceres de pulmón humanos y sugiere que las alteraciones de la expresión del ARNmi pueden tener un impacto pronóstico sobre la supervivencia de pacientes de cáncer pulmonar tratados quirúrgicamente . El desarrollo y uso de micromatrices que contienen todos los microARN conocidos ha permitido un análisis simultáneo de la expresión de cada miARN en una muestra (Liu, C.G. y col., Proc Natl. Acad. Sci. U.S.A. 101: 9740- 9744 (2004)). Estas micromatrices de microARN no solo se han utilizado para confirmar que el miR-16-1 está mal regulado en las células humanas de LLC, sino también para generar firmas de expresión de miARN que se asocian con cuadros clinicopatológicos bien definidos de LLC humanas (Calin, G.A. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 1175-11760 (2004)). Se puede utilizar el aislamiento, el enriquecimiento y/o el marcado de moléculas de miARN para preparar matrices u otras técnicas de detección para el análisis de miARN. Los perfiles de miARN se pueden emplear en aplicaciones terapéuticas, diagnósticas y pronósticas (documento WO 2005/118806).

La identificación de microARN que se expresan diferencialmente en las células del cáncer de pulmón ayudaría al diagnóstico, el pronóstico y el tratamiento del cáncer de pulmón. Además, la identificación de las supuestas dianas de estos miARN ayudaría a desvelar su papel patogénico. La presente invención proporciona un procedimiento nuevo para el diagnóstico de cáncer de pulmón. También se divulgan procedimientos para el pronóstico y tratamiento del cáncer de pulmón y composiciones para el pronóstico y tratamiento del cáncer de pulmón. Sumario La presente invención se basa, en parte, en la identificación de los miARN específicos asociados a niveles de expresión alterados en las células del cáncer de pulmón. En consecuencia, la invención engloba un procedimiento para diagnosticar si un sujeto tiene un cáncer de pulmón. Según el procedimiento de la invención, el nivel de un grupo de productos génicos de miR en una muestra de ensayo del sujeto se compara con el nivel de un correspondiente los productos génicos de miR en una muestra de control, consistiendo dicho grupo en miR-21, miR-191, miR-155, miR-210, miR-126* y miR-224. Una alteración (por ejemplo, un aumento, del nivel de los productos génicos miR-21, miR-191, miR-155 and miR-210 en la muestra de ensayo y un descenso del nivel de los productos génicos miR-126* and miR-224 gene en la muestra de ensayo, con respecto al nivel de los productos génicos de miR correspondientes en una muestra de control, es indicativa de que el sujeto tiene cáncer de pulmón.

También se desvelan procedimientos en los que al menos un producto génico de miR medido en una muestra de ensayo se compara con el nivel de un producto génico de miR correspondiente en una muestra de control. El al menos un producto génico de miR puede seleccionarse entre el grupo que consiste en miR-21, miR-191, miR- 126*, miR-210, miR-155, miR-143, miR-205, miR-192-prec, miR-224, miR-126, miR-24-2, miR-30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216-prec, miR-219- 1, miR-106a, miR-197, miR-192, miR-125a-prec, miR-26a-1-prec, miR-146, miR-203, miR-199b-prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c-prec, miR-150, miR-101-1, miR-124a-3, miR-125a and let- 7f-1. Como alternativa, el al menos un producto génico de miR puede seleccionarse del grupo que consiste en miR- 21, miR-205 y miR-216. Como alternativa, el cáncer de pulmón es un adenocarcinoma de pulmón y el al menos un producto génico de miR se selecciona entre el grupo que consiste en miR-21, miR-191, miR-155, miR-210, miR- 126*, miR-126, miR-24-2, "miR-219-1, miR-95, miR-192-prec, miR-220, miR-216-prec, miR-204-prec, miR-188, miR- 198, miR-145 y miR-224.

El nivel del al menos un producto génico de miR se puede medir utilizando varias técnicas que son bien conocidas por los expertos en la técnica (por ejemplo, RT-PCR semicuantitativa o cuantitativa, análisis de transferencia de Northern, detección de hibridación en solución). En una realización particular, el nivel del grupo de productos génicos de miR se mide haciendo la transcripción inversa del ARN de una muestra de ensayo obtenida de un sujeto, que proporciona una serie de oligodesoxinucleótidos diana, hibridando los oligodesoxinucleótidos diana con una micromatriz que comprende oligonucleótidos sonda específicos de miARN (por ejemplo, en una micromatriz que comprende oligonucleótidos sonda específicos de miARN) que proporciona un perfil de hibridación para la muestra de ensayo y comparando el perfil de hibridación de la muestra de ensayo con un perfil de hibridación generado a partir de una muestra de control. Una alteración en la señal andel grupo de productos génicos del miARN seleccionado entre el grupo que consiste en miR-155 en la muestra de ensayo con respecto a la muestra de control es indicativa de que el sujeto tiene cáncer de pulmón. También se divulgan procedimientos en los que la micromatriz comprende oligonucleótidos sonda específicos de miARN de una parte sustancial de todos los miARN humanos conocidos. Como alternativa, la micromatriz comprende oligonucleótidos sonda específicos de miARN seleccionado entre el grupo que consiste en miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-192-prec, miR-224, miR-126, miR-24-2, miR-30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216-prec, miR-219-1, miR-106a, miR-197, miR-192, miR-125a-prec, miR-26a-1- prec, miR-146, miR-203, miR-199b-prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c- prec, miR-150, miR-101-1, miR-124a-3, miR-125a y let-7f-1. Esta divulgación también abarca procedimientos para determinar el pronóstico de un sujeto con cáncer de pulmón, que comprenden la medición del nivel de al menos un producto génico de miR en una muestra de ensayo del sujeto, que se asocia con un pronóstico adverso en el cáncer de pulmón. De acuerdo con estos procedimientos, una alteración en el nivel de un producto génico de un miR, que se asocia con un pronóstico adverso, en la muestra de ensayo, cuando se compara con el nivel de un correspondiente producto génico de miR en una muestra de control, es indicativa de pronóstico adverso. El al menos un producto génico de miR se puede seleccionar del grupo que consiste en miR-155, miR-17-3p, miR-106a, miR-93, let-7a-2, miR-145, let-7b, miR-20 y miR-21. El cáncer de pulmón puede ser un adenocarcinoma de pulmón y el al menos un producto génico de miR se puede seleccionar entre el grupo que consiste en miR-155 y let-7a-2. El nivel del al menos un producto génico de miR se puede medir como se describe en el presente documento (por ejemplo, por RT-PCR semicuantitativa o cuantitativa, análisis de transferencia de Northern, detección de hibridación en solución, análisis por micromatrices). Una alteración en la señal de al menos un miARN en la muestra de ensayo, con respecto a la muestra de control es indicativa de que el sujeto o tiene o está en riesgo de desarrollar un cáncer de pulmón con un pronóstico adverso. Una alteración en la señal de miR-125a, miR-125b-1, miR-224 y/o miR-21 es indicativa de que el sujeto o tiene o está en riesgo de desarrollar un cáncer de pulmón con un pronóstico adverso. Como alternativa, una alteración de la señal de miR-155 y/o let-7a-2 en una muestra de un sujeto con adenocarcinoma de pulmón es indicativa de un pronóstico adverso. La micromatriz puede comprender oligonucleótidos sonda específicos de miARN para uno o más de los miARN seleccionados entre el grupo que consiste en miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-192-prec, miR-224, miR-126, miR-24-2, miR-30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216-prec, miR-219-1, miR-106a, miR-197, miR-192, miR-125a-prec, miR-26a-1-prec, miR-146, miR- 203, miR-199b-prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c-prec, miR-150, miR- 101-1, miR-124a-3, miR-125a y let-7f-1. Esta divulgación también abarca procedimientos para el tratamiento del cáncer de pulmón en un sujeto, en el que al menos un producto génico de miR está desregulado (por ejemplo, regulado negativamente, regulado positivamente) en las células cancerosas del sujeto. Cuando al menos un producto génico de miR aislado está regulado negativamente en las células del cáncer de pulmón, el procedimiento comprende la administración de una cantidad eficaz de un producto génico aislado de miR o una variante aislada o un fragmento biológicamente activo del mismo, de forma que se inhiba la proliferación de las células cancerosas en el sujeto. Cuando al menos un producto génico de miR aislado está regulado positivamente en las células cancerosas, el procedimiento comprende la administración al sujeto de una cantidad eficaz de al menos un compuesto para inhibir la expresión del al menos un producto génico de miR, de forma que se inhiba la proliferación de las células del cáncer de pulmón. Los procedimientos para el tratamiento del cáncer de pulmón en un sujeto divulgados en el presente documento pueden comprender adicionalmente la etapa de determinar en primer lugar la cantidad de al menos un producto génico de miR en las células del cáncer de pulmón del sujeto y comparar ese nivel con el nivel del correspondiente producto génico de miR en las células control. Si la expresión del producto génico de miR está desregulado (por ejemplo, regulado negativamente, regulado positivamente) en las células del cáncer de pulmón, los procedimientos además comprenden la alteración de la cantidad del al menos un producto génico de miR expresado por las células del cáncer de pulmón. La cantidad del producto génico de miR expresado en las células cancerígenas puede ser menor que la cantidad del producto génico de miR expresado en las células control y se administra al sujeto una cantidad eficaz del producto génico de miR o una variante aislada o un fragmento biológicamente activo del mismo. Como alternativa, la cantidad del producto génico de miR expresado en las células cancerosas es mayor que la cantidad del producto génico de miR expresado en las células control y se administra al sujeto una cantidad eficaz de al menos un compuesto que inhibe la expresión del al menos un gen miR.

Esta divulgación abarca además composiciones farmacéuticas para el tratamiento del cáncer de pulmón. Las composiciones farmacéuticas pueden comprender al menos un producto génico de miR aislado o una variante aislada o un fragmento biológicamente activo del mismo y un vehículo farmacéuticamente aceptable. El al menos un producto génico de miR puede corresponder a un producto génico de miR que tiene un nivel de expresión disminuido en las células del cáncer de pulmón con respecto al de las células control adecuadas. El producto génico de miR aislado se puede seleccionar entre el grupo que consiste en miR-126*, miR-143, miR-192, miR-224, miR- 126, miR-30a-5p, miR-140, miR-9, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216, miR-219-1, miR- 125a, miR-26a-1, miR-199b, let-7a-2, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c, miR-101-1, miR- 124a-3, let-7f-1 y una combinación de los mismos.

Las composiciones farmacéuticas de la invención pueden comprender al menos un compuesto inhibidor de la expresión de miR. El al menos un compuesto inhibidor de la expresión de miR puede ser específico para un producto génico de miR cuya expresión es mayor en las células del cáncer de pulmón que en las células control. El compuesto inhibidor la expresión de miR puede ser específico para uno o más productos génicos de miR seleccionados entre el grupo que consiste en miR-21, miR-191, miR-210, miR-155, miR-205, miR-24-2, miR-212, miR-214, miR-17-3p, miR-106a, miR-197, miR-192, miR-146, miR-203, miR-150 y una combinación de los mismos. Esta divulgación también engloba procedimientos para identificar un agente anticáncer de pulmón, que comprenden proporcionar un agente de ensayo a una célula y medir el nivel de al menos un producto génico de miR en la célula.

El procedimiento puede comprender proporcionar un agente de ensayo a una célula y medir el nivel de al menos un producto génico de miR asociado a niveles de expresión disminuidos en las células del cáncer de pulmón. Un incremento en el nivel del producto génico de miR en la célula, con respecto a una célula control adecuada, es indicativo de que el agente de ensayo es un agente anticáncer de pulmón. El al menos un producto génico de miR asociado a niveles de expresión disminuidos en las células del cáncer de pulmón puede seleccionarse entre el grupo que consiste en miR-126*, miR-143, miR-192, miR-224, miR-126, miR-30a-5p, miR-140, miR-9, miR-124a-1, miR- 218-2, miR-95, miR-145, miR-198, miR-216, miR-219-1, miR-125a, miR-26a-1, miR-199b, let-7a-2, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c, miR-101-1, miR-124a-3, let-7f-1 y una combinación de los mismos. Como alternativa, el procedimiento puede comprender proporcionar un agente de ensayo a una célula y medir el nivel de al menos un producto génico de miR asociado a niveles de expresión aumentados en las células del cáncer de pulmón. Un descenso en la célula del nivel del producto génico de miR asociado a niveles de expresión aumentados en el cáncer de pulmón, con respecto a una célula control adecuada, es indicativo de que el agente de ensayo es un agente anticáncer de pulmón. El al menos un producto génico de miR asociado a niveles de expresión aumentados en las células del cáncer de pulmón pueden seleccionarse entre el grupo que consiste en miR-21, miR- 191, miR-210, miR-155, miR-205, miR-24-2, miR-212, miR-214, miR-17-3p, miR-106a, miR-197, miR-192, miR-146, miR-203, miR-150 y una combinación de los mismos. Breve descripción de los dibujos El documento de patente o solicitud contiene al menos un dibujo ejecutado en color. Las copias de esta publicación de patente o solicitud de patente con dibujos en color se proporcionarán por la Oficina bajo pedido y pago de las tasas necesarias.

La FIG. 1 muestra unos gráficos que representan el nivel de expresión relativa de miR-21 precursor humano (hsa-mir-21; paneles superiores), de miR-126* precursor humano (hsa-mir-126*; paneles medios) y de miR-205 precursor humano (hsa-mir-205; paneles inferiores) en tejidos con cáncer de pulmón (Ca) y no cancerosos (N), que se determinaron por análisis RT-PCR en tiempo real. Las muestras de cáncer fueron de adenocarcinoma o de carcinoma de células escamosas (SCC). Se llevó a cabo un ensayo t pareado para asegurar la significación estadística entre los niveles de expresión en tejidos de cáncer de pulmón y tejidos no cancerosos de pulmón.

La FIG. 2 representa la expresión de los miARN maduros para miR-21 (hsa-mir-21), miR-126* (hsa-mir-126*) y miR-205 (hsa-mir-205) en muestras de cáncer de pulmón (es decir, adenocarcinomas (Adeno) y carcinomas de células escamosas (SCC)), detectados por hibridación en solución. Ca representa tejidos cancerosos de pulmón y N representa tejidos de pulmón no cancerosos. El ARNr 5S sirvió como un control de carga.

La FIG. 3A es un dendrograma que representa un agrupamiento jerárquico que se basa en los perfiles de expresión de microARN de 13 líneas celulares de cáncer de pulmón que representan carcinomas de pulmón de células pequeñas (SCLC) y carcinomas de pulmón de células no pequeñas (NSCLC). La FIG. 3B describe una vista de grupo de la expresión de un miARN de 13 líneas celulares de cáncer de pulmón (arriba), que corresponde a los que se enumeraron en la FIG. 3A. Los niveles de expresión de varios miARN, enumerados a la derecha de la figura, se indican según el color. El azul indica los niveles de expresión por debajo de la media, el negro indica los niveles de expresión que son aproximadamente iguales a la media y el naranja indica los niveles de expresión que son mayores que la media. El gris indica puntos de datos perdidos.

La FIG. 4 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Los casos de adenocarcinoma en los que la intensidad de hibridación era diferente de los antecedentes (véase el Ejemplo 4) se clasificaron de acuerdo con la expresión de hsa-mir-155 y los datos de supervivencia se compararon utilizando un ensayo de intervalo logarítmico. La relación de expresión media se define como la relación de expresión media = media de la expresión del tumor / media de la expresión del tejido no canceroso. El grupo de alta expresión del hsa-mir-155 (es decir, el grupo con una relación de expresión ≥ la relación de expresión media (1,42); n=27) se comparó con los correspondientes tejidos de pulmón no cancerosos. El grupo de baja expresión del hsa-mir-155 (es decir, el grupo con una relación de expresión < la relación de expresión media (1,42); n=28) se comparó con los correspondientes tejidos pulmonares no cancerosos. Las relaciones representan la intensidad de la señal de hibridación en la muestra de cáncer de pulmón con respecto a los controles no cancerosos. La FIG. 5 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Los casos de adenocarcinoma en los que la intensidad de la hibridación fue diferente del antecedente (véase el Ejemplo 4) se clasificaron de acuerdo con la expresión del hsa-let-7a-2 y los datos de supervivencia se compararon utilizando un ensayo de intervalo logarítmico. La relación de expresión media se definió como relación de expresión media = media de expresión del tumor / media de la expresión del tejido no canceroso. El grupo de alta expresión del hsa-let-7a-2 (es decir, el grupo con una relación de expresión ≥ que la relación de expresión media (0,95); n=34) se comparó con los tejidos pulmonares no cancerosos correspondientes. El grupo de baja expresión del hsa-let- 7a-2 (es decir, el grupo con una relación de expresión < relación de expresión media (0,95); n=18) se comparó con los tejidos pulmonares no cancerosos correspondientes. La FIG. 6 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Treinta y dos casos de adenocarcinoma de una cohorte original se clasificaron de acuerdo con la expresión del hsa-miR-155 precursor y los datos de supervivencia se compararon utilizando un ensayo de intervalo logarítmico. La relación de expresión media se definió como relación de expresión media = media de expresión tumoral / media de expresión del tejido no canceroso. El grupo de expresión alta del precursor hsa-miR-155 (es decir el grupo con una relación de expresión ≥ que la relación de expresión media (1,19); n=19) se comparó con los tejidos de pulmón no cancerosos correspondientes.

La FIG. 7 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Treinta y dos casos de adenocarcinoma de una cohorte original se clasificaron de acuerdo con la expresión del precursor del

hsa-let-7a-2 y los datos de supervivencia se compararon utilizando un ensayo de intervalo logarítmico. La relación media de expresión se definió como relación de expresión media = media de la expresión tumoral / media de la expresión del tejido no canceroso. El grupo de expresión alta del precursor del hsa-let-7a-2 (es decir, el grupo con una relación de expresión ≥ la relación de expresión media (0,92); n=18) se comparó con los correspondientes tejidos pulmonares no cancerosos. El grupo de expresión baja del hsa-let-7a-2 precursor (es decir, el grupo con una relación de expresión < la relación de expresión media (0,92); n=14) se comparó con los correspondientes tejidos pulmonares no cancerosos. La FIG. 8 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Treinta y dos casos de una cohorte adicional independiente se clasificaron de acuerdo con la expresión del hsa-mir-155 precursor y los datos de supervivencia se compararon utilizando el ensayo de intervalo logarítmico. El grupo de alta expresión del hsa-mir-155 precursor (n=14); el grupo de baja expresión del hsa-mir-155 precursor (n=18). La FIG. 9 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Treinta y dos casos de adenocarcinoma de una cohorte adicional independiente se clasificaron de acuerdo con la expresión del hsa-let-7a-2 precursor y los datos de supervivencia se compararon utilizando el ensayo de intervalo logarítmico. El grupo de alta expresión del precursor hsa-let-7a-2 (n=15); el grupo de baja expresión del precursor hsa-let-7a-2 (n=17).

La FIG. 10 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Sesenta y cuatro casos de la combinación de 2 cohortes independientes se clasificaron de acuerdo con la expresión del hsa-mir-155 precursor, estimado por el análisis RT-PCR en tiempo real. Los datos de supervivencia se compararon utilizando el ensayo de intervalo logarítmico. La relación de expresión media se definió como relación de expresión media = media de la expresión tumoral / media de expresión de los tejidos no cancerosos.

El grupo de alta expresión del hsa-miR-155 precursor (es decir el grupo con una relación de expresión ≥ relación de la media de expresión (1,19); n=27) se comparó con los correspondientes tejidos pulmonares no cancerosos. El grupo de baja expresión del hsa-miR-155 precursor (es decir el grupo con una relación de expresión < la relación de expresión media (1,19); n=37) se comparó con los correspondientes tejidos tumorales no cancerosos.

La FIG. 11 es una curva de supervivencia de Kaplan-Meier para pacientes con adenocarcinoma. Sesenta y cuatro casos de adenocarcinoma de una combinación de 2 cohortes independientes se clasificaron de acuerdo con la expresión del hsa-let-7a-2 precursor, como se estimó por análisis RT-PCR en tiempo real. Los datos de supervivencia se compararon utilizando el ensayo de intervalo logarítmico. La relación de expresión media se definió como la relación de expresión media = media de la expresión tumoral / media de la expresión de tejido no canceroso. El grupo de alta expresión del hsa-let-7a-2 precursor (es decir, el grupo con una relación de expresión ≥ relación de expresión media (0,92); n=33) se comparó con los correspondientes tejidos pulmonares no cancerosos. El grupo de baja expresión del hsa-let-7a-2 precursor (es decir, el grupo con una relación de expresión < la relación de expresión media (0,92); n=31) se comparó con los correspondientes tejidos pulmonares no cancerosos.

La FIG. 12 describe la expresión de ARNm MYO18B tras el tratamiento con 5-aza-dC y/o TSA en dos líneas celulares de cáncer de pulmón (H157, A549), como se determinó por análisis RT-PCR. Calle 1, sin tratamiento; Calle 2, tratamiento con 5-aza-dC 1,0 µM durante 72 h; Calle 3, tratamiento con TSA 1,0 µM durante 24 h; Calle 4, tratamiento con 5-aza-dC 1,0 µM durante 72 horas, seguido por tratamiento con TSA 1,0 µM durante 24 h. La expresión de GAPDH sirvió como control de carga.

Descripción detallada La presente invención se basa, en parte, en la identificación de microARN particulares que tienen alterada la expresión en células de cáncer de pulmón con respecto a células normales de control y en la asociación de estos microARN con características diagnósticas, pronósticas y terapéuticas particulares. Como se usa en el presente documento de manera intercambiable, un “producto génico de miR”, “microARN”, “miR” o “miARN” se refiere al ARN procesado o sin procesar transcrito a partir de un gen miR. Como los productos génicos de miR no se traducen en proteínas, la expresión “productos génicos de miR” no incluye proteínas. El gen miR transcrito no procesado también se llama “miR precursor” y normalmente comprende un ARN transcrito de una longitud aproximada de 70-100 nucleótidos. El miR precursor se puede procesar por digestión con ARNasa (por ejemplo, Dicer, Argonaut, ARNasa III (por ejemplo ARNasa III de E. coli)) en una molécula de ARN activa con 19-25 nucleótidos. Esta molécula activa de ARN de 19-25 nucleótidos también se llama gen transcrito de miR “procesado” o miARN “maduro”. La molécula activa de ARN con 19-25 nucleótidos se pueden obtener a partir de miR precursor por medio de rutas de procesamiento natural (por ejemplo, utilizando células intactas o lisados celulares) o por rutas de procesamiento sintético (por ejemplo utilizando enzimas de procesamiento aisladas, tales como Dicer, Argonaut o ARNasa III aisladas). Se entiende que la molécula activa de ARN de 19-25 nucleótidos también se puede producir directamente por síntesis biológica o química, sin tener que procesarse a partir de miR precursor. Cuando en el presente documento se llama a un microARN por su nombre, el nombre corresponde tanto a la forma de precursor como a la madura, a menos que se indique otra cosa. La presente invención engloba un procedimiento para diagnosticar si un sujeto tiene o está en riesgo de desarrollar cáncer de pulmón, comprendiendo la medición de un grupo de productos génicos de miR en una muestra de ensayo del sujeto y comparando el nivel del producto génico de miR en la muestra de ensayo con el nivel del correspondiente producto génico de miR en una muestra de control. Como se utiliza en el presente documento, un “sujeto” puede ser cualquier mamífero que tenga o sea sospechoso de tener un cáncer de pulmón.

El cáncer de pulmón puede ser cualquier forma de cáncer de pulmón, por ejemplo, cánceres de pulmón de diferentes histologías (por ejemplo, adenocarcinoma, carcinoma de células escamosas). Además, el cáncer de pulmón se puede asociar con un pronóstico particular (por ejemplo, tasa baja de supervivencia, progresión rápida). Las Tablas 1a y 1b describen las secuencias de nucleótidos de microARN humanos precursores y maduros.

Tabla 1a- Secuencias de precursores de microARN humano Nombre del precursor Secuencia (5’ a 3’)* SEC ID Nº 1

let-7a-1

2

let-7a-2

3

let-7a-3

4

let-7a-4

let-7b

6

let-7c

7

let-7d

8

let-7d-v1

9

let-7d-v2

let-7e

11

let-7f-1

12

let-7f-2-1

13

let-7f-2-2

14

let-7g

let-7i

16

miR-1b-1-1

17

miR-1b-1-2

18

miR-1b-2

19

miR-1b

miR-1d

21

miR-7-1a

22

miR-7-1b

23

miR-7-2

24

miR-7-3

miR-9-1

26

miR-9-2

27

miR-9-3

28

miR-10a

29

miR-10b

miR-15a-2

31

miR-15a

32

miR-15b-1

33

miR-15b-2

34

miR-16-1

miR-16-2

36

miR-16-13

37

miR-17

38

miR-18

39

miR-18-13

miR-19a

41

miR-19a-13

42

miR-19b-1

43

miR-19b-2

44

miR-19b-13

miR-19b-X

46

miR-20 (miR-20a)

47

miR-21

48

miR-21-17

49

miR-22

miR-23a

51

miR-23b

52

miR-23-19

53

miR-24-1

54

miR-24-2

miR-24-19

56

miR-24-9

57

miR-25

58

miR-26a

59

miR-26a-1

miR-26a-2

61

miR-26b

62

miR-27a

63

miR-27b-1

64

miR-27b-2

miR-27-19

66

miR-28

67

miR-29a-2

68

miR-29a

69

miR-29b-1

miR-29b-2

71

miR-29c

72

miR-30a

73

miR-30b-1

74

miR-30b-2

75

miR-30c

76

miR-30d

77

miR-30e

78

miR-31

79

miR-32

80

miR-33b

81

miR-33b-2

82

miR-33

83

miR-34-a

84

miR-34-b

85 miR-34-c 86

miR-91-13

87

miR-92-1

88

miR-92 -2

89

miR-93-1 (miR-93-2)

90

miR-95-4

91

miR-96-7

92

miR-97-6 (miR-30*)

93

miR-98

94

miR-99b

95

miR-99a

96

miR-100-1/2

97

miR-100-11

98

miR-101-1/2

99

miR-101

100

miR-101-1

101

miR-101-2

102

miR-101-9

103

miR-102-1

104

miR-102-7.1 (miR-102-7. 2)

105

miR-103-2

106

miR-103-1

107

miR-104-17

108

miR-105-1

109

miR-105-2

110

miR-106-a

111

miR-106-b

112

miR-107

113

miR-1 08-1-pequeño

114

miR-108-2-pequeño

115

miR-122a-1

116

miR-122a-2

117

miR-123

118

miR-124a-1

119

miR-124a-2

120

miR-124a-3

121

miR-124a

122

miR-124b

123

miR-125a-1

124

miR-125a-2

125

miR-125b-1

126

miR-125b-2

127

miR-126-1

128

miR-126-2

129

miR-127-1

130

miR-127-2

131

miR-128a

132

miR-128b

133

miR-128

134

miR-129-1

135

miR-129-2

136

miR-130a

137

miR-131-1

138

miR-131-3

139

miR-131

140

miR-132-1

141

miR-132-2

142

miR-133a-1

143

miR-133a-2

144

miR-133

145

miR-133b

146

miR-133b-pequeño

147

miR-134-1

148

miR-134-2

149

miR-135a-1

150

miR-135a-2 (miR-135-2)

151

miR-135

152

miR-135b

153

miR-136-1

154

miR-136-2

155

miR-137

156

miR-138-1

157

miR-138-2

158

miR-138

159

miR-139

160

miR-140

161

miR-140as

162

miR-140s

163

miR-141-1

164

miR-141-2

165

miR-142

166

miR-143-1

167

miR-143-2

168

miR-144-1

169

miR-144-2

170

miR-145-1

171

miR-145-2

172

miR-146-1

173

miR-146-2

174

miR-147

175

miR-148a (miR-148)

176

miR-148b

177

miR-148b-pequeño

178

miR-149-1

179

miR-149-2

180

miR-150-1

181

miR-150-2

182

miR-151

183

miR-151-2

184

miR-152-1

185

miR-152-2

186

miR-153-1-1

187

miR-153-1-2

188

miR-153-2-1

189

miR-153-2-2

190

miR-154-1

191

miR-154-2

192

miR-155

miR-156 = miR-

193

157=solapamiento miR-141

194

miR-158-pequeño = miR-192

195

miR-159-1-pequeño

196

miR-161-pequeño

197

miR-163-1b-pequeño

198

miR-163-3-pequeño

199

miR-162

200

miR-175-pequeño=miR-224 201

miR-177-pequeño

202 miR-180-pequeño 203

miR-181a

204

miR-181b-1

205

miR-181b-2

206

miR-181c

207

miR-182-as

208

miR-182

209

miR-183

210

miR-184-1

211

miR-184-2

212

miR-185-1

213

miR-185-2

214

miR-186-1

215

miR-186-2

216

miR-187

217

miR-188-1

218

miR-188-2

219

miR-189-1

220

miR-189-2

221

miR-190-1

222

miR-190-2

223

miR-191-1

224

miR-191-2

225

miR-192-2/3

226

miR-192

227

miR-193-1

228

miR-193-2

229

miR-194-1

230

miR-194-2

231

miR-195-1

232

miR-195-2

233

miR-196-1

234

miR-196a-1

235

miR-196a-2 (miR-196-2)

236

miR-196

237

miR-196b

238

miR-197

239

miR-197-2

240

miR-198

241

miR-199a-1

242

miR-199a-2

243

miR-199b

244

miR-199s

245

miR-200a

246

miR-200b

247

miR-200c

248

miR-202

249

miR-203

250

miR-204

251

miR-205

252

miR-206-1

253

miR-206-2

254

miR-208

255

miR-210

256

miR-211

257

miR-212

258

miR-213-2

259

miR-213

260

miR-214

261

miR-215

262

miR-216

263

miR-217

264

miR-218-1

265

miR-218-2

266

miR-219

267

miR-219-1

268

miR-219-2

269

miR-220

270

miR-221

271

miR-222

272

miR-223

273

miR-224

Nombre del precursor Secuencia (5’ a 3’)* SEC ID Nº 274

miR-294-1 (chr16)

275

miR-296

276

miR-299

277

miR-301

278

miR-302a

279

miR-302b

280

miR-302c

281

miR-302d

282

miR-320

283

miR-321

284

miR-323

285

miR-324

286

miR-325

287

miR-326

288

miR-328

289

miR-330

290

miR-331

291

miR-335

292

miR-337

293

miR-338

294

miR-339

295

miR-340

296

miR-342

297

miR-345

298

miR-346

299

miR-367

300

miR-368

301

miR-369

302

miR-370

303

miR-3 71

304

miR-372

305

miR-3 73

306

miR-374

307

miR-hes1

308

miR-hes2

309

miR-hes3

* Una secuencia subrayada dentro de una secuencia de precursor corresponde a un transcrito de miR procesado maduro (véase la Tabla 1b). Algunas secuencias de precursor tienen dos secuencias subrayadas que indican dos miR maduros diferentes que se obtienen a partir del mismo precursor. Todas las secuencias son humanas.

Tabla 1b - Secuencias de microRNA Maduro Humano.

Nombre de miRNA Secuencia de miRNA Maduro (5’ a 3’) SEC ID Nº microRNA precursor Maduro correspondiente(s); véase la Tabla 1a

let-7a

ugagguaguagguuguauaguu 310

let-7a-1; let-7a-2; let-7a-3; let-7a-4

let-7b

ugagguaguagguugugugguu 311

let-7b

let-7c

ugagguaguagguuguaugguu 312

let-7c

let-7d

agagguaguagguugcauagu 313

let-7d; let-7d-v1

let-7e

ugagguaggagguuguauagu 314

let-7e

let-7f

ugagguaguagauuguauaguu 315

let-7f-1; let-7f-2-1; let-7f-2-2

let-7g

ugagguaguaguuuguacagu 316

let-7g

let-7i

ugagguaguaguuugugcu 317

let-7i

miR-1

uggaauguaaagaaguaugua 318

miR-1b; miR-1b-1; miR-1b-2

miR-7

uggaagacuagugauuuuguu 319

miR-7-1; miR-7-1a; miR-7-2; miR-7-3

miR-9

ucuuugguuaucuagcuguauga 320

miR-9-1; miR-9-2; miR-9-3

miR-9*

uaaagcuagauaaccgaaagu 321

miR-9-1; miR-9-2; miR-9-3

miR-10a

uacccuguagauccgaauuugug 322

miR-10a

miR-10b

uacccuguagaaccgaauuugu 323

miR-10b

miR-15a

uagcagcacauaaugguuugug 324

miR-15a; miR-15a-2

miR-15b

uagcagcacaucaugguuuaca 325

miR-15b

miR-16

uagcagcacguaaauauuggcg 326

miR-16-1; miR-16-2; miR-16-13

miR-17-5p

caaagugcuuacagugcagguagu 327

miR-17

miR-17-3p

acugcagugaaggcacuugu 328

miR-17

miR-18

uaaggugcaucuagugcagaua 329

miR-18; miR-18-13

miR-19a

ugugcaaaucuaugcaaaacuga 330

miR-19a; miR-19a-13

miR-19b

ugugcaaauccaugcaaaacuga 331

miR-19b-1; miR-19b-2

miR-20

uaaagugcuuauagugcaggua 332

miR-20 (miR-20a)

miR-21

uagcuuaucagacugauguuga 333

miR-21; miR-21-17

miR-22

aagcugccaguugaagaacugu 334

miR-22

miR-23a

aucacauugccagggauuucc 335

miR-23a

miR-23b

aucacauugccagggauuaccac 336

miR-23b

miR-24

uggcucaguucagcaggaacag 337

miR-24-1; miR-24-2; miR-24-19; miR-

24-9

miR-25

cauugcacuugucucggucuga 338

miR-25

miR-26a

uucaaguaauccaggauaggcu 339

miR-26a; miR-26a-1; miR-26a-2

miR-26b

uucaaguaauucaggauaggu 340

miR-26b

miR-27a

uucacaguggcuaaguuccgcc 341

miR-27a

miR-27b

uucacaguggcuaaguucug 342

miR-27b-1; miR-27b-2

miR-28

aaggagcucacagucuauugag 343

miR-28

miR-29a

cuagcaccaucugaaaucgguu 344

miR-29a-2; miR-29a

miR-29b

uagcaccauuugaaaucagu 345

miR-29b-1; miR-29b-2

miR-29c

uagcaccauuugaaaucgguua 346

miR-29c

miR-30a-5p

uguaaacauccucgacuggaagc 347

miR-30a

miR-30a-3p

cuuucagucggauguuugcagc 348

miR-30a

miR-30b

uguaaacauccuacacucagc 349

miR-30b-1; miR-30b-2

miR-30c

uguaaacauccuacacucucagc 350

miR-30c

miR-30d

uguaaacauccccgacuggaag 351

miR-30d

miR-30e

uguaaacauccuugacugga 352

miR-30e

miR-31

ggcaagaugcuggcauagcug 353

miR-31

miR-32

uauugcacauuacuaaguugc 354

miR-32

miR-33

gugcauuguaguugcauug 355

miR-33; miR-33b

miR-34a

uggcagugucuuagcugguugu 356

miR-34a

miR-34b

aggcagugucauuagcugauug 357

miR-34b

miR-34c

aggcaguguaguuagcugauug 358

miR-34c

miR-92

uauugcacuugucccggccugu 359

miR-92-2; miR-92-1

miR-93

aaagugcuguucgugcagguag 360

miR-93-1; miR-93-2

miR-95

uucaacggguauuuauugagca 361

miR-95

miR-96

uuuggcacuagcacauuuuugc 362

miR-96

miR-98

ugagguaguaaguuguauuguu 363

miR-98

miR-99a

aacccguagauccgaucuugug 364

miR-99a

miR-99b

cacccguagaaccgaccuugcg 365

miR-99b

miR-100

uacaguacugugauaacugaag 366

miR-100

miR-101

uacaguacugugauaacugaag 367

miR-101-1; miR-101-2

miR-103

agcagcauuguacagggcuauga 368

miR-103-1

miR-105

ucaaaugcucagacuccugu 369

miR-105

miR-106-a

aaaagugcuuacagugcagguagc 370

miR-106-a

miR-106-b

uaaagugcugacagugcagau 371

miR-106-b

miR-107

agcagcauuguacagggcuauca 372

miR-107

miR-122a

uggagugugacaaugguguuugu 373

miR-122a-1; miR-122a-2

miR-124a

uuaaggcacgcggugaaugcca 374

miR-124a-1; miR-124a-2; miR-124a-3

miR-125a

ucccugagacccuuuaaccugug 375

miR-125a-1; miR-125a-2

miR-125b

ucccugagacccuaacuuguga 376

miR-125b-1; miR-125b-2

miR-126* cauuauuacuuuugguacgcg 377

miR-126-1; miR-126-2

miR-126

ucguaccgugaguaauaaugc 378

miR-126-1; miR-126-2

miR-127

ucggauccgucugagcuuggcu 379

miR-127-1; miR-127-2

miR-128a

ucacagugaaccggucucuuuu 380

miR-128; miR-128a

miR-128b

ucacagugaaccggucucuuuc 381

miR-128b

miR-129

cuuuuugcggucugggcuugc 382

miR-129-1; miR-129-2

miR-130a

cagugcaauguuaaaagggc 383

miR-130a

miR-130b

cagugcaaugaugaaagggcau 384

miR-130b

miR-132

uaacagucuacagccauggucg 385

miR-132-1

miR-133a

uugguccccuucaaccagcugu 386

miR-133a-1; miR-133a-2

miR-133b

uugguccccuucaaccagcua 387

miR-133b

miR-134

ugugacugguugaccagaggg 388

miR-134-1; miR-134-2

miR-135a

uauggcuuuuuauuccuauguga 389

miR-135a; miR-135a-2 (miR-135-2)

miR-135b

uauggcuuuucauuccuaugug 390

miR-135b

miR-136

acuccauuuguuuugaugaugga 391

miR-136-1; miR-136-2

miR-137

uauugcuuaagaauacgcguag 392

miR-137

miR-138

agcugguguugugaauc 393

miR-138-1; miR-138-2

miR-139

ucuacagugcacgugucu 394

miR-139

miR-140

agugguuuuacccuaugguag 395

miR-140; miR-140as; miR-140s

miR-141

aacacugucugguaaagaugg 396

miR-141-1; miR-141-2

miR-142-3p

uguaguguuuccuacuuuaugga 397

miR-142

miR-142-5p

cauaaaguagaaagcacuac 398

miR-142

miR-143

ugagaugaagcacuguagcuca 399

miR-143-1

miR-144

uacaguauagaugauguacuag 400

miR-144-1; miR-144-2

miR-145

guccaguuuucccaggaaucccuu 401

miR-145-1; miR-145-2

miR-146

ugagaacugaauuccauggguu 402

miR-146-1; miR-146-2

miR-147

guguguggaaaugcuucugc 403

miR-147

miR-148a

ucagugcacuacagaacuuugu 404

miR-148a (miR-148)

miR-148b

ucagugcaucacagaacuuugu 405

miR-148b

miR-149

ucuggcuccgugucuucacucc 406

miR-149

miR-150

ucucccaacccuuguaccagug 407

miR-150-1; miR-150-2

miR-151

acuagacugaagcuccuugagg 408

miR-151

miR-152

ucagugcaugacagaacuugg 409

miR-152-1; miR-152-2

miR-153

uugcauagucacaaaaguga 410

miR-153-1-1; miR-153-1-2; miR-153-

2-1; m iR-153-2-2

miR-154

uagguuauccguguugccuucg 411

miR-154-1; miR-154-2

miR-154*

aaucauacacgguugaccuauu 412

miR-154-I; miR-154-2

miR-155

uuaaugcuaaucgugauagggg 413

miR-155

miR-181a

aacauucaacgcugucggugagu 414

miR-181a

miR-181b

aacauucauugcugucgguggguu 415

miR-181b-1; miR-181b-2

miR-181c

aacauucaaccugucggugagu 416

miR-181c

miR-182

uuuggcaaugguagaacucaca 417

miR-182; miR-182as

miR-182* ugguucuagacuugccaacua 418

miR-182; miR-182as

miR-183

uauggcacugguagaauucacug 419

miR-183

miR-184

uggacggagaacugauaagggu 420

miR-184-1; miR-184-2

miR-185

uggagagaaaggcaguuc 421

miR-185-1; miR-185-2

miR-186

caaagaauucuccuuuugggcuu 422

miR-186-1; miR-186-2

miR-187

ucgugucuuguguugcagccg 423

miR-187

miR-188

caucccuugcaugguggagggu 424

miR-188

miR-189

gugccuacugagcugauaucagu 425

miR-189-1; miR-189-2

miR-190

ugauauguuugauauauuaggu 426

miR-190-1; miR-190-2

miR-191

caacggaaucccaaaagcagcu 427

miR-191-1; miR-191-2

miR-192

cugaccuaugaauugacagcc 428

miR-192

miR-193

aacuggccuacaaagucccag 429

miR-193-1; miR-193-2

miR-194

uguaacagcaacuccaugugga 430

miR-194-1; miR-194-2

miR-195

uagcagcacagaaauauuggc 431

miR-195-1; miR-195-2

miR-196a

uagguaguuucauguuguugg 432

miR-196a; miR-196a-2 (miR196-2)

miR-196b

uagguaguuuccuguuguugg 433

miR-196b

miR-197

uucaccaccuucuccacccagc 434

miR-197

miR-198

gguccagaggggagauagg 435

miR-198

miR-199a

cccaguguucagacuaccuguuc 436

miR-199a-1; miR-199a-2

miR-199a*

uacaguagucugcacauugguu 437

miR-199a-1; miR-199a-2; miR-199s;

miR-199b

miR-199b

cccaguguuuagacuaucuguuc 438

miR-199b

miR-200a

uaacacugucugguaacgaugu 439

miR-200a

miR-200b

cucuaauacugccugguaaugaug 440

miR-200b

miR-200c

aauacugccggguaaugaugga 441

miR-200c

miR-202

agagguauagggcaugggaaga 442

miR-202

miR-203

gugaaauguuuaggaccacuag 443

miR-203

miR-204

uucccuuugucauccuaugccu 444

miR-204

miR-205

uccuucauuccaccggagucug 445

miR-205

miR-206

uggaauguaaggaagugugugg 446

miR-206-1; miR-206-2

miR-208

auaagacgagcaaaaagcuugu 447

miR-208

miR-210

cugugcgugugacagcggcug 448

miR-210

miR-211

uucccuuugucauccuucgccu 449

miR-211

miR-212

uaacagucuccagucacggcc 450

miR-212

miR-213

accaucgaccguugauuguacc 451

miR-213

miR-214

acagcaggcacagacaggcag 452

miR-214

miR-215

augaccuaugaauugacagac 453

miR-215

miR-216

uaaucucagcuggcaacugug 454

miR-216

miR-217

uacugcaucaggaacugauuggau 455

miR-217

miR-218

uugugcuugaucuaaccaugu 456

miR-218-1; miR-218-2

miR-219

ugauuguccaaacgcaauucu 457

miR-219; miR-219-1; miR-219-2

miR-220

ccacaccguaucugacacuuu 458

miR-220

miR-221

agcuacauugucugcuggguuuc 459

miR-221

miR-222

agcuacaucuggcuacugggucuc 460

miR-222

miR-223

ugucaguuugucaaauacccc 461

miR-223

miR-224

caagucacuagugguuccguuua 462

miR-224

miR-296

agggcccccccucaauccugu 463

miR-296

miR-299

ugguuuaccgucccacauacau 464

miR-299

miR-301

cagugcaauaguauugucaaagc 465

miR-301

miR-302a

uaagugcuuccauguuuugguga 466

miR-302a

miR-302b*

acuuuaacauggaagugcuuucu 467

miR-302b

miR-302b

uaagugcuuccauguuuuaguag 468

miR-302b

miR-302c*

uuuaacauggggguaccugcug 469

miR-302c

miR-302c

uaagugcuuccauguuucagugg 470

miR-302c

miR-302d

uaagugcuuccauguuugagugu 471

miR-302d

miR-320

aaaagcuggguugagagggcgaa 472

miR-320

miR-321

uaagccagggauuguggguuc 473

miR-321

miR-323

gcacauuacacggucgaccucu 474

miR-323

miR-324-5p

cgcauccccuagggcauuggugu 475

miR-324

miR-324-3p

ccacugccccaggugcugcugg 476

miR-324

miR-325

ccuaguagguguccaguaagu 477

miR-325

miR-326

ccucugggcccuuccuccag 478

miR-326

miR-328

cuggcccucucugcccuuccgu 479

miR-328

miR-330

gcaaagcacacggccugcagaga 480

miR-330

miR-331

gccccugggccuauccuagaa 481

miR-331

miR-335

ucaagagcaauaacgaaaaaugu 482

miR-335

miR-337

uccagcuccuauaugaugccuuu 483

miR-337

miR-338

uccagcaucagugauuuuguuga 484

miR-338

miR-339

ucccuguccuccaggagcuca 485

miR-339

miR-340

uccgucucaguuacuuuauagcc 486

miR-340

miR-342

ucucacacagaaaucgcacccguc 487

miR-342

miR-345

ugcugacuccuaguccagggc 488

miR-345

miR-346

ugucugcccgcaugccugccucu 489

miR-346

miR-367

aauugcacuuuagcaaugguga 490

miR-367

miR-368

acauagaggaaauuccacguuu 491

miR-368

miR-369

aauaauacaugguugaucuuu 492

miR-369

miR-370

gccugcugggguggaaccugg 493

miR-370

miR-371

gugccgccaucuuuugagugu 494

miR-371

miR-372

aaagugcugcgacauuugagcgu 495

miR-372

miR-373*

acucaaaaugggggcgcuuucc 496

miR-373

miR-373

gaagugcuucgauuuuggggugu 497

miR-373

miR-374

uuauaauacaaccugauaagug 498

miR-374

El nivel del al menos un producto génico de miR se puede medir en las células de una muestra biológica obtenida de un sujeto. Por ejemplo, se puede extraer una muestra de tejido de un sujeto del que se sospecha que tiene un cáncer de pulmón por medio de las técnicas de biopsia convencionales. Como alternativa se puede extraer una muestra de sangre del sujeto y se pueden aislar los glóbulos blancos para extraer el ADN por las técnicas de referencia. La muestra de sangre o de tejido se obtiene del sujeto preferentemente antes del inicio de la radioterapia, quimioterapia u otro tratamiento terapéutico. Se puede obtener una correspondiente muestra de tejido o de sangre de control o una muestra de control de referencia, a partir de tejidos sin afectar del sujeto, a partir de un individuo humano normal o una población de individuos humanos normales o a partir de cultivos celulares que correspondan con la mayoría de las células de la muestra del sujeto. La muestra de control de tejido o de sangre se procesa entonces junto con la muestra del sujeto, de forma que se puedan comparar los niveles del producto génico de miR producido por un gen miR determinado en las células de la muestra del sujeto con los niveles del producto génico de miR correspondiente de las células de la muestra de control. De manera alternativa, se puede obtener una muestra de referencia y procesarse independientemente (por ejemplo, a una hora diferente) de la muestra de ensayo y se puede comparar el nivel del producto génico de miR producido por un determinado gen miR en las células de la muestra de ensayo con el nivel del correspondiente producto génico de miR de la muestra de referencia. El nivel de al menos un producto génico de miR en la muestra de ensayo puede ser mayor que el nivel del correspondiente producto génico de miR en la muestra de control (es decir, la expresión del producto génico de miR está “regulada positivamente”). Como se usa en el presente documento, la expresión de un producto génico de miR está “regulada positivamente” cuando la cantidad del producto génico de miR en una célula o muestra de tejido del sujeto es mayor que la cantidad del mismo producto génico en una célula o muestra de tejido de control. Como alternativa, el nivel del al menos un producto génico de miR en la muestra de ensayo puede ser menor que el nivel del correspondiente producto génico de miR de la muestra de control (es decir, la expresión del producto génico de miR está “regulada negativamente”). Como se usa en el presente documento, la expresión de un gen miR está “regulada negativamente” cuando la cantidad del producto génico de miR producido por ese gen en una célula o muestra de tejido del sujeto es menor que la cantidad producida de dicho gen en una célula o muestra de tejido de control. La expresión génica de miR relativa en las muestras de control y normales se puede determinar con respecto a una o más expresiones de ARN de referencia. Las referencias pueden comprender, por ejemplo, un nivel cero de expresión génica de miR, el nivel de expresión génica de miR en una línea celular de referencia, el nivel de expresión génica de miR en tejidos sin afectar del sujeto o el nivel medio de la expresión génica de miR obtenida previamente para una población se seres humanos normales de control. Una alteración (es decir, un aumento o disminución) del nivel de un producto génico de miR en la muestra obtenida del sujeto, con respecto al nivel de un correspondiente producto génico de miR de la muestra de control, es indicativa de la presencia de cáncer de pulmón en el sujeto. El nivel de al menos un producto génico de miR en la muestra de ensayo puede ser mayor que el nivel del correspondiente producto génico de miR en la muestra de control. El nivel de al menos un producto génico de miR en la muestra de ensayo puede ser menor que el nivel del correspondiente producto génico de miR en la muestra de control. En el presente documento tambiñen se divulgan procedimientos en los que el al menos un producto génico de miR se selecciona entre el grupo que consiste en miR- 21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-192-prec, miR-224, miR-126, miR-24-2, miR- 30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR- 216-prec, miR-219-1, miR-106a, miR-197, miR-192, miR-125a-prec, miR-26a-1-prec, miR-146, miR-203, miR-199b- prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c-prec, miR-150, miR-101-1, miR-124a- 3, miR-125a y let-7f-1. Como alaternativa, el al menos un producto génico de miR puede seleccionarse entre el grupo que consiste en miR-21, miR-205 and miR-216. . El producto génico de miR puede no ser uno o más de let7a-2, let-7c, let-7g, let-7i, miR-7-2, miR-7-3, miR-9, miR-9- 1, miR-10a, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-17-5p, miR-20a, miR-21, miR-24-1, miR-24-2, miR-25, miR-29b-2, miR-30, miR-30a-5p, miR-30c, miR-30d, miR-31, miR-32, miR-34, miR-34a, miR-34a prec, miR-34a-1, miR-34a-2, miR-92-2, miR-96, miR-99a, miR-99b prec, miR-100, miR-103, miR-106a, miR-107, miR-123, miR-124a- 1, miR-125b-1, miR-125b-2, miR-126*, miR-127, miR-128b, miR-129, miR-129-1/2 prec, miR-132, miR-135-1, miR- 136, miR-137, miR-141, miR-142-as, miR-143, miR-146, miR-148, miR-149, miR-153, miR-155, miR 159-1, miR-181, miR-181b-1, miR-182, miR-186, miR-191, miR-192, miR-195, miR-196-1, miR-196-1 prec, miR-196-2, miR-199a-1, miR-199a-2, miR-199b, miR-200b, miR-202, miR-203, miR-204, miR-205, miR-210, miR-211, miR-212, miR-214, miR-215, miR-217, miR-221 y/o miR-223.

El nivel de un producto génico de miR en una muestra se puede medir utilizando cualquier técnica que sea adecuada para detectar los niveles de expresión de ARN en una muestra biológica. Las técnicas adecuadas (por ejemplo, análisis de transferencia de Northern, RT-PCR, hibridación in situ) para determinar los niveles de expresión de ARN en una muestra biológica (por ejemplo, células, tejidos) son bien conocidas por los expertos en la técnica. El nivel de al menos un producto génico de miR puede detectarse utilizando el análisis de transferencia de Northern.

Por ejemplo, el ARN total celular se puede purificar a partir de las células por homogenización en presencia de un tampón de extracción de ácido nucleico, seguido por centrifugación. Los ácidos nucleicos se precipitan y el ADN se elimina tratándolo con ADNasa y precipitación. Las moléculas de ARN se separan entonces por electroforesis en gel sobre geles de agarosa según las técnicas de referencia y se transfieren a los filtros de nitrocelulosa. Entonces se inmoviliza el ARN sobre los filtros por calentamiento. La detección y la cuantificación de ARN específico se consigue utilizando sondas de ADN o ARN marcadas adecuadamente que sean complementarias del ARN en cuestión. Véase, por ejemplo, Molecular Cloning: A Laboratory Manual, J. Sambrook y col., eds., 2ª edición, Cold Spring Harbor Laboratory Press, 1989, Capítulo 7. Las sondas adecuadas (por ejemplo, sondas ADN, sondas ARN) para la hibridación por transferencia de Northern de un determinado producto génico de miR se pueden producir a partir de las secuencias proporcionadas en la Tabla 1A y la Tabla 1b e incluyen, pero sin limitación, sondas que tienen al menos una complementariedad de aproximadamente el 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 % o el 99 % con el producto génico de miR de interés. Los procedimientos para la preparación de sondas marcadas de ADN y ARN y las condiciones para la hibridación de las mismas con las secuencias de nucleótidos diana se describen en Molecular Cloning: A Laboratory Manual, J.

Sambrook y col., eds., 2ª edición, Cold Spring Harbor Laboratory Press, 1989, Capítulos 10 y 11. Por ejemplo, la sonda de ácido nucleico se puede marcar con, por ejemplo un radionucleido, tal como 3H, 32P, 33P, 14C o 35S; un metal pesado; un ligando capaz de funcionar como un miembro de un par de unión específico para un ligando marcado (por ejemplo, biotina, avidina o un anticuerpo); una molécula fluorescente; una molécula quimioluminiscente; una enzima o similares. Las sondas se pueden marcar para que tengan una actividad específica alta bien por el procedimiento de traducción de Nick de Rigby y col. (1977), J Mol. Biol. 113: 237-251 o por el procedimiento del cebador aleatorio de Fienberg y col. (1983), Anal. Biochem. 132: 6-13. Este último es el procedimiento de elección para sintetizar sondas de actividad específica alta marcadas con 32P a partir de matrices de ADN de cadena sencilla o de moldes de ARN. Por ejemplo, remplazando los nucleótidos preexistentes con nucleótidos altamente radiactivos según el procedimiento de traducción de Nick, es posible preparar sondas de ácido nucleico marcadas con 32P con una actividad específica en exceso de 108 cpm/microgramo. Se puede entonces llevar a cabo la detección autorradiográfica de hibridación, exponiendo una película fotográfica a los filtros hibridados. El escáner densitométrico de las películas fotográficas expuestas por los filtros hibridados proporciona una medición precisa de los niveles de transcripción del gen miR. Utilizando otra estrategia, los niveles de transcripción del gen miR se pueden cuantificar por sistemas de imagen computarizados, tales como el Molecular Dynamics 400-B 2D Phosphorimager disponible en Amersham Biosciences, Piscataway, NJ.

En el caso de que el marcado de ADN o ARN por radionucleidos no sea práctico, se puede utilizar el procedimiento del cebador aleatorio para incorporar un análogo, por ejemplo, el análogo dTTP 5-(N-(N-blotinil-epsilon- aminocaproil)-3-aminoalil) desoxiuridina trifosfato, en la molécula sonda. El oligonucleótido sonda biotinilado se puede detectar al reaccionar con proteínas unidas a biotina, tales como la avidina, estreptavidina y anticuerpos (por ejemplo, anticuerpos antibiotina) acoplados a tintes fluorescentes o enzimas que producen reacciones de color.

Además de la técnica Northern y otras técnicas de hibridación de ARN, la determinación de las transcripciones de ARN se puede conseguir utilizando la técnica de hibridación in situ. Esta técnica necesita menos células que la técnica de transferencia de Northern e implica depositar las células enteras en un cubreobjetos de microscopio y sondar el contenido de ácido nucleico de la célula con una solución que contiene sondas de ácido nucleico radiactivo o marcado de alguna manera (por ejemplo, ADNc o ARN). Esta técnica es particularmente muy precisa para analizar muestras de biopsias de sujetos. La práctica de la técnica de la hibridación in situ se describe con mayor detalle en la Patente de Estados Unidos Nº 5.427.916. Las sondas adecuadas para la hibridación in situ de un determinado producto génico de miR se pueden producir a partir de las secuencias de ácidos nucleicos proporcionadas en la Tabla 1a y la Tabla 1b, e incluyen, sin limitación, sondas que tienen al menos una complementariedad de aproximadamente el 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 % o el 99 % con un producto génico de miR de interés, así como sondas que tienen una complementariedad completa con un producto génico de interés, como se ha descrito anteriormente. El número relativo de transcritos del gen miR en las células también se puede determinar por transcripción inversa de los transcritos del gen miR, seguida por la amplificación de los transcritos transcritos inversamente por reacción en cadena de la polimerasa (RT-PCR). Los niveles de transcritos del gen miR se pueden cuantificar comparándolos con una referencia interna, por ejemplo, el nivel de ARNm de un gen constitutivo presente en la misma muestra. Un gen constitutivo adecuado para su uso como referencia interna incluye, por ejemplo, el de la miosina o la gliceraldehido-3-fosfato deshidrogenasa (G3PDH). Los procedimientos para llevar a cabo la RT-PCR cuantitativa y semicuantitativa y variaciones de las mismas, son bien conocidos por los expertos en la técnica.

En algunos casos, puede ser deseable determinar simultáneamente el nivel de expresión de una pluralidad de diferentes productos génicos de miR en una muestra. En otros casos, puede ser deseable determinar el nivel de expresión de los transcritos de todos los genes miR conocidos que se correlacionan con un cáncer. Evaluar los niveles de expresión específicos del cáncer para cientos de genes miR o productos génicos tarda mucho tiempo y necesita una gran cantidad de ARN total (por ejemplo, al menos 20 mg para cada transferencia de Northern) y las técnicas autorradiográficas necesitan isótopos radiactivos. Para superar estas limitaciones, puede construirse una genoteca de oligos, en formato de microchip (es decir, una micromatriz) que contenga una serie de oligonucleótidos sondas (por ejemplo, oligodesoxinucleótidos) que son específicos para una serie de genes miR. Utilizando tal micromatriz, se puede determinar el nivel de expresión de múltiples microARN en una muestra biológica haciendo una transcripción inversa de los ARN para generar una serie de oligodesoxinucleótidos diana, e hibridándolos con los oligonucleótidos sonda de la micromatriz para generar un perfil de hibridación o de expresión. El perfil de hibridación de la muestra de ensayo se puede entonces comparar con el de una muestra de control para determinar cuáles son los microARN que tienen un nivel de expresión alterado en las células del cáncer de pulmón. Como se usa en el presente documento, “oligonucleótido sonda” u “oligodesoxinucleótido sonda” se refiere a un oligonucleótido que es capaz de hibridarse con un oligonucleótido diana. “Oligonucleótido diana” u “oligodesoxinucleótido diana” se refiere a una molécula que se tiene que detectar (por ejemplo, por medio de hibridación). Por “oligonucleótido sonda específico de miR” u “oligonucleótido sonda específico para un miR” se entiende un oligonucleótido sonda que tiene una secuencia seleccionada para hibridarse con un producto génico de miR o con una transcripción inversa del producto génico de miR específico. Un “perfil de expresión” o un “perfil de hibridación” de una muestra particular es esencialmente una huella dactilar del estado de la muestra, aunque cualquier gen en particular puede tener dos estados que se expresen de forma similar, la evaluación de un cierto número de genes simultáneamente permite la generación de un perfil de expresión génica que es único del estado de la célula. Es decir que el tejido normal se puede distinguir del tejido del cáncer de pulmón y se pueden determinar diferentes estados pronósticos en el tejido del cáncer de pulmón (por ejemplo, pronósticos de supervivencia buenos o malos a largo plazo). Comparando los perfiles de expresión del tejido del cáncer de pulmón en diferentes estados, se obtiene información con respecto a cuáles son los genes importantes (incluyendo tanto la regulación positiva como negativa de genes) en cada uno de esos estados. La identificación de secuencias que se expresan diferencialmente en el tejido del cáncer de pulmón o en el tejido pulmonar normal, así como la expresión diferencial que da lugar a diferentes resultados pronósticos, permite el uso de esta información de varias maneras. Por ejemplo, se puede evaluar un régimen de tratamiento particular (por ejemplo, para determinar si el fármaco quimioterapéutico actúa para mejorar el pronóstico a largo plazo en un paciente en particular). De manera similar, el diagnóstico se puede hacer o confirmar comparando muestras del paciente con perfiles de expresión conocidos. Además, estos perfiles de expresión génica (o genes individuales) permiten seleccionar entre los fármacos candidatos que suprimen el perfil de expresión del cáncer de pulmón o convierten un perfil de pronóstico malo en un perfil de pronóstico mejor. En consecuencia, la invención proporciona un procedimiento para diagnosticar si un sujeto tiene o está en riesgo de desarrollar un cáncer de pulmón, que comprende la transcripción inversa del ARN de una muestra de ensayo obtenida del sujeto para proporcionar una serie de oligodesoxinucleótidos diana, hibridando los oligodesoxinucleótidos diana con una micromatriz que comprende oligonucleótidos sonda específicos de miARN para proporcionar un perfil de hibridación de la muestra de ensayo y comparando el perfil de hibridación de la muestra de ensayo con un perfil de hibridación generado a partir una muestra de control, de manera que una alteración en la señal de un grupo de miARN es indicativa de que el sujeto tiene cáncer de pulmón, en el que el grupo de miARN consiste en los productos génicos de miR-21, miR-191, miR-155, miR-210, miR-126* y miR-224; y en el que el nivel de los productos génicos de miR-21, miR-191, miR-155 y miR-210 en la muestra de ensayo en es mayor que el nivel del correspondiente producto génico de miR en la muestra de control y en el que el nivel de los productos génicos miR-126* and miR-224 en la muestra de ensayo es menor que el nivel del correspondiente producto génico de miR en la muestra de control. También se divulgan procedimientos en los que la micromatriz comprende oligonucleótidos sonda específicos de miARN para una parte sustancial de todos los miARN humanos conocidos, La micromatriz puede comprender oligonucleótidos sonda específicos de miARN para uno o más de los miARN seleccionados entre el grupo que consiste en miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR- 205, miR-192-prec, miR-224, miR-126, miR-24-2, miR-30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR- 124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216-prec, miR-219-1, miR-106a, miR-197, miR-192, miR-125a- prec, miR-26a-1-prec, miR-146, miR-203, miR-199b-prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR- 33, miR-181c-prec, miR-150, miR-101-1, miR-124a-3, miR-125a, let-7f-1 y una combinación de los mismos. La micromatriz se puede preparar con oligonucleótidos sonda específicos de un gen generados a partir de secuencias conocidas de miARN. La matriz puede contener dos oligonucleótidos sonda diferentes para cada miARN, uno que contiene la secuencia madura, activa y el otro que es específico para el miARN precursor. La matriz también puede contener controles, tales como una o más secuencias de ratón que se diferencian de los ortólogos humanos solamente en unas pocas bases, que pueden servir como controles para las condiciones de rigurosidad de la hibridación. Se pueden imprimir en el microchip ARNt y otros ARN (por ejemplo, ARNr, ARNm) de ambas especies, proporcionando un control interno positivo de hibridación específica, relativamente estable. También se pueden incluir en el microchip uno o más controles apropiados de hibridación no específica. Con este propósito, las secuencias se seleccionan basándose en la ausencia de cualquier homología con cualquiera de los miARN conocidos. La micromatriz puede fabricarse utilizando técnicas conocidas en la técnica. Por ejemplo, los oligonucleótidos sonda de una longitud apropiada, por ejemplo, 40 nucleótidos, se modifican en 5’-amino en la posición C6 y se imprimen utilizando los sistemas de micromatrices disponibles en el mercado, por ejemplo el GeneMachine OmniGrid™ 100 Microarrayer y portaobjetos activados Amersham CodeLink™. El oligómero ADNc marcado correspondiente a los ARN diana se prepara por transcripción inversa del ARN diana con el cebador marcado. Después de la síntesis de la primera cadena, los híbridos ARN/ADN se desnaturalizan para degradar las matrices. Los ADNc marcados preparados de esta manera se hibridan con el chip de la micromatriz bajo condiciones de hibridación, por ejemplo SSPE 6X /formamida al 30 % a 25º C durante 18 horas y a continuación lavándolo con TNT 0,75x a 37º C durante 40 minutos. La hibridación se produce en las posiciones de la matriz en las que la sonda ADN inmovilizada reconoce un ADNc diana complementario de la muestra. El ADNc diana marcado marca la posición exacta en la matriz donde se produce la unión, permitiendo la detección automática y la cuantificación. El resultado consiste en un lista de acontecimientos de hibridación, indicando la abundancia relativa de las secuencias específicas de ADNc y por tanto la abundancia relativa de los correspondientes miR complementarios, en la muestra del paciente. El oligómero ADNc marcado puede ser un ADNc marcado con biotina, preparado a partir de un cebador marcado con biotina. La micromatriz se procesa entonces por detección directa de los transcritos que contienen biotina utilizando, por ejemplo, Streptavidina-Alexa647 conjugada y seleccionada utilizando los procedimientos de selección convencionales. Las intensidades de las imágenes de cada mancha en la matriz son proporcionales a la abundancia del correspondiente miR en la muestra del paciente. El uso de la matriz tiene varias ventajas en la detección de la expresión de miARN. En primer lugar, se puede identificar la expresión global de varios cientos de genes en la misma muestra a la vez. En segundo lugar, con el diseño cuidadoso de los oligonucleótidos sonda, se pueden identificar tanto las moléculas precursoras como las maduras. En tercer lugar, comparado con el análisis de transferencia de Northern, el chip necesita una pequeña cantidad de ARN y proporciona resultados reproducibles utilizando 2,5 mg de ARN en total. El número relativamente limitado de miARN (unos pocos cientos por especie) permite la construcción de una micromatriz común para varias especies, con oligonucleótidos sonda distintivos de cada una. Tal herramienta permitiría analizar la expresión transespecífica para cada miR conocido bajo distintas condiciones. Además de usarse para los ensayos cuantitativos del nivel de expresión de miR específicos, un microchip que contenga oligonucleótidos sonda específicos de miARN que se correspondan con una parte sustancial de miRNoma, preferentemente el miRNoma entero, se puede emplear para llevar a cabo el perfil de expresión génica de miR, por el análisis de los patrones de expresión de miR. Las distintas firmas de miR se pueden asociar con marcadores establecidos de enfermedades o directamente con un estado de enfermedad. De acuerdo con los procedimientos de creación del perfil de expresión descritos en el presente documento, el ARN total de una muestra de un sujeto sospechoso de tener un cáncer (por ejemplo, un cáncer de pulmón) se transcribe inversamente de manera cuantitativa para proporcionar una serie de oligodesoxinucleótidos diana marcados, complementarios del ARN de la muestra. Los oligodesoxinucleótidos diana entonces se hibridan con una micromatriz que comprende oligonucleótidos sonda específicos de miARN para proporcionar un perfil de hibridación de la muestra. El resultado es un perfil de hibridación de la muestra que representa el patrón de expresión del miARN de la muestra. El perfil de hibridación comprende la señal de la unión de los oligodesoxinucleótidos diana de la muestra con los oligonucleótidos sonda específicos de miARN de la micromatriz. El perfil se puede registrar como presencia o ausencia de señal (señal contra cero señal). Más preferentemente, el perfil registrado incluye la intensidad de la señal de cada hibridación. El perfil se compara con el perfil de hibridación generado a partir de una muestra normal, por ejemplo no cancerosa, de control. Una alteración en la señal es indicativa de la presencia de cáncer o la propensión a desarrollar un cáncer en el sujeto.

Otras técnicas para la medición de la expresión génica de miR están dentro de la experiencia de la técnica y se incluyen distintas técnicas para medir tasas de transcripción y degradación del ARN. Esta divulgación también abarca procedimientos para determinar el pronóstico de un sujeto con cáncer de pulmón, que comprenden la medición del nivel de al menos un producto génico de miR, que se asocia con un pronóstico concreto en el cáncer de pulmón (por ejemplo, un pronóstivo bueno o favorable, un pronóstico malo o adverso) en una muestra de ensayo del sujeto. Según estos procedimientos, una alteración en el nivel de un producto génico de miR que se asocia con un pronóstico concreto, en la muestra de ensayo, al compararse con el nivel del correspondiente producto génico de miR en una muestra de control, es indicativa de que el sujeto tiene un cáncer de pulmón con un pronóstico concreto. El producto génico de miR se puede asociar con un pronóstico adverso (es decir, malo). Los ejemplos de un pronóstico adverso incluyen, sin limitación, baja tasa de supervivencia y progresión rápida de la enfermedad. El al menos un producto génico de miR asociado a un pronóstico concreto se puede seleccionar entre el grupo que consiste en miR-155, miR-17-3p, miR-106a, miR-93, let-7a-2, miR-145, let-7b, miR-20 y miR-21. El cáncer de pulmón puede ser un adenocarcinoma y el al menos un producto génico de miR asociado a un pronóstico particular puede seleccionarse entre el grupo que consiste en miR-155 y let-7a-2. El nivel del al menos un producto génico de miR puede medirse haciendo la transcripción inversa del ARN de una muestra de ensayo obtenida de un sujeto para proporcionar una serie de oligodesoxinucleótidos diana, hibridando los oligodesoxinucleótidos diana con una micromatriz que comprende oligonucleótidos sonda específicos de miARN para proporcionar un perfil de hibridación de la muestra de ensayo y comparando el perfil de hibridación de la muestra de ensayo con el perfil de hibridación generado a partir de una muestra de control.

Sin desear quedar ligados por teoría alguna, se cree que las alteraciones en el nivel de uno o más productos génicos de miR en las células pueden dar lugar a la desregulación de una o más posibles dianas de estos miR, lo que conduce a la formación del cáncer de pulmón. Por tanto, alterando el nivel del producto génico de miR (por ejemplo disminuyendo el nivel de un miR que está regulado positivamente en las células del cáncer de pulmón, aumentando el nivel de un miR que está regulado negativamente en las células del cáncer de pulmón) se puede tratar con éxito el cáncer de pulmón. En consecuencia, la presente divulgación engloba procedimientos para tratar el cáncer de pulmón en un sujeto, en el que al menos un producto génico de miR está desregulado (por ejemplo, regulado negativamente, regulado positivamente) en las células (por ejemplo, células del cáncer de pulmón) del sujeto. El nivel de al menos un producto génico de miR en una muestra de ensayo (por ejemplo, una muestra de cáncer de pulmón) puede ser mayor que el nivel del correspondiente producto génico de miR en una muestra de control. El nivel de al menos un producto génico de miR en una muestra de ensayo (por ejemplo, una muestra de cáncer de pulmón) puede ser menor que el nivel del correspondiente producto génico en una muestra de control. Cuando el al menos un producto génico de miR aislado está regulado negativamente en las células del cáncer de pulmón, el procedimiento comprende la administración de una cantidad eficaz del al menos un producto génico de miR aislado o una variante aislada o un fragmento biológicamente activo del mismo, de forma que se inhiba la proliferación de las células del cáncer en el sujeto. Por ejemplo, cuando un producto génico de miR está regulado negativamente en una célula cancerígena de un sujeto, la administración de una cantidad eficaz de un producto génico de miR aislado al sujeto puede inhibir la proliferación de las células cancerígenas. El producto génico de miR aislado que se administra al sujeto puede ser idéntico al producto génico silvestre endógeno de miR (por ejemplo, un producto génico de miR mostrado en la Tabla 1a o la Tabla 1b) que está regulado negativamente en la célula cancerígena o puede ser una variante o un fragmento biológicamente activo del mismo. Como se define en el presente documento, una “variante” de un producto génico de miR se refiere a un miARN que tiene menos del 100 % de identidad con el correspondiente producto génico silvestre de miR y posee una o más actividades biológicas del correspondiente producto génico silvestre de miR. Ejemplos de tales actividades biológicas incluyen, pero sin limitación, la inhibición de la expresión de una molécula de ARN diana (por ejemplo, inhibiendo la traducción de una molécula de ARN diana, modulando la estabilidad de una molécula de ARN diana, inhibiendo el procesamiento de una molécula de ARN diana) y la inhibición de un proceso celular asociado al cáncer de pulmón (por ejemplo, diferenciación celular, crecimiento celular, muerte celular). Estas variantes incluyen variantes de especie y variantes que son la consecuencia de una o más mutaciones (por ejemplo, una sustitución, una deleción, una inserción) en un gen miR. La variante puede ser idéntica en al menos aproximadamente el 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 % o el 99 % a un correspondiente producto génico silvestre de miR. Como se define en el presente documento, un “fragmento biológicamente activo” de un producto génico de miR se refiere a un fragmento de ARN de un producto génico de miR que posee una o más actividades biológicas del correspondiente producto génico silvestre de miR. Como se ha descrito anteriormente, los ejemplos de tales actividades biológicas incluyen, pero sin limitación, la inhibición de la expresión de una molécula de ARN diana y la inhibición del proceso celular asociado a cáncer de pulmón. El fragmento biológicamente activo tiene al menos una longitud de aproximadamente 5, 7, 10, 12, 15 o 17 nucleótidos. Un producto génico de miR aislado se puede administrar a un sujeto en combinación con uno o más tratamientos anticáncer adicionales. Los tratamientos anticáncer adecuados incluyen, pero sin limitación, quimioterapia, radioterapia y combinaciones de las mismas (por ejemplo quimiorradiación). Cuando el al menos un producto génico de miR aislado está regulado positivamente en las células cancerígenas, el procedimiento comprende la administración al sujeto de una cantidad eficaz de un compuesto que inhiba la expresión del al menos un producto génico de miR, de forma que se inhiba la proliferación de las células del cáncer de pulmón. Se hace referencia a tales compuestos en el presente documento como compuestos inhibidores de la expresión génica de miR. Ejemplos de compuestos inhibidores de la expresión génica de miR incluyen, pero sin limitación, los descritos en el presente documento (por ejemplo, ARN de doble cadena, ácidos nucleicos antisentido y moléculas enzimáticas de ARN). Un compuesto inhibidor de la expresión génica de miR se puede administrar a un sujeto en combinación con uno o más tratamientos anticáncer adicionales. Los tratamientos anticáncer adecuados incluyen, pero sin limitación, quimioterapia, radioterapia y la combinación de las mismas (por ejemplo, quimiorradiación).

El producto génico de miR aislado que está desregulado en el cáncer de pulmón puede seleccionarse entre el grupo que consiste en miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-192-prec, miR-224, miR- 126, miR-24-2, miR-30a-5p, miR-212, miR-140, miR-9, miR-214, miR-17-3p, miR-124a-1, miR-218-2, miR-95, miR- 145, miR-198, miR-216-prec, miR-219-1, miR-106a, miR-197, miR-192, miR-125a-prec, miR-26a-1-prec, miR-146, miR-203, miR-199b-prec, let-7a-2-prec, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c-prec, miR-150, miR-101-1, miR-124a-3, miR-125a y let-7f-1. El al menos un producto génico de miR se selecciona entre el grupo que consiste en miR-21, miR-205 y miR-216. El cáncer de pulmón puede ser un adenocarcinoma de pulmón y el al menos un producto génico de miR puede seleccionarse entre el grupo que consiste en miR-21, miR-191, miR-155, miR-210, miR-126* y miR-224. El producto génico de miR puede no ser uno o más de let7a-2, let-7c, let-7g, let-7i, miR-7-2, miR-7-3, miR-9, miR-9- 1, miR-10a, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-17-5p, miR-20a, miR-21, miR-24-1, miR-24-2, miR-25, miR-29b-2, miR-30, miR-30a-5p, miR-30c, miR-30d, miR-31, miR-32, miR-34, miR-34a, miR-34a prec, miR-34a-1, miR-34a-2, miR-92-2, miR-96, miR-99a, miR-99b prec, miR-100, miR-103, miR-106a, miR-107, miR-123, miR-124a- 1, miR-125b-1, miR-125b-2, miR-126*, miR-127, miR-128b, miR-129, miR-129-1/2 prec, miR-132, miR-135-1, miR- 136, miR-137, miR-141, miR-142-as, miR-143, miR-146, miR-148, miR-149, miR-153, miR-155, miR 159-1, miR-181, miR-181b-1, miR-182, miR-186, miR-191, miR-192, miR-195, miR-196-1, miR-196-1 prec, miR-196-2, miR-199a-1, miR-199a-2, miR-199b, miR-200b, miR-202, miR-203, miR-204, miR-205, miR-210, miR-211, miR-212, miR-214, miR-215, miR-217, miR-221 y/o miR-223. Los términos “tratar”, “tratando” y “tratamiento”, como se utilizan en el presente documento, se refieren a la mejoría de los síntomas asociados a una enfermedad o afección, por ejemplo, el cáncer de pulmón, incluyendo la prevención o el retraso de la aparición de los síntomas de la enfermedad y/o la disminución de la gravedad o la frecuencia de los síntomas de la enfermedad o afección. Los términos “sujeto” e “individuo” se definen en el presente documento para incluir animales, tales como mamíferos, incluyendo, pero sin limitación, primates, vacas, ovejas, cabras, caballos, perros, gatos, conejos, cobayas, ratas, ratones u otras especies de bovinos, ovinos, equinos, caninos, felinos, roedores o murinos. Preferentemente, el animal es un ser humano. Como se utiliza en el presente documento, una “cantidad eficaz” de un producto génico de miR aislado es una cantidad suficiente para inhibir la proliferación de una célula cancerígena en un sujeto que padece cáncer de pulmón. Un experto en la técnica puede rápidamente determinar una cantidad eficaz de un producto génico de miR para administrarla a un determinado sujeto, teniendo en cuenta factores tales como el tamaño y el peso del sujeto; el grado de penetración de la enfermedad; la edad, salud y sexo del sujeto; la vía de administración; y si la administración es regional o sistémica. Por ejemplo, una cantidad eficaz de un producto génico de miR aislado se puede basar en el peso aproximado de la masa tumoral que se tiene que tratar. El peso aproximado de una masa tumoral se puede determinar calculando el volumen aproximado de la masa, en la que un centímetro cúbico es equivalente más o menos a un gramo. Una cantidad eficaz del producto génico de miR aislado basándose en el peso de la masa tumoral puede estar en el intervalo de aproximadamente 10-500 microgramos/gramo de masa tumoral. La cantidad eficaz puede ser de al menos aproximadamente 10 microgramos/gramo de masa tumoral, al menos aproximadamente 60 microgramos/gramo de masa tumoral o al menos aproximadamente de 100 microgramos/gramo de masa tumoral. Una cantidad eficaz de un producto génico de miR aislado también se puede basar en el peso corporal aproximado o estimado del sujeto que se tiene que tratar. Preferentemente, tales cantidades eficaces se administran parenteral o entéricamente, como se describe en el presente documento. Por ejemplo, una cantidad eficaz del producto génico de miR aislado que se administra a un sujeto puede variar de aproximadamente 5 – 3000 microgramos/kg de peso corporal, de aproximadamente 700 – 1000 microgramos/kg de peso corporal o aproximadamente más de 1000 microgramos/kg de peso corporal. Un experto en la técnica también puede determinar fácilmente un régimen de dosificación apropiado para la administración de un producto génico de miR aislado a un determinado sujeto. Por ejemplo, un producto génico de miR se puede administrar al sujeto una vez (por ejemplo como inyección única o de depósito). De manera alternativa, un producto génico de miR se puede administrar una vez o dos veces al día a un sujeto durante un periodo de aproximadamente tres a aproximadamente veintiocho días, más particularmente de aproximadamente siete a aproximadamente diez días. En un régimen de dosificación particular, un producto génico de miR se administra una vez al día durante siete días. Cuando un régimen de dosificación comprende múltiples administraciones, se entiende que la cantidad eficaz del producto génico de miR administrado al sujeto puede comprender la cantidad total del producto génico administrado durante el régimen de dosificación completo. Como se utiliza en el presente documento, un producto génico de miR “aislado” es uno que se sintetiza o se altera o se extrae de su estado natural por medio de la intervención humana. Por ejemplo, un producto génico de miR sintético o un producto génico de miR separado parcial o completamente de los materiales con los que coexiste en su estado natural, se considera que está “aislado”. Un producto génico de miR aislado puede existir en una forma sustancialmente purificada o puede existir en una célula a la que se le ha suministrado el producto génico de miR. Por tanto, un producto génico de miR que se ha suministrado deliberadamente a o se ha expresado en, una célula, se considera un producto génico de miR “aislado”. Un producto génico de miR producido dentro de una célula a partir de una molécula precursora de un miR también se considera que es una molécula “aislada”. Los productos génicos de miR aislados descritos en el presente documento se pueden utilizar para la fabricación de un medicamento para tratar el cáncer de pulmón en un sujeto (por ejemplo, un ser humano). Los productos génicos de miR aislados se pueden obtener utilizando varias técnicas de referencia. Por ejemplo, los productos génicos de miR se pueden sintetizar químicamente o producirse de forma recombinante utilizando procedimientos conocidos en la técnica. Los productos génicos de miR pueden sintetizarse químicamente utilizando fosforamiditas de nucleósido protegidas apropiadamente y un sintetizador convencional de ADN/ARN. Se incluyen entre los proveedores comerciales de moléculas sintéticas de ARN o reactivos de síntesis, por ejemplo, Proligo (Hamburgo, Alemania), Dharmacon Research (Lafayette, CO, U.S.A.), Pierce Chemical (parte de Perbio Science, Rockford, IL, U.S.A.), Glen Research (Sterling, VA, U.S.A.), ChemGenes (Ashland, MA, U.S.A.) y Cruachem (Glasgow, RU). De manera alternativa, los productos génicos de miR se pueden expresar a partir de plásmidos ADN recombinantes circulares o lineales utilizando cualquier promotor adecuado. Los promotores adecuados para expresar ARN a partir de un plásmido incluyen, por ejemplo, las secuencias promotoras U6 o H1 de la ARN pol III o los promotores de citomegalovirus. La selección de otros promotores adecuados está dentro de la experiencia de la técnica. Los plásmidos recombinantes de la divulgación también pueden comprender promotores inducibles o regulables para la expresión de los productos génicos de miR en las células cancerosas.

Los productos génicos de miR que se expresan a partir de plásmidos recombinantes se pueden aislar de sistemas de expresión de cultivos celulares por técnicas de referencia. Los productos génicos de miR que se expresan de los plásmidos recombinantes también pueden suministrarse a y expresarse directamente en las células cancerosas. El uso de plásmidos recombinantes para suministrar los productos génicos de miR a las células cancerosas se trata con más detalle posteriormente.

Los productos génicos se pueden expresar de un plásmido recombinante aparte o se pueden expresar del mismo plásmido recombinante. Los productos génicos de miR se pueden expresar como moléculas precursoras de ARN a partir de un único plásmido y las moléculas precursoras se procesan para producir el producto génico de miR funcional por medio de un sistema de procesamiento adecuado, incluyendo, pero sin limitación, los restantes

sistemas de procesamiento que existen en una célula cancerígena. Otros sistemas de procesamiento adecuados incluyen, por ejemplo, el sistema de lisado celular de Drosófila in vitro (por ejemplo, como el descrito en la Solicitud de Patente de Estados Unidos publicada Nº 2002/0086356 a Tuschi y col.) y el sistema ARNasa III de E.coli (por ejemplo, como el que se describe en la Solicitud de Patente de Estados Unidos publicada Nº 2004/0014113 a Yang y col.).

La selección de plásmidos adecuada para expresar los productos génicos de miR, los procedimientos para insertar las secuencias de ácido nucleico en el plásmido para expresar los productos génicos y los procedimientos para suministrar el plásmido recombinante a las células de interés, están dentro de la experiencia de la técnica. Véanse, por ejemplo, Zeng y col. (2002), Molecular Cell 9: 1327-1333; Tuschl (2002), Nat. Biotechnol, 20: 446-448; Brummelkamp y col. (2002), Science 296: 550-553; Miyagishi y col. (2002), Nat. Biotechnol. 20: 497-500; Paddison y col. (2002), Genes Dev. 16: 948-958; Lee y col. (2002), Nat. Biotechnol. 20: 500-505; y Paul y col. (2002), Nat. Biotechnol. 20: 505-508. Un plásmido que expresa los productos génicos de miR puede comprender una secuencia que codifica un ARN precursor de miR bajo el control del promotor temprano intermedio del CMV. Como se utiliza en el presente documento, “bajo el control” de un promotor significa que las secuencias del ácido nucleico que codifican el producto génico de miR están localizados en el 3’ del promotor, de forma que el promotor puede iniciar la transcripción de las secuencias codificantes del producto génico de miR.

Los productos génicos de miR también se pueden expresar a partir de vectores virales recombinantes. Se considera que los productos génicos de miR se pueden expresar a partir de dos vectores virales recombinantes separados o a partir del mismo vector viral. El ARN expresado a partir de vectores virales recombinantes puede aislarse de sistemas de expresión de cultivos celulares por técnicas de referencia o puede expresarse directamente en las células cancerosas. El uso de vectores virales recombinantes para suministrar los productos génicos de miR a las células cancerosas se trata con mayor detalle posteriormente. Los vectores virales recombinantes comprenden secuencias que codifican los productos génicos de miR y cualquier promotor adecuado para expresar secuencias de ARN. Los promotores adecuados incluyen, pero sin limitación, las secuencias de promotor U6 o H1 de la ARN pol III o los promotores de citomegalovirus. La selección de otros promotores adecuados está dentro de la experiencia de la técnica. Los vectores virales recombinantes también pueden comprender promotores inducibles o regulables para la expresión de los productos génicos de miR en una célula cancerosa. Se puede utilizar cualquier vector viral capaz de aceptar las secuencias codificantes para los productos génicos de miR; por ejemplo, vectores que derivan de adenovirus (AV); adenovirus asociados (AAV); retrovirus (por ejemplo, lentivirus (LV), rabdovirus, virus de leucemia murina); herpesvirus y similares. El tropismo de los vectores virales se puede modificar seudotipando los vectores con envueltas de proteínas u otros antígenos de superficie de otros virus o sustituyendo diferentes proteínas de la cápside vírica, según sea apropiado. Por ejemplo, los vectores lentivirales se pueden seudotipar con proteínas de superficie del virus de la estomatitis vesicular (VSV), rabia, Ébola, Mokola y similares. Los vectores AAV se pueden hacer para dirigirse a diferentes células manipulando los vectores para que expresen diferentes serotipos de proteínas de la cápside. Por ejemplo, un vector AAV que exprese un serotipo 2 de cápside sobre un genoma de serotipo 2 se llama AAV 2/2. Este gen de cápside de serotipo 2 en el vector 2/2 se puede remplazar por un gen de serotipo 5 de cápside para producir un vector AAV 2/5. Las técnicas para construir vectores AAV que expresen diferentes serotipos de proteínas de la cápside están dentro de la experiencia de la técnica; véase, por ejemplo, Rabinowitz, J.E. y col. (2002), J. Virol. 76: 791-801. La selección de vectores virales recombinantes, procedimientos para insertar secuencias de ácidos nucleicos para expresar ARN en el vector, los procedimientos de suministro del vector viral a las células de interés y la recuperación de los productos de ARN expresados están en la experiencia de la técnica. Véase, por ejemplo, Dornburg (1995), Gene Therap. 2: 301-310; Eglitis (1988), Biotechniques 6: 608-614; Miller (1990), Hum. Gene Therap. 1: 5-14; y Anderson (1998), Nature 392: 25-30, Son particularmente adecuados los vectores derivados de AV y AAV. Un vector AV adecuado para expresar los productos génicos de miR, un procedimiento para construir un vector AV recombinante y un procedimiento para suministrar el vector en las células diana, se describen en Xia y col. (2002), Nat. Biotech. 20: 1006-1010. Los vectores AAV adecuados para expresar los productos génicos de miR, los procedimientos para construir el vector AAV recombinante y los procedimientos para suministrar los vectores en las células diana se describen en Samulski y col. (1987), J. Virol. 61: 3096-3101; Fisher y col. (1996), J. Virol., 70: 520-532; Samulski y col. (1989), J. virol. 63: 3822-3826; Patente de Estados Unidos Nº 5.252.479; Patente de Estados Unidos Nº 5.139.941; Solicitud de Patente Internacional Nº WO 94/13788; y Solicitud de Patente Internacional Nº WO 93/24641. Los productos génicos de miR pueden expresarse de un vector AAV recombinante único que comprende el promotor temprano intermedio del CMV.

Un vector viral AAV recombinante puede comprender una secuencia de ácido nucleico que codifica un ARN precursor de miR en conexión operativa con una secuencia del extremo poliT bajo el control de un ARN promotor U6 humano. Como se utiliza en el presente documento “en conexión operativa con una secuencia del extremo poliT” significa que las secuencias de ácido nucleico que codifican las cadenas sentido o antisentido están inmediatamente adyacentes a la señal del extremo T en la dirección 5’. Durante la transcripción de las secuencias de miR a partir del vector, el extremo poliT actúa para terminar la transcripción. En el presente documento también se divulgan procedimientos de tratamiento en los que una cantidad eficaz de al menos un compuesto inhibidor de la expresión de miR s epuede administrar al sujeto. Como se utiliza en el presente documento, “inhibidor de la expresión de miR” significa que la producción del precursor y/o el producto génico de miR maduro, activo tras el tratamiento es menor que la cantidad producida antes del tratamiento. Un experto en la técnica puede fácilmente determinar si la expresión de miR se ha inhibido en una célula cancerosa, utilizando, por ejemplo, las técnicas para determinar el nivel de transcripción de miR revisadas en el presente documento. La inhibición puede producirse a nivel de la expresión génica (es decir, inhibiendo la transcripción de un gen miR que codifica el producto génico de miR) o a nivel del procesamiento (por ejemplo, inhibiendo el procesamiento de un precursor de miR que da lugar a un miR maduro, activo).

Como se utiliza en el presente documento, una “cantidad eficaz” de un compuesto inhibidor de la expresión de miR es una cantidad suficiente para inhibir la proliferación de una célula cancerosa en un sujeto que padece un cáncer (por ejemplo, un cáncer de pulmón). Un experto en la técnica puede fácilmente determinar una cantidad eficaz de un compuesto inhibidor de la expresión de un miR que se tiene que administrar a un sujeto determinado, teniendo en cuenta factores tales como el tamaño y el peso del sujeto; el grado de penetración de la enfermedad; la edad, salud y sexo del sujeto; la vía de administración; y si la administración es regional o sistémica. Por ejemplo, una cantidad eficaz del compuesto inhibidor de la expresión se puede basar en el peso aproximado de la masa tumoral que se tiene que tratar, como se ha descrito en el presente documento. Una cantidad eficaz de un compuesto que inhibe la expresión de miR se puede basar también en el peso corporal aproximado o estimado de un sujeto que se tiene que tratar, como se ha descrito en el presente documento. Un experto en la técnica también puede determinar fácilmente un régimen de dosificación apropiado para la administración de un compuesto a un sujeto determinado que inhiba la expresión de miR, como se ha descrito en el presente documento. Los compuestos adecuados para inhibir la expresión del gen miR incluyen el ARN de cadena doble (tal como el ARN corto o pequeño interferente o “ARNsi”), los ácidos nucleicos antisentido y las moléculas enzimáticas de ARN, tales como las ribozimas. Cada uno de estos compuestos se puede dirigir a un determinado producto génico de miR e interfiere con la expresión (por ejemplo, inhibiendo la traducción, induciendo la escisión y/o la degradación) del producto génico de miR diana.

Por ejemplo, la expresión de un determinado gen miR se puede inhibir induciendo la interferencia de ARN del gen miR con una molécula aislada de ARN de doble cadena (ARNds) que tiene al menos el 90 %, por ejemplo al menos el 95 %, al menos el 98 %, al menos el 99 % o el 100 %, de homología de secuencia con al menos una parte del producto génico de miR. La molécula de ARNds puede ser un “ARN corto o pequeño interferente” o “ARNsi”.

El ARNsi útil en los procedimientos presentes comprende un ARN corto de doble cadena con una longitud aproximada de 17 nucleótidos a aproximadamente 29 nucleótidos, preferentemente una longitud de aproximadamente 19 a aproximadamente 25 nucleótidos. El ARNsi comprende una cadena ARN sentido y una cadena de ARN antisentido complementaria hibridadas juntas por las interacciones de emparejamiento de bases de referencia de Watson-Crick (en lo sucesivo en la presente memoria “emparejamiento de bases”). La cadena sentido comprende una secuencia de ácido nucleico que es sustancialmente idéntica a la secuencia de ácido nucleico que está contenida en el producto génico de miR diana. Como se utiliza en el presente documento, una secuencia de ácido nucleico en un ARNsi que es “sustancialmente idéntica” a una secuencia diana que está contenida en el miARN diana, es una secuencia de ácido nucleico que es idéntica a la secuencia diana o que se diferencia de la secuencia diana por uno o dos nucleótidos. Las cadenas de ARNsi sentido y antisentido pueden comprender dos moléculas complementarias de ARN de cadena única o comprender una única molécula en la que dos partes complementarias están emparejadas y unidas covalentemente por un área “horquilla” de una cadena única.

El ARNsi también puede ser un ARN alterado, que difiere del ARN que se produce naturalmente, por adición, deleción, sustitución y/o alteración de uno o más nucleótidos. Tales alteraciones pueden incluir la adición de material no nucleotídico, tal como el de los extremos del ARNsi o de uno o más nucleótidos internos del ARNsi o modificaciones que hacen que el ARNsi sea resistente a la digestión por nucleasas o la sustitución de uno o más nucleótidos en el ARNsi por desoxirribonucleótidos.

Una o ambas cadenas del ARNsi pueden comprender también un saliente 3’. Como se utiliza en el presente documento, un “saliente 3’” se refiere a al menos un nucleótido no emparejado que se extiende desde el extremo 3’ de una cadena de ARN duplicada. Por eso, el ARNsi puede comprender al menos un saliente 3’ de una longitud de 1 a aproximadamente 6 nucleótidos (que incluyen ribonucleótidos o desoxirribonucleótidos), de una longitud de 1 a aproximadamente 5 nucleótidos, de una longitud de 1 a aproximadamente 4 nucleótidos o de una longitud de aproximadamente 2 a aproximadamente 4 nucleótidos. El saliente 3’ puede estar presente en ambas cadenas del ARNsi y tiene una longitud de 2 nucleótidos. Por ejemplo cada cadena del ARNsi puede comprender salientes 3’ de ácido ditimidílico (“TT”) o ácido diuridílico (“uu”).

El ARNsi se puede producir química o biológicamente o se puede expresar a partir de un plásmido recombinante o un vector viral, como se ha descrito anteriormente para los productos génicos de miR aislados. Los procedimientos ilustrativos para producir y ensayar las moléculas de ARNds o ARNsi se describen en la Solicitud de Patente de Estados Unidos publicada Nº 2002/0173478 a Gewirtz y en la Solicitud de Patente de Estados Unidos publicada Nº 2004/0018176 a Reich y col.

La expresión de un determinado gen miR también se puede inhibir por un ácido nucleico antisentido. Como se utiliza en el presente documento, un “ácido nucleico antisentido” se refiere a una molécula de ácido nucleico que se une al ARN diana por medio de interacciones de ácidos nucleicos ARN-ARN, ARN-ADN o ARN-péptido, que alteran la actividad del ARN diana. Los ácidos nucleicos antisentido adecuados para su uso en los presentes procedimientos son ácidos nucleicos de cadena única (por ejemplo, ARN, ADN, quimeras ARN-ADN, ácidos nucleicos peptídicos (PNA)) que generalmente comprenden una secuencia de ácido nucleico complementaria con una secuencia de ácido nucleico contigua en un producto génico de un miR. El ácido nucleico antisentido puede comprender una secuencia de ácido nucleico que tiene una complementariedad del 50 al 100 %, el 75-100 % de complementariedad o el 95-100 % de complementariedad con una secuencia de ácido nucleico contigua en un producto génico de miR.

Las secuencias de ácido nucleico de particulares productos génicos de miR humanos se proporcionan en la Tabla 1a y en la Tabla 1b. Sin desear quedar ligados por teoría alguna, se cree que los ácidos nucleicos antisentido activan la ARNasa H u otra nucleasa celular que digiere el dúplex producto génico de miR/ácido nucleico antisentido. Los ácidos nucleicos antisentido también pueden contener modificaciones en la cadena principal del ácido nucleico o en los restos azúcar y base (o su equivalente) para mejorar la especificidad con la diana, la resistencia a las nucleasas, el suministro u otras propiedades relacionadas con la eficacia de la molécula. Tales modificaciones incluyen restos de colesterol, intercaladores de dúplex, tales como la acridina o uno o más grupos resistentes a la nucleasa.

Los ácidos nucleicos antisentido se pueden producir química o biológicamente o pueden expresarse a partir de un plásmido recombinante o un vector viral, como se ha descrito anteriormente para los productos génicos de miR aislado. Los procedimientos ilustrativos para producirlos y ensayarlos están en la experiencia de la técnica, véase, por ejemplo, Stein y Cheng (1993), Science 261: 1004 y la Patente de Estados Unidos Nº 5.849.902 de Woolf y col.

La expresión de un determinado gen miR también se puede inhibir por un ácido nucleico enzimático. Como se utiliza en el presente documento, un “ácido nucleico enzimático” se refiere a un ácido nucleico que comprende una región de unión al sustrato que tiene complementariedad con una secuencia de ácido nucleico contigua de un producto génico de miR y que es capaz de escindir específicamente el producto génico de miR. La región de unión al sustrato del ácido nucleico enzimático puede ser, por ejemplo, complementaria en un 50-100 %, complementaria en un 75- 100 % o complementaria en un 95-100 % con una secuencia de ácido nucleico contigua en un producto génico de miR. Los ácidos nucleicos enzimáticos también pueden comprender modificaciones en la base, azúcar y/o grupos fosfato. Un ácido nucleico enzimático ejemplar para su uso en los presentes procedimientos es una ribozima. Los ácidos nucleicos enzimáticos se pueden producir química o biológicamente o se pueden expresar a partir de un plásmido recombinante o un vector viral, como se ha descrito anteriormente para los productos génicos de miR aislados. Los procedimientos ilustrativos para producir y ensayar moléculas de ARNds o ARNsi se describen en Werner and Uhlenbeck (1995), Nucl. Acids Res. 23: 2092-96; Hammann y col. (1999), Antisense and Nucleic Acid Drug Dev. 9: 25-31; y Patente de Estados Unidos Nº 4.987.071 de Cech y col. La administración de al menos un producto génico de miR o al menos un compuesto para inhibir la expresión de miR inhibirá la proliferación de las células cancerosas en un sujeto que tenga un cáncer (por ejemplo, un cáncer de pulmón). Como se utiliza en el presente documento, “inhibir la proliferación de una célula cancerosa” significa matar la célula o arrestarla temporal o permanentemente o ralentizar el crecimiento de la célula. La inhibición de la proliferación celular del cáncer se puede inferir si el número de tales células en el sujeto permanece constante o disminuye tras la administración de los productos génicos de miR o de los compuestos inhibidores de la expresión génica de miR. Una inhibición de la proliferación celular del cáncer también se puede inferir si el número absoluto de tales células aumenta, pero la tasa de crecimiento del tumor disminuye. El número de células cancerosas en el cuerpo de un sujeto se puede determinar por medición directa o por estimación a partir del tamaño de las masas tumorales primaria o metastásica. Por ejemplo, el número de células en un sujeto se puede medir por procedimientos inmunohistológicos, citometría de flujo, u otras técnicas diseñadas para detectar los marcadores de superficie característicos de las células cancerosas. El tamaño de una masa tumoral puede determinarse por observación visual directa o por procedimientos de diagnóstico por imagen, tales como rayos X, imágenes de resonancia magnética, ultrasonidos y centellografía. Los procedimientos de diagnóstico por imagen que se usan para determinar el tamaño de una masa tumoral se pueden utilizar con o sin agentes de contraste, como se conoce en la técnica. El tamaño de una masa tumoral también puede determinarse por medios físicos, tales como palpación del tejido de la masa o medición del tejido de la masa con un instrumento de medida, tal como un calibre.

Los productos génicos de miR o los compuestos inhibidores de la expresión génica de miR se pueden administrar a un sujeto por cualquier medio adecuado para suministrar estos compuestos a las células cancerosas del sujeto. Por ejemplo, los productos génicos de miR o los compuestos inhibidores de la expresión de miR se pueden administrar por procedimientos adecuados para transfectar células del sujeto con estos compuestos o con ácidos nucleicos que comprenden secuencias que codifican estos compuestos. Las células se pueden transfectar con un plásmido o un vector viral que comprenden secuencias que codifican al menos un producto génico de miR o un compuesto inhibidor de la expresión génica el miR. Los procedimientos de transfección para células eucariotas se conocen bien en la técnica, e incluyen, por ejemplo, la inyección directa del ácido nucleico en el núcleo o pronúcleo de una célula; la electroporación; la trasferencia por liposomas o la transferencia mediada por materiales lipófilos; el suministro de ácido nucleico mediado por receptor, biobalística o aceleración de partículas; precipitación en fosfato cálcico y la transfección mediada por vectores virales. Por ejemplo, las células pueden transfectarse con un compuesto de transferencia liposómico, por ejemplo, DOTAP (N-[1-(2,3-dioleoiloxi) propil]-N, N, N-trimetil-amonio metilsulfato, Boehringer-Mannheim) o un equivalente, tal como la LIPOFECTINA. La cantidad de ácido nucleico utilizado no es crítica; se pueden alcanzar resultados aceptables con 0,1-100 microgramos de ácido nucleico/105 células. Por ejemplo, se puede utilizar una relación de aproximadamente 0,5 microgramos de vector plásmido en 3 microgramos de DOTAP por 105 células Un producto génico de miR o el compuesto inhibidor de la expresión génica de miR también se pueden administrar a un sujeto por cualquier vía de administración adecuada entérica o parenteral. Las vías adecuadas de administración entérica para los presentes procedimientos incluyen, por ejemplo, el suministro oral, rectal o intranasal. Las vías de administración parenteral adecuadas incluyen, por ejemplo, la administración intravascular (por ejemplo, la inyección intravenosa en bolo, la infusión intravenosa, la inyección intra-arterial en bolo, la infusión intra-arterial y la instilación por catéter en el sistema vascular); la inyección peri e intratisular (por ejemplo, la inyección peri-tumoral e intra- tumoral, la inyección intrarretiniana o la inyección subretiniana); la inyección subcutánea o de depósito, incluyendo la infusión subcutánea (tal como las bombas osmóticas); la aplicación directa sobre el tejido de interés, por ejemplo por medio de un catéter u otro dispositivo de aplicación (por ejemplo, un microgránulo retiniano o un supositorio o un implante que comprenda un material poroso, no poroso o gelatinoso); y por inhalación. Las vías de administración particularmente adecuadas son la inyección, la infusión y la inyección directa en el tumor. En los presentes procedimientos, un producto génico de miR o un compuesto inhibidor de la expresión génica de un miR se puede administrar al sujeto o bien como ARN desnudo, en combinación con un reactivo de suministro o bien como un ácido nucleico (por ejemplo, un plásmido recombinante o un vector viral) que comprendan secuencias que expresan el producto génico de miR o el compuesto inhibidor de la expresión génica de miR. Los reactivos de suministro adecuados incluyen, por ejemplo, el reactivo lipófilo Mirus Transit TKO; LIPOFECTINA; lipofectamina; cellfectina; policationes (por ejemplo, la polilisina) y liposomas. Los plásmidos recombinantes y los vectores virales comprenden secuencias que expresan los productos génicos de miR o los compuestos inhibidores de la expresión génica el miR y las técnicas para suministrar tales plásmidos y vectores a las células cancerosas, se tratan en el presente documento y/o son bien conocidas en la técnica.

Se pueden usar liposomas para suministrar el producto génico de miR o el compuesto inhibidor de la expresión génica de miR (o ácidos nucleicos que comprenden secuencias que los codifican) a un sujeto. Los liposomas también pueden aumentar la vida media sanguínea de los productos génicos o los ácidos nucleicos. Los liposomas adecuados para su uso en la divulgación se pueden formar a partir de los lípidos formadores de vesículas de referencia, que generalmente incluyen fosfolípidos cargados negativamente o neutros y un esterol, tal como el colesterol. La selección de los lípidos está guiada generalmente por la consideración de ciertos factores, tales como el tamaño deseado del liposoma y la vida media de los liposomas en la corriente sanguínea. Se conoce varios procedimientos para preparar liposomas, por ejemplo, los que se describen en Szoka y col. (1980), Ann. Rev. Biophys. Bioeng. 9: 467; y Patentes de Estados Unidos Nº 4.235.871, 4.501.728, 4.837.028 y 5.019.369.

Los liposomas para su uso en los presentes procedimientos pueden comprender una molécula ligando que dirija el liposoma a las células cancerosas. Se prefieren los ligandos que se unen a los receptores prevalentes en las células cancerosas, tales como los anticuerpos monoclonales que se unen a los antígenos celulares del tumor.

Los liposomas para su uso en los presentes procedimientos también se pueden modificar de forma que eviten su eliminación por el sistema mononuclear fagocitario (“MMS”) y el sistema reticuloendotelial (“RES”). Tales liposomas modificados tienen restos inhibidores de la opsonización sobre la superficie o incorporados en la estructura del liposoma. Los liposomas particularmente preferidos comprenden un resto inhibidor de la opsonización y un ligando.

Los restos inhibidores de la opsonización para su uso en la preparación de los liposomas desvelados son normalmente grandes polímeros hidrófilos que se unen a la membrana del liposoma. Como se utiliza en el presente documento, un resto inhibidor de la opsonización se “une” a la membrana de un liposoma cuando se fija química o físicamente a la membrana, por ejemplo, por intercalación de un ancla liposoluble en la misma membrana o uniéndose directamente a grupos activos de los lípidos de la membrana. Estos polímeros hidrófilos inhibidores de la opsonización forman una capa de superficie protectora que disminuye significativamente la captación de los liposomas por el MMS y RES; por ejemplo, como se describe en la Patente de Estados Unidos Nº 4.920.016. Los restos inhibidores de la opsonización adecuados para modificar los liposomas son preferentemente polímeros solubles en agua con un peso molecular medio de aproximadamente 500 a aproximadamente 40.000 Dalton y más preferentemente de aproximadamente 2.000 a aproximadamente 20.000 Dalton. Tales polímeros incluyen el polietilenglicol (PEG) o polipropilenglicol (PPG) o derivados de los mismos; por ejemplo, metoxi PEG o PPG y estearato de PEG o PPG; polímeros sintéticos, tales como poliacrilamida o poli N-vinil pirrolidona; poliamidoaminas lineales, ramificadas o dendriméricas; ácidos poliacrílicos, polialcoholes, por ejemplo, alcohol polivinílico y polixilitol a los que se unen químicamente los grupos amino o carboxílico, así como gangliósidos, tales como el gangliósido GM1. También son adecuados los copolímeros de PEG, metoxiPEG o metoxiPPG o derivados de los mismos. Además, el polímero inhibidor de la opsonización puede ser un copolímero de bloque de PEG y o un poliaminoácido, polisacárido, poliamidoamina, polietilenamina o polinucleótido. Los polímeros inhibidores de la opsonización también pueden ser polisacáridos naturales que contengan aminoácidos o ácidos carboxílicos, por ejemplo, ácido galacturónico, ácido glucurónico, ácido manurónico, ácido hialurónico, ácido péctico, ácido neuramínico, ácido algínico, carragenano; polisacáridos u oligosacáridos aminados (lineales o ramificados); o polisacáridos u oligosacáridos carboxilados, por ejemplo, que reaccionan con derivados de ácidos carbónicos con el resultado de unión de grupos carboxílicos. Preferentemente, el resto inhibidor de la opsonización es un PEG, PPG o un derivado de los mismos. Los liposomas modificados con PEG o derivados del PEG se llaman a veces “liposomas PEGilados”.

El resto inhibidor de la opsonización se puede unir a la membrana del liposoma por cualquiera de las numerosas técnicas que son bien conocidas. Por ejemplo, un N-hidroxisuccinimida éster de PEG puede unirse a un ancla liposoluble fosfatidil-etanolamina y después se unen a la membrana. De manera similar, se puede derivar un polímero de dextrano con un ancla liposoluble estearilamina por medio de aminación reductiva utilizando Na (CN) BH3 y una mezcla disolvente, tal como tetrahidrofurano y agua en una relación de 30:12 a 60 ºC.

Los liposomas modificados con restos inhibidores de la opsonización permanecen en la circulación mucho más tiempo que los liposomas que no están modificados. Por esta razón, tales liposomas a veces se denominan liposomas “furtivos”. Los liposomas furtivos se conocen por acumularse en los tejidos irrigados por un sistema microvascular poroso o “permeable”. Por tanto, el tejido que se caracteriza por esos defectos en el sistema microvascular, como por ejemplo, los tumores sólidos (por ejemplo, los cánceres de pulmón), acumularán eficazmente estos liposomas; véase Gabizon y col. (1988), Proc. Natl. Acad. Sci., U.S.A., 18: 6949-53. Además, su reducida captación por el RES disminuye la toxicidad de los liposomas furtivos previniendo significativamente la acumulación de los liposomas en el hígado y el bazo. Por tanto, los liposomas que se han modificado con restos inhibidores de la opsonización son particularmente adecuados para suministrar los productos génicos de miR o los compuestos inhibidores de la expresión génica de miR (o los ácidos nucleicos que comprenden secuencias que los codifican) a las células tumorales. Los productos génicos de miR o los compuestos inhibidores de la expresión génica de miR se pueden formular como composiciones farmacéuticas, a veces llamadas “medicamentos”, antes de administrarlos a un sujeto, según las técnicas conocidas en la técnica. En consecuencia, esta divulgación engloba composiciones farmacéuticas para tratar el cáncer de pulmón. La composición farmacéutica puede comprender al menos un producto génico de miR aislado o una variante aislada o un fragmento biológicamente activo del mismo y un vehículo farmacéuticamente aceptable. El al menos un producto génico de miR puede corresponder con un producto génico de miR que tiene un nivel de expresión disminuido en las células del cáncer de pulmón con respecto a las células de control adecuadas. El producto génico de miR se puede seleccionar entre el grupo que consiste en miR-126*, miR-192, miR-224, miR- 126, miR-30a-5p, miR-140, miR-9, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216, miR-219-1, miR- 125a, miR-26a-1, miR-199b, let-7a-2, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c, miR-101-1, miR- 124a-3, miR-125b-1, let-7f-1 y una combinación de los mismos. El producto génico de miR aislado puede no ser miR-15a o miR-16-1. Como alternativa, el producto génico de miR puede no ser miR-210 o miR-212. Como alternativa, el producto génico de miR puede no ser miR-21, miR-143, miR-205 o miR-9. Como alternativa, el producto génico de miR puede no ser miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-126, miR-30a-5p, miR-140, miR-214, miR-218-2, miR-145, miR-106a, miR-192, miR-203, miR-150, miR-220, miR-212 o miR-9. Como alternativa, las composiciones farmacéuticas pueden comprender al menos un compuesto inhibidor de la expresión de miR. El al menos un compuesto inhibidor de la expresión génica de miR puede ser específico para un gen miR cuya expresión es mayor en las células del cáncer de pulmón que en las células de control. El compuesto inhibidor de la expresión génica de miR puede ser específico para uno o más productos génicos de miR seleccionados entre el grupo que consiste en miR-21, miR-191, miR-210, miR-155, miR-205, miR-24-2, miR-212, miR-214, miR-17-3p, miR-106a, miR-197, miR-192, miR-146, miR-203, miR-150 y una combinación de los mismos.

El producto génico de miR aislado puede no ser específico para miR-15a o miR-16-1. Como alternativa, el producto génico de miR puede no ser específico para miR-210 o miR-212. Como alternativa, el producto génico de miR puede no ser específico para miR-21, miR-143, miR-205 o miR-9. Como alternativa, el producto génico de miR puede no ser específico para miR-21, miR-191, miR-126*, miR-210, miR-155, miR-143, miR-205, miR-126, miR-30a-5p, miR- 140, miR-214, miR-218-2, miR-145, miR-106a, miR-192, miR-203, miR-150, miR-220, miR-212 o miR-9.

Las composiciones farmacéuticas pueden ser al menos estériles y libres de pirógenos. Como se utiliza en el presente documento, las “composiciones farmacéuticas” incluyen las formulaciones para seres humanos y de uso veterinario. Los procedimientos para preparar las composiciones farmacéuticas están en la experiencia de la técnica, por ejemplo, como se describen EN Remington’s Pharmaceutical Science, 17ª ed., Mack Publishing Company, Easton, PA. (1985). Las composiciones farmacéuticas divulgadas en el presente documento comprenden al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprende una secuencia que codifica el producto génico de miR o el compuesto inhibidor de la expresión génica de miR) (por ejemplo, del 0,1 al 90 % en peso) o una sal fisiológicamente aceptable del mismo, mezclado con un vehículo farmacéuticamente aceptable. Como alternativa, la composición farmacéutica puede comprender adicionalmente uno o más agentes anticáncer (por ejemplo, agentes quimiterapéuticos). Las formulaciones farmacéuticas pueden comprender también al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprenda secuencias que codifiquen el producto génico de miR o un compuesto inhibidor de la expresión génica de miR), que está encapsulado por liposomas y un vehículo farmacéuticamente aceptable. La composición farmacéutica puede comprender un gen miR o un producto génico que no es de miR-15, miR-16, miR-143 y/o miR-145. Vehículos farmacéuticamente aceptables especialmente adecuados son el agua, el agua tamponada, la solución salina normal, la solución salina al 0,4 %, la glicina al 0,3 %, el ácido hialurónico y similares. Como alternativa, las composiciones farmacéuticas pueden comprender al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprende una secuencia que codifica el producto génico de miR o el compuesto inhibidor de la expresión génica de miR) que es resistente a la degradación por nucleasas. Un experto en la técnica puede fácilmente sintetizar ácidos nucleicos que sean resistentes a las nucleasas, por ejemplo incorporando uno o más ribonucleótidos que están modificados en la posición 2’ en el producto génico de miR. Los ribonucleótidos modificados en 2’ adecuados incluyen aquellos modificados en la posición 2’ con fluoro, amino, alquilo, alcoxi y O-alilo.

Las composiciones farmacéuticas también pueden comprender excipientes y/o aditivos farmacéuticos convencionales. Los excipientes farmacéuticos adecuados incluyen estabilizadores, antioxidantes, agentes para ajustar la osmolalidad, tampones y agentes para ajustar el pH. Los aditivos adecuados incluyen, por ejemplo, tampones fisiológicamente biocompatibles (por ejemplo, hidrocloruro de trometamina), adiciones de quelantes (tales como, por ejemplo, DTPA o DTPA-bisamida) o complejos quelantes del calcio (tales como, por ejemplo, DTPA cálcico o CaNaDTPA-bisamida) u, opcionalmente, adiciones de sales de calcio o sodio (por ejemplo, cloruro cálcico, ascorbato cálcico, gluconato cálcico o lactato cálcico). Las composiciones farmacéuticas pueden envasarse para su uso en forma líquida o pueden estar liofilizados. Para las composiciones farmacéuticas sólidas se pueden utilizar vehículos farmacéuticamente aceptables, convencionales, sólidos, no tóxicos; por ejemplo, manitol, lactosa, almidón, estearato magnésico, sacarina sódica, talco, celulosa, glucosa, sacarosa, carbonato magnésico y similares de calidad farmacéutica. Por ejemplo, una composición farmacéutica sólida para administración oral puede comprender cualquiera de los vehículos y excipientes enumerados anteriormente y el 10-95 %, preferentemente el 25 %-75 % del al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprende una secuencia que los codifica). Una composición farmacéutica para administración por aerosol (vía inhalatoria) puede comprender del 0,01-20 % en peso, preferentemente del 1 %-10 % en peso, del al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprende una secuencia que codifica el producto génico de miR o el compuesto inhibidor de la expresión génica de miR) encapsulado en un liposoma como se ha descrito anteriormente y un propulsor. Se puede incluir también, si se desea, un vehículo; por ejemplo, lecitina para suministro intranasal. Las composiciones farmacéuticas pueden comprender además uno o más agentes anticáncer. Las composiciones pueden comprender al menos un producto génico de miR o un compuesto inhibidor de la expresión génica de miR (o al menos un ácido nucleico que comprende una secuencia que codifica el producto génico de miR o el compuesto inhibidor de la expresión de miR) y al menos un agente quimiterapéutico. Los agentes quimiterapéuticos que son adecuados para los procedimientos desvelados en el presente documento incluyen, pero sin limitación, agentes alquilantes de ADN, agentes antibióticos antitumorales, agentes antimetabólicos, agentes estabilizadores de la tubulina, agentes desestabilizantes de la tubulina, agentes antagonistas hormonales, inhibidores de la topoisomerasa, inhibidores de la proteína quinasa, inhibidores de HMG-CoA, inhibidores de la CDK, inhibidores de la ciclina, inhibidores de la caspasa, inhibidores de la metaloproteinasa, ácidos nucleicos antisentido, ADN de triple hélice, aptámeros de ácidos nucleicos y agentes virales, bacterianos o exotóxicos modificados molecularmente. Ejemplos de agentes adecuados para las composiciones incluyen, pero sin limitación, arabinósido de citidina, metotrexato, vincristina, etopósido (VP-16), doxorrubicina (adriamicina), cisplatino (CDDP), dexametasona, arglabin, ciclofosfamida, sarcolisina, metilnitrosourea, fluorouracilo, 5-fluorouracilo (5FU), vinblastina, camptotecina, actinomicina-D, mitomicina-C, peróxido de hidrógeno, oxaliplatino, irinotecan, topotecan, leucovorín, carmustina, estreptozocina, CPT-11, taxol, tamoxifeno, dacarbacina, rituximab, daunorrubicina, 1-β-D-arabinofuranosilcitosina, imatinib, fludarabina, docetaxel y FOLFOX4. Esta divulgación también engloba procedimientos para identificar un agente anticáncer de pulmón, que comprende proporcionar un agente de ensayo a un célula y medir el nivel de al menos un producto génico de miR en la célula. El procedimiento puede comprender proporcionar un agente de ensayo a una célula y medir el nivel de al menos un producto génico asociado a la disminución de los niveles de expresión en las células del cáncer de pulmón. Un aumento del nivel del producto génico de miR en la célula, con respecto a un control adecuado (por ejemplo, el nivel del producto génico de miR en una célula control), es indicativo de que el agente de ensayo es un agente anticáncer de pulmón. El al menos un producto génico de miR puede asociarse con una disminución de los niveles de expresión en las células del cáncer de pulmón se selecciona entre el grupo que consiste en miR-126*, miR-192, miR-224, miR-126, miR-30a-5p, miR-140, miR-9, miR-124a-1, miR-218-2, miR-95, miR-145, miR-198, miR-216, miR- 219-1, miR-125a, miR-26a-1, miR-199b, let-7a-2, miR-27b, miR-32, miR-29b-2, miR-220, miR-33, miR-181c, miR- 101-1, miR-124a-3, miR-125b-1, let-7f-1 y una combinación de los mismos. El producto génico de miR puede no ser uno o más de let7a-2, let-7c, let-7g, let-7i, miR-7-2, miR-7-3, miR-9, miR-9-1, miR-10a, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-17-5p, miR-20a, miR-21, miR-24-1, miR-24-2, miR-25, miR-29b-2, miR-30, miR-30a-5p, miR-30c, miR-30d, miR-31, miR-32, miR-34, miR-34a, miR-34a prec, miR-34a-1, miR-34a-2, miR-92-2, miR-96, miR-99a, miR- 99b prec, miR-100, miR-103, miR-106a, miR-107, miR-123, miR-124a-1, miR-125b-1, miR-125b-2, miR-126*, miR- 127, miR-128b, miR-129, miR-129-1/2 prec, miR-132, miR-135-1, miR-136, miR-137, miR-141, miR-142-as, miR- 143, miR-146, miR-148, miR-149, miR-153, miR-155, miR 159-1, miR-181, miR-181b-1, miR-182, miR-186, miR-191, miR-192, miR-195, miR-196-1, miR-196-1 prec, miR-196-2, miR-199a-1, miR-199a-2, miR-199b, miR-200b, miR-202, miR-203, miR-204, miR-205, miR-210, miR-211, miR-212, miR-214, miR-215, miR-217, miR-221 y/o miR-223. El procedimiento puede comprender proporcionar un agente de ensayo a una célula y medir el nivel de al menos un producto génico de miR asociado a un aumento de los niveles de expresión en las células del cáncer de pulmón. Un descenso en el nivel del producto génico de miR en la célula, con respecto a un control adecuado (por ejemplo, el nivel del producto génico de miR en una célula de control), es indicativo de que el agente de ensayo es un agente anticáncer de pulmón. El al menos un producto génico de miR asociado al aumento de los niveles de expresión en las células del cáncer de pulmón se puede seleccionar entre el grupo que consiste en miR-21, miR-191, miR-210, miR-155, miR-205, miR-24-2, miR-212, miR-214, miR-17-3p, miR-106a, miR-197, miR-192, miR-146, miR-203, miR- 150 y una combinación de los mismos. El producto génico de miR no es uno o más de let7a-2, let-7c, let-7g, let-7i, miR-7-2, miR-7-3, miR-9, miR-9-1, miR-10a, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-17-5Sp, miR-20a, miR-21, miR-24-1, miR-24-2, miR-25, miR-29b-2, miR-30, miR-30a-5p, miR-30c, miR-30d, miR-31, miR-32, miR-34, miR-34a, miR-34a prec, miR-34a-1, miR-34a-2, miR-92-2, miR-96, miR-99a, miR-99b prec, miR-100, miR-103, miR-106a, miR-107, miR-123, miR-124a-1, miR-125b-1, miR-125b-2, miR-126*, miR-127, miR-128b, miR-129, miR-129-1/2 prec, miR-132, miR-135-1, miR-136, miR-137, miR-141, miR-142-as, miR-143, miR-146, miR-148, miR-149, miR- 153, miR-155, miR 159-1, miR-181, miR-181b-1, miR-182, miR-186, miR-191, miR-192, miR-195, miR-196-1, miR- 196-1 prec, miR-196-2, miR-199a-1, miR-199a-2, miR-199b, miR-200b, miR-202, miR-203, miR-204, miR-205, miR- 210, miR-211, miR-212, miR-214, miR-215, miR-217, miR-221 y/o miR-223. Los agentes adecuados incluyen, pero sin limitarse, fármacos (por ejemplo, moléculas pequeñas, péptidos) y macromoléculas biológicas (por ejemplo, proteínas, ácidos nucleicos). El agente se puede producir recombinantemente, sintéticamente o puede aislarse (por ejemplo, purificarse) de una fuente natural. Se conocen bien en la técnica varios procedimientos para proporcionar tales agentes a una célula (por ejemplo, transfección) y varios de tales procedimientos se han descrito anteriormente en el presente documento. Los procedimientos para detectar la expresión de al menos un producto génico de miR (por ejemplo, transferencia de Northern, hibridación in

situ, RT-PCR, perfil de expresión) también son bien conocidos en la técnica. Varios de estos procedimientos también se han descrito en el presente documento. La invención ahora se ilustrará por los siguientes ejemplos no limitantes.

Ejemplos Ejemplo 1: Expresión de miARN alterada en cánceres primarios de pulmón Materiales y procedimientos

Muestras Se utilizaron en este estudio 104 parejas de cánceres primarios de pulmón y sus correspondientes tejidos pulmonares no cancerosos. Se utilizaron 32 casos adicionales, en los que se podía hacer un seguimiento durante 5 años, como una base de datos de validación independiente. Estos tejidos se obtuvieron entre 1990 y 1999 como especímenes quirúrgicos de pacientes en el área metropolitana de Baltimore, con consentimiento informado y de acuerdo con el Consejo de Revisión Institucional. Los tejidos de cáncer de pulmón se obtuvieron de 65 pacientes con adenocarcinoma de pulmón y 39 pacientes con carcinoma de células escamosas de pulmón. Comprendían el grupo 65 pacientes masculinos y 39 pacientes femeninos, con una edad media de 65 años (intervalo de 38-84). Se clasificaron 65 tumores como de estadio I, 17 como de estadio II y 22 tumores como de estadio III o IV. Para la mayoría de las muestras, estaba disponible la información clínica y biológica. El ARN total de los tejidos se aisló con el Reactivo TRIzol® (Invitrogen), según las instrucciones del fabricante. Análisis de micromatrices

El análisis de micromatrices se llevó a cabo como se ha descrito previamente (Liu, C.G. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 9740-9744 (2004)). Resumiendo, 5 µg de ARN total se hibridó con chips de micromatrices miARN que contenían 352 sondas por triplicado. Específicamente, estos chips contenían oligonucleótidos sondas específicas del gen 40-miR, aplicadas por tecnologías de contacto y fijadas covalentemente a una matriz polimérica, que fueron generadas de 161 miARN humanos, 84 miARN de ratón, miARN de otras tres especies y ARNt. Las micromatrices se hibridaron en SSPE 6x (NaCl 0,9 M/ NaH2PO4 ·H2O 60 mM/EDTA 8 mM, pH 7,4)/formamida al 30 % a 25 ºC durante 18 h, se lavaron en TNT 0,75x (Tris-HCl/NaCl/Tween 20) a 37 ºC durante 40 min y se procesaron utilizando un método de detección directa de transcripciones que contienen biotina con streptavidina-Alexa647 conjugada (Molecular Probes, Carlsbad, CA). Los portaobjetos procesados se exploraron utilizando un Scanner PerkinElmer ScanArray XL5K, con el láser ajustado a 635 mm, a 80 de potencia y 70 de PMT y con una resolución de exploración de 10 µm. Un valor medio de las tres réplicas de las manchas para cada miARN se normalizó y analizó con BRB- Array Tools versión 3.2.3. Después de excluir valores negativos con intensidad de hibridación por debajo del fondo, se llevó a cabo la normalización utilizando un procedimiento de normalización per chip sobre la media y normalización para la matriz media como referencia. Finalmente, se seleccionaron 147 miARN con valores logarítmicos congruentes presentes en más del 50 % de las muestras. Los genes que se expresaron de manera diferente entre los grupos se identificaron utilizando el ensayo t o F y los genes se consideraron estadísticamente significativos si su valor de p era menor de 0,001. Se llevó a cabo también un ensayo global para ver si los perfiles de expresión eran diferentes entre los grupos, permutando los marcadores de las matrices que correspondían a los grupos. Para cada permutación, los valores de p se recalcularon y se apuntó el número de genes significativos al nivel de 0,001. La proporción de las permutaciones que dieron al menos tantos genes significativos como los datos actuales fue el nivel significativo del ensayo global Análisis de detección de hibridación en solución y análisis RT-PCR en tiempo real

Los niveles de expresión de los miARN maduros se midieron por detección de hibridación en solución utilizando el Kit de detección mirVanaTM (Ambion Inc., TX). En resumen, se incubó 1 mg de ARN total con sondas marcadas radiactivamente que correspondían con estos miARN. Después de someterse a digestión para eliminar cualquier sonda que no se hubiera unido al miARN diana, se fraccionaron los productos marcados radiactivamente por desnaturalización por electroforesis en gel de poliacrilamida. Las sondas se prepararon marcando el extremo 5’ utilizando polinucleótido quinasa T4 con el kit Probe & Marker de mirVana™ (Ambion Inc., TX), según las instrucciones del fabricante. Se llevó a cabo la PCR cuantitativa en tiempo real como se ha descrito (Schmittgen y col., Nucl. Acids Res. 32: e43 (2004)) sobre un Sistema Aplicado de Detección de Secuencias de Biosistemas, haciéndose todas las reacciones por triplicado. En resumen, el ARN se transcribió inversamente a ADNc con cebadores génicos específicos y Thermoscript y la cantidad relativa de cada miARN con respecto al ARNt, se determinó por medio del iniciador de la metionina, utilizando la ecuación: 2-dCT, donde dCT = (CTmiARN - CTU6).

Análisis de supervivencia Se identificaron los genes cuya expresión estaba relacionada significativamente con la supervivencia del paciente. Se valoró la significación estadística para cada gen basándose en el modelo de regresión de riesgos proporcionales univariado de Cox en BRB-ArrayTools versión 3.2.3. Estos valores de p se utilizaron en un ensayo multivariado de permutación en el que los tiempos de supervivencia y los indicadores de censura se permutaron aleatoriamente entre las matrices. Los genes se consideraron estadísticamente significativos si su valor de p era menor de 0,05. Se estimaron las curvas de supervivencia por el procedimiento de Kaplan-Meier (SAS Institute, Cary, NC) y las curvas resultantes se compararon utilizando un ensayo de intervalo logarítmico. Se examinaron el efecto articulación y las covariables utilizando el modelo de regresión de riesgos proporcionales de Cox. El análisis estadístico se llevó a cabo utilizando el StatMate (ATMS Co. Ltd., Tokyo, Japón). Resultados

Se analizó la expresión de miARN en 104 pares de cáncer primario de pulmón y en los correspondientes tejidos pulmonares no cancerosos para investigar la participación de los miARN en el cáncer de pulmón. La comparación de la expresión de miARN para varios pares de un grupo específico se enumera en la Tabla 2. Se identificaron los miARN que se expresaron de manera diferente en 5 clasificaciones fenotípicas e histológicas (Tabla 2).

Al compararse la expresión del miARN en los tejidos del cáncer de pulmón y en los correspondientes tejidos pulmonares no cancerosos, se identificaron 43 miARN que mostraban diferencias de la expresión entre los grupos estadísticamente significativas (Tabla 3). Se llevó a cabo el ensayo de permutación multivariada en el análisis de comparación de clases utilizando nuestra herramienta de análisis de micromatrices, para controlar las múltiples comparaciones. El ensayo proporciona un nivel de confianza específica para asegurar que el número de descubrimientos falsos no exceda el nivel de dianas o para asegurar que la proporción de la lista de genes que representa falsos descubrimientos no exceda un nivel de dianas. Por tanto, si no hay diferencias reales entre las clases, la probabilidad de obtener por casualidad al menos 43 miARN expresados de manera diferente que sea estadísticamente significativa a un nivel <0,001, sería 0 y así se estimó por el ensayo de permutación multivariada.

Además, el 91 % de los 104 cánceres de pulmón se clasificaron correctamente utilizando el procedimiento de predicción de validación de clase dejando uno fuera, basándose en el predictor covariado compuesto. Basándose en 2.000 permutaciones aleatorias, el valor de p, que se define como la proporción de las permutaciones aleatorias que dan una tasa de errores de validación cruzada no mayor que la tasa de error de validación cruzada con los datos reales, fue < 0,0005.

Varios de estos miARN se asociaron con FRA (Tabla 3). En particular, tres miARN están localizados dentro de sitios frágiles (hsa-mir-21 en FRA17B, hsa-mir-27b en FRA9D y hsa-mir-32 en FRA9E). Además, muchos de estos miARN identificados se localizan en regiones que son eliminadas o amplificadas frecuentemente en varias enfermedades malignas (Tabla 3). Por ejemplo, hsa-mir-21 y hsa-mir-205 están localizados en la región amplificada en el cáncer de pulmón, mientras que hsa-mir-126* y hsa-mir-126 están en 9q34.3, una región eliminada en el cáncer del pulmón. La expresión reducida de los precursores let-7a-2 y let-7f-1 se descubrió en el adenocarcinoma y en el carcinoma de células escamosas con un valor de p con un límite de 0,05. De igual manera. Los análisis de comparación entre el adenocarcinoma vs. tejidos no cancerosos y el carcinoma de células escamosas vs. tejidos no cancerosos revelaron respectivamente, 17 y 16 miARN con una expresión estadísticamente diferente (Tabla 4). Seis miARN (hsa-mir-21,

hsa-mir-191, hsa-mir-155, hsa-mir-210, hsa-mir-126* y hsa-mir-224) se compartieron en los dos tipos histológicos de carcinoma de pulmón de células no pequeñas (NSCLC).

Tabla 2. Análisis de comparación de clasificaciones clinicopatológicas Clasificación (Número) Total Nº de FDRb % clasificados correctamentec (valor genesa de p)

Clasificación Fenotípica

Todos los tumores (104) vs. Todos los 208 43 91 (< 0,0005) normales (104) Tumor Adenod (65) vs. Adeno normal(65) 130 17 0,001 80 (< 0,0005) Tumor SCCc (39) vs. SCC normal (39) 78 16 92 (< 0,0005)

Clasificación Histológica

Tumor Adeno (65) vs. Tumor SCC (39) 104 6 0,001 81 (< 0,0005)

Clasificación por Edad

Todos; Edad <67 (56) vs. Edad ≥67 (48) 104 Adeno: Edad <67 (37) vs. Edad ≥67 (28) SCC; Edad <67 (19) vs. Edad ≥67 (20) 39

Clasificación por Sexo

Todos; Masculino (65) vs. Femenino (39) 104 Adeno; Masculino (39) vs. Femenino (26) SCC; Masculino (26) vs. Femenino (13) 39

Clasificación por Raza

Todos; Afro-Americana (21) vs. Blanca 104 Americana (83) Adeno: Afro-Americana (13) vs. Blanca 65 Americana (52) SCC; Afroamericana (8)

vs.

Blanca 39 Americana (31)

Clasificación por Estadio

Todos; Estadio I (65) vs. Estadio II (17) vs. 104 Estadio III, IV (22) Adeno; Estadio I (41) vs. Estadio II (8) vs. 65 1 Estadio III, IV (16) SCC; Estadio I (24) vs. Estadio II (9) vs. 39 Estadio III. IV (6) aNº de genes, Número de genes significativos a 0,001. bFDR, Tasa de falsos descubrimientos que es la probabilidad de genes significativos por casualidad. c% clasificados correctamente (valor de p). Procedimiento de predicción de clases de validación cruzada dejando uno fuera basado en el predictor covariado compuesto. El valor de p es la proporción de permutaciones aleatorias que daban una tasa de error de validación cruzada que no era mayor que la tasa de error de validación cruzada con los datos reales. dAdeno, Adenocarcinoma. eSCC, Carcinoma de células escamosas.

Tabla 3. 43 miARN expresados diferencialmente en tejidos del cáncer de pulmón vs. Tejidos pulmonares no cancerosos.

miARN Localización Valor de p

Tipo Asociación con Regiones genómicas Gen FRAa asociadas a Cáncera hospedadorb

hsa-mir-21 17q23.2 p < 1e-07 Positivo FRA17B Ampc-netwoblastoma;

TMEM49

pulmón ca

hsa-mir-

3p21.31 p < 1e-07 Positivo Proteína nueva

191 hsa-mir-

9q34.3 p < 1e-07 Negativo Deld-NSCLCe; HCCf

EGFL-7

126* hsa-mir-

11p15.5 1,00E-07 Positivo Del-ovárico: pulmón co Proteína nueva

210 hsa-mir-

21q21.3 1,00E-07 Positivo Amp-colon ca

BIC

155 hsa-mir-

5q32 4,00E-07 Negativo Del-próstata ca minARNcF

143 hsa-mir-

1q32.2 4,00E-07 Positivo Amp-pulmón ca minARNc

205 hsa-mir-

11q13.1 5,00E-07 Negativo FRA11A Del-tiroides ca minARNc

192-prec hsa-mir-

Xq28 5,00E-07 Negativo FRAXF

G4BRE

224 hsa-mir-

9q34.3 7,00E-07 Negativo Del-NSCLC: HCC

EGFL-7

126 hsa-mir-

19p13.1 1,30E-06 Positivo NDb

24-2 hsa-mir-

6q13 4,S0E-06 Negativo minARNc

30a-5p hsa-mir-

17p13.3 5,00E-06 Positivo ND

212 hsa-mir-

16q22.1 5,10E-06 Negativo

ATROPINA-1

140 hsa-mir-9

15q26.1 6,50E-06 Negativo Proteína nueva

hsa-mir-

1q24.3 8,60E-06 Positivo ND

214 hsa-mir-

13q31.3 9,40E-06 Positivo Proteína nueva

17-3p hsa-mir-

8p23.1 1,23E-05 Negativo Amp-MFHsi Proteína nueva

124a-1 hsa-mir-

5q34 1,34E-05 Negativo

SLIT3

218-2 hsa-mir-95 4p16.1 1,48E-05 Negativo

ABLIM2

hsa-mir-

5q32 1,90E-05 Negativo Del-próstata ca minARNc

145 hsa-mir-

3q13.33 2,43E-05 Negativo

FSTL1

198 hsa-mir-

2p16.1 3,05E-05 Negativo ND

216-prec hsa-mir-

6p21.32 5,56E-05 Negativo ND

219-1 hsa-mir-

Xq26.2 6,20E-05 Positivo Del-ovárico ca ND

106a hsa-mir-

1p13.3 7,23E-05 ND Positivo

197 hsa-mir-

11q13.1 0,000119 Del-tiroides ca ND Positivo FRA11A

192 hsa-mir-

19q13.41 0,000143 minARNc Negativo

125a- prec hsa-mir-

3p22.3 0,000148 Del-epitelial ca

NIF1

26a-1-

Negativo

prec hsa-mir-

5q33.3 minARNc

0,000163 Positivo

146 hsa-mir-

ND 14q32.33 0,000267 Positivo

203 hsa-mir-

9q34.11 Del-vejiga ca

GOLGA2

0,000304 Negativo

199b- prec hsa-mir-

11q24.1 FRA11B Del-pulmón ca minARNc 0,000398 Negativo

7a-2- prec hsa-mir-

Del-Vejiga ca Proteína nueva 9q22.32 0,000454 Negativo FRA9D

27b hsa-mir-32 9q31.3 0,000458 Negativo FRA9E Del-pulmón ca Proteína nueva

hsa-mir-

minARNc 1q32.2 0,000466 Negativo

29b-2- hsa-mir-

ND Xq25 0,000630 Negativo

220 hsa-mir-33 22q13.2 0,000683 Negativo Del-colon ca

SREBF2

hsa-mir-

NANOS3

19p13.12 0,000736 Negativo

181c- prec hsa-mir-

ND 19q13.33 0,000784 Positivo

150 hsa-mir-

Del-ovárico; mama ca ND 1p31.3 0,000844 Negativo FRA1C

101-1 hsa-mir-

ND 20q13.33 0,000968 Negativo

124n-3 hsa-mir-

ND 19q13.41 0,000993 Negativo

125a a La información se obtuvo de un informe previo (Calin, G.A. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 2999-3004 (2004)). b La información se obtuvo de un informe previo (Rodríguez, A. y col., Genome Res. 14: 1902-1910 (2004)). cAmp, Amplificación; dDel, Deleción; eNSCLC, Carcinoma de pulmón de células no pequeñas; fHCC, carcinoma hepatocelular; gminARNc, ARN no codificante similar a mARN; hND, no definido; iMFHs, Histiocitomas fibrosos malignos.

El análisis PCR en tiempo real de los precursores de miARN seleccionados se llevó a cabo para validar los resultados del análisis de la micromatriz. Primero, se prepararon los ADNc de 16 pares de adenocarcinomas pulmonares y 16 pares de carcinoma pulmonar de células escamosas, utilizando cebadores génicos específicos para hsa-mir-21, hsa-mir-126*, hsa-mir-205 y U6 (como control). A continuación, se llevaron a cabo los análisis de RT-PCR en tiempo real para determinar los niveles de expresión de estos miARN en diferentes muestras. Al menos una regulación doblemente positiva de la expresión de los precursores de miARN hsa-mir-21 y hsa-mir-205 se encontró en el 66 % y el 56 % de los 32 casos, respectivamente, cuando se compararon con los niveles de expresión de estos miARN en los tejidos no cancerosos correspondientes (FIG. 1). Las diferencias fueron estadísticamente significativas con una p<0,001 según el ensayo-t pareado. Por el contrario, el 31 % de los 32 casos de cáncer de pulmón examinados mostraron una reducción de la expresión del precursor hsa-mir-126* de más del 50 %, aunque estos resultados no fueron estadísticamente significativos (FIG. 1). Estos hallazgos muestran que los miARN precursores específicos están regulados frecuentemente de forma positiva o están reducidos en los cánceres de pulmón, lo que es congruente con los patrones de expresión de sus miARN maduros, como se determinó utilizando el análisis de micromatriz.

Tabla 4. miARN expresados diferencialmente en tejidos con adenocarcinoma/tejidos con carcinoma pulmonar de células escamosas vs. Tejidos pulmonares no cancerosos.

miARN Localización Valor de p

Tipo Adenocarcinoma

hsa-mir-21

17q23.2 p < 1e-07 Positivo

hsa-mir-191

3p21.31 1,20E-06 Positivo

hsa-mir-155

21q21.3 4,10E-06 Positivo

hsa-mir-210

11p15.5 9,90E-06 Positivo

hsa-mir-126*

9q34.3 1,92E-05 Negativo

hsa-mir-126

9q34.3 4,13E-05 Negativo

hsa-mir-24-2

19p13.1 0,000228 Positivo

hsa-mir-219-1

6p21.32 0,000251 Negativo

hsa-mir-95

4p16.1 0,000303 Negativo

hsa-mir-192-prec

11q13.1 0,000307 Negativo

hsa-mir-220

Xq25 0,000309 Negativo

hsa-mir-216-prec

2p16.1 0,00042 Negativo

hsa-mir-204-prec

9q21.11 0,000449 Negativo

hsa-mir-188

Xp11.23 0,000475 Negativo

hsa-mir-198

3q13.33 0,000494 Negativo

hsa-mir-145

5q32 0,000579 Negativo

hsa-mir-224

Xq28 0,000925 Negativo Carcinoma de células escamosas

hsa-mir-205

1q32.2 p < 1e-07 Positivo

hsa-mir-224

Xq28 4,14E-05 Negativo

hsa-mir-191

3p21.31 5,18E-05 Positivo

hsa-mir-126*

9q34.3 9,74E-05 Negativo

hsa-mir-140

16q22.1 0,000132 Negativo

hsa-mir-210

11p15.5 0,0001383 Positivo

hsa-mir-17-3p

13q31.3 0,0001772 Positivo

hsa-mir-29b

1q32.2 0,0002046 Negativo

hsa-mir-143

5q32 0,0003141 Negativo

hsa-mir-203

14q32.33 0,0003293 Positivo

hsa-mir-155

21q21.3 0,0003688 Positivo

hsa-mir-21

17q23.2 0,0003904 Positivo

hsa-mir-214

1q24.3 0,0004546 Positivo

hsa-mir-212

17p13.3 0,0005426 Positivo

hsa-mir-30a-5p

6q13 0,0006165 Negativo

hsa-mir-197

1p13.3 0,0008507 Positivo Además, los datos de la micromatriz para los tres precursores de miARN, hsa-mir-21, hsa-mir-126* y hsa-mir-205, se confirmaron por el procedimiento de detección de hibridación en solución, sus miARN maduros. Específicamente, se analizaron siete pares de tejidos de cáncer de pulmón primario y sus correspondientes tejidos pulmonares no cancerosos, para los que estaban disponibles cantidades suficientes de ARN. Las formas maduras de hsa-mir-21 y hsa-mir-205 estaban claramente reguladas positivamente en los tejidos del cáncer de pulmón cuando se comparaban con los correspondientes tejidos pulmonares no cancerosos (FIG. 2), mientras que hsa-mir-126* estaba regulado negativamente en la mayoría de los tejidos de cáncer de pulmón examinados. Por tanto, como en los resultados de la RT-PCR, estos análisis confirmaron los datos de la expresión de la micromatriz para estos tres miARN. Ejemplo 2: Firmas distintivas de la expresión de miARN en líneas celulares de cáncer de pulmón.

Materiales y procedimientos Muestras Se utilizaron en este estudio trece líneas celulares de cáncer de pulmón, que consistían en cinco líneas celulares de carcinoma de pulmón de células pequeñas (SCLC) y ocho líneas celulares de carcinoma de pulmón de células no pequeñas (NSCLC). Las 5 líneas celulares SCLC fueron DMS 92, NCI-H82, NCI-H146, NCI-H446 y NCI-H417 (American Tissue Culture Collection). Las ocho líneas celulares NSCLC fueron NCI-H157, Calu-1, Calu-6, NCI-H292, NCI-H596, A-427, A549, and A2182 (American Tissue Culture Collection, Manassas, VA). Se aisló el ARN total de los tejidos y los cultivos celulares con Reactivo TRIzol® (Invitrogen, Carlsbad, CA), según las instrucciones del fabricante. Análisis de micromatriz

Se llevó a cabo el análisis de la micromatriz como se ha descrito anteriormente (Liu, C.G. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 9740-9744 (2004), véase también el Ejemplo 1). Análisis estadístico

Se llevaron a cabo los análisis estadísticos como se describe anteriormente en el presente documento (véase, por ejemplo, el Ejemplo 1). Resultados

Se generaron con el análisis de micromatriz, los perfiles de expresión del miARN de cinco líneas celulares de carcinoma de pulmón de células pequeñas (SCLC) y ocho líneas celulares de carcinoma de pulmón de células no pequeñas (NSCLC). La comparación de los perfiles de expresión del miARN de NSCLC y SCLC reveló diferencias estadísticamente significativas (p<0,001 por el ensayo-t) en el nivel de expresión de 3 miARN (hsa-mir-24-1, hsa-mir- 29a y hsa-mir-29c). Además, se revelaron distintos grupos cuando se aplicó el análisis de agrupamiento jerárquico a los 18 miARN expresados más diferencialmente para cada tipo de muestra, de forma que todas las líneas celulares NSCLC caían dentro del grupo que era distinto de las líneas celulares de SCLC (FIG. 3A, FIG. 3B). Estos resultados indican que los perfiles de expresión del miARN pueden ser diferentes en células de diferentes orígenes y/o tipos, como se había descubierto en estudios previos (véase, por ejemplo Liu, C.G. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 9740-9744 (2004); Bhattacharjee, A. y col., Proc. Natl. Acad. Sci. U.S.A. 98: 13790-13795 (2001); Garber, M.E.

y col., Proc. Natl. Acad. Sci. U.S.A. 98: 13784-13789 (2001)). Ejemplo 3: Identificación de los miARN asociados a características clinicopatológicas del cáncer de pulmón Materiales y procedimientos

Análisis de micromatrices Se llevaron a cabo los análisis de micromatrices como se ha descrito anteriormente (Liu, C.G. y col., Proc. Natl. Acad. Sci. U.S.A. 101: 9740-9744 (2004), véase también, el Ejemplo 1).

Análisis estadísticos Los análisis estadísticos se llevaron a cabo como se ha descrito anteriormente en el presente documento (véase, por ejemplo, el Ejemplo 1).

Resultados Se analizó si los datos de la micromatriz revelaban firmas moleculares específicas para subgrupos de cáncer de pulmón que se diferenciaran por su comportamiento clínico. Para este análisis, se examinaron las relaciones de cinco tipos de información clínica y patológica (Tabla 2). En la clasificación histológica, se identificaron seis miARN (hsa-mir-205, hsa-mir-99b, hsa-mir-203, hsa-mir-202, hsa-mir-102 y hsa-mir-204-prec) que se expresaban de forma diferente en los dos tipos histológicos más comunes de NSCLC, adenocarcinoma y carcinoma de células escamosas. Los niveles de expresión de hsa-mir-99b y hsa-mir-102 fueron mayores en el adenocarcinoma. No se identificaron miARN que se expresaran de manera diferente para los grupos que se habían diferenciado por la edad, el género o la raza. Ejemplo 4: Correlación entre la expresión de hsa-mir-155 and hsa-let-7a-2 y el pronóstico de los pacientes con adenocarcinoma de pulmón.

Materiales y procedimientos Análisis de micromatriz Se llevó a cabo el análisis de micromatriz como se ha descrito previamente (Liu, C.G. y col., Proc. Natl. Acad. Sci.

U.S.A. 101: 9740-9744 (2004), véase también, el Ejemplo 1).

Análisis estadístico Se llevaron a cabo los análisis estadísticos como se ha descrito anteriormente en el presente documento (véase, por ejemplo, el Ejemplo 1).

Análisis de Ontología Génica Las dianas predichas del hsa-mir-155 y hsa-let-7a se determinaron por los procedimientos de Lewis y col., (Lewis, B.P. y col., Cell 120: 15-20 (2005)) y PicTar (Krek, A. y col., Nat. Genet. 37: 495-500 (2005)) y se analizaron con respecto a la sobre-representación en los agrupamientos biológicos de una Ontología Génica (GO) particular. Las listas de término GO se sometieron a análisis utilizando la aplicación Whole Pathway Scope (WPS) y esos términos se enumeraron si la puntuación de la prueba exacta de Fisher era menor de 0,005. Resultados

Se evaluó la correlación de la expresión del miARN con la supervivencia del paciente. El modelo de regresión de riesgos proporcionales de Cox univariado con el ensayo de permutación total en el BRB-Array Tools indicaron que ocho miARN (hsa-mir-155, hsa-mir-17-3p, hsa-mir-106a, hsa-mir-93, hsa-let-7a-2, hsa-mir-145, hsa-let-7b y hsa-mir- 21) estaban relacionados con la supervivencia del paciente con adenocarcinoma. Se descubrió que la alta expresión de hsa-mir-155, hsa-mir-17-3p, hsa-mir-106a, hsa-mir-93 o hsa-mir-21 y la baja expresión de hsa-let-7a-2, hsa-let-7b o hsa-mir-145 tenían un pronóstico significativamente peor. Además, el análisis de supervivencia entre 41 pacientes con adenocarcinoma en estadio I reveló que tres miARN (hsa-mir-155, hsa-mir-17-3p y hsa-mir-20) estaban asociados al resultado del paciente. Estos resultados demuestran la importante relación entre los perfiles de expresión del miARN y la supervivencia del paciente, independientemente del estadio de la enfermedad.

Debido a que cinco de estos miARN (hsa-mir-155, hsa-mir-17-3p, hsa-let-7a-2, hsa-mir-145 y hsa-mir-21) se expresaban de manera diferente en los tejidos del cáncer de pulmón con respecto a los correspondientes tejidos pulmonares no cancerosos, se utilizaron estos miARN para más análisis de supervivencia. Se calculó la relación entre la expresión en el cáncer de pulmón y la correspondiente expresión en el tejido pulmonar no canceroso para cada uno de estos cinco miARN y los casos se clasificaron de acuerdo con la relación de expresión. Utilizando este agrupamiento para cada miARN, se llevó a cabo el análisis de supervivencia de Kaplan-Meier. La supervivencia estimada por Kaplan-Meier mostraba que los pacientes con adenocarcinoma de pulmón con alta expresión de hsa- mir-155 o con expresión reducida de hsa-let-7a-2 tenían peores perspectivas de supervivencia que los pacientes con expresión baja de hsa-mir-155 o alta expresión de hsa-let-7a-2 (FIG. 4 y FIG. 5). La diferencia pronóstica de estos dos grupos era altamente significativa para hsa-mir-155 (p=0,006; ensayo de intervalo logarítmico), pero menos significativo para hsa-let-7a-2 (p=0,033; ensayo de intervalo logarítmico). Los análisis de supervivencia de los factores clinicopatológicos mostraron que el estadio estaba asociado significativamente a la supervivencia (p=0,01; ensayo de intervalo logarítmico), mientras que la edad, la raza, el sexo y la historia de fumador no contaba para el pronóstico malo (Tablas 5A y 5B). Para ajustarlo por comparaciones múltiples, utilizamos el procedimiento de Storey

y col., (Storey, J.D. and Tibshirani, R., Proc. Natl. Acad. Sci. U.S.A. 100: 9440-9445 (2003)) limitando las tasas de falsos descubrimientos a 0,05. Utilizando esta tasa, hsa-mir-155 y el estadio de enfermedad fueron aun estadísticamente significativos. Posteriormente, se llevó a cabo un análisis de regresión de riesgos proporcionales de Cox multivariado utilizando todos estos factores clinicopatológicos y moleculares. La expresión alta del hsa-mir- 155 se determinó que era un factor de pronóstico desfavorable, independiente de otros factores clinicopatológicos (p=0,027; relación de riesgo 3,03; 95 % CI, 1,13-8,14), en adición al estadio de la enfermedad (p=0,013; relación de riesgo 3,27; 95 % CI, 1,31-8,37; Tabla 5A).

Tabla 5A. Supervivencia postoperatoria de pacientes con adenocarcinoma de pulmón en relación con las características clinicopatológicas y la expresión de miARN analizada por análisis de micromatriz.

Variable subgrupo Relación de riesgo

p

(95 % CIa)

Análisis univariados (n=65)

Edad Edad >67/ Edad <67 1,41 (0,67-3,06) 0,348 Sexo Masculino/femenino 1,36 (0,64-2,93) 0,413 Estadio II-IV/I 2,51 (1,29-6,82) 0,010 Historia de fumador Actual/exfumador 1,32 (0,63-2,79) 0,456

hsa-mir-155 (n=55) Alto/bajo 3,42 (1,42-8,19) 0,006

hsa-let-7a-2 (n=52) Bajo/alto 2,35 (1,08-6,86) 0,033

Análisis Multivariado (n=55)b. c

Edad Edad>67/Edad<67 1,92 (0,71-5,17) 0,195 Sexo Masculino/femenino 1,23 (0,47-3,22) 0,669 Estadio II-IV/I 3,27 (1,31-8,37) 0,013 Historia de fumador Actual/exfumador 1,49 (0,51-4,34) 0,457

hsa-mir-155

Alto/bajo 3,03 (1,13-8,14) 0,027 a95 % CI, 95 % Intervalo de confianza. bAnálisis multivariado, Modelo de regresión de riesgos proporcionados de Cox. c hsa-let-7a-2 bajo/alto no fue estadísticamente significativo (p=0,089).

Tabla 5B. Supervivencia postoperatoria en pacientes con adenocarcinoma de pulmón en relación con las características clinicopatológicas y la expresión de miARN precursores analizados por análisis RT-PCR en tiempo real.

Cohorte Original Cohorte Adicional Todos los casos (n=32) (n=32) (n=64) Relación de Variable Subgrupo Relación de riesgos Relación de riesgos riesgos

p

p

p

(95 % CIa) (95 % CI) (95 % CI)

Análisis univariado

1,89 1,21 Edad >67/ Edad 1,28 Edad 0,274 0,679 0,482 <67 (0,64-2,58) (0,62-5,34) (0,46-3,21) 0,53 1,37 0,99 Sexo Masculino/femenino 0,232 0,479 0,975 (0,49-1,98) (0,14-1,56) (0,54-3,63)

4,22

2,37

3,07

Estadio II-IV/I 0,003 0,048 <0,00 (1,82-8,84) (1,91-23,6) (1,01-7,83) 0,92 1,22 Historia de 1,12 Actual/exfumador 0,921 0,674 0,757 fumador (0,56-2,25) (0,31-2,66) (0,47-3,16) Precursor 2,75 2,52 2,74 Alto/bajo 0,047 0,033 0,002 (1,53-6,91)

hsa-mir-155

(1,05-12,1) (1,10-7,45) precursor

3,01

2,22

2,73

Bajo/alto 0,037 0,084 0,003 (1,42-5,88)

hsa-let-7a-2

(1,09-9,86) (0,91-5,71)

Análisis

Multivariadob

0,91 0,93 Edad >67/ Edad 1,22 Edad 0,899 0,914 0,593 <67 (0,58-2,53) (0,22-3,68) (0,30-2,91) 0,35 0,92 0,85 Sexo Masculino/femenino 0,089 0,885 0,659 (0,41-1,74) (0,11-1,17) (0,32-2,66)

8,99

4,91

5,58

Estadio II-IV/I 0,004 0,008 <0,001 (2,42-12,8) (1,95-41,2) (1,51-15,9) 1,01 2,27 Historia de 1,89 (0,85- Actual/exfumador 0,980 0,170 0,117 fumador 4,21) (0,30-3,38) (0,70-7,34) Precursor

13,3

3,77

4,98

Alto/bajo 0,002 0,013 <0,001 (2,29-10,8)

hsa-mir-155

(2,59-69,0) (1,32-10,6) Precursor

3,93

2,97

3,55

Bajo/alto 0,040 0,036 0,001 (1,64-7,69)

hsa-let-7a-2

(1,06-14,5) (1,07-8,23) a95 % CI, 95 % Intervalo de confianza. b Análisis multivariado, modelo de regresión de riesgos proporcionales de Cox.

Para investigar las consecuencias biológicas de la expresión alterada de hsa-mir-155 and hsa-let-7a-2, se llevó a cabo un análisis bioinformático para agrupar las dianas predichas de estos miARN de acuerdo con los términos de Ontología Génica (Tabla 6). Además de las asociaciones con los términos más generales de GO, se vio un enriquecimiento significativo para las dianas asociado a la transcripción del hsa-mir-155. El hsa-let-7a mostró una sobre representación de dianas génicas unidas con la proteína quinasa y las cascadas intracelulares de señalización, un hallazgo congruente con la interacción funcional que se había informado, entre el let-7 y RAS (Johnson, S.M. y col., Cell 120:635-647 (2005)).

Tabla 6. Análisis de ontología génica (proceso biológico) para las dianas de transcripción predichas de hsa-mir-155 y

hsa-let-7a.

Proceso biológico Ontología Génica Valor de p

hsa-mir-155

regulación del proceso biológico GO:0050789 3,44343E-05 regulación de base nucleica \ nucleósido \ nucleótido y metabolismo de GO:0019219 0,000149553 ácido nucleico regulación de proceso fisiológico G0:0050791 0,000192938 regulación de transcripción \ dependiente de ADN GO:0006355 0,000244233 regulación del metabolismo GO:0019222 0,000310887 regulación de la transcripción GO:0045449 0,000367426 transcripción\dependiente de ADN GO:0006351 0,000373583 transcripción GO:0006350 0,000749403 Importación de sustrato del núcleo que contiene NLS GO:0006607 0,000871079 Diferenciación de base nucleica celular B \ nucleósido \ GO:0030183 0,00142995 nucleótido y metabolismo de ácido nucleico GO:0006139 0,0021327 Selección de proteínas diana GO:0006605 0,00238267 hemopoyesis GO:0030097 0,00243434 proceso celular GO:0009987 0,00270393 metabolismo de uridina GO:0046108 0,0040568 activación celular B GO:0042113 0,00458041

hsa-let-7a

modificación proteica GO:0006464 9,02643E-05 mantenimiento y crecimiento celular GO:0008151 9,99217E-05 proceso fisiológico celular GO:0050875 0,000128316 cascada de la proteína quinasa GO:0007243 0,000703203 proceso celular GO:0009987 0,000870863 cascada de señalización intracelular GO:0007242 0,001290613 transporte GO:0006810 0,004305096 modificación de la cromatina GO:0016568 0,004414505 localización GO:0051179 0,004492152 metabolismo del fósforo GO:0006793 0,00481218 metabolismo del fosfato GO:0006796 0,00481218 Se llevaron a cabo los análisis de la RT-PCR en tiempo real para hsa-mir-155 y hsa-let-7a-2 para determinar si la expresión de los miARN precursores también tenía un impacto pronóstico en los pacientes con adenocarcinoma. Primero, se sometieron 32 pares de adenocarcinoma del grupo original, en los que estaba disponible el ARN, al análisis RT-PCR en tiempo real. Se calculó la relación entre la expresión en cáncer de pulmón y la expresión de los correspondientes tejidos pulmonares no cancerosos y se clasificaron los casos de acuerdo con la relación de expresión. El análisis de supervivencia de Kaplan-Meier (FIG. 6, FIG. 7) demostró una supervivencia significativamente peor para los pacientes que tenían una expresión alta del precursor hsa-mir-155 (p=0,047; ensayo de intervalo logarítmico) o una expresión reducida del precursor hsa-let-7a-2 (p=0,037; ensayo de intervalo logarítmico) (Tabla 5B). Para validar más los clasificadores de pronóstico descritos aquí, se analizó un grupo adicional independiente de 32 adenocarcinomas utilizando el análisis RT-PCR en tiempo real. Las curvas de supervivencia de Kaplan-Meier (FIG. 8, FIG. 9) mostraron también en esta cohorte una relación clara entre la expresión del hsa-mir-155 precursor (p=0,033; ensayo de intervalo logarítmico) y cerca de la significación en la expresión de hsa-let-7a-2 (p=0,084; ensayo de intervalo logarítmico) (Tabla 5B). Además, se descubrió que la expresión alta del precursor hsa-mir-155 era un predictor independiente de pronóstico malo con un análisis de regresión de riesgos proporcionales de Cox multivariado (Tabla 5B). Para confirmar más si había cualquier fuerza de agrupamiento en el grupo original (32 casos) y el grupo adicional (32 casos), se llevaron a cabo los análisis de supervivencia multivariado y univariado de los 64 casos. De manera congruente con los resultados previos, estos análisis mostraron la significación de la expresión del hsa-mir-155 precursor (Tabla 5B; FIG. 10). Es importante decir que la expresión reducida del precursor hsa-let-7a-2 también tiene un impacto pronóstico similar en los pacientes con adenocarcinoma (Tabla 5B; FIG. 11), lo que es congruente con un informe previo (Takamizawa, J. y col., Cancer Res. 64, 3753-3756 (2004)). Ejemplo 5: Falta de regulación epigenética de la expresión de miARN en líneas celulares de NSCLC. Materiales y procedimientos

Análisis de micromatriz El análisis de micromatriz se llevó a cabo como se ha descrito anteriormente (Liu, C.G., et al., Proc. Natl. Acad. Sci. U.S.A. 101: 9740-9744 (2004), véase también, el Ejemplo 1).

Análisis estadístico El análisis estadístico se llevó a cabo como se ha descrito anteriormente en el presente documento (véase, por ejemplo, el Ejemplo 1).

Tratamiento con 5-aza-dC y/o TSA Se incubaron células A549 y NCI-H157 de cáncer de pulmón (disponibles en la American Tissue Culture Collection) en un medio que contenía 5-aza-dC 1,0 mM (Sigma, St. Louis, MO) durante 48 h y luego se incubaron durante 24 h adicionales en presencia de TSA 1,0 mM (Sigma, St. Louis, MO). Se aisló el ARN total con ReactivoTRIzol® (Invitrogen) y se llevó a cabo el análisis de micromatriz como se ha descrito anteriormente. Cada tratamiento se llevó a cabo por triplicado. Resultados

Se utilizaron las micromatrices de miARN para analizar la expresión de varios miARN en el tratamiento con 5-aza-2’- desoxicitidina (5-aza-dC), un inhibidor de la metilación del ADN y/o Tricostatina A (TSA), un potente inhibidor de la histona desacetilasa, en dos líneas celulares de cáncer de pulmón (A549 y NCI-H157). Aunque se confirmó el aumento de la expresión de un gen, que se sabe que está silenciado transcripcionalmente (MYO18B) después del tratamiento con 5-aza-dC o TSA (FIG. 12), ningún miARN de la micromatriz mostró cambios de expresión, estadísticamente significativos tras el tratamiento con cualquiera de los productos, sugiriendo que la hipermetilación y la desacetilación de histona no eran responsables de la reducción de los niveles de la expresión de miARN, al menos en estas dos líneas celulares. Aunque esta invención se ha mostrado y descrito particularmente con referencia a las realizaciones preferidas de la misma, se entenderá por los expertos en la técnica que se pueden hacer varios cambios en su forma y detalles sin alejarse de la invención abarcada por las reivindicaciones adjuntas. LISTADO DE SECUENCIAS <110> THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION NATIONAL INSTITUTES OF HEALTH <120> PROCEDIMIENTOS BASADOS EN LOS MICROARN PARA EL DIAGNÓSTICO, PRONÓSTICO Y TRATAMIENTO DEL CÁNCER DE PULMÓN <130> 53-28348 <140> AU 2007205234 <141> 03-01-2007 <150> PCT/US07/000103 <151> 03-01-2007 <150> 60/756.400 <151> 01-05-2006 <160> 498 <170> PatentIn versión 3.5 <210> 1 <211> 90 <212> ARN <213> Homo sapiens

<400> 1 <210> 2 <211> 72 <212> ARN <213> Homo sapiens

<400> 2 <210> 3 <211> 74 <212> ARN <213> Homo sapiens

<400> 3 <210> 4 <211> 107 <212> ARN <213> Homo sapiens <400> 4 <210> 5 <211> 85 <212> ARN <213> Homo sapiens <400> 5 <210> 6 <211> 84 <212> ARN <213> Homo sapiens <400> 6 <210> 7 <211> 87 <212> ARN <213> Homo sapiens

<400> 7 <210> 8 <211> 85 <212> ARN <213> Homo sapiens <400> 8 <210> 9 <211> 85 <212> ARN <213> Homo sapiens <400> 9 <210> 10 <211> 79 <212> ARN <213> Homo sapiens

<400> 10 <210> 11 <211> 87 <212> ARN <213> Homo sapiens

<400> 11 <210> 12 <211> 89 <212> ARN <213> Homo sapiens <400> 12 <210> 13 <211> 85 <212> ARN <213> Homo sapiens <400> 13 <210> 14 <211> 108 <212> ARN <213> Homo sapiens <400> 14 <210> 15 <211> 85 <212> ARN <213> Homo sapiens <400> 15 <210> 16 <211> 85 <212> ARN <213> Homo sapiens

<400> 16 <210> 17 <211> 108 <212> ARN <213> Homo sapiens

<400> 17 <210> 18 <211> 85 <212> ARN <213> Homo sapiens <400> 18 <210> 19 <211> 71 <212> ARN <213> Homo sapiens <400> 19 <210> 20 <211> 85 <212> ARN <213> Homo sapiens <400> 20 <210> 21 <211> 108 <212> ARN <213> Homo sapiens

<400> 21 <210> 22 <211> 110 <212> ARN <213> Homo sapiens

<400> 22 <210> 23 <211> 110 <212> ARN <213> Homo sapiens <400> 23 <210> 24 <211> 110 <212> ARN <213> Homo sapiens <400> 24 <210> 25 <211> 89 <212> ARN <213> Homo sapiens <400> 25 <210> 26 <211> 87 <212> ARN <213> Homo sapiens

<400> 26 <210> 27 <211> 90 <212> ARN <213> Homo sapiens

<400> 27 <210> 28 <211> 110 <212> ARN <213> Homo sapiens <400> 28 <210> 29 <211> 110 <212> ARN <213> Homo sapiens <400> 29 <210> 30 <211> 108 <212> ARN <213> Homo sapiens <400> 30 <210> 31 <211> 83 <212> ARN <213> Homo sapiens

<400> 31 <210> 32 <211> 64 <212> ARN <213> Homo sapiens

<400> 32 <210> 33 <211> 98 <212> ARN <213> Homo sapiens <400> 33 <210> 34 <211> 89 <212> ARN <213> Homo sapiens <400> 34 <210> 35 <211> 81 <212> ARN <213> Homo sapiens <400> 35 <210> 36 <211> 81 <212> ARN <213> Homo sapiens <400> 36 <210> 37 <211> 84 <212> ARN <213> Homo sapiens <400> 37 <210> 38 <211> 71 <212> ARN <213> Homo sapiens

<400> 38 <210> 39 <211> 81 <212> ARN <213> Homo sapiens

<400> 39 <210> 40 <211> 82 <212> ARN <213> Homo sapiens <400> 40 <210> 41 <211> 80 <212> ARN <213> Homo sapiens <400> 41 <210> 42 <211> 87 <212> ARN <213> Homo sapiens <400> 42 <210> 43 <211> 96 <212> ARN <213> Homo sapiens

<400> 43 <210> 44 <211> 80 <212> ARN <213> Homo sapiens

<400> 44 <210> 45 <211> 81 <212> ARN <213> Homo sapiens <400> 45 <210> 46 <211> 71 <212> ARN <213> Homo sapiens <400> 46 <210> 47 <211> 72 <212> ARN <213> Homo sapiens <400> 47 <210> 48 <211> 81 <212> ARN <213> Homo sapiens

<400> 48 <210> 49 <211> 85 <212> ARN <213> Homo sapiens

<400> 49 <210> 50 <211> 73 <212> ARN <213> Homo sapiens <400> 50 <210> 51 <211> 97 <212> ARN <213> Homo sapiens <400> 51 <210> 52 <211> 81 <212> ARN <213> Homo sapiens <400> 52 <210> 53 <211> 68 <212> ARN <213> Homo sapiens <400> 53 <210> 54 <211> 73 <212> ARN <213> Homo sapiens <400> 54 <210> 55 <211> 81 <212> ARN <213> Homo sapiens

<400> 55 <210> 56 <211> 71 <212> ARN <213> Homo sapiens

<400> 56 <210> 57 <211> 84 <212> ARN <213> Homo sapiens <400> 57 <210> 58 <211> 86 <212> ARN <213> Homo sapiens <400> 58 <210> 59 <211> 77 <212> ARN <213> Homo sapiens <400> 59 <210> 60 <211> 84 <212> ARN <213> Homo sapiens <400> 60 <210> 61 <211> 77 <212> ARN <213> Homo sapiens

<400> 61 <210> 62 <211> 78 <212> ARN <213> Homo sapiens

<400> 62 <210> 63 <211> 73 <212> ARN <213> Homo sapiens <400> 63 <210> 64 <211> 97 <212> ARN <213> Homo sapiens <400> 64 <210> 65 <211> 80 <212> ARN <213> Homo sapiens <400> 65 <210> 66 <211> 86 <212> ARN <213> Homo sapiens

<400> 66 <210> 67 <211> 108 <212> ARN <213> Homo sapiens

<400> 67 <210> 68 <211> 64 <212> ARN <213> Homo sapiens <400> 68 <210> 69 <211> 81 <212> ARN <213> Homo sapiens

<400> 69 <210> 70 <211> 81 <212> ARN <213> Homo sapiens

<400> 70 <210> 71 <211> 110 <212> ARN <213> Homo sapiens

<400> 71 <210> 72 <211> 71 <212> ARN <213> Homo sapiens <400> 72 <210> 73 <211> 60 <212> ARN <213> Homo sapiens <400> 73 auguaaacau ccuacacuca gcuguaauac auggauuggc ugggaggugg auguuuacgu <210> 74 <211> 88 <212> ARN <213> Homo sapiens

<400> 74 <210> 75 <211> 72 <212> ARN <213> Homo sapiens <400> 75 <210> 76 <211> 70 <212> ARN <213> Homo sapiens <400> 76 <210> 77 <211> 64 <212> ARN <213> Homo sapiens

<400> 77 <210> 78 <211> 71 <212> ARN <213> Homo sapiens

<400> 78 <210> 79 <211> 70 <212> ARN <213> Homo sapiens <400> 79 <210> 80 <211> 110 <212> ARN <213> Homo sapiens <400> 80 <210> 81 <211> 88 <212> ARN <213> Homo sapiens <400> 81 <210> 82 <211> 69 <212> ARN <213> Homo sapiens

<400> 82 <210> 83 <211> 110 <212> ARN <213> Homo sapiens

<400> 83 <210> 84 <211> 84 <212> ARN <213> Homo sapiens <400> 84 <210> 85 <211> 77 <212> ARN <213> Homo sapiens <400> 85 <210> 86 <211> 82 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 86 <210> 87 <211> 78 <212> ARN <213> Homo sapiens

<400> 87 <210> 88 <211> 75 <212> ARN <213> Homo sapiens <400> 88 <210> 89 <211> 80 <212> ARN <213> Homo sapiens <400> 89 <210> 90 <211> 81 <212> ARN <213> Homo sapiens <400> 90 <210> 91 <211> 78 <212> ARN <213> Homo sapiens

<400> 91

ES 2 553 442 T3   <210> 92 <211> 80 <212> ARN <213> Homo sapiens

<400> 92 <210> 93 <211> 80 <212> ARN <213> Homo sapiens

<400> 93 <210> 94 <211> 70 <212> ARN <213> Homo sapiens <400> 94 <210> 95 <211> 81 <212> ARN <213> Homo sapiens <400> 95 <210> 96 <211> 108 <212> ARN <213> Homo sapiens <400> 96 <210> 97 <211> 80 <212> ARN <213> Homo sapiens

<400> 97

ES 2 553 442 T3   <210> 98 <211> 110 <212> ARN <213> Homo sapiens <400> 98 <210> 99 <211> 57 <212> ARN <213> Homo sapiens <400> 99 ucaguuauca cagugcugau gcuguccauu cuaaagguac aguacuguga uaacuga 57 <210> 100 <211> 75 <212> ARN <213> Homo sapiens

<400> 100 <210> 101 <211> 79 <212> ARN <213> Homo sapiens <400> 101 <210> 102 <211> 75 <212> ARN <213> Homo sapiens <400> 102 <210> 103 <211> 81 <212> ARN <213> Homo sapiens <400> 103

ES 2 553 442 T3   <210> 104 <211> 81 <212> ARN <213> Homo sapiens <400> 104 <210> 105 <211> 78 <212> ARN <213> Homo sapiens <400> 105 <210> 106 <211> 78 <212> ARN <213> Homo sapiens <400> 106 <210> 107 <211> 78 <212> ARN <213> Homo sapiens

<400> 107 <210> 108 <211> 81 <212> ARN <213> Homo sapiens

<400> 108 <210> 109

ES 2 553 442 T3   <211> 81 <212> ARN <213> Homo sapiens

<400> 109 <210> 110 <211> 81 <212> ARN <213> Homo sapiens <400> 110 <210> 111 <211> 82 <212> ARN <213> Homo sapiens <400> 111 <210> 112 <211> 81 <212> ARN <213> Homo sapiens <400> 112 <210> 113 <211> 90 <212> ARN <213> Homo sapiens

<400> 113 <210> 114 <211> 80 <212> ARN <213> Homo sapiens

<400> 114

ES 2 553 442 T3   <210> 115 <211> 85 <212> ARN <213> Homo sapiens <400> 115 <210> 116 <211> 66 <212> ARN <213> Homo sapiens <400> 116 <210> 117 <211> 61 <212> ARN <213> Homo sapiens

<400> 117 <210> 118 <211> 85 <212> ARN <213> Homo sapiens

<400> 118 <210> 119 <211> 110 <212> ARN <213> Homo sapiens <400> 119 <210> 120 <211> 87

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 120 <210> 121 <211> 68 <212> ARN <213> Homo sapiens <400> 121 <210> 122 <211> 67 <212> ARN <213> Homo sapiens <400> 122 <210> 123 <211> 86 <212> ARN <213> Homo sapiens

<400> 123 <210> 124 <211> 65 <212> ARN <213> Homo sapiens

<400> 124 <210> 125 <211> 88 <212> ARN <213> Homo sapiens <400> 125

ES 2 553 442 T3   <210> 126 <211> 89 <212> ARN <213> Homo sapiens <400> 126 <210> 127 <211> 85 <212> ARN <213> Homo sapiens

<400> 127 <210> 128 <211> 61 <212> ARN <213> Homo sapiens

<400> 128 <210> 129 <211> 97 <212> ARN <213> Homo sapiens <400> 129 <210> 130 <211> 70 <212> ARN <213> Homo sapiens <400> 130 <210> 131 <211> 82 <212> ARN <213> Homo sapiens <400> 131

ES 2 553 442 T3   <210> 132 <211> 110 <212> ARN <213> Homo sapiens <400> 132 <210> 133 <211> 70 <212> ARN <213> Homo sapiens <400> 133 <210> 134 <211> 74 <212> ARN <213> Homo sapiens <400> 134 <210> 135 <211> 90 <212> ARN <213> Homo sapiens

<400> 135 <210> 136 <211> 89 <212> ARN <213> Homo sapiens

<400> 136 <210> 137 <211> 110

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 137 <210> 138 <211> 110 <212> ARN <213> Homo sapiens <400> 138 <210> 139 <211> 72 <212> ARN <213> Homo sapiens <400> 139 <210> 140 <211> 101 <212> ARN <213> Homo sapiens

<400> 140 <210> 141 <211> 66 <212> ARN <213> Homo sapiens

<400> 141 <210> 142 <211> 88 <212> ARN <213> Homo sapiens <400> 142

ES 2 553 442 T3   <210> 143 <211> 102 <212> ARN <213> Homo sapiens <400> 143 <210> 144 <211> 68 <212> ARN <213> Homo sapiens <400> 144 <210> 145 <211> 119 <212> ARN <213> Homo sapiens

<400> 145 <210> 146 <211> 80 <212> ARN <213> Homo sapiens <400> 146 <210> 147 <211> 73 <212> ARN <213> Homo sapiens <400> 147 <210> 148 <211> 71 <212> ARN

ES 2 553 442 T3   <213> Homo sapiens <400> 148 <210> 149 <211> 90 <212> ARN <213> Homo sapiens <400> 149 <210> 150 <211> 100 <212> ARN <213> Homo sapiens

<400> 150 <210> 151 <211> 60 <212> ARN <213> Homo sapiens

<400> 151 cuauggcuuu uuauuccuau gugauucuac ugcucacuca uauagggauu ggagccgugg <210> 152 <211> 97 <212> ARN <213> Homo sapiens <400> 152 <210> 153 <211> 82 <212> ARN <213> Homo sapiens <400> 153 <210> 154

ES 2 553 442 T3   <211> 62 <212> ARN <213> Homo sapiens

<400> 154 <210> 155 <211> 73 <212> ARN <213> Homo sapiens <400> 155 <210> 156 <211> 99 <212> ARN <213> Homo sapiens <400> 156 <210> 157 <211> 84 <212> ARN <213> Homo sapiens <400> 157 <210> 158 <211> 71 <212> ARN <213> Homo sapiens

<400> 158 <210> 159 <211> 68 <212> ARN <213> Homo sapiens

<400> 159

ES 2 553 442 T3   <210> 160 <211> 100 <212> ARN <213> Homo sapiens <400> 160 <210> 161 <211> 72 <212> ARN <213> Homo sapiens <400> 161 <210> 162 <211> 70 <212> ARN <213> Homo sapiens

<400> 162 <210> 163 <211> 95 <212> ARN <213> Homo sapiens

<400> 163 <210> 164 <211> 72 <212> ARN <213> Homo sapiens <400> 164 <210> 165 <211> 64

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 165 <210> 166 <211> 106 <212> ARN <213> Homo sapiens <400> 166 <210> 167 <211> 63 <212> ARN <213> Homo sapiens <400> 167 <210> 168 <211> 86 <212> ARN <213> Homo sapiens

<400> 168 <210> 169 <211> 66 <212> ARN <213> Homo sapiens

<400> 169 <210> 170 <211> 88 <212> ARN <213> Homo sapiens <400> 170

ES 2 553 442 T3   <210> 171 <211> 70 <212> ARN <213> Homo sapiens <400> 171 <210> 172 <211> 99 <212> ARN <213> Homo sapiens <400> 172 <210> 173 <211> 65 <212> ARN <213> Homo sapiens

<400> 173 <210> 174 <211> 72 <212> ARN <213> Homo sapiens

<400> 174 <210> 175 <211> 68 <212> ARN <213> Homo sapiens <400> 175 <210> 176

ES 2 553 442 T3   <211> 99 <212> ARN <213> Homo sapiens

<400> 176 <210> 177 <211> 70 <212> ARN <213> Homo sapiens <400> 177 <210> 178 <211> 89 <212> ARN <213> Homo sapiens <400> 178 <210> 179 <211> 53 <212> ARN <213> Homo sapiens <400> 179 gcucuggcuc cgugucuuca cucccgugcu uguccgagga gggagggagg gac 53 <210> 180 <211> 84 <212> ARN <213> Homo sapiens

<400> 180 <210> 181 <211> 64 <212> ARN <213> Homo sapiens <400> 181

ES 2 553 442 T3   <210> 182 <211> 72 <212> ARN <213> Homo sapiens

<400> 182 <210> 183 <211> 69 <212> ARN <213> Homo sapiens

<400> 183 <210> 184 <211> 87 <212> ARN <213> Homo sapiens <400> 184 <210> 185 <211> 71 <212> ARN <213> Homo sapiens <400> 185 <210> 186 <211> 90 <212> ARN <213> Homo sapiens <400> 186 <210> 187 <211> 71 <212> ARN <213> Homo sapiens

<400> 187

ES 2 553 442 T3   <210> 188 <211> 87 <212> ARN <213> Homo sapiens <400> 188 <210> 189 <211> 69 <212> ARN <213> Homo sapiens <400> 189 <210> 190 <211> 84 <212> ARN <213> Homo sapiens

<400> 190 <210> 191 <211> 66 <212> ARN <213> Homo sapiens

<400> 191 <210> 192 <211> 65 <212> ARN <213> Homo sapiens <400> 192 <210> 193

ES 2 553 442 T3   <211> 82 <212> ARN <213> Homo sapiens

<400> 193 <210> 194 <211> 110 <212> ARN <213> Homo sapiens <400> 194 <210> 195 <211> 80 <212> ARN <213> Homo sapiens <400> 195 <210> 196 <211> 70 <212> ARN <213> Homo sapiens <400> 196 <210> 197 <211> 64 <212> ARN <213> Homo sapiens

<400> 197 <210> 198 <211> 70 <212> ARN <213> Homo sapiens

<400> 198

ES 2 553 442 T3   <210> 199 <211> 108 <212> ARN <213> Homo sapiens <400> 199 <210> 200 <211> 81 <212> ARN <213> Homo sapiens <400> 200 <210> 201 <211> 70 <212> ARN <213> Homo sapiens

<400> 201 <210> 202 <211> 70 <212> ARN <213> Homo sapiens

<400> 202 <210> 203 <211> 110 <212> ARN <213> Homo sapiens <400> 203 <210> 204 <211> 110

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 204 <210> 205 <211> 89 <212> ARN <213> Homo sapiens <400> 205 <210> 206 <211> 110 <212> ARN <213> Homo sapiens <400> 206 <210> 207 <211> 110 <212> ARN <213> Homo sapiens

<400> 207 <210> 208 <211> 70 <212> ARN <213> Homo sapiens

<400> 208 <210> 209 <211> 110 <212> ARN <213> Homo sapiens <400> 209

ES 2 553 442 T3   <210> 210 <211> 84 <212> ARN <213> Homo sapiens <400> 210 <210> 211 <211> 65 <212> ARN <213> Homo sapiens <400> 211 <210> 212 <211> 82 <212> ARN <213> Homo sapiens

<400> 212 <210> 213 <211> 66 <212> ARN <213> Homo sapiens

<400> 213 <210> 214 <211> 86 <212> ARN <213> Homo sapiens <400> 214 <210> 215 <211> 71 <212> ARN

ES 2 553 442 T3   <213> Homo sapiens <400> 215 <210> 216 <211> 109 <212> ARN <213> Homo sapiens <400> 216 <210> 217 <211> 86 <212> ARN <213> Homo sapiens

<400> 217 <210> 218 <211> 68 <212> ARN <213> Homo sapiens

<400> 218 <210> 219 <211> 102 <212> ARN <213> Homo sapiens <400> 219 <210> 220 <211> 68 <212> ARN <213> Homo sapiens <400> 220

ES 2 553 442 T3   <210> 221 <211> 85 <212> ARN <213> Homo sapiens <400> 221 <210> 222 <211> 67 <212> ARN <213> Homo sapiens

<400> 222 <210> 223 <211> 92 <212> ARN <213> Homo sapiens

<400> 223 <210> 224 <211> 74 <212> ARN <213> Homo sapiens <400> 224 <210> 225 <211> 108 <212> ARN <213> Homo sapiens <400> 225 <210> 226 <211> 110 <212> ARN <213> Homo sapiens <400> 226

ES 2 553 442 T3   <210> 227 <211> 88 <212> ARN <213> Homo sapiens <400> 227 <210> 228 <211> 58 <212> ARN <213> Homo sapiens <400> 228 gcugggucuu ugcgggcgag augagggugu cggaucaacu ggccuacaaa gucccagu 58 <210> 229 <211> 85 <212> ARN <213> Homo sapiens

<400> 229 <210> 230 <211> 63 <212> ARN <213> Homo sapiens <400> 230 <210> 231 <211> 87 <212> ARN <213> Homo sapiens <400> 231 <210> 232 <211> 58 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 232 uagcagcaca gaaauauugg cacagggaag cgagucugcc aauauuggcu gugcugcu 58 <210> 233 <211> 110 <212> ARN <213> Homo sapiens <400> 233 <210> 234 <211> 70 <212> ARN <213> Homo sapiens <400> 234 <210> 235 <211> 110 <212> ARN <213> Homo sapiens <400> 235 <210> 236 <211> 70 <212> ARN <213> Homo sapiens

<400> 236 <210> 237 <211> 84 <212> ARN <213> Homo sapiens

<400> 237 <210> 238 <211> 75 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 238 <210> 239 <211> 60 <212> ARN <213> Homo sapiens

<400> 239 gugcaugugu auguaugugu gcaugugcau guguaugugu augagugcau gcgugugugc <210> 240 <211> 62 <212> ARN <213> Homo sapiens <400> 240 <210> 241 <211> 71 <212> ARN <213> Homo sapiens <400> 241 <210> 242 <211> 110 <212> ARN <213> Homo sapiens

<400> 242 <210> 243 <211> 110 <212> ARN <213> Homo sapiens

<400> 243 <210> 244 <211> 71 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 244 <210> 245 <211> 70 <212> ARN <213> Homo sapiens

<400> 245 <210> 246 <211> 95 <212> ARN <213> Homo sapiens <400> 246 <210> 247 <211> 68 <212> ARN <213> Homo sapiens <400> 247 <210> 248 <211> 72 <212> ARN <213> Homo sapiens <400> 248 <210> 249 <211> 110 <212> ARN <213> Homo sapiens

<400> 249

ES 2 553 442 T3   <210> 250 <211> 110 <212> ARN <213> Homo sapiens

<400> 250 <210> 251 <211> 110 <212> ARN <213> Homo sapiens

<400> 251 <210> 252 <211> 86 <212> ARN <213> Homo sapiens <400> 252 <210> 253 <211> 69 <212> ARN <213> Homo sapiens <400> 253 <210> 254 <211> 71 <212> ARN <213> Homo sapiens <400> 254 <210> 255 <211> 110 <212> ARN <213> Homo sapiens

<400> 255

ES 2 553 442 T3   <210> 256 <211> 110 <212> ARN <213> Homo sapiens <400> 256 <210> 257 <211> 110 <212> ARN <213> Homo sapiens <400> 257 <210> 258 <211> 110 <212> ARN <213> Homo sapiens

<400> 258 <210> 259 <211> 108 <212> ARN <213> Homo sapiens

<400> 259 <210> 260 <211> 110 <212> ARN <213> Homo sapiens <400> 260 <210> 261 <211> 110

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 261 <210> 262 <211> 110 <212> ARN <213> Homo sapiens <400> 262 <210> 263 <211> 110 <212> ARN <213> Homo sapiens <400> 263 <210> 264 <211> 110 <212> ARN <213> Homo sapiens

<400> 264 <210> 265 <211> 110 <212> ARN <213> Homo sapiens

<400> 265 <210> 266 <211> 110 <212> ARN <213> Homo sapiens <400> 266

ES 2 553 442 T3   <210> 267 <211> 110 <212> ARN <213> Homo sapiens <400> 267 <210> 268 <211> 97 <212> ARN <213> Homo sapiens <400> 268 <210> 269 <211> 110 <212> ARN <213> Homo sapiens

<400> 269 <210> 270 <211> 110 <212> ARN <213> Homo sapiens

<400> 270 <210> 271 <211> 110 <212> ARN <213> Homo sapiens <400> 271 <210> 272

ES 2 553 442 T3   <211> 110 <212> ARN <213> Homo sapiens

<400> 272 <210> 273 <211> 81 <212> ARN <213> Homo sapiens <400> 273 <210> 274 <211> 60 <212> ARN <213> Homo sapiens <400> 274 caaucuuccu uuaucauggu auugauuuuu cagugcuucc cuuuugugug agagaagaua <210> 275 <211> 80 <212> ARN <213> Homo sapiens

<400> 275 <210> 276 <211> 63 <212> ARN <213> Homo sapiens

<400> 276 <210> 277 <211> 86 <212> ARN <213> Homo sapiens <400> 277 <210> 278

ES 2 553 442 T3   <211> 69 <212> ARN <213> Homo sapiens

<400> 278 <210> 279 <211> 73 <212> ARN <213> Homo sapiens <400> 279 <210> 280 <211> 68 <212> ARN <213> Homo sapiens <400> 280 <210> 281 <211> 68 <212> ARN <213> Homo sapiens <400> 281 <210> 282 <211> 82 <212> ARN <213> Homo sapiens

<400> 282 <210> 283 <211> 59 <212> ARN <213> Homo sapiens

<400> 283 uuggccuccu aagccaggga uuguggguuc gagucccacc cgggguaaag aaaggccga 59

ES 2 553 442 T3   <210> 284 <211> 86 <212> ARN <213> Homo sapiens

<400> 284 <210> 285 <211> 83 <212> ARN <213> Homo sapiens

<400> 285 <210> 286 <211> 98 <212> ARN <213> Homo sapiens <400> 286 <210> 287 <211> 95 <212> ARN <213> Homo sapiens <400> 287 <210> 288 <211> 75 <212> ARN <213> Homo sapiens <400> 288 <210> 289 <211> 94 <212> ARN <213> Homo sapiens

<400> 289

ES 2 553 442 T3   <210> 290 <211> 94 <212> ARN <213> Homo sapiens <400> 290 <210> 291 <211> 94 <212> ARN <213> Homo sapiens <400> 291 <210> 292 <211> 93 <212> ARN <213> Homo sapiens

<400> 292 <210> 293 <211> 67 <212> ARN <213> Homo sapiens

<400> 293 <210> 294 <211> 94 <212> ARN <213> Homo sapiens <400> 294 <210> 295 <211> 95

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 295 <210> 296 <211> 99 <212> ARN <213> Homo sapiens <400> 296 <210> 297 <211> 98 <212> ARN <213> Homo sapiens <400> 297 <210> 298 <211> 86 <212> ARN <213> Homo sapiens

<400> 298 <210> 299 <211> 68 <212> ARN <213> Homo sapiens

<400> 299 <210> 300 <211> 66 <212> ARN <213> Homo sapiens <400> 300

ES 2 553 442 T3   <210> 301 <211> 70 <212> ARN <213> Homo sapiens <400> 301 <210> 302 <211> 75 <212> ARN <213> Homo sapiens <400> 302 <210> 303 <211> 67 <212> ARN <213> Homo sapiens

<400> 303 <210> 304 <211> 67 <212> ARN <213> Homo sapiens

<400> 304 <210> 305 <211> 69 <212> ARN <213> Homo sapiens <400> 305 <210> 306 <211> 72 <212> ARN

ES 2 553 442 T3   <213> Homo sapiens <400> 306 <210> 307 <211> 102 <212> ARN <213> Homo sapiens <400> 307 <210> 308 <211> 101 <212> ARN <213> Homo sapiens

<400> 308 <210> 309 <211> 102 <212> ARN <213> Homo sapiens

<400> 309 <210> 310 <211> 22 <212> ARN <213> Homo sapiens <400> 310 ugagguagua gguuguauag uu 22 <210> 311 <211> 22 <212> ARN <213> Homo sapiens <400> 311 ugagguagua gguugugugg uu 22 <210> 312 <211> 22 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 312 ugagguagua gguuguaugg uu 22 <210> 313 <211> 21 <212> ARN <213> Homo sapiens <400> 313 agagguagua gguugcauag u 21 <210> 314 <211> 21 <212> ARN <213> Homo sapiens <400> 314 ugagguagga gguuguauag u 21 <210> 315 <211> 22 <212> ARN <213> Homo sapiens

<400> 315 ugagguagua gauuguauag uu 22 <210> 316 <211> 21 <212> ARN <213> Homo sapiens <400> 316 ugagguagua guuuguacag u 21 <210> 317 <211> 19 <212> ARN <213> Homo sapiens

<400> 317 ugagguagua guuugugcu 19 <210> 318 <211> 21 <212> ARN <213> Homo sapiens <400> 318 uggaauguaa agaaguaugu a 21 <210> 319 <211> 21 <212> ARN <213> Homo sapiens <400> 319 uggaagacua gugauuuugu u 21 <210> 320 <211> 23 <212> ARN <213> Homo sapiens

<400> 320 ucuuugguua ucuagcugua uga 23

ES 2 553 442 T3   <210> 321 <211> 21 <212> ARN <213> Homo sapiens <400> 321 uaaagcuaga uaaccgaaag u 21 <210> 322 <211> 23 <212> ARN <213> Homo sapiens

<400> 322 uacccuguag auccgaauuu gug 23 <210> 323 <211> 22 <212> ARN <213> Homo sapiens <400> 323 uacccuguag aaccgaauuu gu 22 <210> 324 <211> 22 <212> ARN <213> Homo sapiens

<400> 324 uagcagcaca uaaugguuug ug 22 <210> 325 <211> 22 <212> ARN <213> Homo sapiens <400> 325 uagcagcaca ucaugguuua ca 22 <210> 326 <211> 22 <212> ARN <213> Homo sapiens <400> 326 uagcagcacg uaaauauugg cg 22 <210> 327 <211> 24 <212> ARN <213> Homo sapiens

<400> 327 caaagugcuu acagugcagg uagu 24 <210> 328 <211> 20 <212> ARN <213> Homo sapiens <400> 328 acugcaguga aggcacuugu <210> 329

ES 2 553 442 T3   <211> 22 <212> ARN <213> Homo sapiens

<400> 329 uaaggugcau cuagugcaga ua 22 <210> 330 <211> 23 <212> ARN <213> Homo sapiens <400> 330 ugugcaaauc uaugcaaaac uga 23 <210> 331 <211> 23 <212> ARN <213> Homo sapiens

<400> 331 ugugcaaauc caugcaaaac uga 23 <210> 332 <211> 22 <212> ARN <213> Homo sapiens <400> 332 uaaagugcuu auagugcagg ua 22 <210> 333 <211> 22 <212> ARN <213> Homo sapiens <400> 333 uagcuuauca gacugauguu ga 22 <210> 334 <211> 22 <212> ARN <213> Homo sapiens <400> 334 aagcugccag uugaagaacu gu 22 <210> 335 <211> 21 <212> ARN <213> Homo sapiens <400> 335 aucacauugc cagggauuuc c 21 <210> 336 <211> 23 <212> ARN <213> Homo sapiens

<400> 336 aucacauugc cagggauuac cac 23 <210> 337 <211> 22 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 337 uggcucaguu cagcaggaac ag 22 <210> 338 <211> 22 <212> ARN <213> Homo sapiens

<400> 338 cauugcacuu gucucggucu ga 22 <210> 339 <211> 22 <212> ARN <213> Homo sapiens <400> 339 uucaaguaau ccaggauagg cu 22 <210> 340 <211> 21 <212> ARN <213> Homo sapiens

<400> 340 uucaaguaau ucaggauagg u 21 <210> 341 <211> 22 <212> ARN <213> Homo sapiens <400> 341 uucacagugg cuaaguuccg cc 22 <210> 342 <211> 20 <212> ARN <213> Homo sapiens <400> 342 uucacagugg cuaaguucug <210> 343 <211> 22 <212> ARN <213> Homo sapiens

<400> 343 aaggagcuca cagucuauug ag 22 <210> 344 <211> 22 <212> ARN <213> Homo sapiens <400> 344 cuagcaccau cugaaaucgg uu 22 <210> 345 <211> 20 <212> ARN <213> Homo sapiens

<400> 345

ES 2 553 442 T3   uagcaccauu ugaaaucagu <210> 346 <211> 22 <212> ARN <213> Homo sapiens <400> 346 uagcaccauu ugaaaucggu ua 22 <210> 347 <211> 23 <212> ARN <213> Homo sapiens

<400> 347 uguaaacauc cucgacugga age 23 <210> 348 <211> 22 <212> ARN <213> Homo sapiens <400> 348 cuuucagucg gauguuugca gc 22 <210> 349 <211> 21 <212> ARN <213> Homo sapiens <400> 349 uguaaacauc cuacacucag c 21 <210> 350 <211> 23 <212> ARN <213> Homo sapiens

<400> 350 uguaaacauc cuacacucuc age 2 3 <210> 351 <211> 22 <212> ARN <213> Homo sapiens <400> 351 uguaaacauc cccgacugga ag 22 <210> 352 <211> 20 <212> ARN <213> Homo sapiens

<400> 352 uguaaacauc cuugacugga <210> 353 <211> 21 <212> ARN <213> Homo sapiens <400> 353 ggcaagaugc uggcauagcu g 21

ES 2 553 442 T3   <210> 354 <211> 21 <212> ARN <213> Homo sapiens

<400> 354 uauugcacau uacuaaguug c 21 <210> 355 <211> 19 <212> ARN <213> Homo sapiens <400> 355 gugcauugua guugcauug 19 <210> 356 <211> 22 <212> ARN <213> Homo sapiens <400> 356 uggcaguguc uuagcugguu gu 22 <210> 357 <211> 22 <212> ARN <213> Homo sapiens

<400> 357 aggcaguguc auuagcugau ug 22 <210> 358 <211> 22 <212> ARN <213> Homo sapiens <400> 358 aggcagugua guuagcugau ug 22 <210> 359 <211> 22 <212> ARN <213> Homo sapiens

<400> 359 uauugcacuu gucccggccu gu 22 <210> 360 <211> 22 <212> ARN <213> Homo sapiens <400> 360 aaagugcugu ucgugcaggu ag 22 <210> 361 <211> 22 <212> ARN <213> Homo sapiens <400> 361 uucaacgggu auuuauugag ca 22 <210> 362 <211> 22

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 362 uuuggcacua gcacauuuuu gc 22 <210> 363 <211> 22 <212> ARN <213> Homo sapiens <400> 363 ugagguagua aguuguauug uu 22 <210> 364 <211> 22 <212> ARN <213> Homo sapiens

<400> 364 aacccguaga uccgaucuug ug 22 <210> 365 <211> 22 <212> ARN <213> Homo sapiens <400> 365 cacccguaga accgaccuug cg 22 <210> 366 <211> 22 <212> ARN <213> Homo sapiens

<400> 366 uacaguacug ugauaacuga ag 22 <210> 367 <211> 22 <212> ARN <213> Homo sapiens <400> 367 uacaguacug ugauaacuga ag 22 <210> 368 <211> 23 <212> ARN <213> Homo sapiens <400> 368 agcagcauug uacagggcua uga 23 <210> 369 <211> 20 <212> ARN <213> Homo sapiens

<400> 369 ucaaaugcuc agacuccugu <210> 370 <211> 24 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 370 aaaagugcuu acagugcagg uagc 24 <210> 371 <211> 21 <212> ARN <213> Homo sapiens

<400> 371 uaaagugcug acagugcaga u 21 <210> 372 <211> 23 <212> ARN <213> Homo sapiens <400> 372 agcagcauug uacagggcua uca 23 <210> 373 <211> 23 <212> ARN <213> Homo sapiens

<400> 373 uggaguguga caaugguguu ugu 23 <210> 374 <211> 22 <212> ARN <213> Homo sapiens <400> 374 uuaaggcacg cggugaaugc ca 22 <210> 375 <211> 23 <212> ARN <213> Homo sapiens <400> 375 ucccugagac ccuuuaaccu gug 23 <210> 376 <211> 22 <212> ARN <213> Homo sapiens

<400> 376 ucccugagac ccuaacuugu ga 22 <210> 377 <211> 21 <212> ARN <213> Homo sapiens <400> 377 cauuauuacu uuugguacgc g 21 <210> 378 <211> 21 <212> ARN <213> Homo sapiens

<400> 378

ES 2 553 442 T3   ucguaccgug aguaauaaug c 21 <210> 379 <211> 22 <212> ARN <213> Homo sapiens <400> 379 ucggauccgu cugagcuugg cu 22 <210> 380 <211> 22 <212> ARN <213> Homo sapiens

<400> 380 ucacagugaa ccggucucuu uu 22 <210> 381 <211> 22 <212> ARN <213> Homo sapiens <400> 381 ucacagugaa ccggucucuu uc 22 <210> 382 <211> 21 <212> ARN <213> Homo sapiens <400> 382 cuuuuugcgg ucugggcuug c 21 <210> 383 <211> 20 <212> ARN <213> Homo sapiens

<400> 383 cagugcaaug uuaaaagggc <210> 384 <211> 22 <212> ARN <213> Homo sapiens <400> 384 cagugcaaug augaaagggc au 22 <210> 385 <211> 22 <212> ARN <213> Homo sapiens

<400> 385 uaacagucua cagccauggu cg 22 <210> 386 <211> 22 <212> ARN <213> Homo sapiens <400> 386 uugguccccu ucaaccagcu gu 22

ES 2 553 442 T3   <210> 387 <211> 21 <212> ARN <213> Homo sapiens

<400> 387 uugguccccu ucaaccagcu a 21 <210> 388 <211> 21 <212> ARN <213> Homo sapiens <400> 388 ugugacuggu ugaccagagg g 21 <210> 389 <211> 23 <212> ARN <213> Homo sapiens <400> 389 uauggcuuuu uauuccuaug uga 23 <210> 390 <211> 22 <212> ARN <213> Homo sapiens

<400> 390 uauggcuuuu cauuccuaug ug 22 <210> 391 <211> 23 <212> ARN <213> Homo sapiens <400> 391 acuccauuug uuuugaugau gga 23 <210> 392 <211> 22 <212> ARN <213> Homo sapiens

<400> 392 uauugcuuaa gaauacgcgu ag 22 <210> 393 <211> 17 <212> ARN <213> Homo sapiens <400> 393 agcugguguu gugaauc 17 <210> 394 <211> 18 <212> ARN <213> Homo sapiens <400> 394 ucuacagugc acgugucu 18 <210> 395 <211> 21

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 395 agugguuuua cccuauggua g 21 <210> 396 <211> 21 <212> ARN <213> Homo sapiens <400> 396 aacacugucu gguaaagaug g 21 <210> 397 <211> 23 <212> ARN <213> Homo sapiens

<400> 397 uguaguguuu ccuacuuuau gga 23 <210> 398 <211> 20 <212> ARN <213> Homo sapiens <400> 398 cauaaaguag aaagcacuac <210> 399 <211> 22 <212> ARN <213> Homo sapiens

<400> 399 ugagaugaag cacuguagcu ca 22 <210> 400 <211> 22 <212> ARN <213> Homo sapiens <400> 400 uacaguauag augauguacu ag 22 <210> 401 <211> 24 <212> ARN <213> Homo sapiens <400> 401 guccaguuuu cccaggaauc ccuu 24 <210> 402 <211> 22 <212> ARN <213> Homo sapiens

<400> 402 ugagaacuga auuccauggg uu 22 <210> 403 <211> 20 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 403 guguguggaa augcuucugc <210> 404 <211> 22 <212> ARN <213> Homo sapiens

<400> 404 ucagugcacu acagaacuuu gu 22 <210> 405 <211> 22 <212> ARN <213> Homo sapiens <400> 405 ucagugcauc acagaacuuu gu 22 <210> 406 <211> 22 <212> ARN <213> Homo sapiens

<400> 406 ucuggcuccg ugucuucacu cc 22 <210> 407 <211> 22 <212> ARN <213> Homo sapiens <400> 407 ucucccaacc cuuguaccag ug 22 <210> 408 <211> 22 <212> ARN <213> Homo sapiens <400> 408 acuagacuga agcuccuuga gg 22 <210> 409 <211> 21 <212> ARN <213> Homo sapiens

<400> 409 ucagugcaug acagaacuug g 21 <210> 410 <211> 20 <212> ARN <213> Homo sapiens <400> 410 uugcauaguc acaaaaguga <210> 411 <211> 22 <212> ARN <213> Homo sapiens

<400> 411

ES 2 553 442 T3   uagguuaucc guguugccuu cg 22 <210> 412 <211> 22 <212> ARN <213> Homo sapiens <400> 412 aaucauacac gguugaccua uu 22 <210> 413 <211> 22 <212> ARN <213> Homo sapiens

<400> 413 uuaaugcuaa ucgugauagg gg 22 <210> 414 <211> 23 <212> ARN <213> Homo sapiens <400> 414 aacauucaac gcugucggug agu 23 <210> 415 <211> 24 <212> ARN <213> Homo sapiens <400> 415 aacauucauu gcugucggug gguu 24 <210> 416 <211> 22 <212> ARN <213> Homo sapiens

<400> 416 aacauucaac cugucgguga gu 22 <210> 417 <211> 22 <212> ARN <213> Homo sapiens <400> 417 uuuggcaaug guagaacuca ca 22 <210> 418 <211> 21 <212> ARN <213> Homo sapiens

<400> 418 ugguucuaga cuugccaacu a 21 <210> 419 <211> 23 <212> ARN <213> Homo sapiens <400> 419 uauggcacug guagaauuca cug 23

ES 2 553 442 T3   <210> 420 <211> 22 <212> ARN <213> Homo sapiens

<400> 420 uggacggaga acugauaagg gu 22 <210> 421 <211> 18 <212> ARN <213> Homo sapiens <400> 421 uggagagaaa ggcaguuc 18 <210> 422 <211> 23 <212> ARN <213> Homo sapiens <400> 422 caaagaauuc uccuuuuggg cuu 23 <210> 423 <211> 21 <212> ARN <213> Homo sapiens

<400> 423 ucgugucuug uguugcagcc g 21 <210> 424 <211> 22 <212> ARN <213> Homo sapiens <400> 424 caucccuugc augguggagg gu 22 <210> 425 <211> 23 <212> ARN <213> Homo sapiens

<400> 425 gugccuacug agcugauauc agu 23 <210> 426 <211> 22 <212> ARN <213> Homo sapiens <400> 426 ugauauguuu gauauauuag gu 22 <210> 427 <211> 22 <212> ARN <213> Homo sapiens <400> 427 caacggaauc ccaaaagcag cu 22 <210> 428 <211> 21

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 428 cugaccuaug aauugacagc c 21 <210> 429 <211> 21 <212> ARN <213> Homo sapiens <400> 429 aacuggccua caaaguccca g 21 <210> 430 <211> 22 <212> ARN <213> Homo sapiens

<400> 430 uguaacagca acuccaugug ga 22 <210> 431 <211> 21 <212> ARN <213> Homo sapiens <400> 431 uagcagcaca gaaauauugg c 21 <210> 432 <211> 21 <212> ARN <213> Homo sapiens

<400> 432 uagguaguuu cauguuguug g 21 <210> 433 <211> 21 <212> ARN <213> Homo sapiens <400> 433 uagguaguuu ccuguuguug g 21 <210> 434 <211> 22 <212> ARN <213> Homo sapiens <400> 434 uucaccaccu ucuccaccca gc 22 <210> 435 <211> 19 <212> ARN <213> Homo sapiens

<400> 435 gguccagagg ggagauagg 19 <210> 436 <211> 23 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 436 cccaguguuc agacuaccug uuc 23 <210> 437 <211> 22 <212> ARN <213> Homo sapiens

<400> 437 uacaguaguc ugcacauugg uu 22 <210> 438 <211> 23 <212> ARN <213> Homo sapiens <400> 438 cccaguguuu agacuaucug uuc 23 <210> 439 <211> 22 <212> ARN <213> Homo sapiens

<400> 439 uaacacuguc ugguaacgau gu 22 <210> 440 <211> 24 <212> ARN <213> Homo sapiens <400> 440 cucuaauacu gccugguaau gaug 24 <210> 441 <211> 22 <212> ARN <213> Homo sapiens <400> 441 aauacugccg gguaaugaug ga 22 <210> 442 <211> 22 <212> ARN <213> Homo sapiens

<400> 442 agagguauag ggcaugggaa ga 22 <210> 443 <211> 22 <212> ARN <213> Homo sapiens <400> 443 gugaaauguu uaggaccacu ag 22 <210> 444 <211> 22 <212> ARN <213> Homo sapiens

<400> 444

ES 2 553 442 T3   uucccuuugu cauccuaugc cu 22 <210> 445 <211> 22 <212> ARN <213> Homo sapiens <400> 445 uccuucauuc caccggaguc ug 22 <210> 446 <211> 22 <212> ARN <213> Homo sapiens

<400> 446 uggaauguaa ggaagugugu gg 22 <210> 447 <211> 22 <212> ARN <213> Homo sapiens <400> 447 auaagacgag caaaaagcuu gu 22 <210> 448 <211> 21 <212> ARN <213> Homo sapiens <400> 448 cugugcgugu gacagcggcu g 21 <210> 449 <211> 22 <212> ARN <213> Homo sapiens

<400> 449 uucccuuugu cauccuucgc cu 22 <210> 450 <211> 21 <212> ARN <213> Homo sapiens <400> 450 uaacagucuc cagucacggc c 21 <210> 451 <211> 22 <212> ARN <213> Homo sapiens

<400> 451 accaucgacc guugauugua cc 22 <210> 452 <211> 21 <212> ARN <213> Homo sapiens <400> 452 acagcaggca cagacaggca g 21

ES 2 553 442 T3   <210> 453 <211> 21 <212> ARN <213> Homo sapiens

<400> 453 augaccuaug aauugacaga c 21 <210> 454 <211> 21 <212> ARN <213> Homo sapiens <400> 454 uaaucucagc uggcaacugu g 21 <210> 455 <211> 24 <212> ARN <213> Homo sapiens <400> 455 uacugcauca ggaacugauu ggau 24 <210> 456 <211> 21 <212> ARN <213> Homo sapiens

<400> 456 uugugcuuga ucuaaccaug u 21 <210> 457 <211> 21 <212> ARN <213> Homo sapiens <400> 457 ugauugucca aacgcaauuc u 21 <210> 458 <211> 21 <212> ARN <213> Homo sapiens

<400> 458 ccacaccgua ucugacacuu u 21 <210> 459 <211> 23 <212> ARN <213> Homo sapiens <400> 459 agcuacauug ucugcugggu uuc 23 <210> 460 <211> 24 <212> ARN <213> Homo sapiens <400> 460 agcuacaucu ggcuacuggg ucuc 24 <210> 461 <211> 21

ES 2 553 442 T3   <212> ARN <213> Homo sapiens <400> 461 ugucaguuug ucaaauaccc c 21 <210> 462 <211> 23 <212> ARN <213> Homo sapiens <400> 462 caagucacua gugguuccgu uua 23 <210> 463 <211> 21 <212> ARN <213> Homo sapiens

<400> 463 agggcccccc cucaauccug u 21 <210> 464 <211> 22 <212> ARN <213> Homo sapiens <400> 464 ugguuuaccg ucccacauac au 22 <210> 465 <211> 23 <212> ARN <213> Homo sapiens

<400> 465 cagugcaaua guauugucaa age 23 <210> 466 <211> 23 <212> ARN <213> Homo sapiens <400> 466 uaagugcuuc cauguuuugg uga 23 <210> 467 <211> 23 <212> ARN <213> Homo sapiens <400> 467 acuuuaacau ggaagugcuu ucu 23 <210> 468 <211> 23 <212> ARN <213> Homo sapiens

<400> 468 uaagugcuuc cauguuuuag uag 23 <210> 469 <211> 22 <212> ARN <213> Homo sapiens

ES 2 553 442 T3   <400> 469 uuuaacaugg ggguaccugc ug 22 <210> 470 <211> 23 <212> ARN <213> Homo sapiens

<400> 470 uaagugcuuc cauguuucag ugg 23 <210> 471 <211> 23 <212> ARN <213> Homo sapiens <400> 471 uaagugcuuc cauguuugag ugu 23 <210> 472 <211> 23 <212> ARN <213> Homo sapiens

<400> 472 aaaagcuggg uugagagggc gaa 23 <210> 473 <211> 21 <212> ARN <213> Homo sapiens <400> 473 uaagccaggg auuguggguu c 21 <210> 474 <211> 22 <212> ARN <213> Homo sapiens <400> 474 gcacauuaca cggucgaccu cu 22 <210> 475 <211> 23 <212> ARN <213> Homo sapiens

<400> 475 cgcauccccu agggcauugg ugu 23 <210> 476 <211> 22 <212> ARN <213> Homo sapiens <400> 476 ccacugcccc aggugcugcu gg 22 <210> 477 <211> 21 <212> ARN <213> Homo sapiens

<400> 477

ES 2 553 442 T3   ccuaguaggu guccaguaag u 21 <210> 478 <211> 20 <212> ARN <213> Homo sapiens <400> 478 ccucugggcc cuuccuccag <210> 479 <211> 22 <212> ARN <213> Homo sapiens

<400> 479 cuggcccucu cugcccuucc gu 22 <210> 480 <211> 23 <212> ARN <213> Homo sapiens <400> 480 gcaaagcaca cggccugcag aga 23 <210> 481 <211> 21 <212> ARN <213> Homo sapiens <400> 481 gccccugggc cuauccuaga a 21 <210> 482 <211> 23 <212> ARN <213> Homo sapiens

<400> 482 ucaagagcaa uaacgaaaaa ugu 23 <210> 483 <211> 23 <212> ARN <213> Homo sapiens <400> 483 uccagcuccu auaugaugcc uuu 23 <210> 484 <211> 23 <212> ARN <213> Homo sapiens <400> 484 uccagcauca gugauuuugu uga 23 <210> 485 <211> 21 <212> ARN <213> Homo sapiens

<400> 485 ucccuguccu ccaggagcuc a 21

ES 2 553 442 T3   <210> 486 <211> 23 <212> ARN <213> Homo sapiens <400> 486 uccgucucag uuacuuuaua gcc 23 <210> 487 <211> 24 <212> ARN <213> Homo sapiens

<400> 487 ucucacacag aaaucgcacc cguc 24 <210> 488 <211> 21 <212> ARN <213> Homo sapiens <400> 488 ugcugacucc uaguccaggg c 21 <210> 489 <211> 23 <212> ARN <213> Homo sapiens

<400> 489 ugucugcccg caugccugcc ucu 23 <210> 490 <211> 22 <212> ARN <213> Homo sapiens <400> 490 aauugcacuu uagcaauggu ga 22 <210> 491 <211> 22 <212> ARN <213> Homo sapiens <400> 491 acauagagga aauuccacgu uu 22 <210> 492 <211> 21 <212> ARN <213> Homo sapiens

<400> 492 aauaauacau gguugaucuu u 21 <210> 493 <211> 21 <212> ARN <213> Homo sapiens <400> 493 gccugcuggg guggaaccug g 21 <210> 494

ES 2 553 442 T3   <211> 21 <212> ARN <213> Homo sapiens

<400> 494 gugccgccau cuuuugagug u 21 <210> 495 <211> 23 <212> ARN <213> Homo sapiens <400> 495 aaagugcugc gacauuugag cgu 23 <210> 496 <211> 22 <212> ARN <213> Homo sapiens

<400> 496 acucaaaaug ggggcgcuuu cc 22 <210> 497 <211> 23 <212> ARN <213> Homo sapiens <400> 497 gaagugcuuc gauuuugggg ugu 23 <210> 498 <211> 22 <212> ARN <213> Homo sapiens <400> 498 uuauaauaca accugauaag ug 22

ES 2 553 442 T3  

REIVINDICACIONES

1. Un procedimiento para diagnosticar si un sujeto tiene cáncer de pulmón, que comprende la medición del nivel de los productos génicos de miR en una muestra de ensayo de tejido pulmonar dicho sujeto, en el que una alteración del nivel del producto génico de miR en la muestra de ensayo, con respecto al nivel correspondiente de los productos génicos de miR en una muestra de control, es indicativa de que el sujeto tiene cáncer de pulmón en el que los productos génicos de miR comprenden un grupo de productos génicos de miR, consistiendo dicho grupo en miR- 21, miR-191, miR-155, miR-210, miR-126* y miR-224; y.en el que el nivel de los productos génicos miR-21, miR-191, miR-155 and miR-210 en la muestra de ensayo es mayor que el correspondiente producto génico de miR en la muestra de control y en el que el nivel de los productos génicos miR-126* and miR-224 en la muestra de ensayo es menor que el nivel del correspondiente producto géico de miR en la muestra de control. 2. El procedimiento de acuerdo con la Reivindicación 1 en el que el cáncer de pulmón es adenocarcinoma de pulmón.

3. El procedimiento de acuerdo con la Reivindicación 1 en el que el cáncer de pulmón es carcinoma pulmonar de células escamosas. 4. El procedimiento de acuerdo con la reivindicación 1 caracterizado además por que comprende las etapas siguientes: la transcripción inversa de ARN de una muestra de ensayo obtenida del sujeto para proporcionar un conjunto de oligodesoxinucleótidos diana; hibridar los oligodesoxinucleótidos diana con una micromatriz que comprende oligonucleótidos sonda específicos de miARN para proporcionar un perfil de hibridación de dicha muestra de ensayo; y comparar el perfil de hibridación de la muestra de ensayo con el perfil de hibridación generado a partir de una muestra de control, en el que una alteración de la señal es indicativa de que el sujeto tiene un cáncer de pulmón con un pronóstico adverso en el que una alteración de la señal de l grupo de miR es indicativa de que el sujeto tiene un cáncer de pulmón.

ES 2 553 442 T3