Anticuerpos contra el virus sincitial respiratorio humano (VSR) y método de uso.

Un anticuerpo o fragmento de unión a antígeno del mismo que comprende:

una CDR1 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 2;

una CDR2 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 3;

una CDR3 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 4;

una CDR1 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 6;

una CDR2 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 7; y

una CDR3 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 8,

en el que el anticuerpo o fragmento de unión a antígeno se une inmunoespecíficamente con la proteína de fusión

(F) del Virus Sincitial Respiratorio (VSR) y neutraliza VSR.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2010/045549.

Solicitante: CRUCELL HOLLAND B.V..

Nacionalidad solicitante: Países Bajos.

Dirección: ARCHIMEDESWEG 4 2333 CN LEIDEN PAISES BAJOS.

Inventor/es: WILLIAMSON,ROBERT ANTHONY, WADIA,JEHANGIR, PASCUAL,GABRIEL, KEOGH,ELISSA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K31/00 (Preparaciones medicinales que contienen ingredientes orgánicos activos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/13 (Inmunoglobulinas)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Células no diferenciadas humanas, animales o vegetales,... > C12N5/10 (Células modificadas por introducción de material genético extraño, p. ej. células transformadas por virus)
  • SECCION G — FISICA > METROLOGIA; ENSAYOS > INVESTIGACION O ANALISIS DE MATERIALES POR DETERMINACION... > Investigación o análisis de materiales por métodos... > G01N33/53 (Ensayos inmunológicos; Ensayos en los que interviene la formación de uniones bioespecíficas; Materiales a este efecto)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales caracterizadas por los... > A61K47/48 (estando el ingrediente no activo químicamente unido al ingrediente activo, p. ej. conjugados polímero-medicamento)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/63 (Introducción de material genético extraño utilizando vectores; Vectores; Utilización de huéspedes para ello; Regulación de la expresión)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/42 (virales)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > Antiinfecciosos, es decir antibióticos, antisépticos,... > A61P31/14 (para virus ARN)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K38/00 (Preparaciones medicinales que contienen péptidos (péptidos que contienen ciclos beta-lactama A61K 31/00; dipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina 2,5-dionas, A61K 31/00; péptidos basados en la ergolina A61K 31/48; que contienen compuestos macromoleculares que tienen unidades aminoácido repartidas estadísticamente A61K 31/74; preparaciones medicinales que contienen antígenos o anticuerpos A61K 39/00; preparaciones medicinales caracterizadas por los ingredientes no activos, p. ej. péptidos como soportes de fármacos, A61K 47/00))
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/10 (de virus ARN)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Anticuerpos contra el virus sincitial respiratorio humano (VSR) y método de uso Campo de la invención Se proporcionan anticuerpos y fragmentos de unión a antígenos de los mismos que se unen inmunoespecíficamente con la proteína F del Virus Sincitial Respiratorio (VSR) y/o con VSR y/o neutralizan VSR. También se proporcionan métodos de diagnóstico y terapéuticos que emplean anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos. Los métodos terapéuticos incluyen administrar los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos para la prevención o el tratamiento de una infección por VSR y/o alivio de uno o más síntomas de una infección por VSR, tales como infecciones en niños e infecciones asociadas con trasplante de órganos. Pueden usarse combinaciones de una pluralidad de anticuerpos anti VSR diferentes y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento y/o con otros anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos para terapia de combinación. También se proporcionan composiciones que contienen las mezclas de anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos. Antecedentes El virus sincitial respiratorio (VSR) es la principal causa de enfermedad respiratoria grave en bebés y niños pequeños y es la principal causa de bronquiolitis infantil (Welliver (2003) J Pediatr 143: S112). Una estimación de 64 millones de casos de enfermedad respiratoria y 160.000 muertes en todo el mundo son atribuibles a enfermedad inducida por VSR. Solamente en los Estados Unidos, decenas de miles de hospitalizaciones infantiles se deben a infecciones por paramixovirus, tales como VSR y virus paragripal (PIV) (Shay et al. (1999) JAMA 282: 1440-1446).

Se produce infección por VSR grave más frecuentemente en niños y bebés, especialmente en bebés prematuros. Los problemas de salud subyacentes tales como enfermedad pulmonar crónica o enfermedad cardiaca congénita pueden aumentar significativamente el riesgo de enfermedad grave. Las infecciones por VSR también pueden provocar enfermedad grave en ancianos, individuos con enfermedad pulmonar crónica y adultos inmunocomprometidos, tales como receptores de trasplante de médula ósea.

El documento WO 2008/106980 A2 (SYMPHOGEN AS [DK]; LANTTO JOHAN [SE]; NIELSEN HENRIETTE SCHJOENNING [D] 12 de septiembre de 2008 (12-09-2008) desvela un anticuerpo recombinante para el tratamiento de infecciones por el virus sincitial respiratorio.

WU H ET AL: “Immunoprophylaxis of RSV infection: advancing from RSV-IGIV to palivizumab and motavizumab”, CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY, SPRINGER, BERLÍN, DE, es una revisión de los diferentes tratamientos posibles de infecciones por VSR con anticuerpos tales como palivizumab y motavizumab. Se han investigado varios enfoques para la prevención y el tratamiento de infección por VSR, incluyendo desarrollo de vacunas, compuestos antivirales (ribavirina), fármacos antisentido, tecnología de interferencia de ARN y productos de anticuerpos, tales como inmunoglobulina o anticuerpos monoclonales intravenosos. La inmunoglobulina intravenosa (RSV-IGIV; RespiGam®) aislada de donantes y un anticuerpo monoclonal, palivizumab (SYNAGIS™), se han aprobado para profilaxis de VSR en niños de alto riesgo. Aún no está disponible, sin embargo, una vacuna o tratamiento disponible en el mercado para VSR. Solamente se ha aprobado la ribavirina para el tratamiento de infección por VSR. Para ser eficaz para el tratamiento de infección por VSR, se requieren altas dosis, administraciones frecuentes y/o volúmenes de productos de anticuerpo, tales como VSR-IG y palivizumab, debido a la baja especificidad. Además, el uso de productos, tales como inmunoglobulina intravenosa, depende de la disponibilidad de donantes. En consecuencia, existe una necesidad de agentes adicionales para la prevención o el tratamiento de infecciones por VSR.

Sumario Se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos para la profilaxis y el tratamiento de infección por virus sincitial Respiratorio (VSR) y enfermedades o afecciones mediadas por VSR. También se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos para el diagnóstico y/o control de la infección por VSR. Se proporcionan en el presente documento polipéptido aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con y neutralizan VSR. En algunos ejemplos los polipéptidos proporcionados en el presente documento se unen inmunoespecíficamente y neutralizan VSR cuando el polipéptido proporcionado en el presente documento está contenido en un anticuerpo o fragmento de unión a antígeno. También se proporcionan en el presente documento anticuerpos y fragmentos de unión a antígeno que contienen un polipéptido proporcionado en el presente documento donde el anticuerpo o fragmento de unión a antígeno se une inmunoespecíficamente con y neutraliza el VSR. Los polipéptidos, anticuerpos y fragmentos de unión a antígeno proporcionados en el presente documento pueden unirse específicamente con la proteína F así como neutralizar VSR. Se proporcionan en el presente documento polipéptido aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que pueden neutralizar VSR subtipos A y B. Se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígenos de los mismos que se unen inmunoespecíficamente con la proteína F de VSR. Se proporcionan en el presente documento anticuerpos aislados o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con la proteína de fusión (F) del Virus Sincitial Respiratorio (VSR) y/o neutralizan VSR y contienen una CDR1 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2; una CDR2 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3; una CDR3 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4; una CDR1 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6; una CDR2 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7; y una CDR3 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. Se proporcionan en el presente documento anticuerpos anti VSR aislados o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con el mismo epítopo en una proteína F de VSR o en un virus VSR como un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR1 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2; una CDR2 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3; una CDR3 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4; una CDR1 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6; una CDR2 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7; y una CDR3 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno del mismo proporcionado en el presente documento contiene una cadena pesada, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 1. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene un dominio VH, que tiene la secuencia de aminoácidos expuesta como los aminoácidos 1-125 de SEC ID Nº: 1. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno del mismo proporcionado en el presente documento contiene una cadena ligera, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 5. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene un dominio VL, que tiene la secuencia de aminoácidos expuesta como los aminoácidos 1-107 de SEC ID Nº: 5. En un ejemplo particular, el anticuerpo aislado o fragmento de unión a antígeno del mismo es 558c5.

Se proporcionan en el presente documento anticuerpos anti VSR aislados o fragmentos de unión a antígeno de los mismos que contienen una cadena pesada variable (VH) y una cadena ligera variable (VL), en los que el anticuerpo o fragmento de unión a antígeno se une inmunoespecíficamente con el mismo epítopo en una proteína de fusión (F) del Virus Sincitial Respiratorio (VSR) que un anticuerpo o fragmento de unión a antígeno que contiene una cadena pesada expuesta en SEC ID Nº: 1 y una cadena ligera expuesta en SEC ID Nº: 5.

En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno del mismo proporcionado en el presente documento contiene una región determinante de complementariedad 1 (CDR1) de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una CDR2 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una CDR3 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno del mismo proporcionado en el presente documento contiene una CDR1 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2; una CDR2 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3; y una CDR3 de VH, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno del mismo proporcionado en el presente documento contiene una CDR1 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una CDR2 de VL, que tiene la secuencia de aminoácidos de la CDR2 de VL expuesta en SEC ID Nº: 7. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una CDR3 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una CDR1 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6; una CDR2 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7; y una CDR3 de VL, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una cadena pesada, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 9. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene un dominio VH, que tiene la secuencia de aminoácidos expuesta en los aminoácidos 1-125 de SEC ID Nº: 9. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene una cadena ligera, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 13. En algunos ejemplos, un anticuerpo aislado o fragmento de unión a antígeno proporcionado en el presente documento contiene un dominio VL, que tiene la secuencia de aminoácidos expuesta en 1-107 de SEC ID Nº: 13.

Se proporcionan en el presente documento anticuerpos anti VSR aislados o fragmentos de unión a antígeno de los mismos que contienen una cadena pesada variable (VH) y una cadena ligera variable (VL), en los que el anticuerpo o fragmento de unión a antígeno se une inmunoespecíficamente con el mismo epítopo en una proteína de fusión (F) del Virus Sincitial Respiratorio (VSR) como un anticuerpo o fragmento de unión a antígeno que contiene una cadena pesada expuesta en SEC ID Nº: 9 y una cadena ligera expuesta en SEC ID Nº: 13. Se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con una parte de una proteína F de VSR, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 25. También se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con una proteína F de VSR, que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 1629. Se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que contienen un dominio de unión a antígeno que es un anticuerpo humano o uno humanizado o fragmento de unión a antígeno del mismo. En algunos ejemplos, el polipéptido aislado, anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento es un anticuerpo quimérico. En algunos ejemplos, el polipéptido aislado, anticuerpo o fragmento de unión a antígeno es un fragmento Fv monocatenario (scFv), Fab, Fab’, F(ab’)2, Fv, dsFv, diacuerpo, Fd o Fd’. En algunos ejemplos, el polipéptido aislado, anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento contiene un enlazador peptídico. En algunos ejemplos, el enlazador peptídico contiene de aproximadamente 1 a aproximadamente 50 aminoácidos. En algunos ejemplos, el polipéptido aislado, anticuerpo o fragmento de unión a antígeno de mismo proporcionado en el presente documento se conjuga con polietilenglicol (PEG). En algunos ejemplos, el polipéptido aislado, anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento contienen un agente terapéutico o de diagnóstico. Los agentes de diagnóstico ejemplares incluyen, pero sin limitación, una enzima, un compuesto fluorescente, un agente de transferencia de electrones y un radiomarcador. Se proporcionan en el presente documento polipéptidos aislados, anticuerpos o fragmentos de unión a antígeno de los mismos que contienen un dominio de transducción de proteínas. En algunos ejemplos, el dominio de transducción de proteínas se selecciona entre un péptido que tenga una secuencia de aminoácidos expuesta en SEC ID Nº: 1529-1600. En algunos ejemplos, el dominio de transducción de proteínas es un dominio de transducción de proteínas VIH-TAT. Se proporcionan en el presente documento anticuerpos multivalentes, que contienen una primera parte de unión a antígeno que contiene un polipéptido, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento conjugado con un dominio de multimerización; y una segunda parte de unión a antígeno que contiene un fragmento de unión a antígeno de un anticuerpo viral conjugado con un segundo dominio de multimerización. En dichos ejemplos, el primer dominio de multimerización y el segundo dominio de multimerización son complementarios o iguales, por lo que la primera parte de unión a antígeno y la segunda parte de unión a antígeno forman un anticuerpo multivalente. En algunos ejemplos, los anticuerpos multivalentes proporcionados en el presente documento contienen 1, 2, 3, 4 o 5 partes de unión a antígeno adicionales. Los anticuerpos multivalentes ejemplares incluyen un anticuerpo bivalente, trivalente, tetravalente, pentavalente, hexavalente o heptavalente. Los anticuerpos multivalentes proporcionados en el presente documento incluyen anticuerpos heterobivalentes u homobivalentes. Los anticuerpos multivalentes proporcionados en el presente documento incluyen anticuerpos multiespecíficos. En algunos ejemplos, el anticuerpo multiespecífico es un anticuerpo biespecífico, triespecífico o tetraespecífico. En algunos ejemplos, los anticuerpos multivalentes proporcionados en el presente documento contienen un fragmento de unión a antígeno que es un fragmento Fv monocatenario (scFv), Fab, Fab’, F(ab’)2, Fv, dsFv, diacuerpo, Fd o Fd’. La primera parte de unión a antígeno y/o la segunda parte de unión a antígeno de los anticuerpos multivalentes proporcionados en el presente documento pueden conjugarse con un dominio de multimerización por enlace covalente o no covalente. En algunos ejemplos, la parte de unión a antígeno se conjuga con el dominio de multimerización mediante un enlazador, tal como un enlazador químico o un enlazador polipeptídico. En algunos ejemplos, el dominio de multimerización del anticuerpo multivalente proporcionado en el presente documento se selecciona de entre una región constante de inmunoglobulina (Fc), una cremallera de leucina, regiones hidrófobas complementarias, regiones hidrófilas complementarias o dominios de interacción proteína-proteína compatibles. En algunos ejemplos, el dominio Fc es un dominio Fc IgG, IgM o IgE. En algunos ejemplos, los anticuerpos multivalentes proporcionados en el presente documento contienen dos o más anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. En un ejemplo particular, los anticuerpos multivalentes proporcionados en el presente documento contienen dos o más anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. Se proporcionan en el presente documento anticuerpos multivalentes, que contienen una primera parte de unión a antígeno que contiene un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento conjugado con un dominio de multimerización; y una segunda parte de unión a antígeno que contiene un anticuerpo anti VSR o fragmento de unión a antígeno del mismo, seleccionado de entre palivizumab, motavizumab, AFFF, P12f2, P12f4, P11d4, A1e9 A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, RF-2 o un fragmento de unión a antígeno de los mismos, conjugado con un segundo dominio de multimerización.

Se proporcionan en el presente documento anticuerpos multivalentes, que contienen una primera parte de unión a antígeno que contiene un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento conjugado con un dominio de multimerización; y una segunda parte de unión a antígeno que contiene un anticuerpo antiviral que se une inmunoespecíficamente con un antígeno del virus paragripal (PIV) o metaneumovirus humano (hMPV), conjugado con un segundo dominio de multimerización.

Se proporcionan en el presente documento combinaciones, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y un agente antiviral. En algunos ejemplos, el agente antiviral es ribavirina. Se proporcionan en el presente combinaciones, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento y un agente antiviral formulado como una única composición o como composiciones separadas. Se proporcionan en el presente documento combinaciones, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y uno o más anticuerpos antivirales adicionales. En algunos ejemplos, la combinación contiene dos o más anticuerpos anti VSR diferentes o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, la combinación contiene dos o más anticuerpos anti VSR diferentes o fragmentos de unión a antígeno seleccionados de entre un anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento. En algunos ejemplos, la combinación contiene un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento y un anticuerpo seleccionado de entre palivizumab, motavizumab, AFFF, P12f2, P12f4, P11d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, Alh5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, RF-2 o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, la combinación contiene un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento y un anticuerpo seleccionado de entre un anticuerpo o fragmento de unión a antígeno del mismo que se une inmunoespecíficamente con un antígeno del virus paragripal (PIV) o metaneumovirus humano (hMPV). En algunos ejemplos, el antígeno de PIV es un antígeno de PIV humano de tipo 1, PIV humano de tipo 2, PIV humano de tipo 3 y/o PIV humano de tipo 4. En algunos ejemplos, el antígeno de PIV se selecciona de entre una fosfoproteína de nucleocápsida de PIV, una proteína de fusión (F) de PIV, una fosfoproteína de PIV, una proteína grande (L) de PIV, una proteína de matriz (M) de PIV, una glucoproteína de hemaglutinina-neuraminidasa (HN) de PIV, una ARN polimerasa dependiente de ARN de PIV, una proteína Y1 de PIV, una proteína D de PIV, una proteína C de PIV y variantes alélicas de las mismas. En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de tipo A o hMPV de tipo B. En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de subtipo A1, hMPV de subtipo A2, hMPV de subtipo B1 o hMPV de subtipo B2. En algunos ejemplos, el antígeno de hMPV se selecciona de entre una nucleoproteína de hMPV, una fosfoproteína de hMPV, una proteína de la matriz de hMPV, una proteína hidrófoba pequeña de hMPV, una ARN polimerasa dependiente de ARN de hMPV, una proteína F de hMPV, una proteína G de hMPV G y variantes alélicas de las mismas. Se proporcionan en el presente documento combinaciones, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y uno o más anticuerpos antivirales adicionales, en los que el o los anticuerpos antivirales adicionales son un fragmento Fv monocatenario (scFv), Fab, Fab’, F(ab’)2, Fv, dsFv, diacuerpo, Fd o Fd’.

Se proporcionan en el presente documento composiciones farmacéuticas que contienen cualquier polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento, cualquier anticuerpo multivalente proporcionado en el presente documento, o cualquier combinación proporcionada en el presente documento y un vehículo o excipiente farmacéuticamente aceptable. En algunos ejemplos, las composiciones farmacéuticas proporcionadas en el presente documento se formulan como un gel, pomada, líquido, suspensión, aerosol, comprimido, píldora, polvo o pulverización nasal. En algunos ejemplos, las composiciones farmacéuticas proporcionadas en el presente documento se formulan para administración pulmonar, intranasal o parenteral. En algunos ejemplos, las composiciones farmacéuticas proporcionadas en el presente documento se formulan para administración de dosificación individual. En algunos ejemplos, las composiciones farmacéuticas proporcionadas en el presente documento se formulan para liberación sostenida.

Se proporcionan en el presente documento composiciones farmacéuticas, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y uno o más anticuerpos antivirales adicionales. En algunos ejemplos, las composiciones farmacéuticas contienen dos o más anticuerpos anti VSR diferentes o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, las composiciones farmacéuticas contienen dos o más anticuerpos anti VSR diferentes o fragmentos de unión a antígeno seleccionados de entre un anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento. En algunos ejemplos, las composiciones farmacéuticas contienen un anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento y un anticuerpo seleccionado de entre palivizumab, motavizumab, AFFF, P12f2, P 12f4, P11d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, Alh5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, RF-2 o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, las composiciones farmacéuticas contienen un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento y un anticuerpo seleccionado de entre un anticuerpo o fragmento de unión a antígeno del mismo que se unen inmunoespecíficamente con un antígeno de virus paragripal (PIV) o metaneumovirus humano (hMPV). En algunos ejemplos, el antígeno de PIV es un antígeno de PIV humano de tipo 1, PIV humano de tipo 2, PIV humano de tipo 3 y/o PIV humano de tipo 4. En algunos ejemplos, el antígeno de PIV se selecciona de entre una fosfoproteína de nucleocápsida de PIV, una proteína de fusión (F) de PIV, una fosfoproteína de PIV, una proteína grande (L) de PIV, una proteína de matriz (M) de PIV, una glucoproteína de hemaglutinina-neuraminidasa (HN) de PIV, una ARN polimerasa dependiente de ARN de PIV, una proteína Y1 de PIV, una proteína D de PIV, una proteína C de PIV y variantes alélicas de las mismas.

En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de tipo A o hMPV de tipo B. En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de subtipo A1, hMPV de subtipo A2, hMPV de subtipo B1 o hMPV de subtipo B2. En algunos ejemplos, el antígeno de hMPV se selecciona de entre una nucleoproteína de hMPV, una fosfoproteína de hMPV, una proteína de la matriz de hMPV, una proteína hidrófoba pequeña de hMPV, una ARN polimerasa dependiente de ARN de hMPV, una proteína F de hMPV, una proteína G de hMPV y variantes alélicas de las mismas. Se proporcionan en el presente documento composiciones farmacéuticas, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y uno o más anticuerpos antivirales adicionales, en los que el o los anticuerpos antivirales adicionales son un fragmento Fv monocatenario (scFv), Fab, Fab’, F(ab’)2, Fv, dsFv, diacuerpo, Fd o Fd’. Se proporcionan en el presente documento composiciones farmacéuticas, que contienen un polipéptido aislado, anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento o un anticuerpo multivalente proporcionado en el presente documento, y un agente antiviral. En algunos ejemplos, el agente antiviral es ribavirina. Se proporcionan en el presente documento métodos para tratar una infección viral en un sujeto, que implican administrar al sujeto una cantidad terapéuticamente eficaz de una composición farmacéutica proporcionada en el presente documento. Se proporcionan en el presente documento métodos para tratar o inhibir uno o más síntomas de una infección viral en un sujeto, que implican administrar al sujeto una cantidad terapéuticamente eficaz de una composición farmacéutica proporcionada en el presente documento. También se proporcionan en el presente documento métodos para prevenir una infección viral en un sujeto, que implican administrar al sujeto una cantidad terapéuticamente eficaz de una composición farmacéutica proporcionada en el presente documento. En un ejemplo particular, la infección viral es una infección por VSR. En un ejemplo particular, la infección por VSR es una infección del tracto respiratorio superior. La administración puede efectuarse por cualquier vía adecuada, incluyendo pero sin limitación, por vía tópica, por vía parenteral, por vía local o por vía sistémica, tal como por ejemplo por vía intranasal, por vía intramuscular, por vía intradérmica, por vía intraperitoneal, por vía intravenosa, por vía subcutánea, por vía oral o por administración pulmonar. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento se administra por un nebulizador o un inhalador. Las composiciones farmacéuticas proporcionadas en el presente documento pueden administrarse a cualquier sujeto adecuado, tal como un mamífero, por ejemplo, un ser humano.

En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento se administra a un bebé humano, un bebé humano nacido prematuramente o en riesgo de hospitalización para una infección por VSR, un ser humano anciano, un sujeto humano que tiene fibrosis quística, displasia broncopulmonar, enfermedad cardiaca congénita, inmunodeficiencia congénita, inmunodeficiencia adquirida, leucemia o linfoma no de Hodgkin o un sujeto humano que ha tenido un trasplante, tal como, por ejemplo, un trasplante de médula ósea o un trasplante de hígado. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento se administra una vez, dos veces, tres veces, cuatro veces o cinco veces durante la temporada de VSR (por ejemplo, de Octubre a Mayo). En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento se administra una vez, dos veces, tres veces, cuatro veces o cinco veces en un intervalo de un mes, dos meses o tres meses, antes de una temporada de VSR. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento puede administrarse con uno o más agentes antivirales. En algunos ejemplos, el agente antiviral es ribavirina. En algunos ejemplos, la composición farmacéutica y el agente antiviral se formulan como una única composición o como composiciones separadas. En los métodos proporcionados en el presente documento, la composición farmacéutica y el agente antiviral pueden administrarse secuencialmente, simultáneamente o intermitentemente. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento puede administrarse con una terapia hormonal, inmunoterapia o un agente antiinflamatorio. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento puede administrarse con uno o más anticuerpos antivirales adicionales o fragmentos de unión a antígeno de los mismos. La composición farmacéutica y el o los anticuerpos antivirales adicionales se formulan como una única composición o como composiciones separadas. La composición farmacéutica y el o los anticuerpos anti VSR adicionales pueden administrarse secuencialmente, simultáneamente o intermitentemente. En algunos ejemplos, el fragmento de unión a antígeno es un fragmento Fv monocatenario (scFv), Fab, Fab’, F(ab’)2, Fv, dsFv, diacuerpo, Fd o Fd’. En algunos ejemplos, una composición farmacéutica proporcionada en el presente documento puede administrarse con uno o más anticuerpos antivirales adicionales seleccionados de entre anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos, tales como, por ejemplo, palivizumab, motavizumab, AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2- 15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, RF-2 o fragmentos de unión a antígeno de los mismos.

En algunos ejemplos, puede administrarse una composición farmacéutica proporcionada en el presente documento con uno o más anticuerpos antivirales adicionales seleccionados de entre un anticuerpo o fragmento de unión a antígeno del mismo que se une inmunoespecíficamente con un antígeno del virus paragripal (PIV) o metaneumovirus humano (hMPV). En algunos ejemplos, el antígeno de PIV es un antígeno de PIV humano de tipo 1, PIV humano de tipo 2, PIV humano de tipo 3 y/o PIV humano de tipo 4. En algunos ejemplos, el antígeno de PIV se selecciona de entre una fosfoproteína de nucleocápsida de PIV, una proteína de fusión (F) de PIV, una fosfoproteína de PIV, una proteína grande (L) de PIV, una proteína de matriz (M) de PIV, una glucoproteína de hemaglutinina-neuraminidasa (HN) de PIV, una ARN polimerasa dependiente de ARN de PIV, una proteína Y1 de PIV, una proteína D de PIV, una proteína C de PIV y variantes alélicas de las mismas. En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de tipo A o hMPV de tipo B. En algunos ejemplos, el antígeno de hMPV es un antígeno de hMPV de subtipo A1, hMPV de subtipo A2, hMPV de subtipo B1 o hMPV de subtipo B2. En algunos ejemplos, el antígeno de hMPV se selecciona de entre una nucleoproteína de hMPV, una fosfoproteína de hMPV, una proteína de la matriz de hMPV, una proteína hidrófoba pequeña de hMPV, una ARN polimerasa dependiente de ARN de hMPV, una proteína F de hMPV, una proteína G de hMPV y variantes alélicas de las mismas.

Se proporcionan en el presente documento métodos para detectar infección por VSR, que implican (a) ensayar el nivel de antígeno de VSR en una muestra de fluido, celular o tisular usando un anticuerpo o fragmentos de unión a antígeno del mismo proporcionados en el presente documento; (b) comparar el nivel ensayado de antígeno de VSR con un nivel de control por lo que un aumento en el nivel ensayado de antígeno de VSR en comparación con el nivel de control del antígeno de VSR es indicativo de una infección por VSR. En algunos ejemplos, la muestra celular o tisular se obtiene de un sujeto humano. En algunos ejemplos, la muestra celular o tisular es una muestra de sangre, orina, saliva, esputo pulmonar, lavado o linfa. Se proporcionan en el presente documento ácidos nucleicos aislados que codifican el polipéptido, anticuerpo o fragmentos de unión a antígeno del mismo proporcionados en el presente documento. Se proporcionan en el presente documento vectores que contienen un ácido nucleico que codifica el polipéptido, anticuerpo o fragmentos de unión a antígeno del mismo proporcionados en el presente documento. Se proporcionan en el presente documento células aisladas que contienen un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento, un ácido nucleico proporcionado en el presente documento o un vector proporcionado en el presente documento. Las células proporcionadas en el presente documento pueden ser, por ejemplo, células procariotas o eucariotas. También se proporcionan en el presente documento animales transgénicos que contienen un ácido nucleico proporcionado en el presente documento o un vector proporcionado en el presente documento. También se proporcionan en el presente documento métodos para expresar un anticuerpo aislado o fragmento de unión a antígeno del mismo, que implican cultivar las células aisladas proporcionadas en el presente documento en condiciones que expresan el anticuerpo codificado o por aislamiento del anticuerpo o fragmento de unión a antígeno del animal transgénico proporcionado en el presente documento. En algunos ejemplos, el anticuerpo o fragmento de unión a antígeno se aísla del suero o la leche del animal transgénico.

Se proporcionan en el presente documento kits que contienen un polipéptido, anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento, un anticuerpo multivalente proporcionado en el presente documento, o una combinación proporcionada en el presente documento, en uno o más recipientes, e instrucciones para su uso.

También se proporcionan en el presente documento usos de un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento para la prevención y/o el tratamiento de la infección viral en un sujeto. También se proporcionan en el presente documento usos de un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento para tratar o inhibir uno o más síntomas de una infección viral en un sujeto. También se proporcionan en el presente documento usos de un anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento para la formulación de un medicamento para la prevención y/o el tratamiento de infección viral en un sujeto. También se proporcionan en el presente documento usos de un anticuerpo o fragmento de unión a antígeno proporcionado en el presente documento para la formulación de un medicamento para tratar o inhibir uno o más síntomas de una infección viral en un sujeto. Descripción detallada Esquema A. DEFINICIONES B. VISIÓN DE CONJUNTO 1. Virus Sincitial Respiratorio C. ANTICUERPOS ANTI VSR 1. Estructura de Anticuerpo General y Dominios Funcionales a. Dominios Estructurales y Funcionales de los Anticuerpos b. Fragmentos de Anticuerpo 2. Anticuerpos Anti VSR Ejemplares a. Anticuerpos Derivados i. Anticuerpos Monocatenarios ii. Anticuerpos Antiidiotípicos iii. Anticuerpos Multiespecíficos y Multimerización de Anticuerpos D. MODIFICACIONES ADICIONALES DE ANTICUERPOS ANTI VSR 1. Modificaciones para reducir la inmunogenicidad 2. Modificaciones de Fc 3. Pegilación 4. Conjugación de un Resto Detectable 5. Conjugación de un Resto Terapéutico 6. Modificaciones para mejorar la especificidad de unión E. MÉTODOS PARA AISLAR ANTICUERPOS ANTI VSR F. MÉTODOS PARA PRODUCIR ANTICUERPOS ANTI VSR, Y FORMAS MODIFICADAS O VARIANTES DE LOS MISMOS Y ÁCIDOS NUCLEICOS QUE CODIFICAN ANTICUERPOS 1. Ácidos Nucleicos 2. Vectores 3. Sistemas de Expresión Celular a. Expresión Procariota b. Células de Levadura c. Células de Insecto d. Células de Mamífero e. Plantas 4. Purificación de Anticuerpos G. EVALUACIÓN DE LAS PROPIEDADES Y ACTIVIDADES DE ANTICUERPOS ANTI VSR 1. Ensayos de Unión 3. Ensayos in vitro para analizar los efectos de neutralización de virus de anticuerpos 4. Modelos animales in vivo para evaluar la eficacia de los anticuerpos anti VSR 5. Ensayos In vitro e In vivo para Medir la Eficacia de los Anticuerpos H. USOS DE DIAGNÓSTICO 1. Detección in vitro de la infección patógena 2. Detección in vivo de la infección patógena 3. Control de la Infección I. USOS PROFILÁCTICOS Y TERAPÉUTICOS 1. Sujetos para terapia 2. Dosificaciones 3. Vías de Administración 4. Terapias de combinación a. Anticuerpos Antivirales para Terapia de Combinación i. Anticuerpos anti VSR ii. Anticuerpos contra otros virus respiratorios 5. Terapia Génica J. Composiciones Farmacéuticas, Combinaciones y Artículos de fabricación/Kits 1. Composiciones Farmacéuticas 2. Artículos de Fabricación/Kits 3. Combinaciones

K. Ejemplos

A. DEFINICIONES A no ser que se defina de otro modo, todos los términos técnicos y científicos usados en el presente documento tienen el mismo significado que se entiende habitualmente por un experto en la materia a la que pertenecen la invención o las invenciones. En caso de que haya una pluralidad de definiciones para términos del presente documento, prevalecerán los de la presente sección. Cuando se haga referencia a una URL u otro identificador u otra dirección tal, se entiende que dichos identificadores pueden cambiar y la información particular en internet puede aparecer y desaparecer, pero puede encontrarse información equivalente buscando en internet. La referencia a las mismas demuestra la disponibilidad y difusión pública de dicha información.

Como se usa en el presente documento, “anticuerpo” se refiere a inmunoglobulinas y fragmentos de inmunoglobulina, bien naturales o bien producidos de forma parcial o completamente sintética, tal como de forma recombinante, incluyendo cualquier fragmento de los mismos que contienen al menos una parte de la región variable de la molécula de inmunoglobulina que conserva la capacidad de especificidad de unión de la inmunoglobulina de longitud completa. Por lo tanto, un anticuerpo incluye cualquier proteína que tenga un dominio de unión que sea homólogo o sustancialmente homólogo de un dominio de unión a antígeno de inmunoglobulina (sitio de combinación de anticuerpo). Los anticuerpos incluyen fragmentos de anticuerpo, tales como fragmentos de anticuerpo anti VSR. Como se usa en el presente documento, el término anticuerpo, por lo tanto, incluye anticuerpos sintéticos, anticuerpos producidos de forma recombinante, anticuerpos multiespecíficos (por ejemplo, anticuerpos biespecíficos), anticuerpos humanos, anticuerpos no humanos, anticuerpos humanizados, anticuerpos quiméricos, intracuerpos y fragmentos de anticuerpo, tales como, pero sin limitación, fragmentos Fab, fragmentos Fab’, fragmentos F(ab’)2, fragmentos Fv, fragmentos Fv con enlaces disulfuro (dsFv), fragmentos Fd, fragmentos Fd’, Fv monocatenarios (scFv), Fab monocatenarios (scFab), diacuerpos, anticuerpos antiidiotípicos (anti Id) o fragmentos de unión a antígeno de cualquiera de los anteriores. Los anticuerpos proporcionados en el presente documento incluyen miembros de cualquier tipo de inmunoglobulina (por ejemplo, IgG, IgM, IgD, IgE, IgA e IgY), cualquier clase (por ejemplo IgG1, IgG2, IgG3, IgG4, IgA1 e IgA2) o subclase (por ejemplo, IgG2a e IgG2b). Como se usa en el presente documento, un “fragmento de anticuerpo” o “fragmento de unión a antígeno” de un anticuerpo se refiere a cualquier parte de un anticuerpo de longitud completa que es menor de longitud completa pero contiene al menos una parte de la región variable del anticuerpo que se une con el antígeno (por ejemplo una o más CDR y/o uno o más sitios de combinación de anticuerpo) y por lo tanto conserva la especificidad de unión y al menos una parte de la capacidad de unión específica del anticuerpo de longitud completa; los fragmentos de anticuerpo incluyen derivados de anticuerpo producidos por tratamiento enzimático de anticuerpos de longitud completa, así como derivados producidos de forma sintética, por ejemplo recombinante. Se incluye un fragmento de anticuerpo entre los anticuerpos. Los ejemplos de fragmentos de anticuerpo incluyen, pero sin limitación, fragmentos Fab, Fab’, F(ab’)2, Fv monocatenarios (scFv), Fv, dsFv, diacuerpos, Fd y Fd’ y otros fragmentos, incluyendo fragmentos modificados (véase, por ejemplo, Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Capítulo 1; p 3-25, Kipriyanov). El fragmento puede incluir múltiples cadenas unidas entre sí, tales como por enlaces disulfuro y/o por enlazadores peptídicos. Un fragmento de anticuerpo contiene en general al menos o aproximadamente 50 aminoácidos y típicamente al menos o aproximadamente 200 aminoácidos. Como se usa en el presente documento, un fragmento de unión a antígeno se refiere a un fragmento de anticuerpo que contiene una parte de unión a antígeno que se une con el mismo antígeno que el anticuerpo del que deriva el fragmento de anticuerpo. Un fragmento de unión a antígeno, como se usa en el presente documento, incluye cualquier fragmento de anticuerpo que cuando se inserta en un armazón de anticuerpo (tal como reemplazando una región correspondiente) da como resultado un anticuerpo que se une inmunoespecíficamente (es decir muestra Ka de al menos o al menos aproximadamente 107- 108 M-1) con el antígeno. Los fragmentos de unión a antígeno incluyen fragmentos de anticuerpo, tales como fragmentos Fab, fragmentos Fab’, fragmentos F(ab’)2, fragmentos Fv, Fv con enlaces disulfuro (dsFv), fragmentos Fd, fragmentos Fd’, Fv monocatenarios (scFv), Fab monocatenarios (scFab) y también incluye otros fragmentos, tales como fragmentos que contienen CDR, y polipéptidos que se unen inmunoespecíficamente con un antígeno o que cuando se insertan en un armazón de anticuerpo dan como resultado un anticuerpo que se une inmunoespecíficamente con el antígeno. Como se usa en el presente documento, un “anticuerpo terapéutico” se refiere a cualquier anticuerpo o fragmento de unión a antígeno del mismo que se administra para tratamiento de un animal, incluyendo un ser humano. Dichos anticuerpos pueden prepararse por cualquier método conocido para la producción de polipéptidos y, por lo tanto, incluyen, pero sin limitación, anticuerpos producidos de forma recombinante, anticuerpos producidos de forma sintética y anticuerpos terapéuticos extraídos de células o tejidos y otras fuentes. Como se aíslan de cualquier fuente o como se producen, los anticuerpos terapéuticos pueden ser de longitud heterogénea o diferir en la modificación postraduccional, tal como glucosilación (es decir, contenido de carbohidratos). La heterogeneidad de anticuerpos terapéuticos también puede diferir dependiendo de la fuente de los anticuerpos terapéuticos. Por lo tanto, la referencia a anticuerpos terapéuticos se refiere a la población heterogénea como se produce o se aísla. Cuando se pretenda una preparación homogénea, se indicará. Las referencias a anticuerpos terapéuticos en el presente documento son a sus formas monoméricas, diméricas u otras multiméricas, según sea apropiado.

Como se usa en el presente documento, un “anticuerpo neutralizante” es cualquier anticuerpo o fragmento de unión a antígeno del mismo que se una con un patógeno e interfiera con la capacidad del patógeno para infectar una célula y/o provocar enfermedad en un sujeto. Son ejemplos de anticuerpos neutralizantes los anticuerpos neutralizantes que se unen con virus, bacterias y patógenos fúngicos. Típicamente, los anticuerpos neutralizantes proporcionados en el presente documento se unen con la superficie del patógeno. En ejemplos en los que el patógeno es un virus, un anticuerpo neutralizante que se une con el virus típicamente se une con una proteína en la superficie del virus. Dependiendo de la clase del virus, la proteína de superficie puede ser una proteína de la cápsida (por ejemplo una proteína de la cápsida de un virus sin envoltura) o una proteína de envoltura viral (por ejemplo, una proteína de envoltura viral de un virus con envoltura). En algunos ejemplos, la proteína es una glucoproteína. La capacidad del virus para inhibir la infecciosidad del virus puede medirse por ejemplo, mediante un ensayo de neutralización in vitro, tal como, por ejemplo, un ensayo de reducción de placas usando células hospedadoras Vero. Como se usa en el presente documento, un “virus con envoltura” es un virus animal que posee una membrana o envoltura externa, que es una bicapa lipídica que contiene proteínas virales, que rodean la cápsida del virus. Las proteínas de la envoltura del virus participan en el ensamblaje de la partícula infecciosa y también están implicadas en la entrada del virus mediante unión con receptores presentes en la célula hospedadora e inducción de fusión entre la envoltura viral y una membrana de la célula hospedadora. Los virus con envoltura pueden ser bien esféricos o bien filamentosos (en forma de bastones). Los virus con envoltura ejemplares incluyen, pero sin limitación, miembros de las familias de virus Herpesviridae, Poxviridae, Hepadnaviridae, Togaviridae, Arenaviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, Bunyaviridae, Rhabdoviridae, Filoviridae, Coronaviridae y Bornaviridae. El virus sincitial respiratorio (VSR) es un virus con envoltura de ARN monocatenario con sentido negativo de la familia Paramyxoviridae, subfamilia Pneumovirinae. Como se usa en el presente documento, un “virus sin envoltura” o “virus desnudo” es un virus que carece de una envoltura viral. Para infección de una célula hospedadora, un virus sin envoltura usa proteína de la cápsida viral para unirse con la célula diana. Los virus sin envoltura ejemplares incluyen, pero sin limitación, las familias de virus Adenoviridae, Papillomavirinae, Parvoviridae, Polyomavirinae, Circoviridae, Reoviridae, Picornaviridae, Caliciviridae, y Astroviridae.

Como se usa en el presente documento, una “proteína de superficie” de un patógeno es cualquier proteína que se localiza en la superficie externa del patógeno. La proteína de superficie puede estar expuesta parcial o completamente al ambiente externo (es decir superficie externa). Son ejemplos de proteínas de superficie las proteínas de membrana, tales como, por ejemplo, una proteína localizada en la superficie de una envoltura viral o membrana externa bacteriana (por ejemplo, una glucoproteína de membrana). Las proteínas de membrana pueden ser proteínas transmembrana (es decir proteínas que atraviesan la bicapa lipídica) o proteínas que no son proteínas asociadas a superficie celular no transmembrana (por ejemplo, ancladas o unidas covalentemente con la superficie de la membrana, tal como unión con otra proteína en la superficie del patógeno). Otras proteínas de superficie ejemplares incluyen proteínas de la cápsida viral de virus con envoltura sin envoltura que están al menos parcialmente expuestas al ambiente externo.

Como se usa en el presente documento, “anticuerpo monoclonal” se refiere a una población de anticuerpos idénticos, lo que significa que cada molécula de anticuerpo individual en una población de anticuerpos monoclonales es idéntica a las otras. Esta propiedad se diferencia de la de una población policlonal de anticuerpos, que contiene anticuerpos que tienen una pluralidad de secuencias diferentes. Los anticuerpos monoclonales pueden producirse por varios métodos bien conocidos (Smith et al. (2004) J. Clin. Pathol. 57, 912-917; y Nelson et al., J Clin Pathol (2000), 53, 111-117). Por ejemplo, pueden producirse anticuerpos monoclonales por inmortalización de un linfocito B, por ejemplo mediante fusión con una célula de mieloma para generar una línea celular de hibridoma o mediante infección de linfocitos B con virus tales como VEB. También puede usarse tecnología recombinante para producir anticuerpos in vitro a partir de poblaciones clonales de células hospedadoras transformando las células hospedadoras con plásmidos que portan secuencias artificiales de nucleótidos que codifican los anticuerpos.

Como se usa en el presente documento, un “anticuerpo convencional” se refiere a un anticuerpo que contiene dos cadenas pesadas (que pueden indicarse H y H’) y dos cadenas ligeras (que pueden indicarse L y L’) y dos sitios de combinación de anticuerpos, en los que cada cadena pesada puede ser una cadena pesada de inmunoglobulina de longitud completa o cualquier región funcional de la misma que conserve la capacidad de unión a antígeno (por ejemplo las cadenas pesadas incluyen, pero sin limitación, cadenas VH, cadenas VH-CH1 y cadenas VH-CH1-CH2- CH3), y cada cadena ligera puede ser una cadena ligera de longitud completa o cualquier región funcional de la misma (por ejemplo las cadenas ligeras incluyen, pero sin limitación, cadenas VL y cadenas VL-CL). Cada cadena pesada (H y H’) se empareja con una cadena ligera (L y L’, respectivamente) Como se usa en el presente documento, un anticuerpo de longitud completa es un anticuerpo que tiene dos cadenas pesadas de longitud completa (por ejemplo VH-CH1-CH2-CH3 o VH-CH1-CH2-CH3-CH4) y dos cadenas ligeras de longitud completa (VL-CL) regiones bisagra, tales como anticuerpos humanos producidos de forma natural por linfocitos B secretores de anticuerpos y anticuerpos con los mismos dominios que se producen de forma sintética.

Como se usa en el presente documento, un fragmento de anticuerpo Fv está compuesto de un dominio pesado variable (VH) y un dominio ligera variable (VL) unidos por interacciones no covalentes. Como se usa en el presente documento, un dsFv se refiere un Fv con un enlace disulfuro intermolecular modificado técnicamente, que estabiliza el par VH-VL.

Como se usa en el presente documento, un fragmento Fd es un fragmento de un anticuerpo que contiene un dominio variable (VH) y un dominio de región constante (CH1) de una cadena pesada de anticuerpo. Como se usa en el presente documento, un fragmento Fab es un fragmento de anticuerpo que resulta de la digestión de una inmunoglobulina de longitud completa con papaína, o un fragmento que tiene la misma estructura que se produce de forma sintética, por ejemplo por métodos recombinantes. Un fragmento Fab contiene una cadena ligera (que contiene un VL y CL) y otra cadena que contiene un dominio variable de una cadena pesada (VH) y un dominio de región constante de la cadena pesada (CH1).

Como se usa en el presente documento, un fragmento F(ab’)2 es un fragmento de anticuerpo que resulta de la digestión de una inmunoglobulina con pepsina a pH 4,0-4,5, o un fragmento que tiene la misma estructura que se produce de forma sintética, por ejemplo mediante métodos recombinantes. El fragmento F(ab’)2 esencialmente contiene dos fragmentos Fab en los que cada parte de cadena pesada contiene algunos aminoácidos adicionales, incluyendo restos de cisteína que forman enlaces disulfuro que unen los dos fragmentos.

Como se usa en el presente documento, un fragmento Fab’ es un fragmento que contiene una mitad (una cadena pesada y una cadena ligera) del fragmento F(ab’)2. Como se usa en el presente documento, un fragmento Fd’ es un fragmento de un anticuerpo que contiene una parte de cadena pesada de un fragmento F(ab’)2. Como se usa en el presente documento, un fragmento Fv’ es un fragmento que contiene solamente los dominios VH y VL de una molécula de anticuerpo.

Como se usa en el presente documento, hsFv se refiere a fragmentos de anticuerpo en los que los dominios constantes normalmente presentes en un fragmento Fab se han sustituido con un dominio superenrollado heterodimérico (véase, por ejemplo, Arndt et al. (2001) J Mol Biol. 7: 312: 221-228). Como se usa en el presente documento, un fragmento scFv se refiere a un fragmento de anticuerpo que contiene una cadena ligera variable (VL) y cadena pesada variable (VH), conectadas covalentemente por un enlazador polipeptídico en cualquier orden. El enlazador es de una longitud tal que los dos dominios variables se unen sin interferencia sustancial. Los enlazadores ejemplares son restos de (Gly-Ser)n con algunos restos de Glu o Lys intercalados para aumentar la solubilidad. Como se usa en el presente documento, el término “derivado” se refiere a un polipéptido que contiene una secuencia de aminoácidos de un anticuerpo anti VSR o un fragmento del mismo que se ha modificado, por ejemplo, mediante la introducción de sustituciones, deleciones o adiciones de restos de aminoácidos, mediante la unión covalente de cualquier tipo de molécula con el polipéptido (por ejemplo, por glucosilación, acetilación, pegilación, fosforilación, amidación, derivatización por grupos protectores/de bloqueo conocidos, escisión proteolítica, enlace con un ligando celular u otra proteína). Un derivado de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede modificarse por modificaciones químicas usando técnicas conocidas por los expertos en la materia, incluyendo, pero sin limitación, escisión química específica, acetilación, formilación, síntesis metabólica de tunicamicina. Además, un derivado de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener uno o más aminoácidos no clásicos. Típicamente, un derivado polipeptídico posee una función similar o idéntica a un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento (por ejemplo neutralización de VSR).

Como se usa en el presente documento, la expresión “derivado de” cuando se refiere a fragmentos de anticuerpos derivados de otro anticuerpo, tal como un anticuerpo monoclonal, se refiere a la modificación técnica de fragmentos de anticuerpo (por ejemplo, fragmentos Fab, F(ab’), F(ab’)2, Fv monocatenarios (scFv), Fv, dsFv, diacuerpo, Fd y Fd’) que conservan la especificidad de unión del anticuerpo original. Dichos fragmentos pueden derivarse por una diversidad de métodos conocidos en la técnica, incluyendo, pero sin limitación, escisión enzimática, entrecruzamiento químico, medios recombinantes o combinaciones de los mismos. En general, el fragmento de anticuerpo derivado comparte la región variable de cadena pesada (VH) y región variable de cadena ligera (VL) idéntica o sustancialmente idéntica del anticuerpo parental, de modo que el fragmento de anticuerpo y el anticuerpo parental se unan con el mismo epítopo.

Como se usa en el presente documento, un “anticuerpo parental” o “anticuerpo fuente” se refiere a un anticuerpo del que deriva un fragmento de anticuerpo (por ejemplo, fragmentos Fab, F(ab’), F(ab’)2, Fv monocatenarios (scFv), Fv, dsFv, diacuerpo, Fd y Fd’).

Como se usa en el presente documento, el término “epítopo” se refiere a cualquier determinante antigénico en un antígeno con el que se una el parótopo de un anticuerpo. Los determinantes epitópicos típicamente contienen agrupamientos de superficie químicamente activos de moléculas tales como aminoácidos o cadenas laterales de azúcares y típicamente tienen características estructurales tridimensionales específicas, así como características de carga específicas.

Como se usa en el presente documento, un polipéptido quimérico se refiere a un polipéptido que contiene partes de al menos dos polipéptidos diferentes o de dos partes no contiguas de un único polipéptido. Por lo tanto, un polipéptido quimérico generalmente incluye una secuencia de restos de aminoácidos de todo o parte de un polipéptido y una secuencia de aminoácidos de todo o parte de otro polipéptido diferente. Las dos partes pueden unirse directa o indirectamente y pueden unirse mediante enlaces peptídicos, otros enlaces covalentes u otras interacciones no covalentes de suficiente fuerza para mantener la integridad de una parte sustancial del polipéptido quimérico en condiciones de equilibrio y condiciones fisiológicas, tales como en solución salina tamponada a pH 7 isotónica. Para fines del presente documento, los polipéptidos quiméricos incluyen los que contienen todo o parte de un anticuerpo anti VSR unido con otro polipéptido, tal como, por ejemplo, un dominio de multimerización, un dominio constante de inmunoglobulina heterólogo o región marco conservada, o un polipéptido de diagnóstico o terapéutico. Como se usa en el presente documento, una proteína de fusión es un polipéptido modificado técnicamente para contener secuencias de aminoácidos correspondientes a dos polipéptidos distintos, que se unen entre sí, tal como expresando la proteína de fusión de un vector que contiene dos ácidos nucleicos, que codifican los dos polipéptidos, en proximidad estrecha, por ejemplo, adyacentes, entre sí a lo largo de la longitud del vector. En general, una proteína de fusión proporcionada en el presente documento se refiere a un polipéptido que contiene un polipéptido que tiene la secuencia de aminoácidos de un anticuerpo o fragmento de unión a antígeno del mismo y un polipéptido o péptido que tiene la secuencia de aminoácidos de un polipéptido o péptido heterólogo, tal como, por ejemplo, un polipéptido de diagnóstico o terapéutico. En consecuencia, una proteína de fusión se refiere a una proteína quimérica que contiene dos o partes de dos o más proteínas o péptidos que se unen directa o indirectamente mediante enlaces peptídicos. Las dos moléculas pueden estar adyacentes en la construcción o separadas por un enlazador, o polipéptido espaciador. El espaciador puede codificar un polipéptido que altere las propiedades del polipéptido, tal como la solubilidad o el tráfico intracelular.

Como se usa en el presente documento, péptido “enlazador” o “espaciador” se refiere a secuencias cortas de aminoácidos que unen dos secuencias polipeptídicas (o ácido nucleico que codifica dicha secuencia de aminoácidos). El “enlazador peptídico” se refiere a la secuencia corta de aminoácidos que une las dos secuencias polipeptídicas. Son ejemplos de enlazadores polipeptídicos los enlazadores que unen un dominio de transducción de péptido con un anticuerpo o enlazadores que unen dos cadenas de anticuerpo en un fragmento de anticuerpo sintético tal como un fragmento scFv. Los enlazadores se conocen bien y puede usarse cualquier enlazador conocido en los métodos proporcionados. Son ejemplos de enlazadores polipeptídicos las secuencias de aminoácidos (Gly-Ser)n, con algunos restos Glu o Lys intercalados para aumentar la solubilidad. Otros enlazadores ejemplares se describen en el presente documento; cualquiera de estos y otros enlazadores conocidos pueden usarse con las composiciones y los métodos proporcionados.

Como se usa en el presente documento, “región bisagra de anticuerpo” o “región bisagra” se refiere a una región polipeptídica que existe de forma natural en la cadena pesada de los isotipos de anticuerpo gamma, delta y alfa, entre los dominios CH1 y CH2 que no tiene homología con los otros dominios de anticuerpo. Esta región es rica en restos de prolina y proporciona a los anticuerpos IgG, IgD e IgA flexibilidad, permitiendo que las dos “ramas” (que contienen cada una un sitio de combinación de anticuerpo) de la parte Fab sean móviles, suponiendo diversos ángulos unos con respecto a los otros como se unen con el antígeno. Esta flexibilidad permite que las ramas Fab se muevan para alinear los sitios de combinación de anticuerpos para interaccionar con epítopos en superficies celulares u otros antígenos. Dos enlaces disulfuro intercatenarios dentro de la región bisagra estabilizan la interacción entre las dos cadenas pesadas. En algunas realizaciones proporcionadas en el presente documento, los fragmentos de anticuerpo producidos de forma sintética contienen una o más regiones bisagra, por ejemplo, para promover la estabilidad mediante interacciones entre dos cadenas de anticuerpo. Las regiones bisagra son ejemplares de dominios de dimerización. Como se usa en el presente documento, los diacuerpos son scFv diméricos; los diacuerpos tienen típicamente enlazadores peptídicos más cortos que los scFv, y preferentemente dimerizan.

Como se usa en el presente documento, los anticuerpos humanizados se refieren a anticuerpos que se modifican para incluir secuencias “humanas” de aminoácidos de modo que la administración a un ser humano no provoca una respuesta inmunitaria. Un anticuerpo humanizado típicamente contiene regiones determinantes de complementariedad (CDR) derivadas de una inmunoglobulina de especie no humana y el resto de la molécula de anticuerpo derivada principalmente de una inmunoglobulina humana. Se conocen métodos para la preparación de dichos anticuerpos. Por ejemplo, el ADN que codifica un anticuerpo monoclonal puede alterarse por técnicas de ADN recombinante para codificar un anticuerpo en el que la composición de aminoácidos de las regiones no variables se basa en anticuerpos humanos. Se conocen métodos para identificar dichas regiones, incluyendo programas informáticos, que se diseñan para identificar las regiones variables y no variables de inmunoglobulinas.

Como se usa en el presente documento, idiotipo se refiere a un conjunto de uno o más determinantes antigénicos específicos para la región variable de una molécula de inmunoglobulina. Como se usa en el presente documento, anticuerpo antiidiotípico se refiere a un anticuerpo dirigido contra la parte específica de antígeno de la secuencia de un anticuerpo o receptor de linfocitos T. En principio un anticuerpo antiidiotípico inhibe una respuesta inmunitaria específica. Como se usa en el presente documento, un dominio Ig es un dominio reconocido como tal por los expertos en la materia, que se distingue por una estructura, denominado el pliegue de inmunoglobulina (Ig), que contiene dos láminas plegadas en beta, conteniendo cada una cadenas beta antiparalelas de aminoácidos conectados por bucles. Las dos láminas beta en el pliegue Ig se superponen entre sí por interacciones hidrófobas y un enlace disulfuro intracatenario conservado. Los dominios de inmunoglobulina individuales dentro de una cadena de anticuerpo pueden distinguirse adicionalmente basándose en la función. Por ejemplo una cadena ligera contiene un dominio de región variable (VL) y un dominio de región constante (CL), mientras que una cadena pesada contiene un dominio de región variable (VH) y tres o cuatro dominios de región constante (CH). Cada dominio VL, CL, VH y CH es un ejemplo de un dominio de inmunoglobulina. Como se usa en el presente documento, un dominio variable o región variable es un dominio Ig específico de una cadena pesada o ligera de anticuerpo que contiene una secuencia de aminoácidos que varía entre diferentes anticuerpos. Cada cadena ligera y cada cadena pesada tienen un dominio de región variable, VL y VH, respectivamente. Los dominios variables proporcionan especificidad de antígeno, y son por lo tanto responsables del reconocimiento de antígenos. Cada región variable contiene CDR que son parte del dominio de sitio de unión a antígeno y regiones marco conservadas (FR).

Como se usa en el presente documento, “dominio de unión a antígeno”, “sitio de unión a antígeno”, “sitio de combinación de antígeno” y “sitio de combinación de anticuerpo” se usan de forma sinónima para hacer referencia a un dominio dentro de un anticuerpo que reconoce e interacciona físicamente con un antígeno afín. Una molécula de anticuerpo de longitud completa convencional nativa tiene dos sitios de unión a antígeno convencionales, conteniendo cada uno partes de una región variable de cadena pesada y partes de una región variable de cadena ligera. Un sitio de unión a antígeno convencional contiene los bucles que conectan las cadenas beta antiparalelas dentro de los dominios de región variable. Los sitios de combinación de antígeno pueden contener otras partes de los dominios de región variable. Cada sitio de unión a antígeno convencional contiene tres regiones hipervariables de la cadena pesada y tres regiones hipervariables de la cadena ligera. Las regiones hipervariables también se denominan regiones determinantes de complementariedad (CDR).

Como se usa en el presente documento, “región hipervariable”, “HV”, “región determinante de complementariedad” y “CDR” y “CDR de anticuerpo” se usan indistintamente para hacer referencia a una de una pluralidad de partes dentro de cada región variable que forman juntas un sitio de unión a antígeno de un anticuerpo. Cada dominio de región variable contiene tres CDR, denominadas CDR1, CDR2 y CDR3. Las tres CDR son no contiguas a lo largo de la secuencia de aminoácidos lineal, pero están próximas en el polipéptido plegado. Las CDR se localizan dentro de los bucles que unen las cadenas paralelas de las láminas beta del dominio variable. Como se describe en el presente documento, un experto en la materia conoce y puede identificar las CDR basándose en la numeración de Kabat o Chothia (véase por ejemplo, Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Quinta Edición, U.S. Department of Health and Human Services, Publicación de NIH N.º 91-3242, y Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917). Como se usa en el presente documento, las regiones marco conservadas (FR) son los dominios dentro de los dominios de región variable de anticuerpos que se localizan dentro de las láminas beta; las reacciones FR están comparativamente más conservadas, con respecto a sus secuencias de aminoácidos, que las regiones hipervariables. Como se usa en el presente documento, un dominio “de región constante” es un dominio en la cadena pesada o ligera de un anticuerpo que contiene una secuencia de aminoácidos que está comparativamente más conservada que la del dominio de región variable. En moléculas de anticuerpo de longitud completa convencionales, cada cadena ligera tiene un único dominio de región constante de cadena ligera (CL) y cada cadena pesada contiene uno o más dominios de región constante de cadena pesada (CH), que incluyen CH1, CH2, CH3 y CH4. Los isotipos IgA, IgD e IgG de longitud completa contienen CH1, CH2, CH3 y una región bisagra, mientras que IgE e IgM contienen CH1, CH2, CH3 y CH4. Los dominios CH1 y CL extienden la rama Fab de la molécula de anticuerpo, contribuyendo de este modo a la interacción con el antígeno y a la rotación de las ramas del anticuerpo. Las regiones constantes de anticuerpo pueden cumplir funciones efectoras, tales como, pero sin limitación, eliminación de antígenos, patógenos y toxinas con los que se une específicamente el anticuerpo, por ejemplo, mediante interacciones con diversas células, biomoléculas y tejidos. Como se usa en el presente documento, una región funcional de un anticuerpo es una parte del anticuerpo que contiene al menos un dominio VH, VL, CH (por ejemplo CH1, CH2 o CH3), CL o de región bisagra del anticuerpo, o al menos una región funcional del mismo. Como se usa en el presente documento, una región funcional de un dominio VH es al menos una parte del dominio VH completo que conserva al menos una parte de la especificidad de unión del dominio VH completo (por ejemplo conservando una o más CDR del dominio VH completo), de modo que la región funcional del dominio VH, solo o en combinación con otro dominio de anticuerpo (por ejemplo dominio VL) o región del mismo, se une con el antígeno. Son regiones funcionales ejemplares de dominios VH las regiones que contienen la CDR1, CDR2 y/o CDR3 del dominio VH.

Como se usa en el presente documento, la región funcional de un dominio VL es al menos una parte del dominio VL completo que conserva al menos una parte de la especificidad de unión del dominio VL completo (por ejemplo conservando una o más CDR del dominio VL completo), de modo que la región funcional del dominio VL, bien solo o bien en combinación con otro dominio de anticuerpo (por ejemplo dominio VH) o región del mismo, se une con el antígeno. Las regiones funcionales ejemplares de dominios VL son regiones que contienen las CDR1, CDR2 y/o CDR3 del dominio VL. Como se usa en el presente documento, “se une específicamente” o “se une inmunoespecíficamente” con respecto a un anticuerpo o fragmento de unión a antígeno del mismo se usan indistintamente en el presente documento y se refieren a la capacidad del anticuerpo o fragmento de unión a antígeno para formar uno o más enlaces no covalentes con un antígeno afín, por interacciones no covalentes entre el sitio o los sitios de combinación de anticuerpos del anticuerpo y el antígeno. El antígeno puede ser un antígeno aislado o presentado en un virus. Típicamente, un anticuerpo que se une inmunoespecíficamente (o que se une específicamente) con un antígeno viral o virus es uno que se une con el antígeno viral (o con el antígeno en el virus o con el virus) con una constante de afinidad Ka de aproximadamente o 1 x 107 M-1 o 1 x 108 M-1 o mayor (o una constante de disociación (Kd) de 1 x 10-7 M o 1 x 10-8 M o menos). Las constantes de afinidad pueden determinarse por metodología cinética convencional para reacciones de anticuerpos, por ejemplo, inmunoensayos, resonancia de plasmón superficial (SPR) (Rich y Myszka (2000) Curr. Opin. Biotechnol 11: 54; Englebienne (1998) Analyst. 123: 1599), calorimetría de valoración isotérmica (ITC) u otros ensayos de interacción cinética conocidos en la técnica (véase, por ejemplo, Paul, ed., Fundamental Immunology, 2ª ed., Raven Press, Nueva York, páginas 332-336 (1989); véase también Patente de Estados Unidos N.º 7.229.619 para una descripción de métodos de SPR e ITC ejemplares para calcular la afinidad de unión de anticuerpos anti VSR). Se conocen y están disponibles en el mercado instrumentación y métodos para detección en tiempo real y control de las velocidades de unión (por ejemplo, BiaCore 2000, Biacore AB, Upsala, Suecia y GE Healthcare Life Sciences; Malmqvist (2000) Biochem. Soc. Trans. 27: 335). Un anticuerpo que se une inmunoespecíficamente con un antígeno viral (o virus) puede unirse con otros péptidos, polipéptidos o proteínas o virus con afinidad de unión igual o menor. Típicamente, un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento que se une inmunoespecíficamente con una proteína F de VSR (o virus VSR) no reacciona de forma cruzada con otros antígenos o reacciona de forma cruzada con sustancialmente (al menos 10-100 veces) menor afinidad por dichos antígenos. Los anticuerpos o fragmentos de unión a antígeno que se unen inmunoespecíficamente con un antígeno viral particular (por ejemplo una proteína F de VSR) pueden identificarse, por ejemplo, mediante inmunoensayos, tales como radioinmunoensayos (RIA), ensayos inmunoabsorbentes ligados a enzima (ELISA), resonancia de plasmón superficial u otras técnicas conocidas por los expertos en la materia. Una anticuerpo o fragmento de unión a antígeno del mismo que se une inmunoespecíficamente con un epítopo en una proteína F de VSR típicamente es uno que se une con el epítopo (presentado en la proteína o virus) con una afinidad de unión mayor que con cualquier epítopo de reacción cruzada como se determina usando técnicas experimentales, tales como, pero sin limitación, inmunoensayos, resonancia de plasmón superficial, u otras técnicas conocidas por los expertos en la materia. La unión inmunoespecífica con una proteína del VSR aislada (es decir, una proteína producida de forma recombinante), tal como proteína F de VSR, no significa necesariamente que el anticuerpo muestre la misma unión inmunoespecífica y/o neutralización del virus. Dichas mediciones y propiedades son distintas. Puede determinarse la afinidad para el anticuerpo o fragmentos de unión a antígeno por el virus o el antígeno como se presenta en el virus. Para fines del presente documento, cuando se describe una afinidad o término relacionado, se identificará la diana, tal como la proteína aislada o el virus. Como se usa en el presente documento, la expresión “resonancia de plasmón superficial” se refiere a un fenómeno óptico que permite el análisis de interacciones en tiempo real mediante detección de alteraciones en concentraciones de proteína dentro de una matriz biosensora, por ejemplo, usando el sistema BiaCore (GE Healthcare Life Sciences). Como se usa en el presente documento, un anticuerpo “multivalente” es un anticuerpo que contiene dos o más sitios de unión a antígeno. Los anticuerpos multivalentes abarcan anticuerpos bivalentes, trivalentes, tetravalentes, pentavalentes, hexavalentes, heptavalentes o de mayor valencia.

Como se usa en el presente documento, un “monoespecífico” es un anticuerpo que contiene dos o más sitios de unión a antígeno, en los que cada sitio de unión a antígeno se une inmunoespecíficamente con el mismo epítopo. Como se usa en el presente documento, un anticuerpo “multiespecífico” es un anticuerpo que contiene dos o más sitios de unión a antígeno, en los que al menos dos de los sitios de unión a antígeno se unen inmunoespecíficamente con diferentes epítopos. Como se usa en el presente documento, un anticuerpo “biespecífico” es un anticuerpo multiespecífico que contiene dos o más sitios de unión a antígeno y puede unirse inmunoespecíficamente con dos epítopos diferentes. Un anticuerpo “triespecífico” es un anticuerpo multiespecífico que contiene tres o más sitios de unión a antígeno y puede unirse inmunoespecíficamente con tres epítopos diferentes, un anticuerpo “tetraespecífico” es un anticuerpo multiespecífico que contiene cuatro o más sitios de unión a antígeno y puede unirse inmunoespecíficamente con cuatro epítopos diferentes, y así sucesivamente.

Como se usa en el presente documento, un anticuerpo “heterobivalente” es un anticuerpo biespecífico que contiene dos sitios de unión a antígeno, en los que cada sitio de unión a antígeno se une inmunoespecíficamente con un epítopo diferente. Como se usa en el presente documento, un anticuerpo “homobivalente” es un anticuerpo monoespecífico que contiene dos sitios de unión a antígeno, en los que cada sitio de unión a antígeno se une inmunoespecíficamente con el mismo epítopo. Los anticuerpos homobivalentes incluyen, pero sin limitación, anticuerpos de longitud completa convencionales, anticuerpos de longitud completa modificados técnicamente o sintéticos, cualquier multímero de dos fragmentos de unión a antígeno idénticos, o cualquier multímero de dos fragmentos de unión a antígeno que contiene el mismo dominio de unión a antígeno.

Como se usa en el presente documento, un dominio de multimerización se refiere a una secuencia de aminoácidos que promueve la interacción estable de una molécula polipeptídica con una o más moléculas polipeptídicas adicionales, conteniendo cada una un dominio de multimerización complementario, que puede ser igual o un dominio de multimerización diferente para formar un multímero estable con el primer dominio. En general, un polipéptido se une directa o indirectamente con el dominio de multimerización. Los dominios de multimerización ejemplares incluyen las secuencias de inmunoglobulina o partes de las mismas, cremalleras de leucina, regiones hidrófobas, regiones hidrófilas y dominios de interacción proteína-proteína compatibles. El dominio de multimerización, por ejemplo, puede ser una región o dominio constante de inmunoglobulina, tal como, por ejemplo, el dominio Fc o partes del mismo de IgG, incluyendo los subtipos IgG1, IgG2, IgG3 o IgG4, IgA, IgE, IgD e IgM y formas modificadas de los mismos. Como se usa en el presente documento, los dominios de dimerización son dominios de multimerización que facilitan la interacción entre dos secuencias polipeptídicas (tales como, pero sin limitación, cadenas de anticuerpos). Los dominios de dimerización incluyen, pero sin limitación, una secuencia de aminoácidos que contiene un resto de cisteína que facilita la formación de un enlace disulfuro entre dos secuencias polipeptídicas, tales como toda o parte de una región bisagra de anticuerpo de longitud completa, o una o más secuencias de dimerización, que son secuencias de aminoácidos que se sabe que promueven la interacción entre polipéptidos (por ejemplo, cremalleras de leucina, cremalleras de GCN4). Como se usa en el presente documento, “Fc” o “región Fc” o “dominio Fc” se refiere a un polipéptido que contiene la región constante de una cadena pesada de anticuerpo, excluyendo el primer dominio de inmunoglobulina de región constante. Por lo tanto, Fc se refiere a los dos últimos dominios de inmunoglobulina de región constante de IgA, IgD e IgE, o los tres últimos dominios de inmunoglobulina de región constante de IgE e IgM. Opcionalmente, un dominio Fc puede incluir toda o parte de la bisagra flexible N terminal de estos dominios. Para IgA e IgM, Fc puede incluir la cadena J. Para un dominio Fc ejemplar de IgG, Fc contiene dominios de inmunoglobulina Cγ2 y Cγ3 y, opcionalmente, toda o parte de la bisagra entre Cγ1 y Cγ2. Los límites de la región Fc pueden variar, pero típicamente incluyen al menos parte de la región bisagra. Además, Fc también incluye cualquier variante alélica o de especie o cualquier variante o forma modificada, tal como cualquier variante o forma modificada que altere la unión con un FcR o altere una función efectora mediada por Fc.

Como se usa en el presente documento, “quimera de Fc” se refiere a un polipéptido quimérico en el que uno o más polipéptidos están unidos, directa o indirectamente, con una región Fc o un derivado de la misma. Típicamente, una quimera Fc combina la región Fc de una inmunoglobulina con otro polipéptido, tal como por ejemplo un fragmento de anticuerpo anti VSR. Los expertos en la materia conocen derivados de o polipéptidos Fc modificados.

Como se usa en el presente documento, un “dominio de transducción de proteínas” o “PTD” es un dominio peptídico que puede conjugarse con una proteína, tal como un anticuerpo proporcionado en el presente documento, para promover la unión con y/o captación de la proteína en una célula diana. Como se usa en el presente documento, un “marcador” o un “marcador epitópico” se refiere a una secuencia de aminoácidos, típicamente añadida al extremo N o C terminal de un polipéptido, tal como un anticuerpo proporcionado en el presente documento. La inclusión de marcadores fusionados con un polipéptido puede facilitar la purificación y/o detección de polipéptidos. Típicamente, un marcador o polipéptido marcador se refiere a un polipéptido que tiene suficiente restos para proporcionar un epítopo reconocido por un anticuerpo o puede actuar para detección o purificación, pero es suficientemente corto de modo que no interfiera con la actividad del polipéptido quimérico con el que se une. El polipéptido marcador típicamente es suficientemente único para que un anticuerpo que se une específicamente con el mismo no reaccione sustancialmente de forma cruzada con epítopos en el polipéptido con el que se une. Los polipéptidos marcadores adecuados tienen en general al menos 5 o 6 restos de aminoácidos y habitualmente entre aproximadamente 8 y 50 restos de aminoácidos, típicamente entre 9 y 30 restos. Los marcadores pueden unirse con uno o más polipéptidos quiméricos en un multímero y permitir la detección de multímero o su recuperación de una muestra o mezcla. Dichos marcadores se conocen bien y pueden sintetizarse y diseñarse fácilmente. Los polipéptidos marcadores ejemplares incluyen los usados para purificación de afinidad e incluyen marcadores de His, el polipéptido marcador de hemaglutinina (HA) de la gripe y su anticuerpo 12CA5 (Field et al. (1988) Mol. Cell. Biol. 8: 2159-2165); el marcador c-myc y los anticuerpos 8F9, 3C7, 6E10, G4, B7 y 9E10 para el mismo (véase, por ejemplo, Evan et al. (1985) Molecular and Cellular Biology 5: 3610-3616); y el marcador de glucoproteína D (gD) del virus del Herpes Simple y su anticuerpo (Paborsky et al. (1990) Protein Engineering 3: 547-5 53 (1990). Un anticuerpo usado para detectar un anticuerpo con epítopo marcado se denomina típicamente en el presente documento un anticuerpo secundario. Como se usa en el presente documento, “polipéptido” se refiere a dos o más aminoácidos unidos covalentemente.

Los términos “polipéptido” y “proteína” se usan indistintamente en el presente documento. Como se usa en el presente documento, un “péptido” se refiere a un polipéptido que es de 2 a aproximadamente o 40 aminoácidos de longitud.

Como se usa en el presente documento, un “aminoácido” es un compuesto orgánico que contiene un grupo amino y un grupo de ácido carboxílico. Un polipéptido contiene dos o más aminoácidos. Para fines del presente documento, los aminoácidos contenidos en los anticuerpos proporcionados incluyen los veinte aminoácidos de origen natural (Tabla 1), aminoácidos no naturales, y análogos de aminoácidos (por ejemplo, aminoácidos en los que el carbono α tiene una cadena lateral). Como se usa en el presente documento, los aminoácidos, que aparecen en las diversas secuencias de aminoácidos de polipéptidos que aparecen en el presente documento, se han identificado de acuerdo con sus abreviaturas de tres letras o una letra, bien conocidas (véase Tabla 1). Los nucleótidos, que aparecen en las diversas moléculas de ácido nucleico y fragmentos, se designan con las designaciones de una única letra convencionales usadas habitualmente en la técnica.

Como se usa en el presente documento, “resto de aminoácido” se refiere a un aminoácido formado tras la digestión química (hidrólisis) de un polipéptido en sus enlaces peptídicos. Los restos de aminoácidos descritos en el presente documento están en general en la forma isomérica “L”. Los restos en la forma isomérica “D” pueden sustituir cualquier resto de aminoácido L, siempre que el polipéptido conserve la propiedad funcional deseada. NH2 se refiere al grupo amino libre presente en el extremo amino terminal de un polipéptido. COOH se refiere al grupo carboxilo libre presente en el extremo carboxilo terminal de un polipéptido. Conforme a la nomenclatura de polipéptidos convencional descrita en J. Biol. Chem., 243: 3557-59 (1968) y adoptada en 37 C.F.R. §§. 1.821 - 1.822, se muestran las abreviaturas para restos de aminoácidos en la Tabla 1: TABLA 1 - Tabla de correspondencia SÍMBOLO 1 Letra 3 Letras AMINOÁCIDO I Tyr Tirosina G Gly Glicina F Phe Fenilalanina M Met Metionina A Ala Alanina S Ser Serina I Ile Isoleucina L Leu Leucina T Thr Treonina V Val Valina P Pro Prolina K Lys Lisina H His Histidina Q Gln Glutamina E Glu Ácido glutámico Z Glx Ácido Glutámico y/o Glutamina W Trp Triptófano R Arg Arginina D Asp Ácido aspártico N Asn Asparagina B Asx Ácido aspártico y/o Asparagina C Cys Cisteína X Xaa Desconocido u otro Todas las secuencias de restos de aminoácidos representadas en el presente documento por una fórmula tienen una orientación de izquierda a derecha en la dirección convencional de extremo amino terminal a extremo carboxilo terminal. Además, se define que la frase “resto de aminoácido” incluye los aminoácidos enumerados en la Tabla de Correspondencia (Tabla 1), aminoácidos modificados, no naturales y poco habituales. Además, un guion al comienzo o final de una secuencia de restos de aminoácidos indica un enlace peptídico con una secuencia adicional de uno o más restos de aminoácidos o con un grupo amino terminal tal como NH2 o con un grupo carboxilo terminal tal como COOH. En un péptido o una proteína, los expertos en la materia conocen sustituciones conservativas adecuadas de aminoácidos y en general pueden realizarse sin alterar una actividad biológica de una molécula resultante. Los expertos en la materia reconocen que, en general, las sustituciones de aminoácidos individuales en regiones no esenciales de un polipéptido no alteran sustancialmente la actividad biológica (véase, por ejemplo, Watson et al., Molecular Biology of the Gene, 4ª Edición, 1987, The Benjamin/Cummings Pub. co., p.224).

Dichas sustituciones pueden realizarse de acuerdo con las expuestas en la Tabla 2 a continuación: TABLA 2 Resto original Sustitución conservativa Ala (A) Gly; Ser Arg (R) Lys Asn (N) Gln; His Cys (C) Ser Gln (Q) Asn Glu (E) Asp Gly (G) Ala; Pro His (H) Asn; Gln Ile (I) Leu; Val Leu (L) Ile; Val Lys (K) Arg; Gln; Glu Met (M) Leu; Tyr; Ile Phe (F) Met; Leu; Tyr Ser (S) Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp; Phe Val (V) He; Leu Otras sustituciones también son permisibles y pueden determinarse de forma empírica o de acuerdo con otras sustituciones conservativas o no conservativas conocidas.

Como se usa en el presente documento, “aminoácidos de origen natural” se refiere a los 20 aminoácidos L que aparecen en polipéptidos. Como se usa en el presente documento, la expresión “aminoácido no natural” se refiere a un compuesto orgánico que tiene una estructura similar a un aminoácido natural pero se ha modificado estructuralmente para imitar la estructura y reactividad de un aminoácido natural. Los aminoácidos de origen no natural incluyen por lo tanto, por ejemplo, aminoácidos o análogos de aminoácidos distintos de los 20 aminoácidos de origen natural e incluyen, pero sin limitación, los D-isoestereómeros de aminoácidos. Los expertos en la materia conocen aminoácidos no naturales ejemplares, e incluyen, pero sin limitación, ácido 2-aminoadípico (Aad), ácido 3-aminoadípico (Baad), ácido β- alanina/β-amino propiónico (Bala), ácido 2-aminobutírico (Abu), ácido 4-aminobutírico/ácido piperidínico (4Abu), ácido 6-aminocaproico (Acp), ácido 2-aminoheptanoico (Ahe), ácido 2-aminoisobutírico (Aib), ácido 3- aminoisobutírico (Baib), ácido 2-aminopimélico (Apm), ácido 2,4-diaminobutírico (Dbu), desmosina (Des), ácido 2,2’- diaminopimélico (Dpm), ácido 2,3-diaminopropiónico (Dpr), N-etilglicina (EtGly), N-etilasparagina (EtAsn), hidroxilisina (Hyl), alo-hidroxilisina (Ahyl), 3-hidroxiprolina (3Hyp), 4-hidroxiprolina (4Hyp), isodesmosina (Ide), alo- isoleucina (Aile), N-metilglicina, sarcosina (MeGly), N-metilisoleucina (Melle), 6-N-metilisina (MeLys), N-metilvalina (MeVal), norvalina (Nva), norleucina (Nle) y ornitina (Orn). Como se usa en el presente documento, un “polipéptido nativo” o una molécula de “ácido nucleico nativo” es un polipéptido o molécula de ácido nucleico, respectivamente, que puede encontrarse en la naturaleza. Un polipéptido nativo o molécula de ácido nucleico puede ser la forma de tipo silvestre de un polipéptido o molécula de ácido nucleico. Un polipéptido o molécula de ácido nucleico o nativo puede ser la forma predominante del polipéptido, o cualquier variante alélica u otra natural del mismo. Los polipéptidos y moléculas de ácido nucleico variantes proporcionados en el presente documento pueden tener modificaciones en comparación con polipéptidos y moléculas de ácido nucleico nativos.

Como se usa en el presente documento, la forma de tipo silvestre de un polipéptido o molécula de ácido nucleico es una forma codificada por un gen o por una secuencia codificante codificada por el gen. Típicamente, una forma de tipo silvestre de un gen, o molécula codificada por el mismo, no contiene mutaciones u otras modificaciones que alteran la función o estructura. La expresión tipo silvestre también abarca formas con variación alélica como aparece entre y dentro de especies. Como se usa en el presente documento, una forma predominante de un polipéptido o molécula de ácido nucleico se refiere a una forma de la molécula que es la forma principal producida a partir de un gen. Una “forma predominante” varía entre fuentes. Por ejemplo, diferentes células o tipos tisulares pueden producir diferentes formas de polipéptidos, por ejemplo, mediante corte y empalme alternativo y/o mediante procesamiento proteico alternativo. En cada tipo celular tisular, un polipéptido diferente puede ser una “forma predominante”. Como se usa en el presente documento, una “variante alélica” o “variación alélica” se refiere a cualquiera de dos o más formas alternativas de un gen que ocupan el mismo locus cromosómico. La variación alélica surge de forma natural mediante mutación, y puede dar como resultado polimorfismo fenotípico dentro de poblaciones. Las mutaciones génicas pueden ser silenciosas (sin cambios en el polipéptido codificado) o pueden codificar polipéptidos que tienen secuencia de aminoácidos alterada. La expresión “variante alélica” también se usa en el presente documento para indicar una proteína codificada por una variante alélica de un gen. Típicamente la forma de referencia del gen codifica una forma de tipo silvestre y/o forma predominante de un polipéptido de una población o miembro de referencia individual de una especie. Típicamente, las variantes alélicas, que incluyen variantes entre y dentro de especies típicamente tienen al menos o aproximadamente 80 %, 85 %, 90 %, 95 % o mayor identidad de aminoácidos con una forma de tipo silvestre y/o predominante de la misma especie; el grado de identidad depende del gen y si la comparación es entre especies o dentro de especies. En general, las variantes alélicas dentro de especies tienen al menos o aproximadamente 80 %, 85 %, 90 % o 95 % de identidad o mayor con una forma de tipo silvestre y/o predominante, incluyendo 96 %, 97 %, 98 %, 99 % o mayor identidad con una forma de tipo silvestre y/o predominante de un polipéptido. La referencia a una variante alélica en el presente documento se refiere en general a variaciones en proteínas entre miembros de la misma especie. Como se usa en el presente documento, “alelo”, que se usa indistintamente en el presente documento con “variante alélica” se refiere a formas alternativas de un gen o partes del mismo. Los alelos ocupan el mismo locus o posición en cromosomas homólogos. Cuando un sujeto tiene dos alelos idénticos de un gen, se dice que el sujeto es homocigoto para ese gen o alelo. Cuando un sujeto tiene dos alelos diferentes de un gen, se dice que el sujeto es heterocigoto para el gen. Los alelos de un gen específico pueden diferir entre sí en un único nucleótido o varios nucleótidos, y pueden incluir sustituciones, deleciones e inserciones de nucleótidos. Un alelo de un gen también puede ser una forma de un gen que contiene una mutación. Como se usa en el presente documento, “variantes de especies” se refiere a variantes en polipéptidos entre diferentes especies, incluyendo diferentes especies de mamífero, tales como ratón y ser humano, y especies de microorganismos, tales como virus y bacterias.

Como se usa en el presente documento, un “dominio” polipeptídico es una parte de un polipéptido (una secuencia de tres o más, generalmente 5, 10 o más aminoácidos) que es estructuralmente y/o funcionalmente distinguible o definible. Es un ejemplo de un dominio polipeptídico una parte del polipéptido que puede formar una estructura plegada independientemente dentro de un polipéptido compuesto de uno o más motivos estructurales (por ejemplo combinaciones de hélices alfa y/o cadenas beta conectados por regiones de bucle) y/o que se reconoce por una actividad funcional particular, tal como actividad enzimática, dimerización o unión a antígeno. Un polipéptido puede tener uno o más, típicamente más de uno, dominios distintos. Por ejemplo, el polipéptido puede tener uno o más dominios estructurales y uno o más dominios funcionales. Un único dominio polipeptídico puede distinguirse basándose en la estructura y función. Un dominio puede abarcar una secuencia lineal contigua de aminoácidos.

Como alternativa, un dominio puede abarcar una pluralidad de partes de aminoácidos no contiguas, que son no contiguas a lo largo de la secuencia lineal de aminoácidos del polipéptido. Típicamente, un polipéptido contiene una pluralidad de dominios. Por ejemplo, cada cadena pesada y cada cadena ligera de una molécula de anticuerpo contiene una pluralidad de dominios de inmunoglobulina (Ig), cada uno de aproximadamente 110 aminoácidos de longitud.

Los expertos en la materia están familiarizados con dominios polipeptídicos y pueden identificarlos en virtud de la homología estructural y/o funcional con otros de dichos dominios. Para ejemplificación del presente documento, se proporcionan definiciones, pero se entiende que está dentro de la experiencia de la técnica reconocer dominios particulares por su nombre. Si es necesario, puede emplearse software apropiado para identificar dominios.

Como se usa en el presente documento, una región funcional de un polipéptido es una región del polipéptido que contiene al menos un dominio funcional (que transmite una función particular, tal como una capacidad para interaccionar con una biomolécula, por ejemplo, mediante unión a antígeno, unión a ADN, unión a ligando, o dimerización, o por actividad enzimática, por ejemplo, actividad quinasa o actividad proteolítica); son ejemplos de regiones funcionales de polipéptidos los dominios de anticuerpo, tales como VH, VL, CH, CL, y partes de los mismos, tales como CDR, incluyendo CDR1, CDR2 y CDR3, o partes de unión a antígeno, tales como sitios de combinación de anticuerpo. Como se usa en el presente documento, una región estructural de un polipéptido es una región del polipéptido que contiene al menos un dominio estructural.

Como se usa en el presente documento, una región de un polinucleótido es una parte del polinucleótido que contiene dos o más, típicamente al menos seis o más, típicamente diez o más, nucleótidos contiguos, por ejemplo, 2, 3, 4, 5, 6, 8, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 o más nucleótidos del polinucleótido, pero no necesariamente todos los nucleótidos que componen el polinucleótido. Como se usa en el presente documento, una “propiedad” de un polipéptido, tal como un anticuerpo, se refiere a cualquier propiedad mostrada por un polipéptido, incluyendo, pero sin limitación, especificidad de unión, configuración estructural o conformación, estabilidad proteica, resistencia a proteólisis, estabilidad conformacional, tolerancia térmica y tolerancia a condiciones de pH. Los cambios en las propiedades pueden alterar una “actividad” del polipéptido. Por ejemplo, un cambio en la especificidad de unión del polipéptido de anticuerpo puede alterar la capacidad de unión con un antígeno y/o diversas actividades de unión, tales como afinidad o avidez, o actividades in vivo del polipéptido.

Como se usa en el presente documento, una “actividad” o una “actividad funcional” de un polipéptido, tal como un anticuerpo, se refiere a cualquier actividad mostrada por el polipéptido. Dichas actividades pueden determinarse de forma empírica. Las actividades ejemplares incluyen, pero sin limitación, capacidad para interaccionar con una biomolécula, por ejemplo, mediante unión a antígeno, unión a ADN, unión a ligando o dimerización, actividad enzimática, por ejemplo, actividad quinasa o actividad proteolítica. Para un anticuerpo (incluyendo fragmentos de anticuerpo), las actividades incluyen, pero sin limitación, la capacidad para unirse específicamente con un antígeno particular, afinidad de unión a antígeno (por ejemplo afinidad alta o baja), avidez de unión a antígeno (por ejemplo, avidez alta o baja), velocidad de asociación, velocidad de disociación, funciones efectoras, tales como la capacidad para promover la neutralización o eliminación de antígenos, neutralización de virus y actividades in vivo, tales como la capacidad para prevenir la infección o invasión de un patógeno, o para promover la eliminación, o para penetrar en un tejido o fluido o célula particular en el cuerpo. La actividad puede evaluarse in vitro o in vivo usando ensayos reconocidos, tales como ELISA, citometría de flujo, resonancia de plasmón superficial o ensayos equivalentes para medir la velocidad de asociación o disociación, histología y microscopia de inmunohistoquímica e inmunofluorescencia, ensayos basados en células, citometría de flujo y ensayos de unión (por ejemplo, ensayos de selección). Por ejemplo, para un polipéptido de anticuerpo, las actividades pueden evaluarse midiendo afinidades de unión, avideces y/o coeficientes de unión (por ejemplo, para velocidades de asociación/disociación), y otras actividades in vitro o midiendo diversos efectos in vivo, tales como efectos inmunitarios, por ejemplo eliminación de antígenos, penetración o localización del anticuerpo en tejidos, protección de enfermedad, por ejemplo, infección, títulos de anticuerpos en suero u otro fluido, u otros ensayos que se conocen bien en la técnica. Los resultados de estos ensayos que indican que un polipéptido muestra una actividad pueden correlacionarse con la actividad del polipéptido in vivo, en el que la actividad in vivo puede denominarse actividad terapéutica, o actividad biológica. La actividad de un polipéptido modificado puede ser cualquier nivel de porcentaje de actividad del polipéptido no modificado, incluyendo pero sin limitación, 1 % de la actividad, 2 %, 4 %, 5 %, 10 %, 20 %, 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 100 %, 200 %, 300 %, 400 %, 500 %, o más de la actividad en comparación con el polipéptido no modificado. Se conocen bien en la técnica ensayos para determinar la funcionalidad o actividad de anticuerpos modificados (por ejemplo, variantes). Como se usa en el presente documento, “actividad terapéutica” se refiere a la actividad in vivo de un polipéptido terapéutico. En general, la actividad terapéutica es la actividad que se usa para tratar una enfermedad o afección. La actividad terapéutica de un polipéptido modificado puede ser cualquier nivel de porcentaje de actividad terapéutica del polipéptido no modificado, incluyendo pero sin limitación, 1 % de la actividad, 2 %, 3 %, 4 %, 5 %, 10 %, 20 %, 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 100 %, 200 %, 300 %, 400 %, 500 %, o más de la actividad terapéutica en comparación con el polipéptido no modificado. Como se usa en el presente documento, “muestra al menos una actividad” o “conserva al menos una actividad” se refiere a la actividad mostrada por un polipéptido modificado, tal como un polipéptido variante producido de acuerdo con los métodos proporcionados, tales como un anticuerpo modificado, por ejemplo, variante, u otro polipéptido terapéutico (por ejemplo un anticuerpo anti VSR modificado o fragmento de unión a antígeno del mismo), en comparación con el polipéptido diana o no modificado, que no contiene la modificación. Un polipéptido modificado, o variante, que conserva una actividad de un polipéptido diana puede mostrar actividad mejorada o mantener la actividad del polipéptido no modificado. En algunos casos, un polipéptido modificado, o variante, puede conservar una actividad que aumenta en comparación con una diana o polipéptido no modificado. En algunos casos, un polipéptido modificado, o variante, puede conservar una actividad que se reduce en comparación con un polipéptido no modificado o diana. La actividad de un polipéptido modificado, o variante, puede ser cualquier nivel de porcentaje de actividad del polipéptido no modificado o diana, incluyendo pero sin limitación, 1 % de la actividad, 2 %, 3 %, 4 %, 5 %, 10 %, 20 %, 30 %, 40 %, 50 %, 60 %, 70 %, 80 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 100 %, 200 %, 300 %, 400 %, 500 %, o más actividad en comparación con el polipéptido no modificado o diana. En otras realizaciones, el cambio de actividad es al menos aproximadamente 2 veces, 3 veces, 4 veces, 5 veces, 6 veces, 7 veces, 8 veces, 9 veces, 10 veces, 20 veces, 30 veces, 40 veces, 50 veces, 60 veces, 70 veces, 80 veces, 90 veces, 100 veces, 200 veces, 300 veces, 400 veces, 500 veces, 600 veces, 700 veces, 800 veces, 900 veces, 1000 veces, o más veces mayor que el polipéptido no modificado o diana. Los ensayos con respecto a retención de una actividad dependen de la actividad para retener. Dichos ensayos pueden realizarse in vitro o in vivo. La actividad puede medirse, por ejemplo, usando ensayos conocidos en la técnica y descritos en los ejemplos posteriores con respecto a actividades tales como pero sin limitación ELISA y ensayos de selección. Las actividades de un polipéptido modificado, o variante, en comparación con un polipéptido no modificado o diana también pueden evaluarse con respecto a una actividad biológica o terapéutica in vivo o resultado después de la administración del polipéptido. Como se usa en el presente documento, se pretende que el término “evaluar” incluya la determinación cuantitativa y cualitativa en el sentido de obtener un valor absoluto para la actividad de una proteasa, o un dominio de la misma, presente en la muestra, y también de obtener un índice, una relación, un porcentaje, una visualización u otro valor indicativo del nivel de la actividad. La evaluación puede ser directa o indirecta y no es necesario que la especie química de hecho detectada sea el producto de proteólisis en sí mismo sino que puede ser por ejemplo un derivado del mismo o alguna sustancia adicional. Por ejemplo, detección de un producto de escisión de una proteína del complemento, tal como por SDS-PAGE y tinción de proteínas con azul de Coomassie.

Como se usa en el presente documento, la expresión “ácido nucleico” se refiere a al menos dos nucleótidos o derivados de nucleótidos unidos, incluyendo un ácido desoxirribonucleico (ADN) y un ácido ribonucleico (ARN), unidos entre sí, típicamente por enlaces fosfodiéster. También se incluyen en la expresión “ácido nucleico” análogos de ácidos nucleicos tales como ácido nucleico peptídico (PNA), ADN de fosforotioato, y otros análogos y derivados tales o combinaciones de los mismos. Los ácidos nucleicos también incluyen derivados de ADN y ARN que contienen, por ejemplo, un análogo nucleotídico o un enlace “de cadena principal” distinto de un enlace fosfodiéster, por ejemplo, un enlace fosfotriéster, un enlace fosforamidato, un enlace fosforotioato, un enlace tioéster o un enlace peptídico (ácido nucleico peptídico). El término también incluye, como equivalentes, derivados, variantes y análogos de ARN o ADN realizados a partir de análogos de nucleótidos, ácidos nucleicos monocatenarios (con sentido o antisentido) y bicatenarios. Los desoxirribonucleótidos incluyen desoxiadenosina, desoxicitidina, desoxiguanosina y desoxitimidina. Para ARN, la base de uracilo es uridina. Los ácidos nucleicos pueden contener análogos nucleotídicos, incluyendo, por ejemplo, nucleótidos de masa modificada, que permiten la diferenciación de masas de moléculas de ácido nucleico; nucleótidos que contienen un marcador detectable tal como un marcador fluorescente, radiactivo, luminiscente o quimioluminiscente, que permiten la detección de una molécula de ácido nucleico; o nucleótidos que contienen un grupo reactivo tal como biotina o un grupo tiol, que facilita la inmovilización de una molécula de ácido nucleico en un soporte sólido. Un ácido nucleico también puede contener uno o más enlaces de cadena principal que pueden escindirse selectivamente, por ejemplo, pueden escindirse química, enzimática o fotolíticamente. Por ejemplo, un ácido nucleico puede incluir uno o más desoxirribonucleótidos, seguidos de uno o más ribonucleótidos, que pueden seguirse de uno o más desoxirribonucleótidos, siendo dicha secuencia escindible en la secuencia ribonucleotídica por hidrólisis de bases. Un ácido nucleico también puede contener uno o más enlaces que son relativamente resistentes a la escisión, por ejemplo, un cebador oligonucleotídico quimérico, que puede incluir nucleótidos unidos por enlaces de ácido nucleico peptídico y al menos un nucleótido en el extremo 3’, que se une por un enlace fosfodiéster u otro enlace adecuado, y es capaz de extenderse por una polimerasa. Pueden prepararse secuencias de ácido nucleico peptídico usando métodos bien conocidos (véase, por ejemplo, Weiler et al. (1997) Nucleic Acids Res. 25: 2792-2799). Como se usa en el presente documento, las expresiones “polinucleótido” y “molécula de ácido nucleico” se refieren a un oligómero o polímero que contiene al menos dos nucleótido o derivados de nucleótidos unidos, incluyendo un ácido desoxirribonucleico (ADN) y un ácido ribonucleico (ARN), unidos entre sí, típicamente por enlaces fosfodiéster.

Los polinucleótidos también incluyen derivados de ADN y ARN que contienen, por ejemplo, un análogo nucleotídico o un enlace “de cadena principal” distinto de un enlace fosfodiéster, por ejemplo, un enlace fosfotriéster, un enlace fosforamidato, un enlace fosforotioato, un enlace tioéster, o un enlace peptídico (ácido nucleico peptídico). Los polinucleótidos (moléculas de ácido nucleico) incluyen polinucleótidos monocatenarios y/o bicatenarios, tales como ácido desoxirribonucleico (ADN) y ácido ribonucleico (ARN) así como análogos o derivados de ARN o ADN. El término también incluye, como equivalentes, derivados, variantes y análogos de ARN o ADN realizados a partir de análogos de nucleótidos, polinucleótidos monocatenarios (con sentido o antisentido) y bicatenarios. Los desoxirribonucleótidos incluyen desoxiadenosina, desoxicitidina, desoxiguanosina y desoxitimidina. Para ARN, la base de uracilo es uridina. Los polinucleótidos pueden contener análogos de nucleótidos, incluyendo, por ejemplo, nucleótidos de masa modificada, que permiten la diferenciación de masas de polinucleótidos; nucleótidos que contienen un marcador detectable tal como un marcador fluorescente, radiactivo, luminiscente o quimioluminiscente, que permite la detección de un polinucleótido; o nucleótidos que contienen un grupo reactivo tal como biotina o un grupo tiol, que facilita la inmovilización de un polinucleótido en un soporte sólido. Un polinucleótido también puede contener uno o más enlaces de cadena principal que pueden escindirse de forma selectiva, por ejemplo, pueden escindirse química, enzimática o fotolíticamente. Por ejemplo, un polinucleótido puede incluir uno o más desoxirribonucleótidos, seguidos de uno o más ribonucleótidos, que pueden seguirse de uno o más desoxirribonucleótidos, siendo dicha secuencia escindible en la secuencia ribonucleotídica por hidrólisis de bases. Un polinucleótido también puede contener uno o más enlaces que son relativamente resistentes a la escisión, por ejemplo, un cebador oligonucleotídico quimérico, que puede incluir nucleótidos unidos por enlaces de ácido nucleico peptídico y al menos un nucleótido en el extremo 3’, que se une por un enlace fosfodiéster u otro enlace adecuado, y es capaz de extenderse por una polimerasa. Pueden prepararse secuencias de ácido nucleico peptídico usando métodos bien conocidos (véase, por ejemplo, Weiler et al. (1997) Nucleic Acids Res. 25: 2792-2799). Son ejemplos de las moléculas de ácido nucleico (polinucleótidos) proporcionadas en el presente documento los oligonucleótidos, incluyendo oligonucleótidos sintéticos, dobles cadenas oligonucleotídicas, cebadores, incluyendo cebadores de relleno, y casetes de doble cadena de oligonucleótidos.

Como se usa en el presente documento, una “construcción de ADN” es una molécula de ADN lineal o circular, mono o bicatenaria, que contiene segmentos de ADN combinados y yuxtapuestos de una manera no encontrada en la naturaleza. Las construcciones de ADN existen como resultado de la manipulación humana, e incluyen clones y otras copias de moléculas manipuladas.

Como se usa en el presente documento, un “segmento de ADN” es una parte de una molécula de ADN mayor que tiene atributos específicos. Por ejemplo, un segmento de ADN que codifica un polipéptido específico es una parte de una molécula de ADN más larga, tal como un plásmido o fragmento plasmídico, que, cuando se leen de la dirección 5’ a 3’, codifica la secuencia de aminoácidos del polipéptido específico.

Como se usa en el presente documento, un polinucleótido de cadena positiva se refiere a la “cadena con sentido” o una doble cadena polinucleotídica, que es complementaria de la cadena negativa o la cadena “antisentido”. En el caso de polinucleótidos que codifican genes, la cadena con sentido es la cadena que es idéntica a la cadena de ARNm que se traduce en un polipéptido, mientras que la cadena antisentido es complementaria de esa cadena. Las cadenas positivas y negativas de una doble cadena son complementarias entre sí.

Como se usa en el presente documento, un elemento genético se refiere a un gen, o cualquier región del mismo, que codifica un polipéptido o proteína o región del mismo. En algunos ejemplos, un elemento genético codifica una proteína de fusión.

Como se usa en el presente documento, la región reguladora de una molécula de ácido nucleico significa una secuencia de nucleótidos de acción en cis que influye en la expresión, positiva y negativamente, de un gen unido operativamente. Las regiones reguladoras incluyen secuencias de nucleótidos que confieren expresión inducible (es decir, requieren una sustancia o estímulo para transcripción aumentada) de un gen. Cuando un inductor está presente o a concentración aumentada, puede aumentarse la expresión génica. Las regiones reguladoras también incluyen secuencias que confieren la represión de la expresión génica (es decir, una sustancia o estímulo reducen la transcripción). Cuando un represor está presente o a concentración aumentada la expresión génica puede reducirse. Se sabe que las regiones reguladoras influyen en, modulan o controlan muchas actividades biológicas in vivo incluyendo proliferación celular, crecimiento y muerte celular, diferenciación celular y modulación inmunitaria. Las regiones reguladoras se unen típicamente con una o más proteínas de acción en trans, que dan como resultado la transcripción aumentada o reducida del gen. Son ejemplos particulares de regiones reguladoras génicas promotores y potenciadores. Los promotores son secuencias localizadas en torno al sitio de inicio de la transcripción o traducción, típicamente situados 5’ del sitio de inicio de la traducción. Los promotores se localizan habitualmente a una distancia de 1 Kb del sitio de inicio de la traducción, pero pueden localizarse más lejos, por ejemplo, 2 Kb, 3 Kb, 4 Kb, 5 Kb o más, hasta e incluyendo 10 Kb. Se sabe que los potenciadores influyen en la expresión génica cuando se sitúan 5’ o 3’ del gen, o cuando se sitúan en o una parte de un exón o un intrón. Los potenciadores también pueden actuar a una distancia significativa del gen, por ejemplo, una distancia de aproximadamente 3 Kb, 5 Kb, 7 Kb, 10 Kb, 15 Kb o más.

Las regiones reguladoras también incluyen, además de regiones promotoras, secuencias que facilitan la traducción, señales de corte y empalme para intrones, mantenimiento de la fase de lectura correcta del gen para permitir la traducción en fase del ARNm y codones de terminación, secuencias líder y secuencias de compañeros de fusión, elementos de sitios de unión a ribosoma internos (IRES) para la creación de mensajes multigénicos, o policistrónicos, señales de poliadenilación para proporcionar poliadenilación apropiada del transcrito de un gen de interés y codones de terminación, y pueden incluirse opcionalmente en un vector de expresión. Como se usa en el presente documento, “unido operativamente” en referencia a secuencias de ácido nucleico, regiones, elementos o dominios significa que las regiones de ácido nucleico están funcionalmente relacionadas entre sí. Por ejemplo, el ácido nucleico que codifica un péptido líder puede unirse operativamente con ácido nucleico que codifica un polipéptido, por lo que los ácidos nucleicos pueden transcribirse y traducirse para expresar una proteína de fusión funcional, en el que el péptido líder efectúa secreción del polipéptido de fusión. En algunos casos, el ácido nucleico que codifica un primer polipéptido (por ejemplo, un péptido líder) se une operativamente con ácido nucleico que codifica un segundo polipéptido y los ácidos nucleicos se transcriben como un único transcrito de ARNm, pero la traducción del transcrito de ARNm puede dar como resultado que se expresen uno de dos polipéptidos. Por ejemplo, un codón de terminación ámbar puede localizarse entre el ácido nucleico que codifica el primer polipéptido y el ácido nucleico que codifica el segundo polipéptido, de modo que, cuando se introduce en una célula supresora de ámbar parcial, el transcrito de ARNm individual resultante puede traducirse para producir una proteína de fusión que contiene los primer y segundo polipéptidos, o puede traducirse para producir solamente el primer polipéptido. En otro ejemplo, un promotor puede unirse operativamente con un ácido nucleico que codifica un polipéptido, de modo que el promotor regula o media en la transcripción del ácido nucleico.

Como se usa en el presente documento, “sintético” en referencia a, por ejemplo, una molécula de ácido nucleico sintética o un gen sintético o un péptido sintético se refiere a una molécula de ácido nucleico o molécula polipeptídica que se produce por métodos recombinantes y/o por métodos de síntesis química.

Como se usa en el presente documento, la producción por medios recombinantes usando métodos de ADN recombinante significa el uso de métodos bien conocidos de biología molecular para expresar proteínas codificadas por ADN clonado. Como se usa en el presente documento, “expresión” se refiere al proceso por el que se producen polipéptidos mediante transcripción y traducción de polinucleótidos. El nivel de expresión de un polipéptido puede evaluarse usando cualquier método conocido en la técnica, incluyendo, por ejemplo, métodos para determinar la cantidad del polipéptido producido a partir de la célula hospedadora. Dichos métodos pueden incluir, pero sin limitación, la cuantificación del polipéptido en el lisado celular por ELISA, tinción con azul de Coomassie después de electroforesis en gel, ensayo de proteína de Lowry y ensayo de proteína de Bradford.

Como se usa en el presente documento, una “célula hospedadora” es una célula que se usa para recibir, mantener, reproducir y amplificar un vector. Una célula hospedadora también puede usarse para expresar el polipéptido codificado por el vector. El ácido nucleico contenido en el vector se replica cuando la célula hospedadora se divide, amplificando de este modo los ácidos nucleicos. En un ejemplo, la célula hospedadora es un paquete genético, que puede inducirse que exprese el polipéptido variante en su superficie. En otro ejemplo, la célula hospedadora se infecta con el paquete genético. Por ejemplo, las células hospedadoras pueden ser células hospedadoras compatibles con presentación de fagos, que pueden transformarse con vectores de fagos o fagémidos y acomodar el empaquetamiento de fagos que expresan proteínas de fusión que contienen los polipéptidos variantes.

Como se usa en el presente documento, un “vector” es un ácido nucleico replicable del que pueden expresarse una o más proteínas heterólogas cuando el vector se transforma en una célula hospedadora apropiada. La referencia a un vector incluye los vectores en los que puede introducirse un ácido nucleico que codifica un polipéptido o fragmento del mismo, típicamente por digestión de restricción y ligamiento. La referencia a un vector también incluye los vectores que contienen ácido nucleico que codifica un polipéptido. El vector se usa para introducir el ácido nucleico que codifica el polipéptido en la célula hospedadora para amplificación del ácido nucleico o para expresión/presentación del polipéptido codificado por el ácido nucleico. Los vectores permanecen típicamente episómicos, pero pueden diseñarse para efectuar la integración de un gen o parte del mismo en un cromosoma del genoma. También se contemplan vectores que son cromosomas artificiales, tales como cromosomas artificiales de levadura y cromosomas artificiales de mamífero. Se conoce bien por los expertos en la materia la selección y el uso de dichos vehículos. Como se usa en el presente documento, un vector también incluye “vectores de virus” o “vectores virales”. Los vectores virales son virus modificados técnicamente que se unen operativamente con genes exógenos para transferir (como vehículos o lanzaderas) los genes exógenos a células.

Como se usa en el presente documento, un “vector de expresión” incluye vectores capaces de expresar ADN que está unido operativamente con secuencias reguladoras, tales como regiones promotoras, que son capaces de efectuar la expresión de dichos fragmentos de ADN. Dichos segmentos adicionales pueden incluir secuencias promotoras y terminadoras, y opcionalmente pueden incluir uno o más orígenes de replicación, uno o más marcadores seleccionables, un potenciador, una señal de poliadenilación. Los vectores de expresión derivan en general de ADN plasmídico o viral, o pueden contener elementos de ambos. Por lo tanto, un vector de expresión se refiere a una construcción de ADN o ARN recombinante, tal como un plásmido, un fago, virus recombinante u otro vector que, tras la introducción en una célula hospedadora apropiada, da como resultado la expresión del ADN clonado. Los expertos en la materia conocen bien vectores de expresión apropiados e incluyen los que son replicables en células eucariotas y/o células procariotas y los que permanecen episómicos o los que se integran en el genoma de la célula hospedadora. Como se usa en el presente documento, los términos “oligonucleótido” y “oligo” se usan de forma sinónima. Los oligonucleótidos son polinucleótidos que contienen un número limitado de nucleótidos de longitud. Los expertos en la materia reconocen que los oligonucleótidos generalmente son de menos de o de aproximadamente doscientos cincuenta, típicamente de menos de o aproximadamente doscientos, típicamente menos de o aproximadamente cien nucleótidos de longitud. Típicamente, los oligonucleótidos proporcionados en el presente documento son oligonucleótidos sintéticos. Los oligonucleótidos sintéticos contienen menos de o aproximadamente 250 o 200 nucleótidos de longitud, por ejemplo, menos de aproximadamente 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 o 200 nucleótidos de longitud. Típicamente, los oligonucleótidos son oligonucleótidos monocatenarios. La terminación “mero” puede usarse para indicar la longitud de un oligonucleótido. Por ejemplo “100-mero” puede usarse para referirse a un oligonucleótido que contiene 100 nucleótidos de longitud. Son ejemplos de los oligonucleótidos sintéticos proporcionados en el presente documento oligonucleótidos de cadena positiva y negativa, oligonucleótidos aleatorios, oligonucleótidos de secuencia de referencia, oligonucleótidos molde y cebadores de relleno.

Como se usa en el presente documento, los oligonucleótidos sintéticos son oligonucleótidos producidos por síntesis química. Se conocen bien métodos de síntesis química de oligonucleótidos. Puede usarse cualquiera de los métodos de síntesis conocidos para producir los oligonucleótidos diseñados y usados en los métodos proporcionados. Por ejemplo, se preparan oligonucleótidos sintéticos típicamente uniendo químicamente monómeros nucleotídicos individuales o trímeros nucleotídicos que contienen grupos protectores. Típicamente, se añaden fosforamiditas, nucleótidos individuales que contienen grupos protectores uno a uno. La síntesis comienza típicamente con el extremo 3’ del oligonucleótido. La fosforamidita más 3’ está unida a un soporte sólido y la síntesis sucede añadiendo cada fosforamidita al extremo 5’ del último. Después de cada edición, el grupo protector se retira del grupo fosfato 5’ en la base más recientemente añadida, permitiendo la adición de otra fosforamidita. Los sintetizadores automáticos generalmente pueden sintetizar oligonucleótidos de hasta aproximadamente 150 a aproximadamente 200 nucleótidos de longitud. Típicamente, los oligonucleótidos diseñados y usados en los métodos proporcionados se sintetizan usando química de cianoetilo convencional de monómeros de fosforamidita. Los oligonucleótidos sintéticos producidos por este método convencional pueden obtenerse de Integrated DNA Technologies (IDT) (Coralville, IA) o TriLink Biotechnologies (San Diego, CA).

Como se usa en el presente documento, “cebador” se refiere a una molécula de ácido nucleico (más típicamente, a un grupo de dichas moléculas que comparten identidad de secuencia) que puede actuar como un punto de inicio de síntesis de ácido nucleico dirigida por molde en condiciones apropiadas (por ejemplo, en presencia de cuatro nucleósido trifosfatos diferentes y un agente de polimerización, tal como ADN polimerasa, ARN polimerasa o transcriptasa inversa) en un tampón apropiado y a una temperatura adecuada. Se apreciará que ciertas moléculas de ácido nucleico pueden actuar como una “sonda” y como un “cebador”. Un cebador, sin embargo, tiene un grupo hidroxilo 3’ para extensión. Un cebador puede usarse en una diversidad de métodos, incluyendo, por ejemplo, reacción en cadena de la polimerasa (PCR), PCR de transcriptasa inversa (RT), PCR de ARN, LCR, PCR múltiple, PCR en franjas, PCR de captura, PCR de expresión, RACE 3’ y 5’, PCR in situ, PCR mediada por ligamiento y otros protocolos de amplificación. Como se usa en el presente documento, “par de cebadores” se refiere a un conjunto de cebadores (por ejemplo dos grupos de cebadores) que incluye un cebador 5’ (cadena arriba) que hibrida específicamente con el extremo 5’ de una secuencia para amplificar (por ejemplo por PCR) y un cebador 3’ (cadena abajo) que hibrida específicamente con el complemento del extremo 3’ de la secuencia para amplificar. Debido a que “cebador” puede referirse a un grupo de moléculas de ácido nucleico idénticas, un par de cebadores típicamente es un par de dos grupos de cebadores. Como se usa en el presente documento, “cebador individual” y “grupo de cebadores individuales” se refieren de forma sinónima a un grupo de cebadores, en los que cada cebador en el grupo contiene identidad de secuencia con los otros miembros de cebadores, por ejemplo, un grupo de cebadores en los que los miembros comparten al menos o aproximadamente 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 o 100 % de identidad. Los cebadores en el grupo de cebadores individuales (que comparten todos identidad de secuencia) actúan como cebadores 5’ (cadena arriba) (que hibridan específicamente con el extremo 3’ de una secuencia para amplificar (por ejemplo por PCR)) y como cebadores 3’ (cadena abajo) (que hibridan específicamente con el complemento del extremo 3’ de la secuencia para amplificar). Por lo tanto, el cebador individual puede usarse, sin otros cebadores, para iniciar la síntesis de cadenas complementarias y amplificar un ácido nucleico en una reacción de amplificación de polimerasa. Como se usa en el presente documento, la complementariedad, con respecto a dos nucleótidos, se refiere a la capacidad de los dos nucleótidos para formar pares de bases entre sí tras la hibridación de dos moléculas de ácido nucleico. Dos moléculas de ácido nucleico que comparten complementariedad se denominan moléculas de ácido nucleico complementarias; son ejemplos de moléculas de ácido nucleico complementarias las cadenas positiva y negativa en una doble cadena polinucleotídica. Como se usa en el presente documento, cuando una molécula de ácido nucleico o región de la misma es complementaria de otra molécula de ácido nucleico o región de la misma, las dos moléculas o regiones hibridan específicamente entre sí. Dos moléculas de ácido nucleico complementarias pueden describirse con respecto al porcentaje de complementariedad. Por ejemplo, se dice que dos moléculas de ácido nucleico, cada una de 100 nucleótidos de longitud, que hibridan específicamente entre sí pero contienen 5 desapareamientos entre sí, son complementarias al 95 %. Para que dos moléculas de ácido nucleico hibriden con 100 % de complementariedad, no es necesario que la complementariedad exista a lo largo de la longitud completa de ambas moléculas. Por ejemplo, una molécula de ácido nucleico que contiene 20 nucleótidos contiguos de longitud puede hibridar específicamente con una parte de 20 nucleótidos contiguos de una molécula de ácido nucleico que contiene 500 nucleótidos contiguos de longitud. Si no aparece ningún desapareamiento a lo largo de esta parte de 20 nucleótidos, la molécula de 20 nucleótidos se hibrida con 100 % de complementariedad. Típicamente, las moléculas de ácido nucleico complementarias se alinean con menos de 25 %, 20 %, 15 %, 10 %, 5 % 4 %, 3 %, 2 % o 1 % de desapareamientos entre los nucleótidos complementarios (en otras palabras, al menos o aproximadamente 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 % o 99 % de complementariedad). En otro ejemplo, las moléculas de ácido nucleico complementarias contienen exactamente o aproximadamente o al menos exactamente o aproximadamente 50 %, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 % o 99 % de complementariedad. En un ejemplo, las moléculas de ácido nucleico complementarias contienen menos de 5, 4, 3, 2 o 1 nucleótidos desapareados. En un ejemplo, los nucleótidos complementarios son 100 % complementarios. Si es necesario, se especificará el porcentaje de complementariedad. Típicamente las dos moléculas se seleccionan de modo que hibriden específicamente en condiciones de alta rigurosidad. Como se usa en el presente documento, una cadena complementaria de una molécula de ácido nucleico se refiere a una secuencia de nucleótidos, por ejemplo, una molécula de ácido nucleico, que hibrida específicamente con la molécula, tal como la cadena opuesta a la molécula de ácido nucleico en una doble cadena polinucleotídica. Por ejemplo, en una doble cadena polinucleotídica, la cadena complementaria de un oligonucleótido de cadena positiva es un oligonucleótido de cadena negativa que hibrida específicamente con el oligonucleótido de cadena positiva en una doble cadena. En un ejemplo de los métodos proporcionados, se usan reacciones de polimerasa para sintetizar cadenas complementarias de polinucleótidos para formar dobles cadenas, que comienzan típicamente hibridando un cebador oligonucleotídico con el polinucleótido. Como se usa en el presente documento, “hibrida específicamente” se refiere a hibridación, mediante formación de pares de bases complementarias, de una molécula de ácido nucleico (por ejemplo, un oligonucleótido o polinucleótido) con otra molécula de ácido nucleico. Los expertos en la materia están familiarizados con parámetros in vitro e in vivo que afectan a la hibridación específica, tales como longitud y composición de la molécula particular. Los parámetros particularmente relevantes para la hibridación in vitro incluyen además temperatura de hibridación y lavado, composición del tampón y concentración salina. No es necesario que dos moléculas de ácido nucleico muestren 100 % de complementariedad para que hibriden específicamente entre sí. Por ejemplo, dos moléculas de ácido nucleico complementarias que comparten complementariedad de secuencia, tal como exactamente o aproximadamente o al menos exactamente o aproximadamente 99 %, 98 %, 97 %, 96 %, 95 %, 90 %, 85 %, 80 %, 75 %, 70 %, 65 %, 60 %, 55 % o 50 % de complementariedad, pueden hibridar específicamente entre sí. Los parámetros, por ejemplo, componentes de tampón, tiempo y temperatura, usados en los métodos de hibridación in vitro proporcionados en el presente documento, pueden ajustarse en su rigurosidad para variar el porcentaje de complementariedad requerido para hibridación específica de dos moléculas de ácido nucleico. El experto en la materia puede ajustar fácilmente estos parámetros para conseguir una hibridación específica de una molécula de ácido nucleico con una molécula de ácido nucleico diana apropiada para una aplicación particular. Como se usa en el presente documento, “secuencia primaria” se refiere a la secuencia de restos de aminoácidos en un polipéptido o la secuencia de nucleótidos en una molécula de ácido nucleico. Como se usa en el presente documento, la “similitud” entre dos proteínas o ácidos nucleicos se refiere a la relación entre la secuencia de aminoácidos de las proteínas o las secuencias de nucleótidos de los ácidos nucleicos. La similitud puede basarse en el grado de identidad de las secuencias de restos y los restos contenidos en las mismas.

Los expertos en la materia conocen métodos para evaluar el grado de similitud entre proteínas o ácidos nucleicos. Por ejemplo, en un método para evaluar la similitud de secuencia, se alinean dos secuencias de aminoácidos o nucleótidos de manera que produzcan un nivel máximo de identidad entre las secuencias. La “identidad” se refiere al grado en que las secuencias de aminoácidos o nucleótidos son invariantes. El alineamiento de secuencias de aminoácidos, y en algún grado secuencias de nucleótidos, también tienen en cuenta diferencias conservativas y/o sustituciones frecuentes en aminoácidos (o nucleótidos). Las diferentes conservativas son las que conservan las propiedades fisicoquímicas de los restos implicados. Los alineamientos pueden ser globales (alineamiento de las secuencias comparadas sobre la longitud completa de las secuencias e incluyendo todos los restos) o locales (el alineamiento de una parte de las secuencias que incluye solamente la región o las regiones más similares).

Como se usa en el presente documento, cuando un polipéptido o molécula de ácido nucleico o región del mismo contiene o tiene “identidad” u “homología” con otro polipéptido o molécula o región de ácido nucleico, las dos moléculas y/o regiones comparten más de o igual a exactamente o aproximadamente 40 % de identidad de secuencia, y típicamente más de o igual a exactamente o aproximadamente 50 % de identidad de secuencia, tal como al menos o aproximadamente 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 % o 100 % de identidad de secuencia; el porcentaje preciso de identidad puede especificarse si es necesario. Una molécula de ácido nucleico, o región de la misma, que es idéntica u homóloga de una segunda molécula o región de ácido nucleico puede hibridar específicamente con una molécula o región de ácido nucleico que es 100 % complementaria de la segunda molécula o región de ácido nucleico. La identidad puede compararse como alternativa entre dos secuencias de nucleótidos o aminoácidos teóricas o entre una molécula de ácido nucleico o polipéptido y una secuencia teórica. La “identidad” de secuencia, en sí misma, tiene un significado reconocido en la técnica y el porcentaje de identidad de secuencia entre dos moléculas o regiones de ácido nucleico o polipéptidos pueden calcularse usando técnicas publicadas. La identidad de secuencia puede medirse a lo largo de la longitud completa de un polinucleótido o polipéptido o a lo largo de una región de la molécula (véase, por ejemplo: Computational MolecularBiology, Lesk, A. M., ed., Oxford University Press, Nueva York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, Nueva York, 1993; Computer Analysis of Sequence Data, Parte I, Griffin, A. M., y Griffin, H. G., eds., Humana Press, Nueva Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; y Sequence Analysis Primer, Gribskov, M. y Devereux, J., eds., M Stockton Press, Nueva York, 1991). Aunque existen varios métodos para medir la identidad entre dos polinucleótidos o polipéptidos, el término “identidad” se conoce bien por los expertos en la materia (Carrillo, H. y Lipman, D., SIAM J Applied Math 48: 1073 (1988)).

La identidad de secuencia comparada a lo largo de la longitud completa de dos polinucleótidos o polipéptidos se refiere al porcentaje de restos de nucleótidos o aminoácidos idénticos a lo largo de la longitud completa de la molécula. Por ejemplo, si un polipéptido A tiene 100 aminoácidos y el polipéptido B tiene 95 aminoácidos, que son idénticos a los aminoácidos 1-95 del polipéptido A, entonces el polipéptido B tiene 95 % de identidad cuando se compara la identidad de secuencia a lo largo de la longitud completa de un polipéptido A en comparación con la longitud completa del polipéptido B. Como alternativa, la identidad de secuencia entre el polipéptido A y el polipéptido B puede compararse a lo largo de una región, tal como una región análoga de 20 aminoácidos, de cada polipéptido. En este caso, si el polipéptido A y B tienen 20 aminoácidos idénticos a lo largo de esta región, la identidad de secuencia para las regiones es del 100 %. Como alternativa la identidad de secuencia puede compararse a lo largo de la longitud de una molécula, en comparación con una región de otra molécula. Como alternativa, la identidad de secuencia entre el polipéptido A y el polipéptido B pueden compararse a lo largo del polipéptido de la misma longitud pero con reemplazos de aminoácidos, tales como reemplazos de aminoácidos conservativos o reemplazos de aminoácidos no conservativos. Como se analiza posteriormente, y se conoce por los expertos en la materia, los expertos en la materia conocen diversos programas y métodos para evaluar la identidad. Pueden determinarse sin software fácilmente altos niveles de identidad, tales como 90 % o 95 % de identidad. Si dos moléculas de ácido nucleico cualesquiera tienen secuencias de nucleótidos que son al menos o aproximadamente 60 %, 70 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 % o 99 % “idénticas” puede determinarse usando algoritmos informáticos conocidos tales como el programa “FASTA”, usando por ejemplo los parámetros por defecto como en Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85: 2444 (otros programas incluyen el paquete de programas GCG (Devereux, J. et al. (1984) Nucleic Acids Research 12(I): 387), BLASTP, BLASTN, FASTA (Altschul, S. F. et al. (1990) J. Molec. Biol. 215: 403; guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, y Carrillo et al. (1988) SIAM J Applied Math 48: 1073). Por ejemplo, la función BLAST de la base de datos del Centro Nacional para la Información Biotecnológica puede usarse para determinar la identidad. Otros programas disponibles en el mercado o públicamente incluyen programa DNAStar “MegAlign” (Madison, WI) y el programa “Gap” del Grupo de Informática Genética de la Universidad de Wisconsin (UWG) (Madison WI)). El porcentaje de homología o identidad de proteínas y/o moléculas de ácido nucleico pueden determinarse, por ejemplo, comparando información de secuencia usando un programa informático GAP (por ejemplo, Needleman et

al. (1970) J. Mol. Biol. 48: 443, revisado en Smith y Waterman ((1981) Adv. Appl. Math. 2: 482). Brevemente, el programa GAP define la similitud como el número de símbolos alineados (es decir, nucleótidos o aminoácidos), que son similares, dividido por el número total de símbolos en la más corta de las dos secuencias. Los parámetros por defecto para el programa GAP pueden incluir: (1) una matriz de comparación unitaria (que contiene un valor de 1 para identidades y 0 para no identidades) y la matriz de comparación ponderada de Gribskov et al. (1986) Nucl.

Acids Res. 14: 6745, como se describe en Schwartz y Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979); (2) una penalización de 3,0 para cada hueco y una penalización adicional de 0,10 para cada símbolo en cada hueco; y (3) sin penalización para huecos finales.

En general, para la determinación del porcentaje de identidad de secuencia, las secuencias se alinean de modo que se obtenga la coincidencia de mayor orden (véase, por ejemplo: Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, Nueva York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, Nueva York, 1993; Computer Analysis of Sequence Data, Parte 1, Griffin, A. M., y Griffin, H. G., eds., Humana Press, Nueva Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; y Sequence Analysis Primer, Gribskov, M. y Devereux, J., eds., M Stockton Press, Nueva York, 1991; Carrillo et al. (1988) SIAM J Applied Math 48: 1073). Para identidad de secuencia, el número de aminoácidos conservados se determina por programas de algoritmos de alineamiento convencionales, y pueden usarse con penalizaciones de hueco por defecto establecidas por cada proveedor. Las moléculas de ácido nucleico sustancialmente homólogas hibridan específicamente típicamente a rigurosidad moderada o a alta rigurosidad a lo largo de la longitud completa del ácido nucleico de interés. También se contemplan moléculas de ácido nucleico que contienen codones degradados en lugar de codones en la molécula de ácido nucleico de hibridación. Por lo tanto, el término “identidad”, cuando se asocia con un número particular, representa una comparación entre las secuencias de un primer y un segundo polipéptido o polinucleótido o regiones de los mismos y/o entre secuencias de nucleótidos o aminoácidos teóricas. Como se usa en el presente documento, la expresión al menos “90 % idéntico a” se refiere a porcentajes de identidad del 90 al 99,99 en relación con la primera secuencia de ácido nucleico o aminoácidos del polipéptido. La identidad a un nivel del 90 % o más es indicativa del hecho de que, suponiendo para fines de ejemplificación, que se comparan una longitud de primer y segundo polipéptidos de 100 aminoácidos, no más del 10 % (es decir, 10 de cada 100) de los aminoácidos en el primer polipéptido difieren de los del segundo polipéptido. Pueden realizarse comparaciones similares entre los primer y segundo polinucleótidos. Dichas diferencias entre las primera y segunda secuencias pueden representarse como mutaciones puntuales distribuidas aleatoriamente a lo largo de la longitud completa de un polipéptido o pueden agruparse en una o más localizaciones de diversa longitud hasta el máximo permisible, por ejemplo una diferencia de 10/100 aminoácidos (aproximadamente 90 % de identidad). Las diferencias se definen como sustituciones, inserciones, adiciones o deleciones de restos de nucleótidos o aminoácidos. Al nivel de homologías o identidades por encima de aproximadamente el 85-90 %, el resultado es independiente del programa y conjunto de parámetros de hueco; dichos altos niveles de identidad pueden evaluarse fácilmente, con frecuencia por alineamiento manual sin basarse en el software. Como se usa en el presente documento, el alineamiento de una secuencia se refiere al uso de homología para alinear dos o más secuencias de nucleótidos o aminoácidos. Típicamente, se alinean dos o más secuencias que se relacionan en 50 % o más identidad. Un conjunto alineado de secuencias se refiere a dos o más secuencias que se alinean en posiciones correspondientes y puede incluir alineamiento de secuencias derivadas de ARN, tales como EST y otros ADNc, alineados con secuencia de ADN genómica.

Los polipéptidos o moléculas de ácido nucleico relacionados o variantes pueden alinearse por cualquier método conocido por los expertos en la materia. Dichos métodos típicamente maximizan las coincidencias, e incluyen métodos, tales como el uso de alineamientos manuales y usando los numerosos programas de alineamiento disponibles (por ejemplo, BLASTP) y otros conocidos por los expertos en la materia. Alineando las secuencias de polipéptidos o ácidos nucleicos, un experto en la materia puede identificar partes o posiciones análogas, usando restos de aminoácidos conservados e idénticos como guías. Además, un experto en la materia puede emplear también restos de aminoácidos o nucleótidos conservados como guías para encontrar restos de aminoácidos o nucleótidos correspondientes entre y dentro de secuencias humanas y no humanas. Las posiciones correspondientes también pueden basarse en alineamientos estructurales, por ejemplo usando alineamientos simulados por ordenador de la estructura proteica, En otros casos, pueden identificarse regiones correspondientes.

Un experto en la materia también puede emplear restos de aminoácidos conservados como guías para encontrar restos de aminoácidos correspondientes entre y dentro de secuencias humanas y no humanas. Como se usa en el presente documento, las partes, posiciones o regiones “análogas” y “correspondientes” son partes, posiciones o regiones que se alinean entre sí tras alinear dos o más secuencias polipeptídicas o de ácido nucleico relacionadas (incluyendo secuencias de moléculas, regiones de moléculas y/o secuencias teóricas) de modo que se obtenga la coincidencia del mayor orden, usando un método de alineamiento conocido por los expertos en la materia para maximizar las coincidencias. En otras palabras, dos posiciones análogas (o partes o regiones) se alinean tras alineamiento de mejor ajuste de dos o más secuencias polipeptídicas o de ácido nucleico. Las partes/posiciones/regiones análogas se identifican basándose en la posición a lo largo de la secuencia de ácido nucleico o aminoácidos lineal cuando las dos o más secuencias se alinean. No es necesario que las partes análogas compartan ninguna similitud de secuencia entre sí. Por ejemplo, el alineamiento (de modo que maximice las coincidencias) de las secuencias de dos moléculas de ácido nucleico homólogas, cada una de 100 nucleótidos de longitud, puede revelar que 70 de los 100 nucleótidos son idénticos. Las partes de estas moléculas de ácido nucleico que contienen alguno o todos de los otros 30 aminoácidos no idénticos son partes análogas que no comparten identidad de secuencia. Como alternativa, las partes análogas pueden contener algún porcentaje de identidad de secuencia entre sí, tal como exactamente o aproximadamente 50 %, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 %, 99 %, o fracciones de los mismos. En un ejemplo, las partes análogas son 100 % idénticas.

Como se usa en el presente documento, una “modificación” es en referencia a modificación de una secuencia de aminoácidos de un polipéptido o una secuencia de nucleótidos en una molécula de ácido nucleico e incluye deleciones, inserciones y reemplazos de aminoácidos y nucleótidos, respectivamente. Los métodos para modificar un polipéptido son rutinarios para los expertos en la materia, tal como usando metodologías de ADN recombinante.

Como se usa en el presente documento, “deleción”, cuando se refiere a una secuencia de ácido nucleico o polipeptídica, se refiere a la deleción de uno o más nucleótidos o aminoácidos en comparación con una secuencia, tal como un polinucleótido o polipéptido diana o una secuencia nativa o de tipo silvestre. Como se usa en el presente documento, la “inserción” cuando se refiere a una secuencia de ácido nucleico o aminoácidos, describe la inclusión de uno o más nucleótidos o aminoácidos adicionales, dentro de una secuencia diana, nativa, de tipo silvestre u otra relacionada. Por lo tanto, una molécula de ácido nucleico que contiene una o más inserciones en comparación con una secuencia de tipo silvestre, contiene uno o más nucleótidos adicionales dentro de la longitud lineal de la secuencia. Como se usa en el presente documento, “adiciones”, a secuencias de ácido nucleico y aminoácidos describen adición de nucleótidos o aminoácidos en uno de los extremos terminales en comparación con otra secuencia. Como se usa en el presente documento, la “sustitución” se refiere al reemplazo de uno o más nucleótidos o aminoácidos en una secuencia de ácido nucleico o polipeptídica nativa, diana, de tipo silvestre u otra con un nucleótido o aminoácido alternativo, sin cambiar la longitud (como se describe en números de restos) de la molécula.

Por lo tanto, una o más sustituciones en una molécula no cambian el número de restos de aminoácidos o nucleótidos de la molécula. Las mutaciones de sustitución en comparación con un polipéptido particular pueden expresarse con respecto al número del resto de aminoácido a lo largo de la longitud de la secuencia polipeptídica. Por ejemplo, un polipéptido modificado que tiene una modificación en el aminoácido en la posición 19ª de la secuencia de aminoácidos que es una sustitución de cisteína (Cys; C) por isoleucina (Ile; I) puede expresarse como I19C, Ile19C, o simplemente C19, para indicar que el aminoácido en la posición 19ª modificada es una cisteína. En este ejemplo, la molécula que tiene la sustitución tiene una modificación en Ile 19 del polipéptido no modificado.

Como se usa en el presente documento, una propiedad de unión es una característica de una molécula, por ejemplo un polipéptido, en relación con si se une o no, y cómo, con uno o más compañeros de unión. Las propiedades de unión incluyen capacidad para unir el compañero o los compañeros de unión, la afinidad con la que se une con el compañero de unión (por ejemplo alta afinidad), la avidez con la que se une con el compañero de unión, la fuerza del enlace con el compañero de unión y la especificidad por la unión con el compañero de unión. Como se usa en el presente documento, la afinidad describe la fuerza de la interacción entre dos o más moléculas, tales como compañeros de unión, típicamente la fuerza de las interacciones no covalentes entre dos compañeros de unión. La afinidad de un anticuerpo o fragmento de unión a antígeno del mismo por un epítopo antigénico es la medida de la fuerza de las interacciones no covalentes totales entre un único sitio de combinación de anticuerpo y el epítopo. La interacción anticuerpo-antígeno de baja afinidad es débil, y las moléculas tienden a disociarse rápidamente, mientras que la unión de anticuerpo-antígeno de alta afinidad es fuerte y las moléculas permanecen unidas durante un periodo de tiempo más largo. Se conocen bien métodos para calcular la afinidad, tales como métodos para determinar las constantes de asociación/disociación. La afinidad puede estimarse de forma empírica o las afinidades pueden determinarse de forma comparativa, por ejemplo comparando la afinidad de un anticuerpo y otro anticuerpo por un antígeno particular. Como se usa en el presente documento, la avidez de anticuerpo se refiere a la fuerza de múltiples interacciones entre un anticuerpo multivalente y su antígeno afín, tal como con anticuerpos que contienen múltiples sitios de unión asociados con un antígeno con epítopos repetidos o una matriz epitópica. Un anticuerpo de alta avidez tiene una mayor fuerza de dichas interacciones en comparación con un anticuerpo de baja avidez. Como se usa en el presente documento, “unir” se refiere a la participación de una molécula en cualquier interacción atrayente con otra molécula, que da como resultado una asociación estable en la que las dos moléculas están en proximidad estrecha entre sí. La unión incluye, pero sin limitación, enlaces no covalentes, enlaces covalentes (tales como enlaces covalentes reversibles e irreversibles), e incluyen interacciones entre moléculas tales como, pero sin limitación, proteínas, ácidos nucleicos, carbohidratos, lípidos y moléculas pequeñas, tales como compuestos químicos incluyendo fármacos. Son ejemplos de enlaces las interacciones anticuerpo-antígeno e interacciones receptor-ligando. Cuando un anticuerpo “se une” con un antígeno particular, la unión se refiere al reconocimiento específico del antígeno por el anticuerpo, mediante interacción anticuerpo-antígeno afín, en sitios de combinación de anticuerpos. La unión también puede incluir la asociación de múltiples cadenas de un polipéptido, tales como cadenas de anticuerpo que interaccionan mediante enlaces disulfuro. Como se usa en el presente documento, la “constante de afinidad” se refiere a una constante de asociación (Ka) usada para medir la afinidad de un anticuerpo por un antígeno. Cuanto mayor sea la constante de afinidad mayor será la afinidad del anticuerpo por el antígeno. Las constantes de afinidad se expresan en unidades de molaridad recíproca (es decir M-1) y pueden calcularse a partir de la constante de velocidad para la reacción de asociación- disociación como se mide por metodología cinética convencional para reacciones de anticuerpos (por ejemplo, inmunoensayos, resonancia de plasmón superficial u otros ensayos de interacción cinética conocidos en la técnica).

Como se usa en el presente documento, el término “igual”, cuando se usa en referencia a la afinidad de unión a anticuerpo, significa que la constante de asociación (Ka) está en un intervalo de aproximadamente 1 a 100 veces o de 1 a 10 veces del anticuerpo de referencia (1-100 veces mayor afinidad o 1-100 veces menor afinidad, o cualquier valor numérico o intervalo o valor dentro de dichos intervalos, que el anticuerpo de referencia).

Como se usa en el presente documento, “sustancialmente igual” cuando se usa en referencia a la constante de asociación (Ka), significa que la constante de asociación está en un intervalo de aproximadamente 5 a 5000 veces mayor o menor que la constante de asociación, Ka, del anticuerpo de referencia (5-5000 veces mayor o 5-5000 veces menor que el anticuerpo de referencia). La afinidad de unión de un anticuerpo también puede expresarse como una constante de disociación, o Kd. La constante de disociación es la recíproca de la constante de asociación, Kd = 1 /Ka. Como se usa en el presente documento, la expresión “que tiene la misma especificidad de unión” cuando se usa para describir un anticuerpo en referencia a otro anticuerpo, significa que el anticuerpo se une específicamente (se une inmunoespecíficamente o se une específicamente con el virus) con todo o una parte del mismo epítopo antigénico que el anticuerpo de referencia. Por lo tanto, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo que tiene la misma especificidad de unión que el anticuerpo indicado como 58c5 se une específicamente con todo o una parte del mismo epítopo que el anticuerpo anti VSR o fragmento de unión a antígeno del mismo indicado como 58c5. El epítopo puede estar en la proteína aislada, o en la proteína en el virus. La capacidad de dos anticuerpos para unirse con el mismo epítopo puede determinarse por ensayos conocidos en la técnica, tales como, por ejemplo, ensayos de resonancia de plasmón superficial y ensayos de competición de anticuerpos. Típicamente, los anticuerpos que se unen inmunoespecíficamente con el mismo epítopo pueden competir por la unión con el epítopo, que puede medirse, por ejemplo, por un ensayo de competición de unión in vitro (por ejemplo ELISA de competición), usando técnicas conocidas en este campo. Típicamente, un primer anticuerpo que se une de forma inmunoespecífica con los mismos epítopos que un segundo anticuerpo puede competir por la unión con el epítopo en aproximadamente o 30 %, 35 %, 40 %, 45 %, 50 %, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 100 % en el que porcentaje de competición es la capacidad medida del segundo anticuerpo para desplazar la unión del primer anticuerpo con el epítopo. En ensayos de competición ejemplares, el antígeno se incuba en presencia de una dilución limitante predeterminada de un anticuerpo marcado (por ejemplo, concentración de saturación de 50-70 %) y diluciones en serie de un anticuerpo de competición no marcado. La competición se determina midiendo la unión del anticuerpo marcado con el antígeno para cualquier reducción en la unión en presencia del anticuerpo competidor. Las variaciones de dichos ensayos, incluyendo diversas técnicas de marcaje y métodos de detección incluyendo, por ejemplo, detección radiométrica, fluorescente, enzimática y colorimétrica, se conocen en la técnica. La capacidad de un primer anticuerpo para unirse con el mismo epítopo que un anticuerpo secundario también puede determinarse, por ejemplo, por ensayos de neutralización de virus usando Mutantes Resistentes a Anticuerpos Monoclonales (MARM). Por ejemplo, cuando un primer anticuerpo anti VSR neutraliza un VSR de tipo silvestre pero no un VSR mutante particular, un segundo anticuerpo que neutraliza el VSR de tipo silvestre pero no el VSR mutante particular se une en general con el mismo epítopo en VSR que el primer anticuerpo. Cuando un primer anticuerpo anti VSR neutraliza el VSR de tipo silvestre pero no un VSR mutante particular, un segundo anticuerpo que neutraliza el VSR de tipo silvestre y el VSR mutante particular generalmente no se une con el mismo epítopo en VSR que el primer anticuerpo. Como se usa en el presente documento, un “mutante resistente a anticuerpo monoclonal” (MARM) también denominado un “mutante de escape de anticuerpo monoclonal” es un virus sincitial respiratorio (VSR) mutante que muestra resistencia aumentada a neutralización por un anticuerpo monoclonal que neutraliza el virus VSR de tipo silvestre. Se generan MARM cultivando VSR de tipo silvestre en presencia de un anticuerpo monoclonal durante sucesivos ciclos de replicación viral en presencia del anticuerpo de modo que después de cada ciclo sucesivo de replicación del virus, se requieren concentraciones crecientes de anticuerpo para producir efectos de neutralización del virus. Solamente se observan efectos citopáticos (CPE) en presencia de concentraciones crecientes de anticuerpos hasta que resulta un virus mutante que ya no se neutraliza eficazmente por un anticuerpo. Si se requieren más ciclos de replicación para la aparición de un MARM en presencia de un primer anticuerpo en comparación con un segundo anticuerpo, se puede concluir que el primer anticuerpo se une con un epítopo que es diferente del epítopo con el que se une el segundo anticuerpo. Si un primer anticuerpo puede neutralizar un MARM generado contra un segundo anticuerpo, se puede concluir que los anticuerpos se unen específicamente con o interaccionan con diferentes epítopos. Los MARM pueden mapear con más precisión el epítopo de unión a antígeno de un anticuerpo en comparación con un ensayo de unión de competición, de modo que un anticuerpo pueda competir contra otro por la unión con un antígeno, pero aún pueda neutralizar el MARM de su competidor. Como se usa en el presente documento, CE50 se refiere a la concentración eficaz a la que un anticuerpo puede inhibir la infección del virus en 50 % en un ensayo de neutralización in vitro, tal como, por ejemplo, un ensayo de reducción de placas de virus como se describe en el presente documento (por ejemplo, un ensayo de reducción de placas usando células hospedadoras Vero u otra célula hospedadora para infección) u otros ensayos de neutralización de virus conocidos en la técnica. Típicamente, un virus neutralizante es uno que tiene una CE50 de 2 nM o menos para la inhibición del virus en un ensayo de neutralización in vitro, tal como un ensayo de reducción de placas de virus.

Como se usa en el presente documento, “compañero de unión” se refiere a una molécula (tal como un polipéptido, lípido, glucolípido, molécula de ácido nucleico, carbohidrato u otra molécula), con la que interacciona específicamente otra molécula, por ejemplo, mediante interacciones covalentes o no covalentes, tal como la interacción de un anticuerpo con el antígeno afín. El compañero de unión puede producirse de forma natural o sintética. En un ejemplo, se selecciona polipéptidos variantes deseados usando uno o más compañeros de unión, por ejemplo, usando métodos in vitro o in vivo. Los ejemplos de los métodos in vitro incluyen la selección usando un compañero de unión acoplado con un soporte sólido, tal como una perla, placa, columna, matriz u otro soporte sólido; o un compañero de unión acoplado a otra molécula seleccionable, tal como una molécula de biotina, seguido de selección posterior acoplando la otra molécula seleccionable con un soporte sólido. Típicamente, los métodos in

vitro incluyen etapas de lavado para retirar los polipéptidos no unidos, seguido de elución del polipéptido o los polipéptidos variantes seleccionados. El proceso puede repetirse una o más veces en un proceso por iteraciones para seleccionar polipéptidos variantes de entre los polipéptidos seleccionados. Como se usa en el presente documento, un enlace disulfuro (también denominado enlace S-S o un puente disulfuro) es un único enlace covalente derivado del acoplamiento de grupos tiol. Se forman enlaces disulfuro en proteínas entre los grupos tiol de restos de cisteína, y estabilizan las interacciones entre dominios polipeptídicos, tales como dominios de anticuerpo. Como se usa en el presente documento, “acoplado” o “conjugado” significa unido mediante una interacción covalente o no covalente. Como se usa en el presente documento, la expresión “conjugado con un anticuerpo” o “unido con un anticuerpo” o variaciones gramaticales de las mismas, cuando hacen referencia a la unión de un resto con un anticuerpo o fragmento de unión a antígeno del mismo, tal como un resto de diagnóstico o terapéutico, significa que el resto se une con el anticuerpo o fragmento de unión a antígeno del mismo por cualquier medio conocido para unir péptidos, tal como, por ejemplo, mediante la producción de proteína de fusión por medios recombinantes o postraduccionalmente por medios químicos. La conjugación puede emplear cualquiera de una diversidad de agentes de enlace para efectuar la conjugación, incluyendo, pero sin limitación, enlazadores peptídicos o compuestos o agentes de reticulación química.

Como se usa en el presente documento, la “presentación en fagos” se refiere a la expresión de polipéptidos en la superficie de bacteriófagos filamentosos. Como se usa en el presente documento, una “célula compatible con presentación en fagos” o “célula hospedadora compatible con presentación en fagos” es una célula hospedadora, típicamente una célula hospedadora bacteriana, que puede infectarse por fagos y por lo tanto puede apoyar la producción de fagos que presentan proteínas de fusión que contienen polipéptidos, por ejemplo, polipéptidos variantes y puede por lo tanto usarse para presentación en fagos. Los ejemplos de células compatibles con presentación en fagos incluyen, pero sin limitación, células XL1- blue.

Como se usa en el presente documento, la “selección” se refiere a un procedimiento de selección basado en afinidad para el aislamiento de fagos que presentan una molécula con una especificidad por un compañero de unión, por ejemplo, una molécula de captura (por ejemplo un antígeno) o secuencia de aminoácidos o nucleótidos o epítopo, región, parte o locus en la misma.

Como se usa en el presente documento, “proteína de presentación” o “proteína de presentación de paquete genético” significa cualquier polipéptido de paquete genético para presentación de un polipéptido en el paquete genético, de modo que cuando la proteína de presentación esté fusionada con (por ejemplo incluida como parte de una proteína de fusión con) un polipéptido de interés (por ejemplo, un polipéptido para el que se desea expresión reducida), el polipéptido se presenta en la superficie externa del paquete genético. La proteína de presentación típicamente está presente en o dentro de la superficie externa o el compartimento externo de un paquete genético (por ejemplo, membrana, pared celular, cubierta u otra superficie externa o compartimento) de un paquete genético, por ejemplo un paquete genético viral, tal como un fago, de modo que tras la fusión con un polipéptido de interés, el polipéptido esté presente en el paquete genético.

Como se usa en el presente documento, una proteína de cubierta es una proteína de presentación, al menos una parte de la cual está presente en la superficie externa del paquete genético, de modo que cuando se fusione con el polipéptido de interés, el polipéptido se presente en la superficie externa del paquete genético. Típicamente, las proteínas de cubierta son proteínas de cubierta viral, tales como proteínas de cubierta de fagos. Una proteína de cubierta viral, tal como una proteína de cubierta de fago se asocia con la partícula del virus durante el ensamblaje en una célula hospedadora. En un ejemplo, se usan proteínas de cubierta en el presente documento para presentación de polipéptidos en paquetes genéticos; las proteínas de cubierta se expresan como partes de proteínas de fusión, que contienen la secuencia de proteína de cubierta de aminoácidos y una secuencia de aminoácidos del polipéptido presentado. La proteína de cubierta puede ser una proteína de cubierta de longitud completa o cualquier parte de la misma capaz de efectuar presentación del polipéptido en la superficie del paquete genético.

Son ejemplos de proteínas de cubierta las proteínas de cubierta de fagos, tales como, pero sin limitación, (i) proteínas de cubierta menores de fago filamentoso, tales como proteína del gen III (gIIIp, cp3) y (ii) proteínas de cubierta principales (que están presentes en la cubierta viral en 10 copias o más, por ejemplo, decenas, cientos o miles de copias) de fago filamentoso tales como proteína de gen VIII (gVIIIp, cp8); fusiones con otras proteínas de cubierta de fagos tales como proteína de gen VI, proteína de gen VII o proteína de gen IX (véase, por ejemplo, documento WO 00/71694) y partes (por ejemplo, dominios o fragmentos) de estas proteínas, tales como, pero sin limitación dominios que se incorporan de forma estable en la partícula de fago, por ejemplo tales como el dominio de anclaje de gIIIp o gVIIIp. Adicionalmente, pueden usarse mutantes de gVIIIp que están optimizados para la expresión de péptidos mayores, tales como mutantes que tienen propiedades de presentación en superficie mejoradas, tales como gVIIp (véase, por ejemplo, Sidhu et al. (2000) J. Mol. Biol. 296: 487-495). Como se usa en el presente documento, “enfermedad o trastorno” se refiere a una afección patológica en un organismo que resulta de una causa o afección incluyendo, pero sin limitación, infecciones, afecciones adquiridas, afecciones genéticas y caracterizadas por síntomas identificables. Las enfermedades y trastornos de interés en el presente documento son los que implican infección por VSR o los que aumentan el riesgo de una infección por VSR. Como se usa en el presente documento, “infección” e “infección por VSR” se refieren a todos los estadios de un ciclo de vida de VSR en un hospedador (incluyendo, pero sin limitación la invasión por y replicación de VSR en una célula o tejido corporal), así como el estado patológico que resulta de la invasión por y replicación de un VSR. La invasión por y multiplicación de un VSR incluye, pero sin limitación, las siguientes etapas: el acoplamiento de la partícula de VSR con una célula, fusión de un virus con una membrana celular, la introducción de información genética viral en una célula, la expresión de proteínas del VSR, la producción de nuevas partículas de VSR y la liberación de partículas de VSR de una célula. Una infección por VSR puede ser una infección por VSR del tracto respiratorio superior (URI), una infección por VSR del tracto respiratorio inferior (LRI), o una combinación de las mismas. En algunos ejemplos, el estado patológico resultante de la invasión por y replicación de un VSR es una enfermedad de VSR aguda.

Como se usa en el presente documento, “enfermedad de VSR aguda” se refiere a una enfermedad clínicamente significativa en los pulmones o tracto respiratorio inferior como resultado de una infección por VSR, que puede manifestarse como neumonía y/o bronquiolitis, en la que dichos síntomas pueden incluir, por ejemplo, hipoxia, apnea, dificultad respiratoria, respiración rápida, sibilación y cianosis. La enfermedad de VSR aguda requiere que un individuo afectado obtenga intervención médica, tal como hospitalización, administración de oxígeno, intubación y/o ventilación. Como se usa en el presente documento, “tratar” a un sujeto con una enfermedad o afección significa que los síntomas del sujeto se alivian parcial o totalmente, o permanecen estáticos después del tratamiento. Por lo tanto el tratamiento abarca profilaxis, terapia y/o cura. La profilaxis se refiere a la prevención de una enfermedad potencial y/o una prevención del empeoramiento de síntomas o progresión de una enfermedad. El tratamiento también abarca cualquier uso farmacéutico de cualquier anticuerpo o fragmento de unión a antígeno del mismo proporcionado o composiciones proporcionadas en el presente documento.

Como se usa en el presente documento, “prevención” o profilaxis, y formas gramaticalmente equivalentes de la misma, se refiere a métodos en los que se reduce el riesgo de desarrollar enfermedad o afección. Como se usa en el presente documento, un “agente farmacéuticamente eficaz” incluye cualquier agente terapéutico o agentes bioactivos, incluyendo, pero sin limitación, por ejemplo, anestésicos, vasoconstrictores, agentes de dispersión, fármacos terapéuticos convencionales, incluyendo moléculas pequeñas farmacológicas y proteínas terapéuticas. Como se usa en el presente documento, un “efecto terapéutico” significa un efecto resultante del tratamiento de un sujeto que altera, típicamente mejora o alivia los síntomas de una enfermedad o afección o que cura una enfermedad o afección. Como se usa en el presente documento, una “cantidad terapéuticamente eficaz” o una “dosis terapéuticamente eficaz” se refiere a la cantidad de un agente, compuesto, material o composición que contiene un compuesto que es al menos suficiente para producir un efecto terapéutico después de la administración a un sujeto. Por lo tanto, es la cantidad necesaria para prevenir, curar, aliviar, detener o detener parcialmente un síntoma de una enfermedad o un trastorno. Como se usa en el presente documento, la “eficacia terapéutica” se refiere a la capacidad de un agente, compuesto, material o composición que contienen un compuesto para producir un efecto terapéutico en un sujeto al que se ha administrado un agente, compuesto, material o composición que contiene un compuesto. Como se usa en el presente documento, una “cantidad profilácticamente eficaz” o una “dosis profilácticamente eficaz” se refiere a la cantidad de un agente, compuesto, material o composición que contiene un compuesto que cuando se administra a un sujeto tendrá el efecto profiláctico pretendido, por ejemplo, prevención o retardo de la aparición, o reaparición, de la enfermedad o sus síntomas, reducción de la probabilidad de la aparición, o reaparición, de la enfermedad o sus síntomas, o reducción de la incidencia de la infección viral. El efecto profiláctico completo no sucede necesariamente mediante administración de una dosis, y puede producirse solamente después de administración de una serie de dosis. Por lo tanto, una cantidad profilácticamente eficaz puede administrarse en una o más administraciones.

Como se usa en el presente documento, los términos “inmunoterapéuticamente” o “inmunoterapia” junto con anticuerpos proporcionados indica administración profiláctica así como terapéutica. Por lo tanto, los anticuerpos terapéuticos proporcionados pueden administrarse a un sujeto en riesgo de contraer una infección por virus (por ejemplo una infección por VSR) para reducir la probabilidad y/o gravedad de la enfermedad, o administrarse a sujetos que ya demuestran infección por virus activa (por ejemplo una infección por VSR). Como se usa en el presente documento, el alivio de los síntomas de una enfermedad o un trastorno particular por un tratamiento, tal como mediante administración de una composición farmacéutica u otro producto terapéutico, se refiere a cualquier reducción, bien permanente o bien temporal, duradera o transitoria, de los síntomas que pueden atribuirse a o asociarse con la administración de la composición o el producto terapéutico. Como se usa en el presente documento, la expresión cantidad “diagnósticamente eficaz” se refiere a la cantidad de un agente, compuesto, material o composición que contiene un compuesto detectable que es al menos suficiente para la detección del compuesto después de la administración a un sujeto. En general, una cantidad diagnósticamente eficaz de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo, tal como un anticuerpo marcado de forma detectable o fragmento de unión a antígeno del mismo o un anticuerpo o fragmento de unión a antígeno del mismo que puede detectarse por un agente secundario, administrado a un sujeto para detección es la cantidad del anticuerpo o fragmento de unión a antígeno del mismo que es suficiente para permitir la detección del sitio que tiene el antígeno de VSR para el que es específico el anticuerpo o fragmento de unión a antígeno del mismo. En el uso de los anticuerpos proporcionados en el presente documento para la detección in vivo

del antígeno, se proporciona un anticuerpo marcado de forma detectable o fragmento de unión a antígeno del mismo en una dosis que es diagnósticamente eficaz. Como se usa en el presente documento, un marcador o resto detectable es un marcador detectable (por ejemplo, una molécula fluorescente, molécula quimioluminiscente, una molécula bioluminiscente, un agente de contraste (por ejemplo, un metal), un radionúclido, un cromóforo, un péptido detectable o una enzima que cataliza la formación de un producto detectable) que puede unirse o ligarse directa o indirectamente con una molécula (por ejemplo, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento) o asociado con el mismo y puede detectarse in vivo y/o in vitro. El método de detección puede ser cualquier método conocido en la técnica, incluyendo métodos conocidos in vivo y/o in vitro de detección (por ejemplo, captura de imágenes por inspección visual, espectroscopia de resonancia magnética (RM), señal de ultrasonidos, rayos X, espectroscopia de rayos gamma (por ejemplo, exploración por tomografía de emisión de positrones (PET), tomografía computarizada de emisión de un único fotón (SPECT)), espectroscopia de fluorescencia o absorción). La detección indirecta se refiere a la medición de un fenómeno físico, tal como emisión o absorción de energía o partículas, de un átomo, una molécula o una composición que se une directa o indirectamente con el resto detectable (por ejemplo, detección de un anticuerpo secundario marcado o fragmento de unión a antígeno del mismo que se une con un anticuerpo primario (por ejemplo, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento).

Como se usa en el presente documento, el término “sujeto” se refiere a un animal, incluyendo un mamífero, tal como un ser humano. Como se usa en el presente documento, un paciente se refiere a un sujeto humano.

Como se usa en el presente documento, animal incluye cualquier animal, tal como, pero sin limitación, primates incluyendo seres humanos, gorilas y monos; roedores, tales como ratones y ratas; aves de corral, tales como pollos; rumiantes, tales como cabras, vacas, ciervos, ovejas; ovinos, tales como cerdos y otros animales. Los animales no humanos excluyen a los seres humanos como el animal contemplado. Los polipéptidos proporcionados en el presente documento son de cualquier fuente, animal, vegetal, procariota y fúngica. La mayoría de los polipéptidos son de origen animal, incluyendo origen de mamífero. Como se usa en el presente documento, un “anciano”, se refiere a un sujeto que debido a la edad tiene una respuesta inmunitaria reducida y tiene una respuesta reducida a la vacunación. Típicamente, un sujeto anciano es uno que es un ser humano que tiene sesenta y cinco años de edad o más, más típicamente, 70 años de edad o más. Como se usa en el presente documento, un “bebé humano” se refiere a un ser humano de menos de o de aproximadamente 24 meses (por ejemplo, menos de o aproximadamente 16 meses, menos de o aproximadamente 12 meses, menos de o aproximadamente 6 meses, menos de o aproximadamente 3 meses, menos de o aproximadamente 2 meses o menos de o aproximadamente 1 mes de edad). Típicamente, el bebé humano nace a más de 38 semanas de edad gestacional. Como se usa en el presente documento, un “bebé humano nacido prematuramente” se refiere a un ser humano nacido a menos de o aproximadamente 40 semanas de edad gestacional, típicamente menos de o aproximadamente 38 semanas de edad gestacional. Como se usa en el presente documento, una “forma de dosis unitaria” se refiere a unidades físicamente discretas adecuadas para sujetos humanos y animales y envasadas individualmente como se conoce en la técnica.

Como se usa en el presente documento, una “formulación de una única dosificación” se refiere a una formulación para administración directa. Como se usa en el presente documento, un “artículo de fabricación” es un producto que se prepara y se vende. Como se usa a lo largo de la presente solicitud, se pretende que la expresión abarque cualquiera de las composiciones proporcionadas en el presente documento contenidas en artículos de envasado. Como se usa en el presente documento, un “fluido” se refiere a cualquier composición que pueda fluir. Los fluidos abarcan por lo tanto composiciones que están en forma de semisólidos, pastas, soluciones, mezclas acuosas, geles, lociones, cremas y otras de dichas composiciones.

Como se usa en el presente documento, un polipéptido o una proteína aislado o purificado (por ejemplo un anticuerpo aislado o fragmento de unión a antígeno del mismo) o parte biológicamente activa del mismo (por ejemplo un fragmento de unión a antígeno aislado) está sustancialmente libre de material celular u otras proteínas contaminantes de la célula o tejido del que deriva la proteína, o sustancialmente libre de precursores químicos u otros productos químicos cuando se sintetizan químicamente. Puede determinarse que las preparaciones están sustancialmente libres si aparecen libres de impurezas fácilmente detectables como se determina por métodos convencionales de análisis, tales como cromatografía en capa fina (TLC), electroforesis en gel y cromatografía líquida de alto rendimiento (HPLC), usados por los expertos en la materia para evaluar dicha pureza, o suficientemente puras de modo que la purificación adicional no altere de forma detectable las propiedades físicas y químicas, tales como actividades enzimáticas y biológicas, de la sustancia. Los expertos en la materia conocen métodos de purificación de los compuestos para producir compuestos sustancialmente químicamente puros. Un compuesto sustancialmente químicamente puro, sin embargo, puede ser una mezcla de estereoisómeros. En dichos casos, la purificación adicional podría aumentar la actividad específica del compuesto. Como se usa en el presente documento, un “extracto celular” o “lisado” se refiere a una preparación o fracción que se realiza partir de una célula lisada o rota.

Como se usa en el presente documento, una molécula de ácido nucleico aislada es una que se separa de otras moléculas de ácido nucleico que están presentes en la fuente natural de la molécula de ácido nucleico. Una molécula de ácido nucleico “aislada” tal como una molécula de ADNc, puede estar sustancialmente libre de otro material celular, o medio de cultivo cuando se produce por técnicas recombinantes, o sustancialmente libre de precursores químicos u otros productos químicos cuando se sintetiza químicamente. Las moléculas de ácido nucleico aisladas ejemplares proporcionadas en el presente documento incluyen moléculas de ácido nucleico aisladas que codifican un anticuerpo o fragmentos de unión a antígenos proporcionados. Como se usa en el presente documento, un “control” se refiere a una muestra que es sustancialmente idéntica a la muestra de ensayo, excepto que no se trata con un parámetro de ensayo, o, si es una muestra de plasma, puede ser de un voluntario normal no aquejado de la afección de interés. Un control también puede ser un control interno. Como se usa en el presente documento, una “composición” se refiere a cualquier mezcla. Puede ser una solución, suspensión, líquido, polvo, pasta, acuoso, no acuoso o cualquier combinación de los mismos.

Como se usa en el presente documento, una “combinación” se refiere a cualquier asociación entre o dentro de dos o más artículos. La combinación puede ser de dos o más artículos separados, tales como dos composiciones o dos colecciones, puede ser una mezcla de los mismos, tal como una única mezcla de los dos o más artículos, o cualquier variación de los mismos. Los elementos de una combinación están generalmente funcionalmente asociados o relacionados. Como se usa en el presente documento, la terapia de combinación se refiere a la administración de dos o más productos terapéuticos diferentes, tales como dos o más anticuerpos VSR diferentes y/o anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos. Los diferentes agentes terapéuticos pueden proporcionarse y administrarse por separado, secuencialmente, intermitentemente o pueden proporcionarse en una única composición. Como se usa en el presente documento, un kit es una combinación envasada que opcionalmente incluye otros elementos, tales como reactivos adicionales e instrucciones para uso de la combinación o elementos de la misma, para un fin incluyendo, pero sin limitación, activación, administración, diagnóstico y evaluación de una actividad o propiedad biológica. Como se usa en el presente documento, las formas singulares “un” y “el” incluyen referentes plurales a no ser que el contexto claramente dicte otra cosa. Por lo tanto, por ejemplo, la referencia a un polipéptido, que comprende “un dominio de inmunoglobulina” incluye polipéptidos con uno o una pluralidad de domino de inmunoglobulina. Como se usa en el presente documento, el término “o” se usa para indicar “y/o” a no ser que se indique de forma explícita para hacer referencia a alternativas solamente o las alternativas sean mutuamente excluyentes.

Como se usa en el presente documento, los intervalos y cantidades pueden expresarse como “aproximadamente” un valor o intervalo particular. Aproximadamente también incluye la cantidad exacta. Por lo tanto “aproximadamente 5 aminoácidos” significa “aproximadamente 5 aminoácidos” y también “5 aminoácidos”. Como se usa en el presente documento, “opcional” u “opcionalmente” significa que el acontecimiento o la circunstancia descrito a continuación sucede o no sucede y que la descripción incluye casos en los que dicho acontecimiento o circunstancia sucede y casos en los que no. Por ejemplo, una parte opcionalmente variante significa que la parte es variante o no variante. Como se usa en el presente documento, las abreviaturas para cualquier grupo protector, aminoácidos y otros compuestos, están, a no ser que se indique de otro modo, de acuerdo con su uso habitual, abreviaturas reconocidas o la Comisión de Nomenclatura Bioquímica de IUPAC-IUB (véase, Biochem. (1972) 11(9): 1726-1732). B. VISIÓN DE CONJUNTO Se proporcionan anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que se unen con y neutralizan el virus sincitial respiratorio. Los anticuerpos anti VSR proporcionados en el presente documento son anticuerpos neutralizantes que reconocen uno o más epítopos en la superficie del VSR. En particular, los anticuerpos proporcionados en el presente documento se unen con una proteína de fusión (F) de VSR. Los anticuerpos proporcionados en el presente documento pueden usarse en terapias de profilaxis. Los anticuerpos proporcionados en el presente documento también pueden usarse como productos terapéuticos.

Por ejemplo, los anticuerpos proporcionados pueden emplearse para la prevención y/o la propagación de enfermedad patógena, incluyendo, pero sin limitación, la inhibición de trasmisión viral entre sujetos, inhibición del establecimiento de infección viral en un hospedador, y reducción de la carga viral en un sujeto. Los anticuerpos también pueden emplearse para prevenir, tratar y/o aliviar uno o más síntomas de una infección por VSR o para reducir la duración de una infección por VSR. En consecuencia, el tratamiento de pacientes con anticuerpos proporcionados en el presente documento puede reducir la tasa de mortalidad y/o morbilidad asociada con la infección por VSR. La persistencia del VSR se asocia con la generación de mutantes de escape que no pueden neutralizarse por un anticuerpo. Por lo tanto, los principales retos para el desarrollo de anticuerpos antivirales terapéuticos son la generación o identificación de anticuerpos que tienen un epítopo de neutralización que está 1) conservado entre diversas cepas o serotipos y 2) contra el que es difícil para el virus en evolución generar mutantes de escape. Los anticuerpos proporcionados en el presente documento se unen con diversos subgrupos y cepas de VSR. Los anticuerpos proporcionados en el presente documento también muestran actividad de neutralización de virus mejorada en comparación con anticuerpos existentes en la técnica anterior. Los anticuerpos proporcionados neutralizan eficazmente el virus durante ciclos sucesivos de replicación, en los que VSR generaría típicamente mutantes de escape para resistir a la neutralización. La capacidad de limitar la regeneración de MARM significa que los anticuerpos proporcionados en el presente documento se unen con un epítopo que es menos susceptible a variación en forma de mutantes de escape generados. Este epítopo, por lo tanto, es diferente de los epítopos de otros anticuerpos anti VSR conocidos. Por lo tanto, los anticuerpos anti VSR proporcionados, además de terapia de profilaxis, también son útiles para el tratamiento de infección por VSR. En la actualidad, no hay productos terapéuticos de anticuerpo conocidos y aprobados contra infección por VSR. Como tales, los anticuerpos proporcionados en el presente documento son especialmente importantes para el tratamiento de infección por VSR entre pacientes ancianos, por ejemplo los que están en hogares grupales o residencias de ancianos, en los que la proximidad aumenta el riesgo de propagación viral entre pacientes. El tratamiento con los anticuerpos proporcionados en el presente documento también es importante en situaciones en las que la no observancia de los regímenes de dosificación aumenta el riesgo de escape viral, ya que la no observancia del tratamiento profiláctico de VSR con palivizumab causa cada vez más resistencia viral (véase, por ejemplo, Adams et al., (2010) Clin Infect Dis. 51 (2): 185-188).

En general, los anticuerpos anti VSR proporcionados en el presente documento se unen con proteína F de VSR con alta afinidad. En comparación con anticuerpos anti VSR aprobados existentes (por ejemplo palivizumab; Synagis), los anticuerpos anti VSR de alta afinidad proporcionados en el presente documento permiten una administración menos frecuente para prevenir y/o tratar una infección por VSR, para prevenir, tratar y/o aliviar uno más síntomas de infección por VSR o para reducir la duración de una infección por VSR. Por lo tanto, los anticuerpos anti VSR proporcionados en el presente documento son útiles como anticuerpos terapéuticos, es decir, para el tratamiento de infección por VSR. La administración menos frecuente permite una observancia más fácil con regímenes de dosificación y por lo tanto reduce la posibilidad de saltarse dosificaciones lo que conduce a aumento de la resistencia viral al anticuerpo anti VSR. Dosis menores de anticuerpos que se unen inmunoespecíficamente con VSR también pueden reducir la probabilidad de efectos adversos de la terapia de inmunoglobulina. En general, los anticuerpos anti VSR proporcionados en el presente documento tienen la capacidad de inhibir o reducir una o más actividades del virus, tales como, por ejemplo, la asociación del virus con una membrana celular diana, fusión del virus con la membrana celular diana y/o entrada en la célula, producción de nuevas partículas virales, incluyendo inhibición de la replicación viral, o fusión de célula a célula de una célula infectada con otra célula (es decir formación de sincitio). Los anticuerpos anti VSR proporcionados también pueden emplearse para aumentar la respuesta inmunitaria contra un infección por VSR. 1. Virus Sincitial Respiratorio El VSR humano es un miembro de la subfamilia de Pneumovirus de la familia Paramyxoviridae. Hay dos subgrupos distintos de VSR humano, grupo A y grupo B. Adicionalmente, cada subtipo se divide adicionalmente en dos cepas, A1 y A2, y B1 y B2. El VSR es un virus de ARN con sentido negativo, no segmentado, con envoltura, con un genoma compuesto de aproximadamente 15.000 nucleótidos que codifican once proteínas virales.

El VSR codifica dos glucoproteínas de superficie principales, la glucoproteína G y la glucoproteína F. La glucoproteína G, o la proteína de unión, media en la unión del virus con el receptor celular mientras que la glucoproteína F, o la proteína de fusión, promueve la fusión de las membranas virales y celulares, permitiendo la penetración de la ribonucleoproteína viral en el citoplasma celular (Lopez et al. (1998) J. Virology 72: 6922-6928). La glucoproteína F también promueve la fusión de las membranas de células infectadas con las de células adyacentes lo que conduce a la formación de sincitios. La proteína F contiene dos subunidades con enlaces disulfuro, F1 y F2, que se producen por escisión proteolítica de un precursor N-glucosilado, inactivo. La proteína G es una glucoproteína transmembrana de tipo II de 80-90 kDa, que contiene oligosacáridos con enlaces N y O unidos con una proteína precursora de 32 kDa.

Se ha mostrado que los anticuerpos preparados contra glucoproteínas F o G de VSR neutralizan el VSR con alta eficacia in vitro y tienen efectos profilácticos in vivo (véase por ejemplo, Walsh et al. (1986) J. Gen. Microbiol. 67: 505; Beeler et al. (1989) J. Virol. 63: 2941-2950, Garcia-Borreno et al. (1989) J. Virol. 63: 925-932, Taylor et al. (1984) Immunology 52: 137-142, y Patentes de Estados Unidos N.º 5.824.307 y 6.818.216). Los anticuerpos dirigidos contra la proteína F del VSR también son eficaces en la inhibición de la fusión de células infectadas por VSR con células no infectadas adyacentes. El análisis de diversos anticuerpos monoclonales que se unen inmunoespecíficamente con la proteína F del VSR han conducido a la identificación de tres sitios antigénicos no solapantes, A, B y C y un sitio de enlace, AB (Beeler et al. (1989) J. Virol. 63: 2941-2950). Cada uno de los sitios antigénicos contiene epítopos distintos. En un estudio de un panel de 18 anticuerpos monoclonales, se identificaron cinco epítopos de un sitio antigénico A, cuatro epítopos de un sitio antigénico B y cuatro epítopos de un sitio antigénico C basándose en mutantes de escape de anticuerpos monoclonales (MARM) (véase, por ejemplo, Beeler et al. (1989) J. Virol. 63: 2941-2950). Las mutaciones de la proteína F de la cepa A2 de VSR que efectúan escape de estos anticuerpos anti VSR, incluyen mutaciones de aminoácidos individuales en los restos de aminoácidos N262, K272, S275, N276, P389 o R429, o mutaciones de aminoácidos dobles en F32 y K272 o A241 y K421 (véase, por ejemplo, Crowe et al. (1998) Virology 252: 373-375; Zhao et al., (2004) J. Infectious Diseasse 190: 1941-1946 y Liu et al., (2007) Virology Journal 4: 71). El anticuerpo monoclonal 1129, que se une con el sitio antigénico A epítopo 4 (Beeler et al. (1989) J. Virology 63(7): 2841-2950), es el anticuerpo parental del que se generó el palivizumab humanizado (SYNAGIS®) (véase Johnson et al. (1997) J. Infect. Diseases 176: 1215-1224 y Patente de Estados Unidos N.º 5.824.307). Se ha mostrado previamente que las mutaciones de aminoácidos individuales en los restos N262, N268 o K272 de la proteína F de VSR efectúan escape de palivizumab (SYNAGIS®) (véase, Zhao et al., (2004) J. Infectious Disease 190: 1941-1946). También se han identificado epítopos de la proteína F de VSR adicionales. Por ejemplo, el fragmento Fab anti VSR humano Fab 19 (véase Barbas et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10164-10168 y Crowe et al., (1994) Proc. Natl. Acad Sci USA 91: 1386-1390) se une con un epítopo en el sitio antigénico A que difiere de los epítopos identificados en Beeler et al. (véase Crowe et al. (1998) Virology 252: 373-375) y Barbas et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10164-10168). La proteína F de VSR muestra más del 91 % de similitud a través de los subgrupos de VSR A y B, mientras que la proteína G de VSR muestra solamente 53 % de similitud de aminoácidos entre los subgrupos de VSR A y VSR B (Sullender (2000) Clin. Microbiol. Rev. 13: 1-15). Debido a que los subtipos de virus A y B circulan conjuntamente la mayoría de las epidemias de VSR, es deseable un anticuerpo que neutralice los subtipos A y B de VSR, tales como los anticuerpos anti VSR o fragmentos de unión a antígeno proporcionados en el presente documento. La infección por virus sincitial respiratorio (VSR) es una causa principal de enfermedad del tracto respiratorio inferior en bebés y niños pequeños. La infección por VSR también es la causa más común de bronquiolitis, o inflamación de las vías respiratorias pequeñas en el pulmón, y neumonía en niños de menos de 1 año de edad en los Estados Unidos. Además, la infección por VSR también se reconoce como una causa importante de enfermedad respiratoria en adultos mayores. Los síntomas y afecciones asociados con la infección por VSR incluyen, por ejemplo asma, sibilación, enfermedad de las vías respiratorias reactiva (RAD) y enfermedad pulmonar obstructiva crónica (EPOC).

En consecuencia, como se describe en el presente documento, los anticuerpos anti VSR proporcionados en el presente documento pueden emplearse para la profilaxis de VSR, para el tratamiento de infección por VSR y/o para el alivio de uno o más síntomas de dichas enfermedades mediadas por VSR. C. ANTICUERPOS ANTI VSR Se proporcionan en el presente documento anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que pueden emplearse para uso terapéutico, profiláctico y de diagnóstico. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden usarse, por ejemplo, para inmunización pasiva de un sujeto contra VSR o para el tratamiento de un sujeto con una infección viral. En un ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se usan para profilaxis, es decir, la prevención de infección por VSR. En otro ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se usan como anticuerpos terapéuticos, es decir, para tratamiento de una infección viral por VSR. En otro ejemplo más, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se usan para inmunización pasiva de un sujeto contra VSR. Los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos también pueden usarse para la detección de una infección por VSR o para el control de la infección por VSR in vitro e in vivo. 1. Estructura y dominios funcionales generales del anticuerpo Se producen anticuerpos de forma natural por linfocitos B en formas unida a membrana y secretada. Los anticuerpos reconocen específicamente y se unen con epítopos antigénicos mediante interacciones afines. La unión del anticuerpo con antígenos afines puede iniciar múltiples funciones efectoras, lo que provoca la neutralización y la eliminación de toxinas, patógenos y otros agentes infecciosos.

La diversidad en la especificidad del anticuerpo surge de forma natural debido a acontecimientos de recombinación durante el desarrollo de linfocitos B. A través de estos acontecimientos, diversas combinaciones de múltiples segmentos de genes V, D y J de anticuerpos, que codifican regiones variables de moléculas de anticuerpo, se unen con genes de región constante para generar un repertorio de anticuerpos natural con grandes números de anticuerpos diversos. Un repertorio de anticuerpos humanos contiene más de 1010 especificidades de antígeno diferentes y por lo tanto teóricamente puede reconocer específicamente cualquier antígeno ajeno. Los anticuerpos incluyen dichos anticuerpos producidos de forma natural, así como anticuerpos producidos de forma sintética, es decir de forma recombinante, tales como fragmentos de anticuerpo, incluyendo los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento.

En polipéptidos de anticuerpo plegados, se confiere especificidad de unión por dominios de sitio de unión a antígeno, que contienen partes de dominios de región variable de cadena pesada y/o ligera. Otros dominios en la molécula de anticuerpo cumplen funciones efectoras participando en acontecimientos tales como la transducción de señales e interacción con otras células, polipéptidos y biomoléculas. Estas funciones efectoras provocan neutralización y/o eliminación del agente infeccioso reconocido por el anticuerpo. Los dominios de polipéptidos de anticuerpo pueden variarse de acuerdo con los métodos del presente documento para alterar propiedades específicas. a. Dominios estructurales y funcionales de anticuerpos Los anticuerpos de longitud completa contienen múltiples cadenas, dominios y regiones. Un anticuerpo convencional de longitud completa contiene dos cadenas pesadas y dos cadenas ligeras, cada una de las cuales contiene una pluralidad de dominios de inmunoglobulina (Ig). Un dominio Ig se caracteriza por una estructura denominada el pliegue Ig, que contiene dos láminas plegadas en beta, que contienen cada una cadenas beta antiparalelas conectadas por bucles. Las dos láminas beta en el pliegue de Ig se superponen entre sí por interacciones hidrófobas y un enlace disulfuro intracatenario conservado. Los dominios Ig en las cadenas de anticuerpo son dominios de región variable (V) y constante (C). Cada cadena pesada está unida con una cadena ligera por un enlace disulfuro, y las dos cadenas pesadas están unidas entre sí por enlaces disulfuro. El enlace de las cadenas pesadas está mediado por una región flexible de la cadena pesada, conocida como la región bisagra.

Cada cadena ligera de anticuerpo convencional de longitud completa contiene un dominio de región variable (VL) y un dominio de región constante (CL). Cada cadena pesada convencional de longitud completa contiene un dominio de región variable (VH) y tres o cuatro dominios de región constante (CH) y, en algunos casos, región bisagra. Debido a acontecimientos de recombinación analizados anteriormente, las secuencias de ácido nucleico que codifican los dominios de región variable difieren entre anticuerpos y confieren especificidad de antígeno a un anticuerpo particular. Las regiones constantes, por otro lado, están codificadas por secuencias que están más conservadas entre anticuerpos. Estos dominios confieren propiedades funcionales a anticuerpos, la capacidad para interaccionar con células del sistema inmunitario y proteínas del suero para provocar eliminación de agentes infecciosos. Diferentes clases de anticuerpos, por ejemplo IgM, IgD, IgG, IgE e IgA, Tienen diferentes regiones constantes, permitiéndoles cumplir distintas funciones efectoras. Cada dominio de región variable contiene tres partes denominadas regiones determinantes de complementariedad (CDR) o regiones hipervariables (HV), que están codificadas por secuencias de ácido nucleico altamente variables. Las CDR están localizadas dentro de los bucles que conectan las láminas beta del dominio Ig de región variable.

Juntas, las tres CDR de cadena pesada (CDR1, CDR2 y CDR3) y las tres CDR de cadena ligera (CDR1, CDR2 y CDR3) componen un sitio de unión a antígeno convencional (sitio de combinación de anticuerpo) del anticuerpo, que interacciona físicamente con el antígeno afín y proporciona la especificidad del anticuerpo. Un anticuerpo completo contiene dos sitios de combinación de anticuerpos idénticos, cada uno compuesto de CDR de una cadena pesada y una ligera. Debido a que están contenidas dentro de los bucles que conectan las láminas beta, las tres CDR son no contiguas a lo largo de la secuencia de aminoácidos lineal de la región variable. Tras plegar el polipéptido de anticuerpo, los bucles de CDR están en proximidad estrecha, componiendo el sitio de combinación de antígeno. Las láminas beta de los dominios de región variable forman las regiones marco conservadas (FR), que contienen más secuencias conservadas que son importantes para otras propiedades del anticuerpo, por ejemplo, estabilidad.

b. Fragmentos de anticuerpo Los anticuerpos proporcionados en el presente documento incluyen fragmentos de anticuerpo, que son derivados de anticuerpo de longitud completa que contienen menos de la secuencia completa de los anticuerpos de longitud completa pero conservan al menos una parte de las capacidades de unión específicas del anticuerpo de longitud completa. Los fragmentos de anticuerpo también pueden incluir partes de unión a antígeno de un anticuerpo que pueden insertarse en un armazón de anticuerpo (por ejemplo, anticuerpos Quiméricos) para conservar la afinidad de unión del anticuerpo parental. Los ejemplos de fragmentos de anticuerpo incluyen, pero sin limitación, Fab, Fab’, F(ab’)2, Fv monocatenario (scFv), Fv, dsFv, diacuerpo, Fd y Fd’, y otros fragmentos, incluyendo fragmentos modificados (véase, por ejemplo, Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Capítulo 1; p 3-25, Kipriyanov). Los fragmentos de anticuerpo pueden incluir múltiples cadenas unidas entre sí, tales como por enlaces disulfuro y pueden producirse de forma recombinante. Los fragmentos de anticuerpo también pueden contener enlazadores sintéticos, tales como enlazadores peptídicos, para unir dos o más dominios. Se conocen bien en la técnica métodos para generar fragmentos de unión a antígeno y pueden usarse para modificar cualquier anticuerpo proporcionado en el presente documento. Pueden generarse fragmentos de moléculas de anticuerpo, tal como por ejemplo, mediante escisión enzimática. Por ejemplo, tras la escisión de proteasa por papaína, un dímero de las regiones constantes de cadena pesada, el dominio Fc, se escinde de las dos regiones Fab (es decir las partes que contienen las regiones variables). Pueden obtenerse técnicamente de forma recombinante anticuerpos monocatenarios uniendo una región variable de cadena pesada (VH) y región variable de cadena ligera (VL) de un anticuerpo específico. Las secuencias de ácido nucleico particulares para las regiones variables pueden clonarse por métodos de biología molecular convencionales, tales como, por ejemplo, por reacción en cadena de la polimerasa (PCR) y otras tecnologías de ácido nucleico de recombinación. Se describen métodos para producir sFv, por ejemplo, en Whitlow y Filpula (1991) Methods, 2: 97-105; Bird et al. (1988) Science 242: 423-426; Pack et al. (1993) Bio/Technology 11: 1271-77; y Patentes de Estados Unidos N.º 4.946.778, 5.840.300, 5.667.988, 5.658.727, 5.258.498). También pueden identificarse anticuerpos monocatenarios explorando bibliotecas de anticuerpos monocatenarios con respecto a la unión con un antígeno diana. Se conocen bien en la técnica métodos para la construcción y exploración de dichas bibliotecas. 2. Anticuerpos anti VSR ejemplares Se proporcionan en el presente documento anticuerpos o fragmentos de unión a antígeno de los mismos que se unen con y neutralizan VSR. En particular los anticuerpos o fragmentos de unión a antígeno se unen inmunoespecíficamente con una proteína F de VSR.

Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen anticuerpos monoclonales, anticuerpos multiespecíficos, anticuerpos biespecíficos, anticuerpos humanos, anticuerpos humanizados, anticuerpos camelizados, anticuerpos quiméricos, Fv monocatenarios (scFv), anticuerpos monocatenarios, anticuerpos de un único dominio, fragmentos Fab, fragmentos F(ab’), Fv con enlaces disulfuro (sdFv) y anticuerpos antiidiotípicos (anti Id), intracuerpos o fragmentos de unión a antígeno de cualquiera de los anteriores. En particular, los anticuerpos incluyen moléculas de inmunoglobulina y fragmentos inmunológicamente activos de moléculas de inmunoglobulina, es decir, moléculas que contienen un sitio de unión a antígeno. Las moléculas de inmunoglobulina pueden ser de cualquier tipo (por ejemplo, IgG, IgE, IgM, IgD, IgA e IgY), clase (por ejemplo, IgG1, IgG2, IgG3, IgG4, IgA1 e IgA2) o subclase.

Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden usarse en los métodos de tratamiento y diagnóstico en formas que incluyen anticuerpos monoclonales, anticuerpos multiespecíficos, anticuerpos humanos, anticuerpos humanizados, anticuerpos camelizados, anticuerpos quiméricos, Fv monocatenarios (scFv), anticuerpos monocatenarios, anticuerpos de un único dominio, fragmentos Fab, fragmentos F(ab’), Fv con enlaces disulfuro (sdFv) y anticuerpo antiidiotípicos (anti Id), intracuerpos o fragmentos de unión a antígeno de cualquiera de los anteriores. En particular, los anticuerpos incluyen moléculas de inmunoglobulina y fragmentos inmunológicamente activos de moléculas de inmunoglobulina, es decir, moléculas que contienen un sitio de unión a antígeno. Las moléculas de inmunoglobulina pueden ser de cualquier tipo (por ejemplo, IgG, IgE, IgM, IgD, IgA e IgY), clase (por ejemplo, IgG1, IgG2, IgG3, IgG4, IgA1 e IgA2) o subclase.

Los anticuerpos anti VSR ejemplares o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento que se unen inmunoespecíficamente con una proteína F de VSR incluyen 58c5 y sc5, que son fragmentos Fab descritos en detalle en otra parte del presente documento. Los anticuerpos anti VSR ejemplares o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también incluyen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que contienen una cadena pesada, que contiene un dominio pesado variable (VH) y un dominio pesado constante 1 (CH1) y/o una cadena ligera que contiene un dominio variable ligero (VL) y un dominio constante ligero (CL) de 58c5. Por ejemplo, los anticuerpos anti VSR ejemplares o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que contienen una cadena pesada que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 1 y/o una cadena ligera que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 5. En un ejemplo particular, el anticuerpo anti VSR es un fragmento Fab que contiene una cadena pesada que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 1 y una cadena ligera que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 5.

Los anticuerpos proporcionados en el presente documento incluyen formas de anticuerpo de longitud completa de 58c5. Los anticuerpos proporcionados en el presente documento también incluyen formas de anticuerpo de longitud completa que contienen el sitio de unión a antígeno (por ejemplo CDR) de 58c5. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden contener cualquier región constante conocida en la técnica, tal como cualquier región constante humana conocida en la técnica, incluyendo, pero sin limitación, cadena ligera humana kappa (κ), cadena ligera humana lambda (λ), la región constante de IgG1, la región constante de IgG2, la región constante de IgG3 o la región constante de IgG4. Los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento pueden contener cualquier región constante que se conozca en la técnica. En algunos ejemplos, una o más regiones constantes del anticuerpo son humanas.

Los anticuerpos proporcionados en el presente documento incluyen otras formas de fragmentos de anticuerpo de 58c5 que se unen inmunoespecíficamente con una proteína F de VSR. Dichos fragmentos incluyen cualquier fragmento de unión a antígeno del mismo o un anticuerpo modificado técnicamente que contenga un fragmento o fragmentos de unión a antígeno de 58c5 que conserve la capacidad para unirse con una proteína F de VSR. Dichos anticuerpos incluyen, por ejemplo, anticuerpos quiméricos, Fv monocatenarios (scFv), anticuerpos monocatenarios, anticuerpos de un único dominio, fragmentos F(ab’), Fv con enlaces disulfuro (sdFv) y anticuerpo antiidiotípicos (anti Id), intracuerpos o fragmentos de unión a antígeno de cualquiera de los anteriores. En ejemplos particulares, el anticuerpo es el fragmento Fab 58c5. Los anticuerpos anti VSR ejemplares o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que contienen un dominio VH y/o un dominio variable ligero VL que tiene una secuencia de aminoácidos del dominio VH y/o dominio VL, respectivamente, de 58c5. Por ejemplo, un anticuerpo o fragmento de unión a antígeno del mismo puede contener un dominio VH que tiene la secuencia de aminoácidos expuesta en los aminoácidos 1-125 de SEC ID Nº: 1 y/o un dominio VL que tiene la secuencia de aminoácidos expuesta en los aminoácidos 1-107 de SEC ID Nº: 5. En un ejemplo, un anticuerpo o fragmento de unión a antígeno del mismo contiene un dominio VH que tiene la secuencia de aminoácidos expuesta en los aminoácidos 1-125 de SEC ID Nº: 1 y un dominio VL que tiene la secuencia de aminoácidos expuesta en los aminoácidos 1-107 de SEC ID Nº: 5. También se proporcionan anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que contienen una o más regiones determinantes de complementariedad (CDR) de VH de 58c5. El anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR1 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR1 de VH que tiene la secuencia de aminoácidos GASINSDNYYWT (SEC ID Nº: 2).

El anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR2 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR2 de VH que tiene la secuencia de aminoácidos HISYTGNTYYTPSLKS (SEC ID Nº: 3). El anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR3 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR3 de VH que tiene la secuencia de aminoácidos CGAYVLISNCGWFDS (SEC ID Nº: 4). En un ejemplo particular, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR1 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2, una CDR2 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3 y una CDR3 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4. También se proporcionan anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que contienen una o más regiones determinantes de complementariedad (CDR) de VL seleccionadas de entre las CDRD de 58c5. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR1 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR1 de VL que tiene la secuencia de aminoácidos QASQDISTYLN (SEC ID Nº: 6).

En otro ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR2 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR2 VL que tiene la secuencia de aminoácidos GASNLET (SEC ID Nº: 7).

En otro ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR3 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede contener una CDR3 de VL que tiene la secuencia de aminoácidos QQYQYLPYT (SEC ID Nº: 8).

En un ejemplo particular, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo contiene una CDR1 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6, una CDR2 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7 y una CDR3 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8. Puede seleccionarse cualquier combinación de CDR proporcionada en el presente documento para la generación de un anticuerpo o fragmento de unión a antígeno del mismo, siempre que el anticuerpo o fragmento de unión a antígeno conserve la capacidad para unirse inmunoespecíficamente con una proteína F de VSR. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden contener una región marco conservada de anticuerpo conocida en la técnica. Las regiones marco conservadas ejemplares incluyen regiones marco conservadas de origen natural o consenso aisladas, incluyendo regiones marco conservadas humanas (véase, por ejemplo, Chothia et al. (1998) J. Mol. Biol. 278: 457-479). En algunos ejemplos, la región marco conservada de anticuerpo es una región marco conservada de anticuerpo humana. En algunos ejemplos, el anticuerpo o fragmento de unión a antígeno contiene una región marco conservada de 58c5. Los anticuerpos anti VSR aislados ejemplares o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen cualquier anticuerpo anti VSR o fragmentos de unión a antígeno del mismo que se una inmunoespecíficamente con el mismo epítopo en una proteína de fusión (F) de virus sincitial respiratorio (VSR) que cualquiera de los anticuerpos proporcionados en el presente documento. En un ejemplo, se proporciona en el presente documento un anticuerpo que se une con el mismo epítopo que 58c5, que es el anticuerpo que contiene una cadena pesada expuesta en SEC ID Nº: 1 y una cadena ligerea expuesta en SEC ID Nº: 5. Típicamente, dichos anticuerpos contienen una cadena pesada variable (VH) y una cadena ligera variable (VL) o fragmentos de unión antígeno de las mismas. Los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento muestran una constante de afinidad de unión (Ka) para el epítopo de proteína F de VSR de al menos o aproximadamente 1 x 108 M-1, al menos o aproximadamente 2,5 x 108 M-1, al menos o aproximadamente 5 x 108 M-1, al menos o aproximadamente 1 x 109 M-1, al menos o aproximadamente 5 x 109 M-1, al menos o aproximadamente 1 x 1010 M-1, al menos o aproximadamente 5 x 1010 M-1, al menos o aproximadamente 1 x 1011 M-1, al menos o aproximadamente 5 x 1011 M-1, al menos o aproximadamente 1 x 1012 M-1, al menos o aproximadamente 5 x 1012 M-1, al menos o aproximadamente 1 x 1013 M-1, al menos o aproximadamente 5 x 1013 M-1, al menos o aproximadamente 1 x 1014 M- 1, al menos o aproximadamente 5 x 1014 M-1, al menos o aproximadamente 1 x 1015 M-1, o al menos o aproximadamente 5 x 1015 M-1. Los anticuerpos proporcionados en el presente documento pueden mostrar una afinidad de unión por una proteína F purificada de forma recombinante, tal como el dominio extracelular de la proteína F de la cepa A2 de VSR expuesta en SEC ID Nº: 25. Los anticuerpos proporcionados en el presente documento también pueden mostrar una afinidad de unión por la proteína F de VSR nativo, tal como se genera por infección y expresión de VSR en células. Los anticuerpos proporcionados en el presente documento pueden tener afinidades de unión que son iguales o diferentes para la proteína F purificada de forma recombinante frente a la proteína F de VSR nativa. Por ejemplo, el Ejemplo 4 muestra que 58c5 tiene una mayor afinidad de unión por la proteína F de VSR nativa que por la proteína F purificada de forma recombinante. Por el contrario, sc5 muestra afinidad de unión similar bien si la proteína F de VSR es nativa o bien si se expresa de forma recombinante.

En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento tienen una constante de disociación (Kd) para el epítopo de proteína F de VSR de menos de o aproximadamente 1 x 10-8 M, menos de o aproximadamente 4 x 10-9 M, menos de o aproximadamente 2 x 10-9 M, menos de o aproximadamente 1 x 10-9 M, menos de o aproximadamente 2 x 10-10 M, menos de o aproximadamente 1 x 10-10 M, menos de o aproximadamente 2 x 10-11 M, menos de o aproximadamente 1 x 10-11 M, menos de o aproximadamente 2 x 10-12 M, menos de o aproximadamente 1 x 10-12 M, menos de o aproximadamente 2 x 10-13 M, menos de o aproximadamente 1 x 10-13 M, menos de o aproximadamente 2 x 10-14 M, menos de o aproximadamente 1 x 10-14 M, menos de o aproximadamente 2 x 10-15 M, menos de o aproximadamente 1 x 10-15 M, o menos de o aproximadamente 2 x 10-16 M.

En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento tienen una CE50 de menos de o aproximadamente 0,005 nM, menos de o aproximadamente 0,01 nM, menos de o aproximadamente 0,025 nM, menos de o aproximadamente 0,05 nM, menos de o aproximadamente 0,075 nM, menos de o aproximadamente 0,1 nM, menos de o aproximadamente 0,5 nM, menos de o aproximadamente 0,75 nM, menos de o aproximadamente 1 nM, menos de o aproximadamente 1,25 nM, menos de o aproximadamente 1,5 nM, menos de o aproximadamente 1,75 nM, menos de o aproximadamente 2 nM en un ensayo de microneutralización in vitro para neutralización de VSR. En ejemplos particulares, los anticuerpos anti VSR aislados o fragmentos de unión a antígeno proporcionados en el presente documento tienen una CE50 para neutralización de VSR en un ensayo de reducción de placas in vitro de menos de o aproximadamente 0,005 nM a menos de o aproximadamente 2 nM; menos de o aproximadamente 0,005 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,005 nM a menos de o aproximadamente 0,5 nM; menos de o aproximadamente 0,01 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,05 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,05 nM a menos de o aproximadamente 0,5 nM; o menos de o aproximadamente 0,1 nM a menos de o aproximadamente 0,5 nM.

En algunos ejemplos, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento neutraliza mutantes de escape de anticuerpos monoclonales (MARM) contra diversos anticuerpos anti VSR en un ensayo de microneutralización in vitro para neutralización de VSR. En un ejemplo particular, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento neutraliza un MARM con una CE50 para neutralización que es o es aproximadamente la misma que la CE50 para neutralización de una cepa de VSR parental de la que se generó el MARM. Si un primer anticuerpo puede neutralizar un MARM generado contra un segundo anticuerpo, se puede concluir que los anticuerpos se unen específicamente con o interaccionan con diferentes epítopos. En algunos ejemplos, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento inhibe la unión de VSR con su receptor de célula hospedadora en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la unión de VSR con su receptor de célula hospedadora en ausencia del anticuerpo anti VSR o fragmento de unión a antígeno del mismo. En algunos ejemplos, un anticuerpo anti VSR o fragmento de unión a antígeno proporcionado en el presente documento inhibe la replicación de VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la replicación de VSR en ausencia del anticuerpo anti VSR o fragmento de unión a antígeno del mismo. En algunos ejemplos los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento tienen una semivida de 15 días o más, 20 días o más, 25 días o más, 30 días o más, 40 días o más, 45 días o más, 50 días o más, 55 días o más, 60 días o más, 3 meses o más, 4 meses o más o 5 meses o más. Se conocen en la técnica métodos para aumentar la semivida de un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento. Dichos métodos incluyen, por ejemplo, PEGilación, glucosilación y sustitución de aminoácidos como se describe en otra parte en el presente documento.

a. Anticuerpos derivados Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden usarse para generar anticuerpos derivados tales como anticuerpos quiméricos u otros fragmentos de unión a antígeno, tales como por ejemplo, fragmentos Fab, Fab’, F(ab’)2, Fv monocatenario (scFv), Fv, dsFv, diacuerpo, Fd y Fd’. En general, el anticuerpo derivado o fragmento de unión a antígeno derivado de un anticuerpo parental conserva la especificidad de unión del anticuerpo parental. Pueden generarse fragmentos de anticuerpo por cualquier técnica conocida por los expertos en la materia. Por ejemplo, pueden producirse fragmentos Fab y F(ab’)2 por escisión proteolítica de moléculas de inmunoglobulina, usando enzimas tales como papaína (para producir fragmentos Fab) o pepsina (para producir fragmentos F(ab’)2). Los fragmentos F(ab’)2 contienen la región variable, la región constante de cadena ligera y el dominio CH1 de la cadena pesada. Además, también pueden generarse anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento usando diversos métodos de presentación en fagos conocidos en la técnica. En algunos ejemplos, las regiones variables de unión a antígeno de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden fusionarse de forma recombinante con una o más regiones constantes conocidas en la técnica para generar anticuerpos de longitud completa quiméricos, Fab, Fab’, F(ab’)2 u otros fragmentos de unión a antígeno. Se conocen en la técnica y se proporcionan en el presente documento métodos ejemplares para generar anticuerpos de longitud completa a partir de fragmentos de anticuerpo. Se conocen en la técnica métodos para producir anticuerpos quiméricos (véase por ejemplo, Morrison (1985) Science 229: 1202; Oi et al. (1986) BioTechniques 4: 214; Gillies et al. (1989) J. Immunol. Methods 125: 191-202; y Patentes de Estados Unidos N.º 5.807.715, 4.816.567 y 4.816.397). Pueden producirse anticuerpos quiméricos que comprenden una o más CDR de un anticuerpo anti VSR proporcionado en el presente documento y regiones marco conservadas de una molécula de inmunoglobulina heteróloga usando una diversidad de técnicas conocidas en este campo incluyendo, por ejemplo, injertos de CDR (documentos EP 239.400; publicación de PCT N.º WO 91/09967; y Patentes de Estados Unidos N.º 5.225.539, 5.530.101 y 5.585.089), revestimiento o renovación de superficie (documentos EP 592.106; EP 519.596; Padlan (1991) Molecular Immunology 28(4/5): 489-498; Studnicka et al. (1994) Protein Engineering 7(6): 805-814; y Roguska et al. (1994) PNAS 91: 969-973), y redistribución de cadenas (Patente de Estados Unidos N.º 5.565.332).

En algunos ejemplos, los anticuerpos contienen una o más CDR de 58c5 (por ejemplo, una o más CDR expuestas en SEC ID Nº: 2-4, 1627 y 6-8) y una región marco conservada heteróloga. Los restos marco conservados en las regiones marco conservadas pueden sustituirse con el resto correspondiente del anticuerpo donante de CDR para alterar, tal como mejorar, la unión a antígeno. Estas sustituciones de marco conservados se identifican por métodos bien conocidos en la técnica, por ejemplo, por modelización de las interacciones de la CDR y los restos marco conservados para identificar restos de marco conservado importantes para la unión a antígeno y comparación de secuencias para identificar restos marco conservados poco habituales en posiciones particulares (véase, por ejemplo, Patente de Estados Unidos N.º 5.585.089; y Riechmann et al. (1988) Nature 332: 323). En algunos ejemplos, los anticuerpos anti VSR derivados o fragmentos de unión a antígeno de los mismos tienen una constante de afinidad de unión (Ka) para el epítopo de proteína F de VSR de al menos o aproximadamente 1 x 108 M-1, al menos o aproximadamente 2,5 x 108 M-1, al menos o aproximadamente 5 x 108 M-1, al menos o aproximadamente 1 x 109 M-1, al menos o aproximadamente 5 x 109 M-1, al menos o aproximadamente 1 x 1010 M-1, al menos o aproximadamente 5 x 1010 M-1, al menos o aproximadamente 1 x 1011 M-1, al menos o aproximadamente 5 x 1011 M-1, al menos o aproximadamente 1 x 1012 M-1, al menos o aproximadamente 5 x 1012 M-1, al menos o aproximadamente 1 x 1013 M-1, al menos o aproximadamente 5 x 1013 M-1, al menos o aproximadamente 1 x 1014 M- 1 , al menos o aproximadamente 5 x 1014 M-1, al menos o aproximadamente 1 x 1015 M-1, o al menos o aproximadamente 5 x 1015 M-1. En algunos ejemplos, los anticuerpos anti VSR derivados o fragmentos de unión a antígeno de los mismos tienen una constante de disociación (Kd) para el epítopo de proteína F de VSR de menos de o aproximadamente 1 x 10-8 M, menos de o aproximadamente 4 x 10-9 M, menos de o aproximadamente 2 x 10-9 M, menos de o aproximadamente 1 x 10-9 M, menos de o aproximadamente 2 x 10-10 M, menos de o aproximadamente 1 x 10-10 M, menos de o aproximadamente 2 x 10-11 M, menos de o aproximadamente 1 x 10-11 M, menos de o aproximadamente 2 x 10-12 M, menos de o aproximadamente 1 x 10-12 M, menos de o aproximadamente 2 x 10-13 M, menos de o aproximadamente 1 x 10-13 M, menos de o aproximadamente 2 x 10-14 M, menos de o aproximadamente 1 x 10-14 M, menos de o aproximadamente 2 x 10-15 M, menos de o aproximadamente 1 x 10-15 M, o menos de o aproximadamente 2 x 10-16 M. En algunos ejemplos, los anticuerpos anti VSR derivados o fragmentos de unión a antígeno de los mismos tienen CE50 de menos de o aproximadamente 0,005 nM, menos de o aproximadamente 0,01 nM, menos de o aproximadamente 0,025 nM, menos de o aproximadamente 0,05 nM, menos de o aproximadamente 0,075 nM, menos de o aproximadamente 0,1 nM, menos de o aproximadamente 0.5 nM, menos de o aproximadamente 0,75 nM, menos de o aproximadamente 1 nM, menos de o aproximadamente 1,25 nM, menos de o aproximadamente 1,5 nM, menos de o aproximadamente 1,75 nM, o menos de o aproximadamente 2 nM en un ensayo de microneutralización in vitro para neutralización de VSR. En ejemplos particulares, los anticuerpos anti VSR derivados o fragmentos de unión a antígeno de los mismos tienen una CE50 para neutralización de VSR en un ensayo de reducción de placas in vitro de menos de o aproximadamente 0,005 nM a menos de o aproximadamente 2 nM; menos de o aproximadamente 0,005 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,005 nM a menos de o aproximadamente 0,5 nM; menos de o aproximadamente 0,01 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,05 nM a menos de o aproximadamente 1 nM; menos de o aproximadamente 0,05 nM a menos de o aproximadamente 0,5 nM; o menos de o aproximadamente 0,1 nM a menos de o aproximadamente 0,5 nM. Puede usarse cualquier derivado de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento en regímenes terapéuticos, terapias profilácticas y/o técnicas de diagnóstico, tal como en los métodos proporcionados. Por ejemplo, los anticuerpos derivados o fragmentos de unión a antígeno de los mismos pueden usarse para unirse con VSR para el tratamiento, la prevención y/o la detección de infección por VSR o alivio de uno o más síntomas de una infección por VSR. i. Anticuerpos monocatenarios En ejemplos particulares, el anticuerpo anti VSR es un anticuerpo monocatenario. Un anticuerpo monocatenario puede generarse a partir de los dominios de unión a antígeno de cualquiera de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. Se conocen en la técnica métodos para generar anticuerpos monocatenarios usando técnicas recombinantes, tales como las descritas en, por ejemplo, Marasco et al. (1993) Proc. Natl. Acad. Sci. 90: 7889-7893, Whitlow y Filpula (1991) Methods, 2: 97-105; Bird et al. (1988) Science 242: 423-426; Pack et al. (1993) Bio/Technology 11: 1271-77; y Patentes de Estados Unidos N.º 4.946.778, 5.840.300, 5.667.988, 5.658.727. Un anticuerpo monocatenario puede contener un dominio variable de cadena ligera (VL) o región funcional del mismo y un dominio variable de cadena pesada (VH) o región funcional del mismo de cualquier anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, el dominio VL o región funcional del mismo del anticuerpo monocatenario contiene una región determinante de complementariedad 1 (CDR1), una región determinante de complementariedad 2 (CDR2) y/o una región determinante de complementariedad 3 (CDR3) de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, el dominio VH o región funcional del mismo del anticuerpo monocatenario contiene una región determinante de complementariedad 1 (CDR1), una región determinante de complementariedad 2 (CDR2) y una región determinante de complementariedad 3 (CDR3) de cualquier anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, el anticuerpo monocatenario contiene además un enlazador peptídico. En dichos ejemplos, un enlazador peptídico puede localizarse entre el dominio variable de cadena ligera (VL) y el dominio variable de cadena pesada (VH). El anticuerpo monocatenario puede contener un espaciador peptídico, o enlazador, entre el o los dominios del anticuerpo. Por ejemplo, el dominio variable de cadena ligera (VL) de un anticuerpo puede acoplarse con un dominio variable de cadena pesada (VH) mediante un péptido enlazador flexible. Diversos enlazadores peptídicos se conocen bien en la técnica y pueden emplearse en los métodos proporcionados. Un enlazador peptídico puede incluir una serie de restos de glicina (Gly) o restos de Serina (Ser). Son ejemplos de enlazadores polipeptídicos péptidos que tienen las secuencias de aminoácidos (Gly-Ser)n, (GlymSer)n o (SermGly)n, en las que m es 1 a 6, generalmente 1 a 4, y típicamente 2 a 4, y n es 1 a 30, o 1 a 10, y típicamente 1 a 4, con algunos restos de ácido glutámico (Glu) o lisina (Lys) dispersados por toda la secuencia para aumentar la solubilidad (véase, por ejemplo, solicitud de PCT Internacional N.º WO 96/06641, que proporciona enlazadores ejemplares para su uso en conjugados). Los enlazadores peptídicos ejemplares incluyen, pero sin limitación péptidos que tienen la secuencia GGSSRSSSSGGGGSGGGG (SEC ID Nº: 1512), GSGRSGGGGSGGGGS (SEC ID Nº: 1513), EGKSSGSGSESKST (SEC ID Nº: 1514), EGKSSGSGSESKSTQ (SEC ID Nº: 1515), EGKSSGSGSESKVD (SEC ID Nº: 1516), GSTSGSGKSSEGKG (SEC ID Nº: 1517), KESGSVSSEQLAQFRSLD (SEC ID Nº: 1518), y ESGSVSSEELAFRSLD (SEC ID Nº: 1519). En general, los péptidos enlazadores son de aproximadamente 1-50 aminoácidos de longitud. Los enlazadores usados en el presente documento también pueden aumentar la disponibilidad intracelular, la estabilidad en suero, la especificidad y la solubilidad o proporcionar flexibilidad aumentada o aliviar el impedimento estérico. Se describen restos de enlace, por ejemplo, en Huston et al. (1988) Proc Natl Acad Sci USA 85: 5879- 5883, Whitlow et al. (1993) Protein Engineering 6: 989-995, y Newton et al., (1996) Biochemistry 35: 545-553. Otros enlazadores peptídicos adecuados incluyen cualquiera de los descritos en la Patente de Estados Unidos N.º 4.751.180 o 4.935.233. ii. Anticuerpos antiidiotípicos Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden utilizarse para generar anticuerpos antiidiotípicos que “imitan” el antígeno de proteína F de VSR, con el que se une el anticuerpo de forma inmunoespecífica, usando técnicas bien conocidas por los expertos en la materia (véase, por ejemplo, Greenspan y Bona (1989) FASEB J. 7(5): 437-444; y Nissinoff (1991) J. Immunol. 147(8): 2429-2438). Por ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento que se unen con e inhiben de forma competitiva la unión de VSR con su receptor de célula hospedadora, como se determina por ensayos bien conocidos en la técnica, pueden usarse para generar antiidiotipos que “imitan” un antígeno de VSR y se unen con los receptores de VSR, es decir, compiten con el virus por la unión con la célula hospedadora, reduciendo de este modo la tasa de infección de células hospedadoras con virus. En algunos ejemplos, pueden generarse anti antiidiotipos por técnicas bien conocidas por los expertos en la materia. Los anti antiidiotipos imitan el dominio de unión del anticuerpo anti VSR o fragmento de unión a antígeno del mismo y, como consecuencia, se unen con y neutralizan VSR. iii. Anticuerpos multiespecíficos y multimerización de anticuerpos Dos o más anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse técnicamente para formar anticuerpos derivados multivalentes, o multímeros, tales como anticuerpos derivados bivalentes, trivalentes, tetravalentes, pentavalentes, hexavalentes, heptavalentes o de mayor valencia (es decir, que contienen 2, 3, 4, 5, 6, 7 o más sitios de unión a antígeno). Dichos anticuerpos derivados multivalentes pueden ser monoespecíficos, biespecíficos, triespecíficos o de mayor multiespecificidad. En algunos ejemplos, los anticuerpos derivados multivalentes son monoespecíficos, que contienen dos o más dominios de unión a antígeno que se unen inmunoespecíficamente con el mismo epítopo. En algunos ejemplos, los anticuerpos derivados multivalentes son multiespecíficos, que contienen dos o más dominios de unión a antígeno que se unen inmunoespecíficamente con dos o más epítopos diferentes. En algunos ejemplos particulares, los anticuerpos derivados multivalentes son bivalentes, que contienen dos dominios de unión a antígeno. Dichos anticuerpos bivalentes pueden ser anticuerpos homobivalentes o heterobivalentes, que se unen inmunoespecíficamente con el mismo o diferentes epítopos, respectivamente. En algunos ejemplos, los anticuerpos multiespecíficos pueden unirse imunoespecíficamente con dos o más epítopos diferentes de VSR. Se conocen en este campo técnicas para obtener técnicamente anticuerpos multiespecíficos, e incluyen, por ejemplo, enlace de dos o más fragmentos de unión a antígeno mediante enlace covalente, no covalente o químico. En algunos casos, pueden formarse anticuerpos derivados multivalentes por dimerización de dos o más anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. La multimerización entre dos anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos puede ser espontánea, o puede producirse debido a enlace forzado de dos o más polipéptidos. En un ejemplo, pueden unirse multímeros de anticuerpos anti VSR por enlaces disulfuro formados entre restos de cisteína en diferentes anticuerpos anti VSR. En otro ejemplo, los anticuerpos derivados multivalentes pueden incluir anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos unidos mediante interacciones covalentes o no covalentes con restos peptídicos fusionados con el anticuerpo o fragmento de unión a antígeno del mismo. Dichos péptidos puede ser enlazadores peptídicos (espaciadores) o péptidos que tienen la propiedad de promover la multimerización. En algunos ejemplos, pueden formarse anticuerpos derivados multivalentes entre dos anticuerpos mediante enlace químico, tal como por ejemplo, usando enlazadores heterobifuncionales. Puede generarse cualquier anticuerpo derivado multiespecífico y/o multivalente a partir de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento siempre que el anticuerpo sea biocompatible (por ejemplo, para administración a animales, incluyendo seres humanos) y mantiene su actividad, tal como la unión con uno o más epítopos de y/o neutralización de VSR. Para los anticuerpos derivados multiespecíficos y multivalentes proporcionados en el presente documento, el anticuerpo derivado es al menos inmunoespecífico para un epítopo reconocido por 58c5 o sc5. En algunos ejemplos, el anticuerpo multiespecífico y/o multivalente contiene una CDR1 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 2, una CDR2 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 3, una CDR3 de VH que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 4, una CDR1 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 6, una CDR2 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 7, una CDR3 de VL que tiene la secuencia de aminoácidos expuesta en SEC ID Nº: 8, o cualquier combinación de las mismas.

En algunos ejemplos, pueden generarse anticuerpos multiespecíficos que se unen inmunoespecíficamente con dos o más epítopos de una proteína F de VSR (por ejemplo, una proteína F de VSR que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1527, 1629 o 1630). Por ejemplo, los anticuerpos multiespecíficos pueden unirse inmunoespecíficamente con dos o más epítopos diferentes en las regiones antigénicas A, B o C de la proteína F de VSR. En algunos ejemplos, pueden generarse anticuerpos multiespecíficos que se unen inmunoespecíficamente con un epítopo de una proteína F de VSR y otro epítopo de VSR. Por ejemplo, los anticuerpos multiespecíficos pueden unirse inmunoespecíficamente con un epítopo de una proteína F de VSR y un epítopo de otra glucoproteína de superficie de VSR. En algunos ejemplos, los anticuerpos multiespecíficos pueden unirse inmunoespecíficamente con un epítopo de una proteína F de VSR y un epítopo de una proteína de VSR seleccionada de entre una proteína de unión a VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1520), una proteína estructural grande de subunidad beta de ARN polimerasa de VSR (proteína L) (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1521), una proteína de nucleocápsida de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1522), una nucleoproteína (N) de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1523), una fosfoproteína P de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1524), una proteína de matriz de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1525), una proteína hidrófoba pequeña (SH) de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1526), una polimerasa dependiente de ARN de VSR, una proteína G de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1528), o una variante alélica de cualquiera de las anteriores. En algunos ejemplos, los anticuerpos multiespecíficos pueden unirse inmunoespecíficamente con un epítopo de una proteína F de VSR y un epítopo de una proteína G de VSR. En algunos ejemplos, el anticuerpo multiespecífico contiene un fragmento de unión a antígeno anti VSR derivado de 58c5 o sc5 y un fragmento de unión a antígeno anti VSR derivado de otro anticuerpo anti VSR. En algunos ejemplos, el anticuerpo multiespecífico contiene un fragmento de unión a antígeno anti VSR derivado de 58c5 o sc5 y un fragmento de unión a antígeno anti VSR derivado de un anticuerpo anti VSR seleccionado entre palivizumab (SYNAGIS®), y derivados del mismo, tales como, pero sin limitación, motavizumab (NUMAX®), AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, Alh5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S (véase, por ejemplo, Patentes de Estados Unidos N.º 5.824.307 y 6.818.216). En algunos ejemplos, el anticuerpo multiespecífico contiene un fragmento de unión a antígeno anti VSR derivado de 58c5 o sc5 y un fragmento de unión a antígeno anti VSR derivado de un anticuerpo anti VSR humano, tal como, pero sin limitación, rsv6, rsv11, rsv13, rsv19 (es decir Fab 19), rsv21, rsv22, rsv23, RF- 1, y RF-2 (véase, por ejemplo, Patentes de Estados Unidos N.º 6.685.942 y 5.811.524). En algunos ejemplos, el anticuerpo multiespecífico contiene un fragmento de unión a antígeno anti VSR derivado de 58c5 y un fragmento de unión a antígeno anti VSR derivado de un anticuerpo monoclonal de ratón anti VSR tal como, pero sin limitación, MAb 1153, 1142, 1200, 1214, 1237, 1129, 1121, 1107, 1112, 1269, 1269, 1243 (Beeler et al. (1989) J. Virology 63(7): 2841-2950), MAb151 (Mufson et al. (1987) J. Clin. Microbiol. 25: 1635-1539), MAb 43-1 y 13-1 (Fernie et al. (1982) Proc. Soc. Exp. Biol. Med. 171: 266-271), MAb 1436C, 1302A, 1308F y 1331H (Anderson et al. (1984) J. Clin. Microbiol. 19: 934-936), y derivados humanizados de los mismos. Los anticuerpos ejemplares adicionales o fragmentos de unión a antígeno de los mismos que pueden usarse para generar un anticuerpo multiespecífico que contiene un fragmento de unión a antígeno anti VSR derivado de 58c5 incluyen, pero sin limitación, anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos descritos, por ejemplo, en las Patentes de Estados Unidos N.º 6.413.771, 5.840.298, 5.811.524, 6.656.467, 6.537.809, 7.364.742, 7.070.786, 5.955.364, 7.488.477, 6.818.216, 5.824.307, 7.364.737, 6.685.942 y 5.762.905 y Publicaciones de Patente de Estados Unidos N.º 2007-0082002, 2005-0175986, 2004-0234528, 2006-0198840, 2009-0110684, 2006-0159695, 2006-0013824, 2005-0288491, 2005- 0019758, 2008-0226630, 2009-0137003, y 2009-0092609.

En algunos ejemplos, los anticuerpos multiespecíficos o fragmentos de unión a antígeno pueden unirse inmunoespecíficamente con un epítopo de una proteína F de VSR y un epítopo de otro polipéptido heterólogo u otro material antigénico, tal como, por ejemplo, un material de soporte sólido (véase, por ejemplo, Publicaciones de PCT Internacionales N.º WO 93/17715, WO 92/08802, WO 91/00360, y WO 92/05793; Patentes de Estados Unidos N.º 4.474.893, 4.714.681, 4.925.648, 5.573.920 y 5.601.819; Tutt, et al., (1991) J. Immunol. 147: 60-69; y Kostelny et al., (1992) J. Immunol. 148: 1547-1553. (1) Multimerización mediante enlazadores peptídicos Pueden usarse enlazadores peptídicos para producir anticuerpos multivalentes, tal como, por ejemplo, un multímero en el que un compañero de multimerización es un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En un ejemplo, los enlazadores peptídicos pueden fusionarse con el extremo C terminal de un primer polipéptido y el extremo N terminal de un segundo polipéptido. Esta estructura puede repetirse múltiples veces de modo que al menos uno, tal como 2, 3, 4 o más polipéptidos solubles se unen entre sí mediante enlazadores peptídicos en sus extremos respectivos. Por ejemplo, un polipéptido multimérico puede tener una secuencia Z1-X-Z2, en la que Z1 y Z2 son cada uno una secuencia de un fragmento de unión a antígeno anti VSR (por ejemplo un anticuerpo monocatenario anti VSR; véase, por ejemplo, Patente de Estados Unidos N.º 6.759.518, que describe la multimerización de anticuerpos monocatenarios) y en la que X es una secuencia de un enlazador peptídico. En algunos casos, Z1 y/o Z2 es un fragmento de unión a antígeno anti VSR proporcionado en el presente documento. En otro ejemplo, Z1 y Z2 son diferentes fragmentos de unión a antígeno anti VSR, en los que al menos Z1 o Z2 deriva de anticuerpo anti VSR o fragmento de unión a antígeno proporcionado en el presente documento. En algunos ejemplos, el polipéptido multimérico tiene una secuencia de Z1-X-Z2-(X-Z)n, en la que “n” es cualquier número entero, es decir generalmente 1 o 2. Típicamente, el enlazador peptídico es de suficiente longitud para permitir que cada fragmento de unión a antígeno anti VSR se una con su epítopo respectivo sin interferir con la especificidad de unión del anticuerpo. (2) Multimerización mediante agentes de enlace heterobifuncionales El enlace de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento con otro anticuerpo anti VSR o fragmento de unión a antígeno para crear un anticuerpo multivalente puede ser directo o indirecto. Por ejemplo, el enlace de dos o más anticuerpos anti VSR o fragmentos de unión a antígeno puede conseguirse por enlace químico o facilitarse por enlazadores heterobifuncionales, tales como cualquiera conocido en la técnica o proporcionado en el presente documento.

Los expertos en la materia conocen numerosos reactivos de reticulación heterobifuncionales que se usan para formar enlaces covalentes entre grupos amino y grupos tiol y para introducir grupos tiol en proteínas (véase, por ejemplo, el PIERCE CATALOG, ImmunoTechnology Catalog & Handbook, 1992-1993, que describe la preparación de y uso de dichos reactivos y proporciona una fuente comercial para dichos reactivos; véase, también, por ejemplo, Cumber et al., (1992) Bioconjugate Chem. 3: 397-401; Thorpe et al., (1987) Cancer Res. 47: 5924-5931; Gordon et al., (1987) Proc. Natl. Acad Sci. 84: 308-312; Walden et al., (1986) J. Mol. Cell Immunol. 2: 191-197; Carlsson et al., (1978) Biochem. J. 173: 723-737; Mahan et al., (1987) Anal. Biochem. 162: 163-170; Wawryznaczak et al., (1992) Br. J. Cancer 66: 361-366; Fattom et al., (1992) Infection & Immun. 60: 584-589). Estos reactivos pueden usarse para formar enlaces covalentes entre dos anticuerpos o entre cada uno de los anticuerpos y un enlazador. Los reactivos ejemplares incluyen, pero sin limitación: N-succinimidil-3-(2-piridilditio)propionato (SPDP; enlazador disulfuro); sulfosuccinimidil 6-[3-(2-piridilditio)-propionamido]hexanoato (sulfo-LC-SPDP); succinimidiloxicarbonil-α- metil bencil tiosulfato (SMBT, enlazador disulfato impedido); succinimidil 6-[3-(2-piridilditio) propionamido]-hexanoato (LC-SPDP); sulfosuccinimidil 4-(N-maleimidometil)ciclohexano-1-carboxilato (sulfo-SM-CC); succinimidil 3-(2- piridilditio)butirato (SPDB; enlazador de enlace disulfuro impedido); sulfosuccinimidil 2-(7-azido-4-metilcoumarin-3- acetamida) etil-1,3’-ditiopropionato (SAED); sulfosuccinimidil 7-azido-4-metilcoumarin-3-acetato (SAMCA); sulfosuccinimidil-6-[alfa-metil-alfa-(2-piridilditio)toluamido]-hexanoato (sulfo-LC-SMPT); 1,4-di-[3’-(2’- piridilditio)propionamido]butano (DPDPB); 4-succinimidiloxicarbonil-α-metil-α-(2-piridiltio)tolueno (SMPT, enlazador disulfato impedido); sulfosuccinimidil-6-[α-metil-α-(2-pirimidilditio)toluamido]hexanoato (sulfo-LC-SMPT); m- maleimidobenzoil-N-hidroxi-succinimida éster (MBS); m-maleimidobenzoil-N-hidroxisulfo-succinimida éster (sulfo- MBS); N-succinimidil(4-yodoacetil)aminobenzoato (SIAB; enlazador de tioéter); sulfosuccinimidil-(4-yodoacetil)amino benzoato (sulfo-SIAB); succinimidil-4-(p-maleimido-fenil)butirato (SMPB); sulfosuccinimidil-4-(p-maleimido- fenil)butirato (sulfo-SMPB); y azidobenzoil hidracida (ABH). En algunos ejemplos, los enlazadores pueden usarse en combinación con enlazadores peptídicos, tales como los que aumentan la flexibilidad o solubilidad o que proporcionan o eliminan impedimento estérico. Puede emplearse cualquier otro enlazador conocido por los expertos en la materia para unir una molécula peptídica con otra molécula. (3) Dominios de multimerización de polipéptidos La interacción de dos o más fragmentos de unión a antígeno para formar anticuerpos derivados multivalentes y/o multiespecíficos pueden facilitarse por su enlace, bien directa o bien indirectamente, con cualquier resto u otro polipéptido que sean en sí mismos capaces de interaccionar para formar una estructura estable. Por ejemplo, pueden unirse cadenas polipeptídicas codificadas por separado mediante multimerización, de modo que la multimerización de los polipéptidos está mediada por un dominio de multimerización. Típicamente, el dominio de multimerización posibilita la formación de una interacción proteína-proteína estable entre un primer polipéptido quimérico y un segundo polipéptido quimérico. Los polipéptidos quiméricos incluyen, por ejemplo, enlace (directo o indirecto) de una cadena (por ejemplo, una cadena de dominio variable pesado o dominio de cadena ligera variable) de un anticuerpo o fragmento de unión a antígeno del mismo con un dominio de multimerización. Típicamente, el dominio de multimerización se une con un dominio de cadena pesada del anticuerpo o fragmento de unión a antígeno del mismo. Dichos polipéptidos quiméricos pueden generarse como proteínas de fusión usando técnicas recombinantes para fusionar ácido nucleico que codifica la cadena de anticuerpo con ácido nucleico que codifica el dominio de multimerización. Para los anticuerpos derivados multivalentes y/o multiespecíficos proporcionados en el presente documento, al menos un compañero de multimerización es un anticuerpo anti VSR o fragmento de unión a antígeno del mismo unido directa o indirectamente con un dominio de multimerización. Pueden generarse polipéptidos homo o heteromultiméricos a partir de la expresión conjunta de polipéptidos quiméricos separados. Los primer y segundo polipéptidos quiméricos pueden ser iguales o diferentes. En general, un dominio de multimerización incluye cualquier polipéptido capaz de formar una interacción proteína- proteína estable con otro polipéptido. Los dominios de multimerización pueden interaccionar, por ejemplo, mediante una secuencia de inmunoglobulina (por ejemplo, un dominio Fc), una cremallera de leucina, una región hidrófoba, una región hidrófila o un tiol libre que forma un enlace disulfuro intermolecular entre las moléculas quiméricas de un homo o heteromultímero. Además, un dominio de multimerización puede incluir una secuencia de aminoácidos que comprenda una protuberancia complementaria de una secuencia de aminoácidos que comprende un orificio o bolsillo, tal como se describe, por ejemplo, en la Patente de Estados Unidos N.º 5.731.168. Dicha región de multimerización puede modificarse técnicamente de modo que las interacciones estéricas no solamente promuevan la interacción estable, sino que promuevan además la formación de heterodímeros frente a homodímeros a partir de una mezcla de monómeros quiméricos. En algunos ejemplos, se generan anticuerpos multivalentes y/o multiespecíficos mediante enlace de dos fragmentos de unión a antígeno anti VSR mediante dominio de multimerización. En dichos ejemplos, al menos uno de los fragmentos de unión a antígeno deriva de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento, tal como, por ejemplo, 58c5 o sc5. Un polipéptido de unión a antígeno, tal como por ejemplo fragmento de unión a antígeno anti VSR, puede conjugarse con un dominio de multimerización para formar un polipéptido quimérico. Para fragmentos de unión a antígeno anti VSR que contengan más de una cadena (por ejemplo, una cadena de dominio variable pesado y un dominio de cadena ligera variable), el dominio de multimerización puede conjugarse con una de las cadenas, típicamente la cadena pesada. El fragmento de unión a antígeno se une típicamente con el dominio de multimerización típicamente mediante su extremo N o C terminal con el extremo N o C terminal del dominio de multimerización. Típicamente, el dominio de multimerización se conjuga con el extremo C terminal del fragmento de unión a antígeno (por ejemplo, el extremo C terminal de un anticuerpo monocatenario o el extremo C terminal de una cadena del fragmento de unión a antígeno). El enlace puede ser directo o indirecto mediante un enlazador. Además, el polipéptido quimérico puede ser una proteína de fusión o puede formarse por enlace químico, tal como mediante interacciones covalentes o no covalentes. Por ejemplo, cuando se prepare un polipéptido quimérico que contenga un dominio de multimerización, el ácido nucleico que codifica todo o parte de un fragmento de unión a antígeno anti VSR puede unirse operativamente con ácido nucleico que codifica la secuencia de dominio de multimerización, directa o indirectamente u opcionalmente mediando un dominio enlazador. Típicamente, la construcción codifica una proteína quimérica en la que el extremo C terminal del fragmento de unión a antígeno anti VSR (o cadena individual del fragmento de unión a antígeno) se une con el extremo N terminal del dominio de multimerización.

Un anticuerpo multivalente proporcionado en el presente documento contiene dos proteínas quiméricas creadas por enlace, directo o indirecto, de dos fragmentos de unión a antígeno anti VSR iguales o diferentes directa o indirectamente con un dominio de multimerización. En algunos ejemplos, cuando el dominio de multimerización es un polipéptido, una fusión génica que codifica el polipéptido quimérico de dominio de multimerización de fragmento de unión a antígeno anti VSR (o cadena individual del fragmento de unión a antígeno) se inserta en un vector de expresión apropiado. Las proteínas quiméricas de dominio de multimerización-fragmento de unión-antígeno anti VSR resultantes pueden expresarse en células hospedadoras transformadas con el vector de expresión recombinante, y permitirse que se ensamblen en multímeros, en los que los dominios de multimerización interaccionan para formar anticuerpos multivalentes. También puede efectuarse enlace químico de dominios de multimerización con fragmentos de unión a antígeno anti VSR usando enlazadores heterobifuncionales como se ha analizado anteriormente. En algunos ejemplos, los anticuerpos multivalentes son anticuerpos multiespecíficos que derivan de dos o más fragmentos de unión a antígeno anti VSR que se unen con diferentes epítopos. Los polipéptidos quiméricos resultantes, y anticuerpos multivalentes formados a partir de los mismos, pueden purificarse por cualquier método adecuado conocido en la técnica, tal como, por ejemplo, por cromatografía de afinidad sobre columnas de proteína A o proteína G. Cuando dos moléculas de ácido nucleico que codifican diferentes polipéptidos quiméricos de unión a antígeno anti VSR se transforman en células, se producirá formación de homo y heterodímeros. Las condiciones para expresión pueden ajustarse de modo que se favorezca la formación de heterodímeros frente a la formación de homodímeros.

(a) Dominio de inmunoglobulina Los dominios de multimerización incluyen los que comprenden un resto de tiol libre capaz de reaccionar para formar un enlace disulfuro intermolecular con un dominio de multimerización de una secuencia de aminoácidos adicional. Por ejemplo, un dominio de multimerización puede incluir una parte de una molécula de inmunoglobulina, tal como de IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgM e IgE. En general, la parte de una inmunoglobulina seleccionada para su uso como un dominio de multimerización es la región constante (Fc). Se han descrito preparaciones de proteínas de fusión que contienen polipéptidos fusionados con diversas partes de polipéptidos derivados de anticuerpos, incluyendo el dominio Fc (véase, por ejemplo, Ashkenazi et al. (1991) PNAS 88: 10535; Byrn et al. (1990) Nature, 344:677; y Hollenbaugh y Aruffo, (1992) “Construction of Immunoglobulin Fusion Proteins”, en Current Protocols in Immunology, Supl. 4, pp. 10.19.1-10.19.11). En seres humanos, hay cinco isotipos de anticuerpos clasificados basándose en sus cadenas pesadas indicadas como delta (δ), gamma (γ), mu (µ), alfa (α) y épsilon (ε), que dan lugar a las clases IgD, IgG, IgM, IgA e IgE de anticuerpos, respectivamente. Las clases IgA e IgG contienen las subclases IgA1, IgA2, IgG1, IgG2, IgG3 e IgG4.

Las diferencias de secuencia entre cadenas pesadas de inmunoglobulina provocan que los diversos isotipos difieran, por ejemplo, en el número de dominios constantes (C), la presencia de una región bisagra y el número y localización de enlaces disulfuro intercatenarios. Por ejemplo, las cadenas pesadas de IgM e IgE contienen un dominio C extra (C4), que reemplaza la región bisagra. Las regiones Fc de IgG, IgD e IgA se emparejan entre sí mediante sus dominios Cγ3, Cδ3 y Cα3, mientras que las regiones Fc de IgM e IgE dimerizan mediante sus dominios Cµ4 y Cε4.

IgM e IgA forman estructuras multivalentes con diez y cuatro sitios de unión a antígeno, respectivamente. Los polipéptidos quiméricos de unión a antígeno proporcionados en el presente documento incluyen polipéptidos de inmunoglobulina de longitud completa (es decir, incluyendo todos los dominios de inmunoglobulinas de longitud completa). En algunos ejemplos, el polipéptido quimérico de unión a antígeno es menor de longitud completa (por ejemplo, el polipéptido quimérico puede contener el dominio de unión a antígeno y uno o más dominios de inmunoglobulina para multimerización, en el que el polipéptido quimérico no es una inmunoglobulina de longitud completa). En algunos ejemplos, los polipéptidos quiméricos de unión a antígeno anti VSR se ensamblan como anticuerpos monovalentes o hetero u homomultivalentes, tales como anticuerpos bivalentes, trivalentes, tetravalentes, pentavalentes, hexavalentes, heptavalentes o de mayor valencia. Pueden utilizarse cadenas o unidades básicas de diversas estructuras (por ejemplo, una o más regiones o dominios constantes heterólogos) para ensamblar los anticuerpos monovalentes y hetero y homomultivalentes. Pueden producirse polipéptidos quiméricos de unión a antígeno anti VSR y secretarse por células de mamífero transformadas con la molécula de ácido nucleico apropiada. En algunos ejemplos, una o más de una molécula de fusión de ácido nucleico pueden transformarse en células hospedadoras para producir un anticuerpo multivalente en el que las partes de unión a antígeno anti VSR del anticuerpo multivalente son iguales o diferentes. Típicamente, al menos una de las partes de unión a antígeno anti VSR del anticuerpo multivalente deriva de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento, tal como, por ejemplo, 58c5 o sc5. (i) Dominio Fc Los dominios de multimerización ejemplares que pueden usarse para generar anticuerpos multivalentes y/o multiespecíficos que contienen un fragmento de unión a antígeno anti VSR proporcionado en el presente documento incluyen polipéptidos derivados de una región o un dominio constante de cadena pesada de una molécula de inmunoglobulina seleccionada. Se exponen secuencias ejemplares de regiones constantes de cadena pesada para subtipos de IgG humanos en SEC ID Nº: 1601 (IgG1), SEC ID Nº: 1602 (IgG2), SEC ID Nº: 1603 (IgG3) y SEC ID Nº: 1604 (IgG4). Por ejemplo, para la región constante de cadena pesada ejemplar expuesta en SEC ID Nº: 1601, el dominio CH1 corresponde a los aminoácidos 1-103, la región bisagra corresponde a los aminoácidos 104-119, el dominio CH2 corresponde a los aminoácidos 120-223 y el dominio CH3 corresponde a los aminoácidos 224-330.

En un ejemplo, una proteína quimérica de polipéptido de inmunoglobulina puede incluir la región Fc de un polipéptido de inmunoglobulina. Típicamente, dicha fusión conserva al menos una bisagra funcionalmente activa, dominios CH2 y CH3 de la región constante de una cadena pesada de inmunoglobulina. Por ejemplo, una secuencia de Fc de longitud completa de IgG1 incluye los aminoácidos 104-330 de la secuencia expuesta en SEC ID Nº: 1601. Una secuencia Fc ejemplar para hIgG1 se expone en SEC ID Nº: 1605, y contiene la secuencia bisagra correspondiente a los aminoácidos 104-119 de SEC ID Nº: 1601, y la secuencia completa para el dominio CH2 y CH3 como se expone en SEC ID Nº: 1601. Otro polipéptido Fc ejemplar se expone en la solicitud de PCT WO 93/10151, y es un polipéptido monocatenario que se extiende desde la región bisagra N terminal al extremo C terminal nativo de la región Fc de un anticuerpo IgG1 humano (SEC ID Nº: 1606). El sitio preciso en el que se realiza el enlace no es crítico: se conocen bien en la técnica sitios particulares y pueden seleccionarse para optimizar la actividad biológica, secreción o características de unión del polipéptido quimérico de unión a antígeno anti VSR. Por ejemplo, otras secuencias polipeptídicas de Fc ejemplares comienzan en el aminoácido C109 o P113 de la secuencia expuesta en SEC ID Nº: 1601 (véase por ejemplo, documento US 2006/0024298). Además de Fc hIgG1 Fc, también pueden incluirse otras regiones Fc en los polipéptidos quiméricos de unión a antígeno anti VSR proporcionados en el presente documento. Por ejemplo, las fusiones Fc pueden contener secuencias de inmunoglobulina que están sustancialmente codificadas por genes de inmunoglobulina que pertenecen a cualquiera de las clases de anticuerpo, incluyendo, pero sin limitación, clases IgG (incluyendo las subclases humanas IgG1, IgG2, IgG3 o IgG4), IgA (incluyendo las subclases humanas IgA1 e IgA2), IgD, IgE e IgM de anticuerpos.

En algunos ejemplos, un dominio Fc puede seleccionarse basándose en las propiedades funcionales del dominio, tales como, por ejemplo, las funciones efectoras del dominio Fc en la mediación de una respuesta inmunitaria. Por ejemplo, cuando deban minimizarse las funciones efectoras mediadas por interacciones Fc/FcγR, puede usarse fusión con isotipos de IgG que apenas se reclutan células del complemento o efectoras, tales como, por ejemplo, la Fc de IgG2 o IgG4.

También se contemplan en el presente documento dominios Fc modificados para su uso en quimeras con fragmentos de unión a antígeno anti VSR, véase por ejemplo Patente de Estados Unidos N.º 7.217.797; y Publicaciones de Patente de Estados Unidos N.º 2006/0198840, 2006/0024298 y 2008/0287657; y Publicación de Patente Internacional N.º WO 2005/063816 para modificaciones ejemplares. También se proporcionan en otra parte del presente documento modificaciones de aminoácidos ejemplares de dominios Fc. Típicamente, un anticuerpo bivalente es un dímero de dos proteínas quiméricas creadas uniendo, directa o indirectamente, dos fragmentos de unión a antígeno anti VSR iguales o diferentes con un polipéptido Fc. En algunos ejemplos, se inserta una fusión génica que codifica la proteína quimérica en un vector de expresión apropiado. Las proteínas quiméricas resultantes pueden expresarse en células hospedadoras transformadas con el vector de expresión recombinante y se permite que se ensamblen, en el que se forman enlaces disulfuro intercatenarios entre los restos de Fc para producir anticuerpos anti VSR divalentes. Típicamente, una célula hospedadora y sistema de expresión es un sistema de expresión de mamíferos para permitir la glucosilación de la proteína quimérica. Los polipéptidos quiméricos resultantes que contienen restos de Fc, y anticuerpos multivalentes formados a partir de los mismos, pueden purificarse fácilmente por cromatografía de afinidad sobre columnas de Proteína A o Proteína G. Cuando se transformen dos ácidos nucleicos que codifiquen polipéptidos quiméricos anti VSR diferentes en células, la formación de heterodímeros debe conseguirse de forma bioquímica ya que también se expresarán moléculas quiméricas anti VSR que porten el dominio Fc como homodímeros con enlaces disulfuro. Por lo tanto, los homodímeros pueden reducirse en condiciones que favorecen la alteración de disulfuros intercatenarios, pero no efectúan disulfuros intracatenarios. Típicamente, los monómeros quiméricos con diferentes partes extracelulares se mezclan en cantidades equimolares y se oxidan para formar una mezcla de homo y heterodímeros. Los componentes de esta mezcla se separan por técnicas cromatográficas. Como alternativa, la formación de un heterodímero puede desviarse por ingeniería genética y expresión de moléculas de fusión de unión a antígeno anti VSR que contienen un fragmento de unión a antígeno anti VSR, seguido del dominio Fc de hIgG, seguido de c-jun o las cremalleras de leucina de c-fos. Ya que las cremalleras de leucina forman predominantemente heterodímeros, se pueden usar para conducir la formación de los heterodímeros cuando los polipéptidos quiméricos anti VSR deseados que contienen regiones Fc también pueden modificarse técnicamente para incluir un marcador con quelados metálicos u otro epítopo. El dominio marcado puede usarse para purificación rápida por cromatografía de quelado metálico, y/o por anticuerpos, para permitir la detección de transferencias de western, inmunoprecipitación o emprobrecimiento/bloqueo de la actividad en bioensayos. D. MODIFICACIONES ADICIONALES DE ANTICUERPOS ANTI VSR Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse adicionalmente. Las modificaciones de un anticuerpo anti VSR o fragmento de unión a antígeno pueden mejorar una o más propiedades del anticuerpo, incluyendo, pero sin limitación, reducir la inmunogenicidad del anticuerpo o fragmento de unión a antígeno, mejorar la semivida del anticuerpo o fragmento de unión a antígeno, tal como reducir la susceptibilidad a proteólisis y/o reducir la susceptibilidad a oxidación, y alterar o mejorar las propiedades de unión del anticuerpo o fragmento de unión a antígeno del mismo. Las modificaciones ejemplares incluyen, pero sin limitación, modificaciones de la secuencia de aminoácidos primaria del anticuerpo anti VSR o fragmento de unión a antígeno del mismo y la alteración de la modificación postraduccional del anticuerpo anti VSR o fragmento de unión a antígeno del mismo. Las modificaciones postraduccionales ejemplares incluyen, por ejemplo, glucosilación, acetilación, pegilación, fosforilación, amidación, derivatización con grupo protector/de bloqueo, escisión proteolítica, enlace con un ligando celular u otra proteína. Otras modificaciones ejemplares incluyen la unión de uno o más péptidos heterólogos con el anticuerpo anti VSR o fragmento de unión a antígeno para alterar o mejorar una o más propiedades del anticuerpo o fragmento de unión a antígeno del mismo. En general, las modificaciones no dan como resultado aumento de la inmunogenicidad del anticuerpo o fragmento de unión a antígeno del mismo o afectan significativamente de forma negativa a la unión del anticuerpo o fragmento de unión a antígeno del mismo con VSR. Se proporcionan en el presente documento y se conocen en la técnica métodos para evaluar la unión de los anticuerpos modificados o fragmentos de unión a antígeno de los mismos con una proteína F de VSR. Por ejemplo, pueden ensayarse anticuerpos modificados o fragmentos de unión a antígeno de los mismos con respecto a la unión con una proteína F de VSR por métodos tales como, pero sin limitación, ELISA, resonancia de plasmón superficial (SPR) o mediante ensayos de microneutralización in vitro.

Se proporcionan en el presente documento métodos para mejorar la semivida de los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos. El aumento de la semivida de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden aumentar la eficacia terapéutica de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos y permitir administración menos frecuente de los anticuerpos o fragmentos de unión a antígeno de los mismos para profilaxis y/o tratamiento, tal como prevención o tratamiento de una infección por VSR, prevención, tratamiento y/o alivio de uno o más síntomas de una infección por VSR o reducción de la duración de una infección por VSR. La modificación de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos producidos en el presente documento puede incluir una o más sustituciones, deleciones o adiciones de aminoácidos, bien a partir de mutación natural o bien de manipulación humana a partir del anticuerpo parental. Se conocen en la técnica métodos para modificación de polipéptidos, tales como anticuerpos, y pueden emplearse para la modificación de cualquier anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, las propiedades farmacocinéticas de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden potenciarse mediante modificaciones de Fc por técnicas conocidas por los expertos en la materia. Pueden usarse técnicas convencionales conocidas por los expertos en la materia para introducir mutaciones en la molécula de nucleótidos que codifica un anticuerpo o un fragmento de unión a antígeno proporcionado en el presente documento para producir un polipéptido con una o más sustituciones de aminoácidos. Las técnicas ejemplares para introducir mutaciones incluyen, pero sin limitación, mutagénesis dirigida y mutagénesis mediada por PCR. Los anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse mediante la unión de un péptido heterólogo para facilitar la purificación. En general, dichos péptidos se expresan como una proteína de fusión que contiene el anticuerpo fusionado con el péptido en el extremo C o N terminal del anticuerpo o fragmento de unión a antígeno del mismo. Los péptidos ejemplares usados habitualmente para purificación incluyen, pero sin limitación, péptidos de hexahistidina, péptidos de hemaglutinina (HA), y péptidos de marcadores flag (véase por ejemplo, Wilson et al. (1984) Cell 37: 767; Witzgall et al. (1994) Anal Biochem 223: 2, 291-8). No hace falta necesariamente que la fusión sea directa, sino que puede producirse a través de un péptido enlazador. En algunos ejemplos, el péptido enlazador contiene un sitio de escisión de proteasa que permite la retirada del péptido de purificación después de purificación por escisión con una proteasa que reconoce específicamente el sitio de escisión de proteasa. Los anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden modificarse por la unión de un polipéptido heterólogo que dirige el anticuerpo o fragmento de unión a antígeno a un tipo celular particular (por ejemplo, células epiteliales respiratorias), bien in vitro o bien in vivo. En algunos ejemplos un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede dirigirse a un tipo celular particular fusionando o conjugando el anticuerpo o fragmento de unión a antígeno del mismo con un anticuerpo específico para un receptor de superficie celular particular u otro polipéptido que interaccione con un receptor celular específico.

En algunos ejemplos, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede dirigirse a una superficie celular diana y/o captarse por la célula diana fusionando o conjugando el anticuerpo o fragmento de unión a antígeno del mismo con un péptido que se une con glucoproteínas de superficie celular, tal como un dominio de transducción de proteínas (por ejemplo, un péptido TAT). Los dominios de transducción de proteínas ejemplares incluyen, pero sin limitación, PTD derivados de proteínas tales como TAT del virus de la inmunodeficiencia humana 1 (VIH-1) (Ruben et al. (1989) J. Virol. 63: 1-8; por ejemplo SEC ID Nº: 1571-1582, tal como por ejemplo, GRKKRRQRRR (TAT 48-57) SEC ID Nº: 1575)), la proteína de tegumento VP22 del virus del herpes (Elliott y O’Hare (1997) Cell 88: 223-233; por ejemplo, SEC ID Nº: 1587), la proteína homeótica de proteína Antennapedia (Antp) de Drosophila melanogaster (Penetratina PTD; Derossi et al. (1996) J. Biol. Chem.

271: 18188-18193; por ejemplo, SEC ID Nº: 1556-1559), la protegrina 1 (PG-1) péptido antimicrobiano SynB (por ejemplo, SynB1, SynB3 y Syn B4; Kokryakov et al. (1993) FEBS Lett. 327: 231-236; por ejemplo, SEC ID Nº: 1568- 1570, respectivamente) y factor de crecimiento de fibroblastos básico (Jans (1994) FASEB J. 8: 841-847; por ejemplo, SEC ID Nº: 1552). Los PTD también incluyen PTD sintéticos, tales como, pero sin limitación, péptidos de poliarginina (Futaki et al. (2003) J. Mol. Recognit. 16: 260-264; Suzuki et al. (2001) J. Biol. Chem. 276: 5836-5840; por ejemplo SEC ID Nº: 1560-1561), transportano (Pooga et al. (1988) FASEB J. 12: 67-77; Pooga et al. (2001) FASEB J. 15: 1451-1453; por ejemplo, SEC ID Nº: 1583-1586), MAP (Oehlke et al. (1998) Biochim. Biophys. Acta. 1414: 127-139; por ejemplo, SEC ID Nº: 1550), KALA (Wyman et al. (1997) Biochemistry 36: 3008-3017; por ejemplo, SEC ID Nº: 1548) y otros péptidos catiónicos, tales como, por ejemplo, diversos péptidos catiónicos β (Akkarawongsa et al. (2008) Antimicrob. Agents and Chemother. 52(6): 2120-2129).

Los anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse por la unión de un resto de diagnóstico y/o terapéutico con el anticuerpo o fragmento de unión a antígeno del mismo. Los anticuerpos anti VSR y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse por la unión covalente de cualquier tipo de molécula, tal como una molécula de diagnóstico o terapéutica, con el anticuerpo o fragmento de unión a antígeno del mismo de modo que la unión covalente no evite que el anticuerpo o fragmento de unión a antígeno del mismo se una con su epítopo correspondiente. Por ejemplo, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede modificarse además mediante unión covalente de una molécula de modo que la unión covalente no evite que el anticuerpo o fragmento de unión a antígeno del mismo se una con VSR.

En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno de los mismos pueden fusionarse de forma recombinante con un polipéptido heterólogo en el extremo N terminal o C terminal o conjugarse químicamente, incluyendo conjugación covalente y no covalente, con un polipéptido heterólogo u otra composición. Por ejemplo, el polipéptido heterólogo o composición puede ser un polipéptido de diagnóstico u otro resto de diagnóstico o un polipéptido terapéutico u otro resto terapéutico. Los restos de diagnóstico y terapéuticos ejemplares incluyen, pero sin limitación, fármacos, radionucleótidos, toxinas, moléculas fluorescentes (véase, por ejemplo, Publicaciones Internacionales de PCT N.º WO 92/08495; WO 91/14438; WO 89/12624; Patente de Estados Unidos N.º 5.314.995; y documento EP 396.387). Pueden usarse polipéptidos de diagnóstico o restos de diagnóstico, por ejemplo, como marcadores para detección in vivo o in vitro. Pueden usarse polipéptidos terapéuticos o restos terapéuticos, por ejemplo, para terapia de una infección viral, tal como infección por VSR, o para tratamiento de uno o más síntomas de una infección viral. Pueden generarse proteínas de fusión adicionales de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento mediante las técnicas de redistribución génica, redistribución de motivos, redistribución de exones y/o redistribución de codones (denominados colectivamente “redistribución de ADN”). La redistribución de ADN puede emplearse para alterar las actividades de anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento, por ejemplo, para producir anticuerpos o fragmentos de unión a antígeno de los mismos con mayores afinidades y menores velocidades de disociación (véase, en general, Patentes de Estados Unidos N.º 5.605.793; 5.811.238; 5.830.721; 5.834.252; y 5.837.458, y Patten et al. (1997) Curr. Opinion Biotechnol. 8: 724-33; Harayama (1998) Trends Biotechnol. 16(2): 76- 82; Hansson et al., (1999) J. Mol. Biol. 287: 265-76; y Lorenzo y Blasco (1998) Biotechniques 24(2): 308-13). Los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos pueden unirse también con soportes sólidos, que son útiles para inmunoensayos o purificación del antígeno diana. Los soportes sólidos ejemplares incluyen, pero sin limitación, vidrio, celulosa, poliacrilamida, nylon, poliestireno, polivinil cloruro o polipropileno. 1. Modificaciones para reducir la inmunogenicidad En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse adicionalmente para reducir la inmunogenicidad en un sujeto, tal como un sujeto humano. Por ejemplo, uno o más aminoácidos en el anticuerpo o fragmento de unión a antígeno del mismo pueden modificarse para alterar epítopos potenciales para linfocitos T humanos para eliminar o reducir la imunogenicidad del anticuerpo o fragmento de unión a antígeno del mismo cuando se exponen al sistema inmunitario del sujeto. Las modificaciones ejemplares incluyen sustituciones, deleciones e inserción de uno o más aminoácidos, que eliminan o reducen la inmunogenicidad del anticuerpo o fragmento de unión a antígeno del mismo. En general, dichas modificaciones no alteran la especificidad de unión del anticuerpo o fragmento de unión a antígeno del mismo por su antígeno respectivo. La reducción de la inmunogenicidad del anticuerpo o fragmento de unión a antígeno del mismo puede mejorar una o más propiedades del anticuerpo o fragmento de unión a antígeno del mismo, tal como, por ejemplo, mejorar la eficacia terapéutica del anticuerpo o fragmento de unión a antígeno del mismo y/o aumentar la semivida del anticuerpo o fragmento de unión a antígeno del mismo in vivo. 2. Modificaciones de Fc Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden contener una región Fc de tipo silvestre o modificada. Como se describe en otra parte en el presente documento, una región Fc puede unirse con un fragmento de unión a antígeno anti VSR proporcionado en el presente documento, tal como, por ejemplo, 58c5 o sc5, o un fragmento de unión a antígeno derivado de 58c5 o sc5. En algunos ejemplos, la región Fc puede modificarse para alterar una o más propiedades del polipéptido de Fc. Por ejemplo, la región Fc puede modificarse para alterar (es decir más o menos) las funciones efectoras en comparación con la función efectora de una región Fc de una cadena pesada de inmunoglobulina de tipo silvestre. Las regiones Fc de un anticuerpo interaccionan con varios receptores de Fc, y ligandos, transmitiendo una matriz de capacidades funcionales importantes denominadas funciones efectoras. Las funciones efectoras de Fc incluyen, por ejemplo, unión con el receptor de Fc, fijación del complemento y actividad de empobrecimiento de linfocitos T (véase por ejemplo Patente de Estados Unidos N.º 6.136.310). Se conocen en la técnica métodos para ensayar la actividad de empobrecimiento de linfocitos T, función efectora de Fc y estabilidad de anticuerpos. Por ejemplo, la región Fc de una molécula de IgG interacciona con los FcγR. Estos receptores se expresan en una diversidad de células inmunitarias, incluyendo por ejemplo, monocitos, macrófagos, neutrófilos, células dendríticas, eosinófilos, mastocitos, plaquetas, linfocitos B, linfocitos granulares grandes, células de Langerhans, linfocitos citolíticos naturales (NK) y linfocitos T γ8. La formación del complejo Fc/FcγR recluta estas células efectoras a sitios de antígeno unido, típicamente dando como resultado acontecimientos de señalización dentro de las células y respuestas inmunitarias posteriores importantes tales como liberación de mediadores de inflamación, activación de linfocitos B, endocitosis, fagocitosis y ataque citotóxico. La capacidad para mediar en las funciones efectoras citotóxicas y fagocíticas es un mecanismo potencial por el que los anticuerpos destruyen células diana. El reconocimiento y lisis de anticuerpo unido en células diana por células citotóxicas que expresan FcγR se denomina citotoxicidad mediada por células dependiente de anticuerpo (ADCC). Otros receptores de Fc para diversos isotipos de anticuerpos incluyen FcεR (IgE), FcαR (IgA) y FcµR (IgM). Por lo tanto, un dominio Fc modificado puede tener afinidad alterada, incluyendo pero sin limitación, afinidad aumentada o baja o ninguna por el receptor de Fc. Por ejemplo, las diferentes subclases de IgG tienen diferentes afinidades por los FcγR, uniéndose IgG1 e IgG3 típicamente sustancialmente mejor con los receptores que IgG2 e IgG4. Además, diferentes FcγR median en diferentes funciones efectoras. FcγRI, FcγRIIa/c y FcγRIIIa son reguladores positivos de activación desencadenada por complejo inmunitario, caracterizados por tener un dominio intracelular que tiene un motivo de activación basado en tirosina inmunorreceptor (ITAM). FcγRIIb, sin embargo, tiene un motivo de inhibición basado en tirosina inmunorreceptor (ITIM) y es por lo tanto inhibidor. Por lo tanto, la alteración de la afinidad de una región Fc por un receptor puede modular las funciones efectoras inducidas por el domino Fc. En un ejemplo, se usa una región Fc que se modifica para unión optimizada con ciertos FcγR para mediar mejor en las funciones efectoras, tales como, por ejemplo, citotoxicidad celular dependiente de anticuerpo, ADCC. Dichas regiones Fc modificadas pueden contener modificaciones en uno o más de los restos de aminoácidos (de acuerdo con el esquema de numeración de Kabat, Kabat et al. (1991) Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services), incluyendo, pero sin limitación, las posiciones de aminoácidos 249, 252, 259, 262, 268, 271, 273, 277, 280, 281, 285, 287, 296, 300, 317, 323, 343, 345, 346, 349, 351, 352, 353 y 424. Por ejemplo, pueden realizarse modificaciones en una región Fc correspondientes a una cualquiera o más de G119S, G119A, S122D, S122E, S122N, S122Q, S122T, K129H, K129Y, D132Y, R138Y, E141Y, T143H, V147I, S150E, H151D, E155Y, E155I, E155H, K157E, G164D, E166L, E166H, S181A, S181D, S187T, S207G, S307I, K209T, K209E, K209D, A210D, A213Y, A213L, A213I, I215D, I215E, I215N, I215Q, E216Y, E216A, K217T, K217F, K217A y P279L de la secuencia de IgG1 ejemplar expuesta en SEC ID Nº: 1601, o combinaciones de los mismos. Un Fc modificado que contiene estas mutaciones puede tener unión potenciada con un FcR tal como, por ejemplo, el receptor activador FcγIIIa y/o puede tener unión reducida con el receptor inhibidor FcγRIIb (véase por ejemplo, documento US 2006/0024298). Las regiones Fc modificadas para tener unión aumentada con FcR pueden ser más eficaces en la facilitación de la destrucción de células infectadas por virus (por ejemplo VSR) en pacientes. En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento pueden modificarse además para mejorar la interacción del anticuerpo o fragmento de unión a antígeno del mismo con el receptor FcRn para aumentar la semivida in vivo y la farmacocinética del anticuerpo o fragmento de unión a antígeno del mismo (véase, por ejemplo, Patente de Estados Unidos N.º 7.217.797, Publicaciones de Patente de Estados Unidos N.º 2006/0198840 y 2008/0287657). FcRn es el FcR neonatal, cuya unión recicla el anticuerpo endocitado o fragmento de unión a antígeno del mismo de los endosomas de vuelta al torrente sanguíneo. Este proceso, acoplado con la preclusión de la filtración renal debido al gran tamaño de la molécula de longitud completa, da como resultado semividas en suero del anticuerpo favorables que varían de una a tres semanas. La unión de Fc con FcRn también desempeña un papel en el transporte de anticuerpos. Las modificaciones ejemplares de la región Fc incluyen pero sin limitación, mutación del Fc descrito en la Patente de Estados Unidos N.º 7.217.797; Publicaciones de Patente de Estados Unidos N.º 2006/0198840, 2006/0024298 y 2008/0287657 y la Publicación de Patente Internacional N.º WO 2005/063816, tales como mutaciones en uno o más de los restos de aminoácidos (numeración de Kabat, Kabat et al. (1991)) 251-256, 285-90, 308-314, en el dominio CH2 y/o los restos de aminoácidos 385-389 y 428-436 en el dominio CH3 de la región constante de cadena pesada Fc, en el que la modificación altera la afinidad de unión del receptor de Fc y/o la semivida en suero en relación con el anticuerpo no modificado o fragmento de unión a antígeno del mismo. En algunos ejemplos, el dominio constante de IgG se modifica en la región Fc en una o más de las posiciones de aminoácidos 250, 251, 252, 254, 255, 256, 263, 308, 309, 311, 312 y 314 en el dominio CH2 y/o las posiciones de aminoácidos 385, 386, 387, 389, 428, 433, 434, 436, y 459 en el dominio CH3 de la región constante de cadena pesada de IgG. Dichas modificaciones corresponden a los aminoácidos Gly120, Pro121, Ser122, Phe124, Leu125, Phe126, Thr133, Pro174, Arg175, Glu177, Gln178 y Asn180 en el dominio CH2 y los aminoácidos Gln245, Val246, Ser247, Thr249, Ser283, Gly285, Ser286, Phe288 y Met311 en el dominio CH3 en una secuencia de IgG1 ejemplar expuesta en SEC ID Nº: 1601. En algunos ejemplos, la modificación es en uno o más restos expuestos en superficie, y la modificación es una sustitución con un resto de carga, polaridad o hidrofobicidad similar al resto que se sustituye. En ejemplos particulares, una región constante de cadena pesada Fc se modifica en una o más posiciones de aminoácidos 251, 252, 254, 255 y 256 (numeración de Kabat), en las que la posición 251 se sustituye con Leu o Arg, la posición 252 se sustituye con Tyr, Phe, Ser, Trp o Thr, la posición 254 se sustituye con Thr o Ser, la posición 255 se sustituye con Leu, Gly, Ile o Arg, y/o la posición 256 se sustituye con Ser, Arg, Gln, Glu, Asp, Ala, Asp o Thr. En algunos ejemplos, una región constante de cadena pesada Fc se modifica en una o más de las posiciones de aminoácidos 308, 309, 311, 312 y 314, en las que la posición 308 se sustituye con Thr o Ile, la posición 309 se sustituye con Pro, la posición 311 se sustituye con serina o Glu, la posición 312 se sustituye con Asp, y/o la posición 314 se sustituye con Leu. En algunos ejemplos, una región constante de cadena pesada Fc se modifica en una o más de las posiciones de aminoácidos 428, 433, 434 y 436, en las que la posición 428 se sustituye con Met, Thr, Leu, Phe o Ser, la posición 433 se sustituye con Lys, Arg, Ser, Ile, Pro, Gln o His, la posición 434 se sustituye con Phe, Tyr o His, y/o la posición 436 se sustituye con His, Asn, Asp, Thr, Lys, Met o Thr. En algunos ejemplos, una región constante de cadena pesada Fc se modifica en una o más de las posiciones de aminoácidos 263 y 459, en las que la posición 263 se sustituye con Gln o Glu y/o la posición 459 se sustituye con Leu o Phe. En algunos ejemplos, una región constante de cadena pesada de Fc puede modificarse para potenciar la unión con la proteína del complemento C1q. Además de interaccionar con FcR, Fc también interacciona con la proteína de complemento C1q para mediar en la citotoxicidad dependiente de complemento (CDC). C1q forma un complejo con las serina proteasas C1r y C1s para formar el complejo C1. C1q es capaz de unirse con seis anticuerpos, aunque la unión con dos IgG es suficiente para activar la cascada del complemento. De forma similar a la interacción de Fc con FcR, diferentes subclases de IgG tienen diferente afinidad por C1q, uniéndose típicamente IgG1 e IgG3 sustancialmente mejor que IgG2 e IgG4. Por lo tanto, un Fc modificado que tiene unión aumentada con C1q puede mediar en CDC potenciada, y puede potenciar la destrucción de células infectadas por virus (por ejemplo, VSR). Las modificaciones ejemplares en una región Fc que aumentan la unión con C1q incluyen, pero sin limitación, modificaciones de aminoácidos en las posiciones 345 y 353 (numeración de Kabat). Las modificaciones ejemplares incluyen las que corresponden a K209W, K209Y y E216S en una secuencia de IgG1 ejemplar expuesta en SEC ID Nº: 1601.

En otro ejemplo, también se conocen una diversidad de mutantes de Fc con sustituciones para reducir o anular la unión con FcγR. Dichas muteínas son útiles en casos en los que existe la necesidad de función efectora reducida o eliminada mediada por Fc. Esto sucede con frecuencia cuando se desea antagonismo, pero no destrucción de las células que portan un antígeno diana. Es un ejemplo de dicho Fc una muteína de Fc descrita en la Patente de Estados Unidos N.º 5.457.035, que se modifica en las posiciones de aminoácidos 248, 249 y 251 (numeración de Kabat). En una secuencia de IgG1 ejemplar expuesta en SEC ID Nº: 1601, el aminoácido 117 se modifica de Leu a Ala, el aminoácido 118 se modifica de Leu a Glu, y el aminoácido 120 se modifica de Gly a Ala. Pueden realizarse mutaciones similares en cualquier secuencia de Fc tal como por ejemplo, la secuencia de Fc ejemplar. Esta muteína muestra afinidad reducida por los receptores de Fc.

Los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden modificarse técnicamente para contener regiones Fc modificadas. Por ejemplo, se conocen en la técnica métodos para fusionar o conjugar polipéptidos con las regiones constantes de anticuerpos (es decir preparar proteínas de fusión de Fc) y se describen, por ejemplo, en las Patentes de Estados Unidos N.º 5.336.603, 5.622.929, 5.359.046, 5.349.053, 5.447.851, 5.723.125, 5.783.181, 5.908.626, 5.844.095 y 5.112.946; documentos EP 307.434; EP 367.166; EP 394.827; publicaciones de PCT WO 91/06570, WO 96/04388, WO 96/22024, WO 97/34631 y WO 99/04813; Ashkenazi et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10535-10539; Traunecker et al. (1988) Nature 331: 84-86; Zheng et al. (1995) J. Immunol 154: 5590-5600; y Vil et al. (1992) Proc. Natl. Acad. Sci. USA 89: 11337- 11341 (1992) y descritos en otra parte en el presente documento. En algunos ejemplos, una región Fc modificada que tiene una o más modificaciones que aumentan la afinidad de unión por FcRn y/o mejoran la semivida pueden fusionarse con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. 3. Pegilación Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden conjugarse con moléculas poliméricas tales como polietilenglicol (PEG) de alto peso molecular para aumentar la semivida y/o mejorar sus perfiles farmacocinéticos. La conjugación puede llevarse a cabo por técnicas conocidas por los expertos en la materia. Se ha mostrado que la conjugación de anticuerpos terapéuticos con PEG potencia la farmacodinámica mientras que no interfiere con la función (véase, por ejemplo, Deckert et al., Int. J. Cancer 87: 382-390, 2000; Knight et al., Platelets 15: 409-418, 2004; Leong et al.; Cytokine 16: 106-119, 2001; y Yang et al., Protein Eng. 16: 761-770, 2003). El PEG puede unirse con los anticuerpos o fragmentos de unión a antígeno con o sin un enlazador multifuncional bien mediante conjugación específica de sitio del PEG con el extremo N o C terminal de los anticuerpos o fragmentos de unión a antígeno o mediante grupos amino épsilon presentes en restos de lisina. Puede usarse derivatización de polímeros lineales o ramificados que da como resultado pérdida mínima de la actividad biológica. El grado de conjugación puede controlarse por SDS-PAGE y espectrometría de masas para asegurar la conjugación apropiada de moléculas de PEG con los anticuerpos. Pueden separarse PEG que no ha reaccionado de conjugados de anticuerpo-PEG mediante, por ejemplo, cromatografía de exclusión por tamaño o de intercambio iónico. Los anticuerpos derivatizados con PEG o fragmentos de unión a antígeno de los mismos pueden ensayarse con respecto a actividad de unión para antígenos de VSR así como con respecto a eficacia in vivo usando métodos conocidos por los expertos en la materia, por ejemplo, por inmunoensayos descritos en el presente documento.

4. Conjugación de un resto detectable En algunos ejemplos, los anticuerpos anti VSR y fragmentos de anticuerpo proporcionados en el presente documento pueden modificarse adicionalmente por conjugación con un resto detectable. Los restos detectables pueden detectarse directa o indirectamente. Dependiendo del resto detectable seleccionado, el resto detectable puede detectarse in vivo y/o in vitro. Los restos detectables pueden emplearse, por ejemplo, en métodos de diagnóstico para detectar la exposición a VSR o localización de VSR o ensayos de unión para determinar la afinidad de unión del anticuerpo anti VSR o fragmento de unión a antígeno del mismo por VSR. Los restos detectables también pueden emplearse en métodos de preparación de los anticuerpos anti VSR, tales como, por ejemplo, purificación del anticuerpo o fragmento de unión a antígeno del mismo. Típicamente, se seleccionan restos detectables de modo que la conjugación del resto detectable no interfiera con la unión del anticuerpo o fragmento de unión a antígeno del mismo con el epítopo diana. En general, la elección del resto detectable depende de la sensibilidad requerida, la facilidad de conjugación con el compuesto, los requisitos de estabilidad, la instrumentación disponible y provisiones de desecho. Un experto en la materia está familiarizado con los marcadores y puede identificar un marcador detectable adecuado para y compatible con el ensayo empleado. Se conocen en la técnica métodos para marcar anticuerpos con restos detectables e incluyen, por ejemplo, métodos recombinantes y químicos.

El resto detectable puede ser cualquier material que tenga una propiedad física o química detectable. Dichos marcadores detectables se han desarrollado bien en el campo de inmunoensayos y, en general, prácticamente cualquier marcador útil en dichos métodos puede aplicarse en los métodos proporcionados. Por lo tanto, un marcador es cualquier composición detectable por medios espectroscópicos, fotoquímicos, bioquímicos, inmunoquímicos, eléctricos, ópticos o químicos. Los marcadores útiles incluyen, pero sin limitación, marcadores fluorescentes (por ejemplo, fluoresceín isotiocianato, Texas red, rodamina), radiomarcadores (por ejemplo, 3H, 125I, 35S, 14C o 32P), en particular, radioisótopos emisores de gamma y positrones (por ejemplo, 157Gd, 55Mn, 162Dy, 52Cr y 56Fe), iones metálicos (por ejemplo, 111 In, 97Ru, 67Ga, 68Ga, 72As, 89Zr y 201Tl), enzimas (por ejemplo, peroxidasa de rábano rusticano, fosfatasa alcalina y otras usadas habitualmente en un ELISA), agentes de transferencia de electrones (por ejemplo, incluyendo proteína de unión a metal y compuestos), marcadores luminiscentes y quimioluminiscentes (por ejemplo, luciferina y 2,3-dihidroftalazinedionas, por ejemplo, luminol), perlas magnéticas (por ejemplo, DYNABEADS™), y marcadores colorimétricos tales como oro coloidal o vidrio coloreado o perlas de plástico (por ejemplo, poliestireno, polipropileno, látex, etc.). Para una revisión de diversos sistemas de marcaje o de producción de señal que pueden usarse, véase por ejemplo, Patente de Estados Unidos N.º 4.391.904.

5. Conjugación de un resto terapéutico En algunos ejemplos, el anticuerpo anti VSR y fragmentos de unión a antígeno proporcionados en el presente documento pueden modificarse adicionalmente por conjugación con un resto terapéutico. Los restos terapéuticos ejemplares incluyen, pero sin limitación, una citotoxina (por ejemplo, un agente citostático o citocida), un agente terapéutico o un ion metálico radiactivo (por ejemplo, emisores alfa). Las citotoxinas o agentes citotóxicos ejemplares incluyen, pero sin limitación, cualquier agente que sea perjudicial para células, tales como, pero sin limitación, paclitaxel, citocalasina B, gramicidina D, bromuro de etidio, emetina, mitomicina, etopósido, tenopósido, vincristina, vinblastina, colchicina, doxorrubicina, daunorrubicina, dihidroxi antracin diona, mitoxantrona, mitramicina, actinomicina D, 1-deshidrotestosterona, glucocorticoides, procaína, tetracaína, lidocaína, propranolol y puromicina y análogos u homólogos de los mismos. Los agentes terapéuticos ejemplares incluyen, pero sin limitación, antimetabolitos (por ejemplo, metotrexato, 6-mercaptopurina, 6-tioguanina, citarabina, 5-fluorouracil decarbacina), agentes alquilantes (por ejemplo, mecloretamina, tioepa, clorambucilo, melfalán, carmustina (BSNU) y lomustina (CCNU), ciclofosfamida, busulfán, dibromomanitol, estreptozotocina, mitomicina C y cis-diclorodiamina platino (II) (DDP) cisplatino), antraciclinas (por ejemplo, daunorrubicina (anteriormente daunomicina) y doxorrubicina), antibióticos (por ejemplo, dactinomicina (anteriormente actinomicina), bleomicina, mitramicina y antramicina (AMC)), agente antimitóticos (por ejemplo, vincristina y vinblastina) y antivirales, tales como, pero sin limitación, análogos de nucleósidos, tales como zidovudina, aciclovir, gangciclovir, vidarabina, idoxuridina, trifluridina y ribavirina; foscamet, amantadina, rimantadina, saquinavir, indinavir, ritonavir e interferones alfa.

En algunos ejemplos, los anticuerpos anti VSR y fragmentos de unión a antígeno proporcionados en el presente documento pueden modificarse además por conjugación con un resto terapéutico que es un polipéptido terapéutico. Los polipéptidos terapéuticos ejemplares incluyen, pero sin limitación, una toxina, tal como abrina, ricina A, exotoxina de pseudomonas, o toxina diftérica; o un agente inmunoestimulador, tal como una citocina, tal como, pero sin limitación, un interferón (por ejemplo, IFN-α, β, γ, ω), una linfocina, un factor del crecimiento hematopoyético, tal como, por ejemplo, GM-CSF (factor estimulante de colonias de macrófagos y granulocitos), Interleucina 2 (IL-2), Interleucina 3 (IL-3), Interleucina 4 (IL-4), Interleucina 7 (IL-7), Interleucina 10 (IL-10), Interleucina 12 (IL-12), Interleucina 14 (IL-14) y Factor de Necrosis Tumoral (TNF). 6. Modificaciones para mejorar la especificidad de unión La especificidad de unión de los anticuerpos anti VSR y fragmentos de anticuerpo proporcionados pueden alterarse o mejorarse por técnicas, tales como presentación en fagos. Los métodos para presentación en fagos generalmente implican el uso de un sistema de vector de expresión de superficie de fago filamentoso (fagémido) para clonar y expresar especies de anticuerpo de la biblioteca. Se han descrito por otros diversos sistemas de clonación de fagémidos para producir bibliotecas combinatorias. Véase, por ejemplo, la preparación de bibliotecas de anticuerpos combinatorias en fagémidos como se describe en Kang et al., (1991) Proc. Natl. Acad. Sci., USA, 88: 4363-4366; Barbas et al., (1991) Proc. Natl. Acad. Sci., USA, 88: 7978-7982; Zebedee et al., (1992) Proc. Natl. Acad. Sci., USA, 89: 3175-3179; Kang et al., (1991) Proc. Natl. Acad. Sci., USA, 88: 11120-11123; Barbas et al., (1992) Proc. Natl. Acad. Sci., USA, 89: 4457-4461; y Gram et al., (1992) Proc. Natl. Acad. Sci., USA, 89: 3576-3580.

En ejemplos particulares, se amplifican secuencias de ADN que codifican dominios VH y VL a partir de bibliotecas de ADNc de animales (por ejemplo, bibliotecas de ADNc humano o murino de tejidos linfoides). El ADN que codifica los dominios VH y VL se recombinan junto con un enlazador de scFv por PCR y se clonan en un vector fagémido (por ejemplo, p CANTAB 6 o pComb 3 HSS). El vector se electropora en E. coli y la E. coli se infecta con fago auxiliar.

Los fagos usados en estos métodos son típicamente fagos filamentosos incluyendo fd y M13 y los dominios VH y VL se fusionan habitualmente de forma recombinante con el gen III o el gen VIII del fago. Los fagos que expresan un dominio de unión a antígeno que se une con un antígeno de VSR, por ejemplo, proteína F de VSR, pueden seleccionarse o identificarse con antígeno, por ejemplo, usando antígeno marcado o antígeno unido con o capturado en una superficie sólida o perla. Los ejemplos de métodos de presentación de fagos que pueden usarse para preparar los anticuerpos por presentación de fagos incluyen los desvelados, por ejemplo, en Brinkman et al. (1995) J Immunol. Methods 182: 41-50; Ames et al. (1995) J. Immunol. Methods 184: 177-186; Kettleborough et al. (1994) Eur. J. Immunol. 24: 952-958; Persic et al. (1997) Gene 187: 9-18; Burton et al. (1994) Advances in Immunology 57: 191-280; publicaciones de PCT N.º WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/1 1236, WO 95/15982, WO 95/20401 y WO 97/13844; y Patentes de Estados Unidos N.º 5.698.426, 5.223.409, 5.403.484, 5.580.717, 5.427.908, 5.750.753, 5.821.047, 5.571.698, 5.427.908, 5.516.637, 5.780.225, 5.658.727, 5.733.743 y 5.969.108. Como se ha descrito en las referencias anteriores, después de la sección de fagos, las regiones codificantes de anticuerpos del fago pueden aislarse y usarse para generar anticuerpos completos, incluyendo anticuerpos humanos, o cualquier otro fragmento de unión a antígeno deseado, y se expresan en cualquier hospedador deseado, incluyendo células de mamífero, células de insecto, células vegetales, levaduras y bacterias, por ejemplo, como se describe en el presente documento. También pueden emplearse técnicas para producir de forma recombinante fragmentos Fab, Fab’ y F(ab’)2 usando métodos conocidos en este campo tales como los desvelados en la Publicación de PCT N.º WO 92/22324; Mullinax et al. (1992) BioTechniques 12(6): 864-869; Sawai et al. (1995) AJRI 34: 26-34; y Better et al. (1988) Science 240: 1041-1043. La biblioteca de fagémidos resultante puede manipularse para aumentar y/o alterar las inmunoespecificidades de los anticuerpos o fragmentos de unión a antígeno para producir y posteriormente identifican anticuerpos adicionales con propiedades mejoradas, tales como unión aumentada a un antígeno diana. Por ejemplo, una o ambas de la cadena pesada y ligera que codifican ADN pueden mutarse en una región determinante de complementariedad (CDR) de la región variable del polipéptido de inmunoglobulina, y posteriormente explorarse con respecto a capacidades de inmunorreacción y neutralización deseables. Los anticuerpos resultantes pueden después explorarse en uno o más de los ensayos descritos en el presente documento para determinar la capacidad de neutralización.

Para algunos usos, incluyendo el uso in vivo de anticuerpos en seres humanos y ensayos de detección in vitro, se usan anticuerpos humanos o quiméricos. Los anticuerpos completamente humanos son particularmente deseables para tratamiento terapéutico de sujetos humanos. Pueden prepararse anticuerpos humanos por una diversidad de métodos conocidos en la técnica incluyendo métodos de presentación en fagos descritos anteriormente usando bibliotecas de anticuerpos derivadas de secuencias de inmunoglobulina humana o secuencias sintéticas homólogas de secuencias de inmunoglobulina humana. Véase Patentes de Estados Unidos N.º 4.444.887 y 4.716.111; y publicaciones de PCT N.º WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, y WO 0741. E. MÉTODOS PARA AISLAR ANTICUERPOS ANTI VSR Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden identificarse y aislarse por una diversidad de técnicas bien conocidas en este campo incluyendo, pero sin limitación, hibridomas murinos (véase, por ejemplo, Olsson y Kaplan (1980) Proc Natl Acad Sci. USA 77: 5429-5431; dichos anticuerpos pueden humanizarse como se describe en otra parte en el presente documento para su uso en seres humanos), ratones transgénicos que expresan genes de inmunoglobulina humana (véase, por ejemplo, Kellerman y Green (2000) Curr. Opin Biotechnol. 13: 593-597), presentación en fagos (véase, por ejemplo, Mancini (2004) New Microbiol. 27: 315-28), y aislamiento a partir de células inmunitarias humanas maduras, tales como linfocitos B (véase, por ejemplo, Banchereau y Rousset (1992). Adv Immunol. 52: 125-262, Crotty y Ahmed (2004) Semin Immunol. 16: 197-203, Carsetti (2004) Methods Mol Biol. 271: 25-35., McHeyzer-Williams y McHeyzer-Williams (2005) Annu Rev Immunol. 23: 487-513). En un método ejemplar proporcionado en el presente documento, los anticuerpos anti VSR humanos y fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se identifican y aíslan de linfocitos B humanos. Dada la dificultad para obtener hibridomas estables a partir de células secretoras de anticuerpos humanos, un método ejemplar que se ha usado extensivamente para producir y aislar células secretoras de anticuerpos humanos es la inmortalización de linfocitos B humanos con Virus de Epstein Barr (VEB), que también se sabe que induce activación y proliferación de linfocitos B policlonales (véase, por ejemplo, Sugimoto et al., (2004) Cancer Res. 64: 3361-3364.; Bishop y Busch (2002) Microbes Infect. 4: 853-857). Se han producido células secretoras de anticuerpos, por ejemplo, por inmortalización con VEB de linfocitos B humanos, tales como la sangre periférica, ganglios linfáticos, bazo, amígdalas o líquidos pleurales de pacientes u otros individuos que pueden exponerse al antígeno o sujetos sanos preseleccionados usando un antígeno marcado (véase, por ejemplo, Casali et al. (1986) Science 234: 476-9, Yamaguchi et al. (1987) Proc Natl Acad Sci USA 84: 2416-2420, Posner et al. (1991) J Immunol. 146: 4325-4332, Raff et al. (1988) JExp Med. 168: 905-917, Steenbakkers et al. (1993) Hum Antibod Hybrid. 4: 166-173, Steenbakkers et al. (1994) Mol Biol Rep. 19: 125-134, Evans et al. (1988) J Immunol 140: 941- 943, y Wallis R et al. (1989) J Clin Invest 84: 214-219). Debido a la baja capacidad de transformación, baja clonabilidad y la inestabilidad y heterogeneidad inherentes de linfocitos B humanos infectados por VEB (Chan M et al. (1986) J Immunol 136: 106- 112 y James y Bell (1987) J Immunol Methods. 100: 5-40), pueden emplearse técnicas conocidas tales como fusión celular, tal como, por ejemplo, con una línea celular de mieloma (véase, por ejemplo, Bron et al. (1984) PNAS 81: 3214-3217; Yamaguchi et al. (1987) Proc Natl Acad Sci USA 84: 2416-2420; Posner et al. (1991) J Immunol. 146: 4325-4332, Niedbala y Stott (1998) Hybridoma 17: 299-304; Li et al. (2006) Proc Natl Acad Sci USA 103: 3557-62). Las técnicas adicionales para mejorar la inmortalización por VEB incluyen, por ejemplo, inmortalización con virus oncogénico, transformación con oncogenes, minielectrofusión y heterofusión de ratón-humano en un único proceso (véase, por ejemplo, Patente de Estados Unidos N.º 4.997.764; Steenbakkers et al. (1993) Hum Antibod Hybrid. 4: 166- 173; Dessain et al. (2004) J Immunol Methods. 291: 109-22). Los anticuerpos humanos monoclonales pueden aislarse de linfocitos B que se han activado e inmortalizado en presencia o en ausencia de un antígeno y combinando diversas manipulaciones en el cultivo celular como se describe en la técnica (véase por ejemplo, Borrebaeck C et al. (1988) Proc Natl Acad Sci USA 85: 3995-3999, Davenport et al. (1992) FEMS Microbiol Immunol. 4: 335-343, Laroche-Traineau et al. (1994) Hum Antib Hybrid. 5: 165-177, Morgenthaler et al. (1996) J. Clin Endocrinology. 81: 3155-3161, Niedbala y Kurpisz (1993) Immunol Lett. 35: 93-100, Mulder et al. (1993) Hum Immunol. 36: 186-192, Hur et al. (2005) Cell Prolif. 38: 35- 45, Traggiai et al. (2004) Nat Med 10: 871-875, Tsuchiyama et al. (1997) Hum Antibodies 8: 43-47; y Publicaciones de PCT N.º WO 91109115, WO 041076677, WO 88101642, WO 90102795, WO 96140252 y WO 02146233).

Los métodos para el aislamiento de anticuerpos humanos a partir de linfocitos B maduros generalmente implican el aislamiento de una población de linfocitos B maduros y explorar anticuerpos expresados por los linfocitos B contra un antígeno particular. Puede aislarse una diversidad de poblaciones diferentes de células secretoras de anticuerpos a partir de donantes humanos que tienen perfiles específicos (por ejemplo individuos sin tratamiento previo, vacunados, más o menos recientemente infectados y seropositivos) y de diferentes tejidos (por ejemplo sangre, amígdalas, bazo, ganglios linfáticos) en los que los linfocitos B residen y ejercen sus actividades (Viau y Zouali (2005) Clin Immunol. 114: 17-26). En un método ejemplar proporcionado en el presente documento, pueden aislarse anticuerpos anti VSR proporcionados en el presente documento a partir de una muestra de células mononucleares de sangre periférica (PBMC), que contienen linfocitos B, aislados de donantes humanos y/o de donantes humanos sanos que se han expuesto o tienen una alta probabilidad de haberse expuesto a VSR, tales como trabajadores de los cuidados sanitarios. Después del aislamiento de PBMC de las muestras biológicas, puede realizarse una selección específica de células secretoras de anticuerpos, usando uno de los diversos métodos descritos en la técnica, basándose en la expresión de los marcadores de superficie celular en su superficie y, si es apropiado, de otras proteínas, así como la actividad de proliferación, el estado metabólico y/o morfológico de las células. En particular, diversas tecnologías para la purificación de células secretoras de anticuerpos de muestras humanas usan medios y condiciones diferentes para selección positiva o negativa. Estas células se seleccionan fácilmente y eficazmente separando físicamente las que expresan marcadores de superficie celular específicos para células que expresan y secretan anticuerpos (por ejemplo linfocitos B humanos). Se conocen protocolos específicos y pueden encontrarse en la bibliografía (véase, por ejemplo, Callard y Kotowicz “Human B-cell responses to cytokines” en Cytokine Cell Biology: A practical Approach. Balkwill F. (ed.) Oxford University Press, 2000,17-31). La selección de células inmunitarias específicas tales como linfocitos B, se realiza típicamente usando anticuerpos que se unen específicamente con una proteína de superficie celular específica de linfocitos B y que puede unirse con soportes sólidos (por ejemplo, microperlas o placas de plástico) o marcarse con un fluorocromo que puede detectarse usando clasificación de células activadas por fluorescencia (FACS). Por ejemplo, se han seleccionado linfocitos B humanos basándose en su afinidad por soportes (tales como microperlas) que se unen con microperlas de CD19, CD27 y/o CD22, o por la falta de afinidad de unión por anticuerpos específicos para ciertos isotipos antes de la inmortalización por VEB (véase, por ejemplo, Li et al. (1995) Biochem Biophys Res Commun 207: 985-993, Bernasconi et al. (2003) Blood 101: 4500-4504 y Traggiai et al. (2004) Nat Med 10: 871-875). La selección del marcador celular para purificación puede afectar a la eficacia del proceso de inmortalización, por ejemplo, debido a señales intracelulares que se desencadenan por el proceso de selección y que pueden alterar el crecimiento y la viabilidad celular. Por ejemplo, CD22, que es una proteína transmembrana restringida a linfocitos B que controla las rutas de transducción de señales relacionadas con el reconocimiento de antígenos y la activación de linfocitos B es una molécula ejemplar para selección de linfocitos B inicial. Ya que la población positiva para CD22 contiene células que expresan anticuerpos que tienen diferentes isotipos y especificidades, también pueden usarse otros marcadores de superficie celular para seleccionar las células, bien antes o bien después de la fase de estimulación. En algunos ejemplos, puede obtenerse un enriquecimiento específico de células secretoras de anticuerpos aplicando una selección basada en CD27 además de la selección basada en CD22. Se sabe que CD27 es un marcador para linfocitos B humanos que tienen genes de región variable mutados somáticamente (Borst J et al. (2005) Curr Opin Immunol. 17: 275-281.). También pueden usarse marcadores adicionales tales como CD5, CD24, CD25, CD86, CD38, CD45, CD70 o CD69 para empobrecer o enriquecer con respecto a la población deseada de células. Por lo tanto, dependiendo de factores tales como el historial del donante de exposición al antígeno (por ejemplo antígeno de VSR) y el título de anticuerpos, pueden seleccionarse linfocitos B enriquecidos con CD22 totales, o subpoblaciones de linfocitos B enriquecidas adicionales tales como linfocitos B CD27 positivos. Después de la selección celular, y antes de la inmortalización de las células, la población de las células puede exponerse a un agente estimulante apropiado. Los agentes estimulantes ejemplares incluyen, por ejemplo, activadores de linfocitos B policlonales, tales como, pero sin limitación, agonistas de respuestas inmunitarias innatas (por ejemplo agonistas del receptor de tipo Toll tales como oligonucleótidos CpG (Bernasconi et al. (2003) Blood 101: 4500-4504, Bernasconi et al. (2002) Science 298: 2199-2202, Bourke et al. (2003) Blood 102: 956-63; por ejemplo nucleótidos CpG, tales como, por ejemplo, CpG2006, CpG2395, y CpG2395, disponibles de Cell Sciences, Canton, MA) y moléculas inmunomoduladoras tales como citocinas (por ejemplo, interleucinas que se sabe que tienen actividades inmunoestimulantes, por ejemplo, IL-2, IL-4, IL-6, IL-10 e IL-13 (véase Callard y Kotowicz “Human B-cell responses to cytokines” en Cytokine Cell Biology: A practical Approach. Balkwill F (ed.) Oxford University Press, 2000, 17-31) y agonistas de receptores de membrana celular de la familia del receptor de TNF, en particular los que activan la ruta de NF-κB y proliferación de linfocitos B, tales como, pero sin limitación APRIL, BAFF, ligando de CD 40 (CD40L) (véase, por ejemplo, Schneider (2005) Curr Opin Immunol. 17: 282-289, He et al. (2004) J Immunol. 172: 3268-79, Craxton et al. (2003) Blood 101: 4464-4471, y Tangye et al. (2003) J Immunol. 170: 261- 269). Se conocen en la técnica métodos ejemplares para estimular linfocitos B usando inmortalización por VEB en combinación con o secuencialmente con uno o más activadores policlonales (véase, por ejemplo, Traggiai et al. (2004) Nat Med 10: 871-875, Tsuchiyama et al. (1997) Hum Antibodies 8: 43-47, Imadome et al. (2003) Proc Natl Acad Sci USA 100: 7836-7840, y Publicaciones de PCT N.º WO 2007/068758, WO 04/76677, WO 91/09115 y WO 94/24164). La combinación de agentes estimulantes puede añadirse al medio de cultivo celular antes de la fase de inmortalización al mismo tiempo o secuencialmente (por ejemplo añadiendo un primer agente estimulante inmediatamente después de la selección de células inicial y un segundo agente estimulante horas o días después). Los agentes estimulantes pueden añadirse directamente en el medio de cultivo celular a partir de soluciones de reserva diluidas, o después de formularse de forma apropiada, por ejemplo, usando liposomas u otros compuestos que puedan mejorar su captación y actividad inmunoestimulante (Gursel et al. (2001) J Immunol. 167: 3324-3328).

Los agentes estimulantes también pueden unirse con matrices sólidas (microperlas o directamente en las placas de cultivo celular), lo que puede permitir la retirada eficaz del agente o los agentes. Las células pueden lavarse con medio nuevo una o más veces y, opcionalmente, mantenerse en medio de cultivo celular normal (por ejemplo, de 1 a 6 días) para diluir adicionalmente y eliminar cualquier efecto restante de los agentes estimulantes. El agente o los agentes estimulantes también pueden inhibirse añadiendo compuestos específicos al cultivo celular.

Las células pueden seleccionarse además basándose en el isotipo del anticuerpo expresado después de estimular las células y antes de exponer dichas células seleccionadas y estimuladas al agente inmortalizante (es decir entre la fase de estimulación y la fase de inmortalización). La selección basada en isotipo de las células puede realizarse aplicando medios para selección positiva (que permite el aislamiento de las células específicas) o negativa (que permite la eliminación de células no deseadas). Por ejemplo, una población de células IgG positivas estimuladas puede seleccionarse positivamente (por FACS o separadores celulares magnéticos) o agotando células que expresen IgM de la población de células, y en consecuencia enriqueciendo con respecto a células que expresen IgG. Se conocen en la bibliografía tecnologías de separación para células secretoras de anticuerpos usando separadores celulares magnéticos o activados por fluorescencia (véase, por ejemplo, Li et al. (1995) Biochem.

Biophys Res Commun 207: 985-93, Traggiai et al. (2004) Nat Med 10: 871-875). Dependiendo de la fuente de células secretoras de anticuerpos y su uso final, también puede realizarse empobrecimiento (o enriquecimiento) de otras células que expresan isotipo, tales como células que expresan IgD o IgA. Puede usarse un enfoque similar para aislar células basándose en la subclase específica, si se desea dicha selección precisa (por ejemplo, selección de linfocitos B humanos que expresan anticuerpos IgG1, IgG2, IgG3 o IgG4).

Se conocen en la técnica diversos agentes de inmortalización virales y pueden usarse en células secretoras de anticuerpos para obtener células secretoras de anticuerpos inmortalizadas. Los virus que infectan e inmortalizan células secretoras de anticuerpos se conocen habitualmente como virus linfotrópicos. Son ejemplos de dichos virus los incluidos en la clase gamma del herpesvirus. Los miembros de esta familia de virus infectan linfocitos de una manera específica de especie, y se asocian con trastornos linfoproliferativos y el desarrollo de varios tumores malignos (Nicholas (2000) J. Mol Pathol. 53: 222-237 y Rickinson (2001) Philos Trans R Soc Lond B Biol Sci. 356: 595-604). Los virus ejemplares para su uso como un agente de inmortalización en los métodos proporcionados incluyen VEB (virus de Epstein-Barr, también conocido como herpesvirus 4), y HHV-8 (herpesvirus humano 8, también conocido como KSHV, Herpesvirus asociado al Sarcoma de Kaposi), que pueden infectar e inmortalizar linfocitos humanos. Otros virus ejemplares para su uso en los métodos incluyen, pero sin limitación, MHV-68 (herpesvirus murino 68), HVS (herpesvirus Samiri), RRV (Rhadinovirus Rhesus), LCV (Linfocriptovirus de primate), EHV-2 (Herpesvirus Equino 2), HVA (Herpesvirus Ateles) y AHV-1 (Herpesvirus Alcelafino 1), que son otros herpesvirus oncogénicos, linfotrópicos, que tienen algunas características genéticas comunes conservadas entre ellos y efectos patógenos similares en diferentes células hospedadoras de mamífero.

Las construcciones de ADN recombinantes que contiene proteínas virales específicas de virus empleados para inmortalizar también se han usado para inmortalizar linfocitos B (véase Damania (2004) Nat Rev Microbiol. 2: 656- 668 y Kilger et al. (1998) EMBO J. 17: 1700-1709). Pueden transducirse vectores similares que contienen genes virales en células en los métodos proporcionados. Se conocen bien en la técnica métodos para preparar dichas construcciones e incluyen, por ejemplo, el uso de sistemas retrovirales o partículas de tipo viral y líneas celulares de empaquetamiento, que proporcionan todos los factores necesarios en trans para la formación de dichas partículas. La fase de inmortalización puede durar entre una y varias horas, hasta 2-4 días. La duración de la fase de inmortalización puede ajustarse dependiendo de diversos factores tales como la viabilidad celular y la eficacia de inmortalización. En algunos ejemplos, las células se inmortalizan con VEB durante un periodo de aproximadamente 4 a aproximadamente 24 horas. En un ejemplo particular, las células se inmortalizan con VEB durante un periodo de aproximadamente 16 horas. La inmortalización mediada por VEB de linfocitos B requiere la expresión del receptor de superficie celular CD21, que se considera el principal receptor de VEB. CD21 está presente en la mayoría de subpoblaciones de linfocitos B y regulas las respuestas de linfocitos B formando un complejo con CD19 y el receptor de antígenos de linfocitos B (Fearon y Carroll (2000) Ann Rev Immun. 18: 393-422). La capacidad para transformar células con VEB puede potenciarse mediante la adición de agentes estimulantes de linfocitos B, pero las condiciones deben asegurar que CD21 se mantiene en la superficie celular, permitiendo la inmortalización de VEB a alta eficacia.

Después de la fase de inmortalización, las células inmortalizadas pueden cultivarse a una baja densidad en capas celulares de alimentación. La capa de alimentación puede constituirse por preparaciones celulares de sangre periférica no alogénicas irradiadas, líneas celulares linfoblastoides o de fibroblastos, linfocitos de sangre del cordón umbilical o diferentes tipos de células embrionarias. Un ejemplo de una línea celular que tiene dichas propiedades es EL4-B5, líneas celulares de timoma EL4 mutantes que apoyan eficazmente el crecimiento y la proliferación de linfocitos B. Otras células de alimentación ejemplares incluyen células de alimentación PMBC empobrecidas en linfocitos B irradiadas como se describe en otra parte del presente documento. Los agentes promotores del crecimiento tales como los usados para estimular la población de linfocitos B también pueden usarse para mantener la población de linfocitos B inmortalizada después de la inmortalización.

Las poblaciones inmortalizadas de células pueden usarse para una serie de aplicaciones, en particular relacionadas con el aislamiento, la caracterización y la producción de anticuerpos. En algunos ejemplos, las bibliotecas de ADN que codifican los anticuerpos expresados por las células o fragmentos de dichos anticuerpos pueden construirse a partir de ADN aislado de la población general de células usando técnicas recombinantes habituales. En algunos ejemplos como se describe en el presente documento, las células inmortalizadas pueden además cultivarse y dividirse en grupos de células secretoras de anticuerpos. Los grupos de células pueden cultivarse, por ejemplo, en capas de células de alimentación. En algunos ejemplos, se exploran sobrenadantes de cultivo celular a partir de los grupos de células en uno o más ciclos, para la identificación de células que expresan anticuerpos que tienen una especificidad de antígeno particular (por ejemplo, anticuerpos que se unen inmunoespecíficamente con una proteína F de VSR). Se describen en otra parte en el presente documento y se conocen en la técnica métodos ejemplares para explorar anticuerpos y medir la especificidad de unión. Una vez que se ha identificado un anticuerpo particular, el ADN que codifica el anticuerpo o partes de unión a antígeno del mismo puede aislarse de los grupos de células usando métodos recombinantes bien conocidos. Como se describe en el presente documento, después puede expresarse ADN aislado de los grupos de células (por ejemplo, en una célula hospedadora procariota o eucariota) y volver a explorarse con respecto a la identificación de clones individuales que expresan el anticuerpo deseado o fragmento de unión a antígeno del mismo. En algunos ejemplos como se describe en el presente documento, las células inmortalizadas pueden ser células individuales separadas usando un separador celular (por ejemplo, FACS), usando un antígeno marcado. En un ejemplo particular, las células que expresan anticuerpos anti VSR pueden aislarse usando un antígeno F de VSR marcado con Alexa Fluor 647 para marcar las células deseadas. Después de la separación, el ADN que codifica el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede aislarse a continuación usando métodos recombinantes bien conocidos. El ADN aislado de los grupos de células puede expresarse (por ejemplo, en una célula hospedadora procariota o eucariota) para confirmar la unión con el antígeno de VSR.

Típicamente, los métodos de exploración empleados para la identificación de anticuerpos individuales que se unen con un antígeno particular dan como resultado la identificación de la parte de unión a antígeno de dichos anticuerpos. Para generar anticuerpos de longitud completa u otros derivados del fragmento de unión a antígeno, las secuencias de nucleótidos que codifican la cadena VH y/o VL o partes de unión a antígeno de las mismas pueden aislarse y clonarse en vectores que expresan una región constante VH (por ejemplo, la región constante gamma 1 humana), región constante VL (por ejemplo, regiones constantes kappa o lambda humanas), respectivamente. Los dominios VH y VL también pueden clonarse en un vector que expresa las regiones constantes seleccionadas. Los vectores de conversión de cadena pesada y vectores de conversión de cadena ligera se cotransfectan después en líneas celulares para generar líneas celulares estables o transitorias que expresan anticuerpos de longitud completa, por ejemplo, IgG, usando técnicas conocidas por los expertos en la materia. F. MÉTODOS PARA PRODUCIR ANTICUERPOS ANTI VSR, Y FORMAS MODIFICADAS O VARIANTES DE LOS MISMOS Y ÁCIDOS NUCLEICOS QUE CODIFICAN ANTICUERPOS Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden generarse por cualquier método adecuado conocido en la técnica para la preparación de anticuerpos, incluyendo síntesis química y técnicas de expresión recombinante. Pueden usarse diversas combinaciones de células hospedadoras y vectores para recibir, mantener, reproducir y amplificar ácidos nucleicos (por ejemplo ácidos nucleicos que codifican anticuerpos tales como los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados), y para expresar polipéptidos codificados por los ácidos nucleicos. En general, la elección de célula hospedadora y vector depende de si se desea la amplificación, la expresión del polipéptido y/o la presentación en un paquete genético, tal como un fago. Se conocen bien métodos para transformar células hospedadoras. Puede usarse cualquier método de transformación conocido (por ejemplo, transformación, transfección, infección, electroporación y sonoporación) para transformar la célula hospedadora con ácidos nucleicos. Se conocen bien en la técnica procedimientos para la producción de anticuerpos, tales como anticuerpos monoclonales y fragmentos de anticuerpo, tales como, pero sin limitación, fragmentos Fab y anticuerpos monocatenarios. Pueden prepararse anticuerpos monoclonales usando una amplia diversidad de técnicas conocidas en este campo incluyendo, pero sin limitación, el uso de hibridoma, expresión recombinante, tecnologías de presentación en fagos o una combinación de los mismos. Por ejemplo, pueden producirse anticuerpos monoclonales usando técnicas de hibridoma incluyendo las conocidas en este campo y enseñadas, por ejemplo, en Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2ª ed. 1988); Hammerling, Monoclonal Antibodies and T- Cell Hybridomas 5630681 (Elsevier N. Y. 1981).

Pueden producirse polipéptidos, tales como cualquiera expuesto en el presente documento, incluyendo los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento por cualquier método conocido por los expertos en la materia incluyendo métodos in vivo e in vitro. Los polipéptidos deseados pueden expresarse en cualquier organismo adecuado para producir las cantidades y formas requeridas de las proteínas, tal como por ejemplo, necesarias para el análisis, la administración y el tratamiento. Los hospedadores de expresión incluyen organismos procariotas y eucariotas tales como E. coli, levadura, plantas, células de insecto, células de mamífero, incluyendo líneas celulares humanas y animales transgénicos (por ejemplo, conejos, ratones, ratas y ganado, tal como, pero sin limitación, cabras, ovejas y vacas), incluyendo producción en suero, leche y huevos. Los hospedadores de expresión pueden diferir en sus niveles de producción de proteínas así como en los tipos de modificaciones postraduccionales que están presentes en las proteínas expresadas. La elección de hospedador de expresión puede realizarse basándose en estos y otros factores, tales como consideraciones reguladoras y de seguridad, costes de producción y la necesidad y los métodos de purificación. 1. Ácidos nucleicos Se proporcionan en el presente documento moléculas de ácido nucleico aisladas que codifican un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, la molécula de ácido nucleico aislada codifica un anticuerpo que es 58c5. En algunos ejemplos, la molécula de ácido nucleico aislada codifica un fragmento de unión a antígeno que es un fragmento de unión a antígeno de 58c5.

En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento de unión a antígeno del mismo que contiene una cadena pesada que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada contiene un ácido nucleico que tiene una secuencia de nucleótidos expuesta en SEC ID Nº: 18.

En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento de unión a antígeno del mismo que contiene una cadena ligera que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 5. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada contiene un ácido nucleico que tiene una secuencia de nucleótidos expuesta en SEC ID Nº: 17.

En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR1 de VH que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 2. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR2 de VH que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 3. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR3 de VH que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 4. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR1 de VL que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 6. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR2 de VL que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 7. En algunos ejemplos, la molécula de ácido nucleico aislada proporcionada codifica un anticuerpo o fragmento del mismo que contiene una CDR3 de VL que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 8.

Las moléculas de ácido nucleico que codifican los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden prepararse usando técnicas recombinantes bien conocidas para manipulación de moléculas de ácido nucleico (véase, por ejemplo, técnicas descritas en Sambrook et al. (1990) Molecular Cloning, A Laboratory Manual, 2ª Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. y Ausubel et al., eds. (1998) Current Protocols in Molecular Biology, John Wiley & Sons, NY). En algunos ejemplos, pueden usarse métodos, tales como, pero sin limitación, técnicas de ADN recombinante, mutagénesis dirigida y reacción en cadena de la polimerasa (PCR) para generar anticuerpos modificados o fragmentos de unión a antígeno de los mismos que tengan una secuencia de aminoácidos diferente, por ejemplo, para crear sustituciones, deleciones y/o inserciones de aminoácidos.

En algunos ejemplos, una o más de las CDR de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionadas en el presente documento se insertan dentro de regiones marco conservadas usando técnicas de ADN recombinante rutinarias. Las regiones marco conservadas pueden seleccionarse de regiones marco conservadas de origen natural o consenso, incluyendo regiones marco conservadas humanas (véase, por ejemplo, Chothia et al. (1998) J. Mol. Biol. 278: 457-479 para regiones marco conservadas ejemplares). Generalmente, el polinucleótido generado por la combinación de las regiones marco conservadas y CDR codifica un anticuerpo o fragmento de unión a antígeno del mismo que mantiene la especificidad de unión a antígeno del anticuerpo anti VSR parental o fragmento de unión a antígeno del mismo. Pueden realizarse alteraciones del polinucleótido para mejorar una o más propiedades del anticuerpo codificado o fragmento de unión a antígeno del mismo y dentro de la experiencia de la técnica. En algunos ejemplos, pueden realizarse una o más modificaciones del polinucleótido para producir sustituciones de aminoácidos dentro de las regiones marco conservadas, que, por ejemplo, mejoran la unión del anticuerpo o fragmento de unión a antígeno del mismo con su antígeno. Adicionalmente, dichos métodos pueden usarse para realizar sustituciones o deleciones de aminoácidos de uno o más restos de cisteína de región variable que participan en un enlace disulfuro intracatenario para generar moléculas de anticuerpo que carecen de uno o más enlaces disulfuro intracatenarios.

2. Vectores Se proporcionan en el presente documento vectores que contienen ácido nucleico que codifica los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. Están disponibles muchos vectores de expresión y se conocen por los expertos en la materia y pueden usarse para la expresión de polipéptidos. La elección del vector de expresión estará influida por la elección del sistema de expresión hospedador. Dicha selección está dentro del nivel de experiencia del experto en la materia. En general, los vectores de expresión pueden incluir promotores y opcionalmente potenciadores de la transcripción, señales de traducción y señales de terminación de la transcripción y la traducción. Los vectores de expresión que se usan para transformación estable típicamente tienen un marcador seleccionable que permite la selección y el mantenimiento de las células transformadas. En algunos casos, puede usarse un origen de replicación para amplificar el número de copias del vector en las células. Los vectores también pueden contener secuencias de nucleótidos adicionales unidas operativamente con la molécula de ácido nucleico ligada, tal como, por ejemplo, un marcador epitópico tal como para localización, por ejemplo, un marcador hexa his o un marcador myc, o un marcador para purificación, por ejemplo, una fusión de GST, y una secuencia para dirigir la secreción de proteínas y/o asociación a membrana. La expresión de los anticuerpos o fragmentos de unión a antígeno de los mismos puede controlarse por cualquier promotor/potenciador conocido en la técnica. Los promotores bacterianos adecuados se conocen bien en la técnica y se describen posteriormente en el presente documento. Otros promotores adecuados para células de mamífero, células de levadura y células de insecto se conocen bien en la técnica y algunos se ejemplifican posteriormente. La selección del promotor usado para dirigir la expresión de un ácido nucleico heterólogo depende de la aplicación particular y está dentro del nivel de experiencia del experto en la materia. Los promotores que pueden usarse incluyen pero sin limitación vectores de expresión eucariota que contienen el promotor temprano de SV40 (Bernoist y Chambon, (1981) Nature 290: 304-310), el promotor contenido en la repetición terminal larga 3’ del virus del sarcoma de Rous (Yamamoto et al. (1980) Cell 22: 787-797), el promotor de timidina quinasa de herpes (Wagner et

al., (1981) Proc. Natl. Acad. Sci. USA 78: 1441-1445), las secuencias reguladoras del gen de metalotioneína (Brinster et al., (1982) Nature 296: 39-42); vectores de expresión procariotas tales como el promotor de β-lactamasa (Jay et al., (1981) Proc. Natl. Acad. Sci. USA 78: 5543) o el promotor de tac (DeBoer et al., (1983) Proc. Natl. Acad. Sci. USA 80: 21-25); véase también “Useful Proteins from Recombinant Bacteria”: en Scientific American 242: 79-94 (1980)); vectores de expresión de plantas que contienen el promotor de nopalina sintetasa (Herrera-Estrella et al., (1984) Nature 303: 209-213) o el promotor de ARN 35S del virus del mosaico de la coliflor (Gardner et al., (1981) Nucleic Acids Res. 9: 2871), y el promotor de la enzima fotosintética ribulosa bisfosfato carboxilasa (Herrera-Estrella et al., (1984) Nature 310: 115-120); elementos promotores de levadura y otros hongos tales como el promotor de Gal4, el promotor de la alcohol deshidrogenasa, el promotor de fosfoglicerol quinasa, el promotor de fosfatasa alcalina, y las siguientes regiones de control de la transcripción animales que muestras especificidad tisular y se han usado en animales transgénicos: región de control del gen I de elastasa que está activa en células de acinos pancreáticos (Swift et al., (1984) Cell 38: 639-646; Ornitz et al., (1986) Cold Spring Harbor Symp. Quant. Biol. 50: 399-409; MacDonald, (1987) Hepatology 7: 425-515); región de control del gen de insulina que está activa en células beta pancreáticas (Hanahan et al., (1985) Nature 315: 115-122), región de control del gen de inmunoglobulina que está activa en células linfoides (Grosschedl et al., (1984) Cell 38: 647-658; Adams et al., (1985) Nature 318: 533- 538; Alexander et al., (1987) Mol. Cell Biol. 7: 1436-1444), región de control del virus de tumor mamario de ratón que está activa en células testiculares, de mama, linfoides y mastocitos (Leder et al., (1986) Cell 45: 485-495), región de control del gen de albúmina que está activa en el hígado (Pinckert et al., (1987) Genes and Devel. 1: 268-276), región de control del gen de la fetoproteína alfa que está activa en el hígado (Krumlauf et al., (1985) Mol. Cell. Biol.

5: 1639-1648); Hammer et al., (1987) Science 235: 53-58), región de control del gen de antitripsina alfa 1 que está activa en el hígado (Kelsey et al., (1987) Genes y Devel. 1: 161-171), región de control del gen de beta globina que está activa en células mieloides (Magram et al., (1985) Nature 315: 338-340); Kollias et al., (1986) Cell 46: 89-94), región de control del gen de proteína básica de mielina que está activa en células oligodendrocíticas del cerebro (Readhead et al., (1987) Cell 48: 703-712), región de control del gen de la cadena ligera de miosina 2 que está activa en el músculo esquelético (Shani (1985) Nature 314: 283-286) y región de control del gen de la hormona liberadora gonadotrópica que está activa en gonadotropos del hipotálamo (Mason et al., (1986) Science 234: 1372- 1378). Además del promotor, el vector de expresión típicamente contiene una unidad de transcripción o casete de expresión que contiene todos los elementos adicionales requeridos para la expresión de un anticuerpo, o parte del mismo, en células hospedadoras. Un casete de expresión típico contiene un promotor unido operativamente con la secuencia de ácido nucleico que codifica la cadena de anticuerpo de línea germinal y señales requeridas para poliadenilación eficaz del transcrito, sitios de unión a ribosomas y terminación de la traducción. Los elementos adicionales del casete pueden incluir potenciadores. Además, el casete típicamente contiene una región de terminación de la transcripción cadena abajo del gen estructural para proporcionar terminación eficaz. La región de terminación puede obtenerse del mismo gen que la secuencia promotora o puede obtenerse de genes diferentes. Algunos sistemas de expresión tienen marcadores que proporcionan amplificación génica tales como timidina quinasa y dihidrofolato reductasa. Como alternativa, también son adecuados sistemas de expresión de alto rendimiento que no implican amplificación génica, tal como usando un vector de baculovirus en células de insecto, con una secuencia de ácido nucleico que codifica una cadena de anticuerpo de línea germinal bajo la dirección del promotor de la polihedrina u otro promotor de baculovirus fuerte. Puede usarse cualquier método conocido por los expertos en la materia para la inserción de fragmentos de ADN en un vector para construir vectores de expresión que contengan un ácido nucleico que codifique un anticuerpo o fragmento de unión a antígeno del mismo proporcionado en el presente documento. Estos métodos pueden incluir técnicas de ADN recombinante in vitro y sintéticas y recombinantes in vivo (recombinación genética). La inserción en un vector de clonación puede conseguirse, por ejemplo, ligando el fragmento de ADN en un vector de clonación que tiene extremos cohesivos complementarios. Si los sitios de restricción complementarios usados para fragmentar el ADN no están presentes en el vector de clonación, los extremos de las moléculas de ADN pueden modificarse de forma enzimática. Como alternativa, cualquier sitio deseado puede producirse ligando secuencias de nucleótidos (enlazadores) en los extremos terminales del ADN; estos enlazadores ligados pueden contener ácidos nucleicos sintetizados químicamente específicos que codifican secuencias de reconocimiento de endonucleasas de restricción.

Los vectores plasmídicos ejemplares útiles para producir los anticuerpos o fragmentos de unión a antígeno proporcionados en el presente documento contienen un promotor fuerte, tal como el potenciador/promotor temprano inmediato de HCMV o el promotor del MHC de clase I, un intrón para potenciar el procesamiento del transcrito, tal como el intrón A del gen temprano inmediato de HCMV, y una señal de poliadenilación (poliA), tal como la señal de poliA de SV40 tardía. El plásmido puede ser multicistrónico para permitir la expresión de las cadenas pesada y ligera de longitud completa del anticuerpo, un fragmento Fv monocatenario u otros fragmentos de inmunoglobulina. 3. Sistemas de expresión celular Los ácidos nucleicos que codifican los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden expresarse en un hospedador adecuado. Se proporcionan células que contienen los vectores y ácidos nucleicos que codifican los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. En general, cualquier tipo celular que pueda modificarse técnicamente para expresar ADN heterólogo y tenga una ruta secretora es adecuado. Los hospedadores de expresión incluyen organismos procariotas y eucariotas, tales como células bacterianas (por ejemplo E. coli), células de levadura, células fúngicas, Arqueas, células vegetales, células de insecto y células animales incluyendo células humanas. Los hospedadores de expresión pueden diferir en sus niveles de producción de proteínas así como los tipos de modificaciones postraduccionales que están presentes en las proteínas expresadas. Además, la elección del hospedador de expresión está relacionada con frecuencia con la elección del vector y elementos de transcripción y traducción usados. Por ejemplo, la elección del hospedador de expresión depende con frecuencia, pero no siempre, de la elección de secuencia precursora utilizada. Por ejemplo, muchas secuencias señal heterólogas pueden expresarse solamente en una célula hospedadora de la misma especie (es decir, una secuencia señal de células de insecto se expresa de forma óptima en una célula de insecto). Por el contrario, otras secuencias señal pueden usarse en hospedadores heterólogos tales como, por ejemplo, la secuencia señal de albúmina de suero humano (hHSA) que funciona bien en células hospedadoras de levadura, de insectos o de mamíferos y la secuencia pre/pro activadora del plasminógeno tisular que se ha demostrado que es funcional en células de insectos y de mamíferos (Tan et al., (2002) Protein Eng. 15: 337). La elección del hospedador de expresión puede realizarse basándose en estos y otros factores, tales como consideraciones reguladoras y de seguridad, los costes de producción y la necesidad y los métodos de purificación. Por lo tanto, el sistema de vector debe ser compatible con la célula hospedadora usada.

La expresión en hospedadores eucariotas puede incluir expresión en levaduras tales como Saccharomyces cerevisiae y Pichia pastoris, células de insecto tales como células de Drosophila y células de lepidópteros, plantas y células vegetales tales como tabaco, maíz, arroz, algas y lemna. Las células eucariotas para expresión también incluyen líneas celulares de mamífero tales como células de ovario de hámster Chino (CHO) o células de riñón de cría de hámster (BHK). Los hospedadores de expresión eucariotas también incluyen producción en animales transgénicos, por ejemplo, incluyendo producción en suero, leche y huevos. Pueden introducirse moléculas recombinantes en células hospedadoras mediante, por ejemplo, transformación, transfección, infección, electroporación y sonoporación, de modo que se generen muchas copias de la secuencia génica. En general, se usan métodos de transfección convencionales para producir líneas celulares bacterianas, de mamífero, de levadura o de insecto que expresen grandes cantidades de cadenas de anticuerpos, que después se purifican usando técnicas convencionales (véase por ejemplo, Colley et al. (1989) J. Biol. Chem., 264: 17619-17622; Guide to Protein Purification, en Methods in Enzymology, vol. 182 (Deutscher, ed.), 1990). Se realiza transformación de células eucariotas y procariotas de acuerdo con técnicas convencionales (véase, por ejemplo, Morrison (1977) J. Bact. 132: 349-351; Clark-Curtiss y Curtiss (1983) Methods in Enzymology, 101, 347-362). Por ejemplo, puede usarse cualquiera de los procedimientos bien conocidos para introducir secuencias de nucleótidos ajenas en células hospedadoras. Estos incluyen el uso de transfección con fosfato cálcico, polibreno, fusión de protoplastos, electroporación, biolística liposomas, microinyección, vectores plasmáticos, vectores virales (por ejemplo, baculovirus, virus vaccinia, adenovirus y otros virus) y cualquier otro de los otros métodos bien conocidos para introducir ADN genómico clonado, ADNc, ADN plasmídico, ADN cosmídico, ADN sintético u otro material genético ajeno en una célula hospedadora. a. Expresión procariota Los procariotas, especialmente E. coli, proporcionan un sistema para producir grandes cantidades de proteínas y pueden usarse para expresar los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos. Típicamente, se usan células hospedadoras de E. coli para amplificación y expresión de los polipéptidos variantes proporcionados. La transformación de E. coli es una técnica sencilla y rápida bien conocida por los expertos en la materia. Los vectores de expresión para E. coli pueden contener promotores inducibles, dichos promotores son útiles para inducir altos niveles de expresión de proteínas y para expresar proteínas que muestran algo de toxicidad para las células hospedadoras. Los ejemplos de promotores incluyen el promotor lac, el promotor trp, el promotor tac híbrido, los promotores de ARN T7 y SP6 y el promotor λPL regulador por temperatura. Las proteínas, tales como cualquiera proporcionada en el presente documento, pueden expresarse en el ambiente citoplasmático de E. coli. Para algunos polipéptidos, el ambiente citoplasmático puede dar como resultado la formación de cuerpos de inclusión insolubles que contienen agregados de las proteínas. Pueden usarse agentes reductores tales como ditiotreitol y β-mercaptoetanol y desnaturalizantes, tales como guanidina-HCl y urea para resolubilizar las proteínas, seguido de replegamiento posterior de las proteínas solubles. Un enfoque alternativo es la expresión de proteínas en el espacio periplásmico de bacterias lo que proporciona un ambiente oxidante e isomerasas de tipo chaperonina y de disulfuro y puede conducir a la producción de proteína soluble. Por ejemplo, para presentación en fagos de las proteínas, las proteínas se exportan al periplasma de modo que puedan ensamblarse en el fago. Típicamente, una secuencia líder se fusiona con la proteína para expresar que dirige la proteína al periplasma. El líder se retira después por peptidasas señal dentro del periplasma. Los ejemplos de secuencias líder de dirección periplásmica incluyen el líder pelB del gen de pectato liasa y el líder derivado del gen de la fosfatasa alcalina. En algunos casos, la expresión periplásmica permite la filtración de la proteína expresada al medio de cultivo. La secreción de proteínas permite una purificación rápida y sencilla del sobrenadante de cultivo. Las proteínas que no se secretan pueden obtenerse del periplasma por lisis osmótica. De forma similar a la expresión citoplasmática, en algunos casos las proteínas pueden hacerse insolubles y pueden usarse desnaturalizantes y agentes reductores para facilitar la solubilización y el replegamiento. La temperatura de inducción y crecimiento también puede influir en los niveles de expresión y solubilidad, típicamente se usan temperaturas de entre 25 ºC y 37 ºC. Típicamente, las bacterias producen proteínas no glucosiladas. Por lo tanto, si las proteínas requieren glucosilación para actuar, puede añadirse glucosilación in vitro después de purificación de las células hospedadoras. b. Células de levadura Las levaduras tales como Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis y Pichia pastoris son hospedadores de expresión de levadura bien conocidos que pueden usarse para expresar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. La levadura puede transformarse con vectores de replicación episómica o mediante integración cromosómica estable por recombinación homóloga. Típicamente, se usan promotores inducibles para regular la expresión génica. Los ejemplos de dichos promotores incluyen GAL1, GAL7 y GAL5 y promotores de metalotioneína, tales como CUP1, AOX1 y otro promotor de Pichia u otra levadura. Los vectores de expresión incluyen con frecuencia un marcador seleccionable tal como LEU2, TRP1, HIS3 y URA3 para selección y mantenimiento del ADN transformado. Las proteínas expresadas en levadura son con frecuencia solubles. La coexpresión con chaperoninas tales como Bip y proteína disulfuro isomerasa pueden mejorar los niveles de expresión y solubilidad. Adicionalmente, las proteínas expresadas en levadura pueden dirigirse para secreción usando fusiones de péptidos señal de secreción tales como la señal de secreción del factor alfa de tipo apareamiento de levadura de Saccharomyces cerevisiae y fusiones con proteínas de superficie celular de levadura tales como el receptor de adhesión de apareamiento Aga2p o la glucoamilasa de Arxula adeninivorans. Un sitio de escisión por proteasa tal como para la proteasa Kex-2, puede modificarse técnicamente para retirar las secuencias fusionadas de los polipéptidos expresados a medida que salen de la ruta de secreción. La levadura también tiene capacidad de glucosilación en motivos Asn-X-Ser/Thr. c. Células de insecto Pueden usarse células de insecto, particularmente usando expresión de baculovirus, para expresar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. Las células de insecto expresan altos niveles de proteína y son capaces de la mayoría de modificaciones postraduccionales usadas por eucariotas superiores. Los baculovirus tienen un intervalo de hospedadores restrictivo que mejora la seguridad y reduce las preocupaciones reguladoras de la expresión eucariota. Los vectores de expresión típicos usan un promotor para expresión de alto nivel tal como el promotor de polihedrina del baculovirus. Los sistemas de baculovirus usados habitualmente incluyen los baculovirus tales como virus de la polihedrosis nuclear de Autographa californica (AcNPV) y el virus de la polihedrosis nuclear de Bombyx mori (BmNPV) y una línea celular de insecto tal como Sf9 derivada de Spodoptera frugiperda, Pseudaletia unipuncta (A7S) y Danaus plexippus (DpN1). Para expresión de alto nivel, la secuencia de nucleótidos de la molécula para expresar se fusiona inmediatamente cadena abajo del codón de inicio de la polihedrina del virus. Las señales de secreción de mamíferos se procesan con precisión en células de insecto y pueden usarse para secretar la proteína expresada al medio de cultivo. Además, las líneas celulares Pseudaletia unipuncta (A7S) y Danaus plexippus (DpN1) producen proteínas con patrones de glucosilación similares a los sistemas de células de mamífero.

Un sistema de expresión alternativo en células de insecto es el uso de células transformadas de forma estable. Pueden usarse para expresión líneas celulares tales como las células Schnieder 2 (S2) y Kc (Drosophila melanogaster) y células C7 (Aedes albopictus). El promotor de metalotioneína de Drosophila puede usarse para inducir altos niveles de expresión en presencia de inducción de metales pesados con cadmio o cobre. Los vectores de expresión se mantienen típicamente mediante el uso de marcadores seleccionables tales como neomicina e higromicina. d. Células de mamífero Pueden usarse sistemas de expresión de mamíferos para expresar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. Las construcciones de expresión pueden transferirse a células de mamífero mediante infección viral, tal como, pero sin limitación, adenovirus o virus vaccinia, o mediante transferencia de ADN directa tal como liposomas, fosfato cálcico, DEAE-dextrano y por medios físicos, tales como electroporación y microinyección. Los vectores de expresión para células de mamífero incluyen típicamente un sitio de recubrimiento terminal de ARNm, una caja TATA, una secuencia de inicio de la traducción (secuencia consenso de Kozak) y elementos de poliadenilación. Dichos vectores incluyen con frecuencia promotores-potenciadores de la transcripción para expresión a alto nivel, por ejemplo el promotor-potenciador de SV40, el promotor de citomegalovirus humano (CMV) y la repetición terminal larga del virus del sarcoma de Rous. Estos promotores-potenciadores están activos en muchos tipos celulares. También pueden usarse para expresión promotores de tipo tisular y celular y regiones potenciadoras. Las regiones promotoras/potenciadoras ejemplares incluyen, pero sin limitación, las de genes tales como elastasa 1, insulina, inmunoglobulina, virus del tumor mamario de ratón, albúmina, alfa fetoproteína, antitripsina alfa 1, beta globina, proteína básica de mielina, cadena ligera de

ES 2 553 440 T3   miosina 2 y control del gen de la hormona liberadora gonadotrópica. Los marcadores seleccionables pueden usarse para seleccionar y mantener células con la construcción de expresión. Los ejemplos de genes marcadores seleccionables incluyen, pero sin limitación, higromicina B fosfotransferasa, adenosina desaminasa, xantina-guanina fosforribosil transferasa, aminoglucósido fosfotransferasa, dihidrofolato reductasa y timidina quinasa. La fusión con moléculas de señalización de superficie celular tales como TCR-ζ y FceRI-γ puede dirigir la expresión de las proteínas en un estado activo en la superficie celular. Están disponibles muchas líneas celulares para expresión en mamíferos incluyendo células de ratón, de rata, humanas, de mono, de pollo y de hámster. Las líneas celulares ejemplares incluyen, pero sin limitación, CHO, Balb/3T3, BHK, HeLa, MDCK, MT2, NS0 de ratón (no secretora) y otras líneas celulares de mieloma, líneas celulares de hibridoma y heterohibridoma, linfocitos, fibroblastos, células Sp2/0, COS, NIH3T3, HEK293, W138, BT483, HS578T, HTB2, BT20, T47D, 293S, 2B8 y HKB. Las líneas celulares también están disponibles adaptadas a medios sin suero lo que facilita la purificación de proteínas secretadas del medio de cultivo celular. Un ejemplo tal es la línea celular EBNA-1 sin suero (Pham et al., (2003) Biotechnol. Bioeng. 84: 332-42.) e. Plantas Las células vegetales y plantas transgénicas pueden ser para expresar polipéptidos tales como cualquiera descrito en el presente documento. Típicamente se transfieren construcciones de expresión a plantas usando transferencia de ADN directa tal como bombardeo de microproyectiles y transferencia mediada por PEG en protoplastos, y con transformación mediada por agrobacterium. Los vectores de expresión pueden incluir secuencias promotoras y potenciadoras, elementos de terminación de la transcripción y elementos de control de la traducción. Los vectores de expresión y técnicas de transformación se dividen habitualmente entre hospedadoras dicotiledóneos, tales como Arabidopsis y tabaco, y hospedadores monocotiledóneos, tales como maíz y arroz. Los ejemplos de promotores vegetales usados para expresión incluyen el promotor del virus del mosaico de la coliflor, el promotor de nopalina sintasa, el promotor de ribosa bisfosfato carboxilasa y los promotores de ubiquitina y UBQ3. Se usan con frecuencia marcadores seleccionables tales como higromicina, fosfomanosa isomerasa y neomicina fosfotransferasa para facilitar la selección y el mantenimiento de células transformadas. Las células vegetales transformadas pueden mantenerse en cultivo como células, agregados (tejido calloso) o regenerarse en plantas completas. Las células vegetales transgénicas también pueden incluir algas modificadas técnicamente para producir proteasas o proteasas modificadas (véase por ejemplo, Mayfield et al. (2003) Proc Natl Acad Sci USA 100: 438-442). Debido a que las plantas tienen patrones de glucosilación diferentes a las células de mamífero, esto puede influir en la elección de proteína producida en estos hospedadores.

4. Purificación de anticuerpos Los métodos de purificación de polipéptidos incluyendo los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento, de células hospedadoras dependerán de las células hospedadoras y los sistemas de expresión elegidos. Para moléculas secretadas, las proteínas generalmente se purifican del medio de cultivo después de retirar las células. Para expresión intracelular, las células pueden lisarse y las proteínas purificarse del extracto. En un ejemplo, se aíslan polipéptidos de las células hospedadoras por centrifugación y lisis celular (por ejemplo por congelación/descongelación repetida en un baño de hielo seco/etanol), seguido de centrifugación y retención del sobrenadante que contiene los polipéptidos. Cuando se usan organismos transgénicos tales como plantas y animales transgénicos para expresión, pueden usarse tejidos u órganos como material de partida para realizar un extracto celular lisado. Adicionalmente, la producción de animales transgénicos puede incluir la producción de polipéptidos en leche o huevos, que pueden recogerse, y si es necesario además las proteínas pueden extraerse y purificarse adicionalmente usando métodos convencionales en la técnica. Las proteínas, tales como los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento, pueden purificarse, por ejemplo, a partir de extractos celulares lisados, usando técnicas de purificación de proteínas convencionales conocidas en este campo incluyendo pero sin limitación, SDS-PAGE, fracción de tamaño y cromatografía de exclusión por tamaño, precipitación con sulfato de amonio y cromatografía de intercambio iónico, tal como intercambio aniónico. También pueden utilizarse técnicas de purificación de afinidad para mejorar la eficacia y pureza de las preparaciones. Por ejemplo, pueden usarse en la purificación de afinidad anticuerpos, receptores y otras moléculas que se unen con proteasas. También pueden modificarse técnicamente construcciones de expresión para añadir un marcador de afinidad a una proteína tal como un epítopo myc, fusión de GST o His6 y purificarse por afinidad con anticuerpo de myc, resina de glutatión y resina de Ni, respectivamente. La pureza puede evaluarse por cualquier método conocido en la técnica incluyendo electroforesis en gel y tinción y técnicas espectrofotométricas.

Los polipéptidos aislados pueden después analizarse, por ejemplo, por separación en un gel (por ejemplo gel SDS- Page), fraccionamiento por tamaño (por ejemplo separación en una columna de exclusión por tamaño de 16x60 Sephacryl™ S-200 HiPrep™ (Amersham de GE Healthcare Life Sciences, Piscataway, NJ). Los polipéptidos aislados también pueden analizarse en ensayos de unión, típicamente ensayos de unión usando un compañero de unión unido con un soporte sólido, por ejemplo, con una placa (por ejemplo ensayos de unión basados en ELISA) o una perla, para determinar su capacidad para unirse con compañeros de unión deseados. Los ensayos de unión

ES 2 553 440 T3   descritos en la secciones posteriores, que se usan para evaluar la unión de fagos precipitados que presentan los polipéptidos, también pueden usarse para evaluar polipéptidos aislados directamente de lisados de células hospedadoras. Por ejemplo, pueden llevarse a cabo ensayos de unión para determinar si los polipéptidos de anticuerpo se unen con uno o más antígenos, por ejemplo, extendiendo el antígeno sobre un soporte sólido, tal como un pocillo de una placa de ensayo e incubando los polipéptidos aislados en el soporte sólido, seguido de lavado y detección con reactivos secundarios, por ejemplo anticuerpos marcados con enzimas y sustratos. G. EVALUACIÓN DE LAS PROPIEDADES Y ACTIVIDADES DE ANTICUERPOS ANTI VSR Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento, pueden caracterizarse de diversas maneras bien conocidas por los expertos en la materia. Por ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden ensayarse con respecto a la capacidad para unirse inmunoespecíficamente con una proteína F del virus sincitial respiratorio (VSR) humano. Dichos ensayos pueden realizarse, por ejemplo, en solución (por ejemplo, Houghten (1992) Bio/Techniques 13: 412-421), en perlas (Lam (1991) Nature 354: 82-84), en microplacas (Fodor (1993) Nature 364:555-556), en bacterias (Patentes de Estados Unidos N.º 5.223.409), en esporas (Patentes de Estados Unidos N.º 5.571.698; 5.403.484; y 5.223.409), en plásmidos (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-1869) o en fagos (Scott y Smith (1990) Science 249: 386-390; Devlin (1990) Science 249: 404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87: 6378-6382; y Felici (1991) J. Mol. Biol. 222: 301-310). Los anticuerpos o fragmentos de unión a antígeno de los mismos que se ha identificado que se unen inmunoespecíficamente con un antígeno de VSR o un fragmento del mismo también pueden ensayarse con respecto a su especificidad y afinidad por un antígeno de VSR. La especificidad de unión, o el epítopo, pueden determinarse, por ejemplo, por ensayos de competición con otros anticuerpos anti VSR y/o ensayos de neutralización de virus usando Mutantes Resistentes a Anticuerpo Monoclonal (MARM). Además, pueden emplearse ensayos in vitro y modelos animales in vivo usando los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento para medir el nivel de neutralización de VSR efectuado por el contacto o administración de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. 1. Ensayos de unión Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden evaluarse con respecto a su capacidad para unirse con una diana seleccionada (por ejemplo, virus VSR o proteína F de VSR aislada) y la especificidad para dichas dianas por cualquier método conocido por un experto en la materia. Se proporcionan ensayos ejemplares en los Ejemplos 5 y 8 posteriores, y se describen posteriormente en el presente documento. Pueden realizarse ensayos de unión en solución, suspensión o sobre un soporte sólido. Por ejemplo, los antígenos diana pueden inmovilizarse en un soporte sólido (por ejemplo una superficie de carbono o plástico, una placa de cultivo tisular o microplaca) y ponerse en contacto con anticuerpo o fragmento de unión a antígeno del mismo. El anticuerpo no unido o la proteína diana puede retirarse por lavado y pueden después detectarse complejos unidos. Los ensayos de unión pueden realizarse en condiciones para reducir la unión no específica, tal como usando un tampón de fuerza iónica alta (por ejemplo, NaCl 0,3-0,4 M) con detergente no iónico (por ejemplo Triton X-100 0,1 % o Tween 20) y/o proteínas de bloqueo (albúmina de suero bovino o gelatina). Los controles negativos también pueden incluirse en dichos ensayos como una medida de unión de fondo. Las afinidades de unión pueden determinarse usando análisis de Scatchard (Munson et al., (1980) Anal. Biochem., 107: 220), resonancia de plasmón superficial, calorimetría isotérmica u otros métodos conocidos por los expertos en la materia. Los inmunoensayos ejemplares que pueden usarse para analizar la unión inmunoespecífica y la reactividad cruzada incluyen, pero sin limitación, sistemas de ensayo competitivo y no competitivo usado técnicas tales como, pero sin limitación, transferencias de western, radioinmunoensayos, ELISA (ensayo inmunoabsorbente ligado a enzimas), Meso Scale Discovery (MSD, Gaithersburg, Maryland), inmunoensayos de tipo “sándwich”, ensayos de inmunoprecipitación, ELISPOT, reacciones de precipitina, reacciones de precipitina de difusión en gel, ensayos de inmunodifusión, ensayos de aglutinación, ensayos de fijación del complemento, ensayos inmunorradiométricos, inmunoensayos fluorescentes, inmunoensayos de proteína A. Dichos ensayos son rutinarios y se conocen bien en la técnica (véase, por ejemplo, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Nueva York). Otros formatos de ensayo incluyen inmunoensayos de liposomas (LIA), que usan liposomas diseñados para unir moléculas específicas (por ejemplo, anticuerpos) y liberar reactivos o marcadores encapsulados. Los productos químicos liberados se detectan después de acuerdo con técnicas convencionales (véase Monroe et al., (1986) Amer. Clin. Prod. Rev. 5: 34-41). Se describen brevemente posteriormente inmunoensayos ejemplares que no se pretende que sean limitantes.

Los protocolos de inmunoprecipitación implican en general lisar una población de células en un tampón de lisis tal como tampón RIPA (NP-40 o Triton X-100 1 %, desoxicolato sódico 1 % SDS 0,1 %, NaCl 0,15 M, fosfato sódico 0,01 M a pH 7,2, Trasilol 1 %) complementado con inhibidores de proteína fosfatasa y/o proteasa (por ejemplo, EDTA, PMSF, aprotinina, vanadato sódico), añadir el anticuerpo o fragmento de unión a antígeno del mismo de interés al lisado celular, incubar durante un periodo de tiempo (por ejemplo, 1 a 4 horas) a 40 ºC, añadir perlas de sepharose de proteína A y/o proteína G al lisado celular, incubar durante aproximadamente una hora o más a 40 ºC,

ES 2 553 440 T3   lavar las perlas en tampón de lisis y resuspender las perlas en SDS/tampón de muestras. La capacidad del anticuerpo o fragmento de unión a antígeno del mismo de interés para imunoprecipitar un antígeno particular puede evaluarse, por ejemplo, mediante análisis de transferencia de western. Un experto en la materia conoce los parámetros que pueden modificarse para aumentar la unión del anticuerpo o fragmento de unión a antígeno del mismo con un antígeno y reducir el fondo (por ejemplo, preclarificando el lisado celular con perlas de sepharose). Para análisis adicional con respecto a protocolos de inmunoprecipitación véase, por ejemplo, Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Nueva York en 10.16.1. El análisis de transferencia de western implica en general preparar muestras de proteínas, electroforesis de las muestras de proteínas en un gel de poliacrilamida (por ejemplo, SDS-PAGE 8 %-20 % dependiendo del peso molecular del antígeno), transferir la muestra de proteínas del gel de poliacrilamida a una membrana tal como nitrocelulosa, PVDF o nylon, bloquear la membrana en solución de bloqueo (por ejemplo, PBS con BSA 3 % o leche desnatada), lavar la membrana en tampón de lavado (por ejemplo, PBS-Tween 20), bloquear la membrana con anticuerpo primario o fragmento de unión a antígeno del mismo (es decir, el anticuerpo o fragmento de unión a antígeno del mismo de interés) diluido en tampón de bloqueo, lavar la membrana en tampón de lavado, bloquear la membrana con un anticuerpo secundario (que reconoce el anticuerpo primario, por ejemplo, un anticuerpo anti humano) conjugado con un sustrato enzimático (por ejemplo, peroxidasa de rábano rusticano o fosfatasa alcalina) o molécula radiactiva (por ejemplo, 32P o 125I) diluido en tampón de bloqueo, lavar la membrana en tampón de lavado, y detectar la presencia del antígeno. Un experto en la materia conoce los parámetros que pueden modificarse para aumentar la señal detectada y para reducir el ruido de fondo. Para análisis adicional con respecto a los protocolos de transferencia de western véase, por ejemplo, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Nueva York en 10.8.1. Los ELISA implican preparar antígeno, recubrir el pocillo de una placa de microtitulación de 96 pocillos con el antígeno, añadir el anticuerpo o fragmento de unión a antígeno del mismo de interés conjugado con un compuesto detectable tal como un sustrato enzimático (por ejemplo, peroxidasa de rábano rusticano o fosfatasa alcalina) al pocillo e incubar durante un periodo de tiempo, y detectar la presencia del antígeno. En ELISA, no es necesario que el anticuerpo o fragmento de unión a antígeno del mismo de interés se conjugue con un compuesto detectable; en su lugar, puede añadirse al pocillo un anticuerpo secundario (que reconoce el anticuerpo de interés) conjugado con un compuesto detectable. Además, en lugar de recubrir el pocillo con el antígeno, el anticuerpo puede recubrir el pocillo. En este caso, puede añadirse un anticuerpo secundario conjugado con un compuesto detectable después de la adición del antígeno de interés al pocillo recubierto. Un experto en la materia conoce los parámetros que pueden modificarse para aumentar la señal detectada así como otras variaciones de ELISA conocidas en la técnica. Para análisis adicional con respecto a ELISA véase, por ejemplo, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., Nueva York en 11.2.1. Los Ejemplos 5 y 8 ejemplifican un ensayo de unión para la unión de anticuerpos anti VSR con proteína F de VSR. La afinidad de unión de un anticuerpo o fragmento de unión a antígeno del mismo con un antígeno y la velocidad de disociación de una interacción de anticuerpo-antígeno pueden determinarse, por ejemplo, por ensayos de unión competitiva. Un ejemplo de un ensayo de unión competitiva es un radioinmunoensayo que comprende la incubación de antígeno marcado (por ejemplo, 3H o 125I) con el anticuerpo o fragmento de unión a antígeno del mismo de interés en presencia de cantidades crecientes de antígeno no marcado, y la detección de anticuerpo o fragmento de unión a antígeno del mismo unido con el antígeno marcado. La afinidad de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento para un antígeno de VSR y las velocidades de disociación de unión pueden determinarse a partir de los datos por análisis de transferencia de Scatchard. La competición con un anticuerpo secundario también puede determinarse usando radioinmunoensayos. En este caso, se incuba un antígeno de VSR con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento conjugado con un compuesto marcado (por ejemplo, 3H o 125I) en presencia de cantidades crecientes de un anticuerpo secundario no marcado. En algunos ejemplos, puede usarse el análisis cinético de resonancia de plasmón superficial (por ejemplo, BiaCore 2000, Biacore AB, Upsala, Suecia y GE Healthcare Life Sciences; Malmqvist (2000) Biochem. Soc. Trans. 27: 335) para determinar las velocidades de asociación y disociación de unión de anticuerpos o fragmentos de unión a antígeno de los mismos con un antígeno de VSR. El análisis cinético de resonancia de plasmón superficial implica analizar la unión y disociación de un antígeno de VSR a partir de microplacas con anticuerpos inmovilizados o fragmentos de los mismos en su superficie. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden ensayarse con respecto a su capacidad para inhibir la unión de VSR con su receptor de células hospedadoras usando técnicas conocidas por los expertos en la materia. Por ejemplo, las células que expresan el receptor para VSR pueden ponerse en contacto con VSR en presencia o ausencia de un anticuerpo o fragmento de unión a antígeno del mismo y la capacidad del anticuerpo o fragmento del mismo para inhibir la unión de VSR puede medirse, por ejemplo, por citometría de flujo o un ensayo de centelleo. El VSR (por ejemplo, un antígeno de VSR tal como glucoproteína F o glucoproteína G) o el anticuerpo o fragmento de anticuerpo puede marcarse con un compuesto detectable tal como un marcador radiactivo (por ejemplo, 32P, 35S y 125I) o un marcador fluorescente (por ejemplo, fluoresceín isotiocianato, rodamina, ficoeritrina, ficocianina, aloficocianina, o-ftaldehído y fluorescamina) para permitir la detección de una interacción entre VSR y su receptor de célula hospedadora.

ES 2 553 440 T3   La capacidad de los anticuerpos o fragmentos de unión a antígeno de los mismos para inhibir la unión de VSR con su receptor también puede determinarse en ensayos sin células. Por ejemplo, VSR o un antígeno de VSR tal como glucoproteína F puede ponerse en contacto con un anticuerpo o fragmento del mismo y puede determinarse la capacidad del anticuerpo o fragmento de anticuerpo para inhibir la unión de VSR o el antígeno de VSR con su receptor de célula hospedadora. En algunos ejemplos, el anticuerpo o el fragmento de unión a antígeno se inmoviliza en un soporte sólido y VSR o un antígeno de VSR se marca con un compuesto detectable. En algunos ejemplos, VSR o un antígeno de VSR se inmoviliza en un soporte sólido y el anticuerpo o fragmento del mismo se marca con un compuesto detectable. El VSR o antígeno de VSR puede estar parcial o completamente purificado (por ejemplo, parcial o completamente libre de otros polipéptidos) o partes de un lisado celular. En algunos ejemplos, un antígeno de VSR puede ser una proteína de fusión que comprende el antígeno de VSR y un dominio tal como glutationina-S-transferasa. En algunos ejemplos, un antígeno de VSR puede biotinilarse usando técnicas bien conocidas por los expertos en la materia (por ejemplo, kit de biotinilación Pierce Chemicals; Rockford, Ill.).

2. Especificidad de unión La especificidad de unión, o epítopo, de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden determinarse por cualquier ensayo conocido por un experto en la materia, incluyendo, pero sin limitación, ensayos de resonancia de plasmón superficial, ensayos de competición y ensayos de neutralización de virus usando Mutantes Resistentes a Anticuerpos Monoclonales (MARM). El epítopo puede estar en la proteína aislada, es decir, la proteína F aislada, o en la proteína en el virus. La capacidad de dos anticuerpos para unirse con el mismo epítopo puede determinarse por ensayos conocidos en la técnica tales como, por ejemplo, ensayos de resonancia de plasmón superficial y ensayos de competición de anticuerpos. Típicamente, los anticuerpos que se unen inmunoespecíficamente con el mismo epítopo pueden competir por la unión con el epítopo, lo que puede medirse, por ejemplo, por un ensayo de competición de unión in vitro (por ejemplo ELISA de competición), usando técnicas conocidas en este campo. Típicamente, un primer anticuerpo que se une inmunoespecíficamente con el mismo epítopo que un segundo anticuerpo puede competir por la unión con el epítopo en aproximadamente o 30 %, 35 %, 40 %, 45 %, 50 %, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 100 %, en el que el porcentaje de competición es la capacidad medida del segundo anticuerpo para desplazar la unión del primer anticuerpo con el epítopo. En ensayos de competición ejemplares, el antígeno se incuba en presencia de una dilución limitante predeterminada de un anticuerpo marcado (por ejemplo, concentración de saturación del 50-70 %) y diluciones en serie de un anticuerpo de competición no marcado. La competición se determina midiendo la unión del anticuerpo marcado con el antígeno con respecto a cualquier reducción en la unión en presencia del anticuerpo competidor. Se conocen en este campo variaciones de dichos ensayos, incluyendo diversas técnicas de marcaje y métodos de detección incluyendo, por ejemplo, detección radiométrica, fluorescente, enzimática y colorimétrica. Por ejemplo, como se ejemplifica en el Ejemplo 10 posterior, el anticuerpo IgG 58c5 y motavizumab no compiten por la unión con la proteína F de VSR, lo que indica de este modo que el anticuerpo IgG 58c5 se une con un epítopo diferente que motavizumab.

La capacidad de un primer anticuerpo para unirse con el mismo epítopo que un segundo anticuerpo también puede determinarse, por ejemplo, por ensayos de neutralización de virus usando Mutantes Resistentes a Anticuerpos Monoclonales. Un MARM es un virus sincitial respiratorio mutante (VSR) que no se neutraliza por un anticuerpo monoclonal que neutraliza el virus VSR de tipo silvestre, es decir, un MARM es un mutante de escape de VSR. Se generan MARM cultivando VSR de tipo silvestre en presencia de un anticuerpo monoclonal para ciclos sucesivos de replicación viral en presencia del anticuerpo de modo que después de cada ciclo sucesivo de replicación del virus, se observan efectos citopáticos (CPE) en presencia de concentraciones crecientes de anticuerpos hasta que resulta un virus mutante que no se neutraliza por el anticuerpo. Si un primer anticuerpo puede neutralizar un MARM generado contra un segundo anticuerpo, se puede concluir que los anticuerpos se unen específicamente con o interaccionan con diferentes epítopos. Por ejemplo, cuando un primer anticuerpo anti VSR neutraliza VSR de tipo silvestre pero no un VSR mutante particular (es decir, MARM), un segundo anticuerpo que neutraliza el VSR de tipo silvestre pero no el VSR mutante particular generalmente se une con el mismo epítopo en VSR que el primer anticuerpo. Cuando un primer anticuerpo anti VSR neutraliza VSR de tipo silvestre pero no un VSR mutante particular, un segundo anticuerpo que neutraliza el VSR de tipo silvestre y el VSR mutante particular generalmente no se une con el mismo epítopo en VSR que el primer anticuerpo.

Por ejemplo, como se ejemplifica en el Ejemplo 9 posterior, IgG 58c5 proporcionado en el presente documento es capaz de neutralizar MARM generado previamente contra diversos anticuerpos anti VSR, incluyendo MARM 1129, generados contra MAb 1129, el anticuerpo parental para palivizumab y motavizumab (véase, Johnson et al. (1997) J. Infect. Diseases 176: 1215-1224 y Patente de Estados Unidos N.º 5.824.307), MARM 19, generado contra Fab 19 (véase Barbas et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10164-10168) y MARM 151, generado contra MAb 151 (véase, Mufson et al., (1985) J. Gen. Virol, 66: 2111-2124). Por lo tanto, IgG 58c5 se une con un epítopo diferente en la proteína F que los anticuerpos Fab 19, MAb 151 y MAb 1129. Como se ejemplifica en el Ejemplo 11 posterior, se generaron MARM contra motavizumab e IgG 58c5. El MARM de motavizumab, generado después de 5-7 ciclos de selección, contiene una mutación de un único aminoácido (K272E, SEC ID Nº: 1642) en comparación con la proteína F de VSR de tipo silvestre. La mutación en el aminoácido K272 es

ES 2 553 440 T3   coherente con mutaciones conocidas que alteran la unión del anticuerpo parental de motavizumab (véase, Zhao et al., (2004) J. Infectious Disease 190: 1941-1946). El MARM IgG 58c5, generado después de 10 ciclos de selección, contiene 3 mutaciones de aminoácidos (N63K, M115K y E295G, SEC ID Nº: 1643) en comparación con la proteína F de VSR de tipo silvestre. Las mutaciones que efectúan escape en el MARM IgG 58c5 no se han identificado previamente como sitios antigénicos para diversos anticuerpos monoclonales que se unen inmunoespecíficamente con la proteína F de VSR (véase, por ejemplo, Beeler et al. (1989) J. Virology 63(7): 2841-2950, Crowe et al. (1998) Virology 252: 373-375; Zhao et al., (2004) J. Infectious Disease 190: 1941-1946; Liu et al., (2007) Virology Journal 4:71). Además, como se muestra en el Ejemplo 11 posterior, IgG 58c5 neutraliza el MARM motavizumab, y motavizumab neutraliza el MARM IgG 58c5. Por lo tanto, IgG 58c5 se une con un epítopo diferente de la proteína F de VSR que motavizumab. 3. Ensayos in vitro para analizar los efectos de neutralización de virus de anticuerpos Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden analizarse por cualquier método adecuado conocido en la técnica para la detección de neutralización viral. Los métodos para detección de neutralización viral incluyen, pero sin limitación, ensayos de placas y ensayos para inhibición de la formación de sincitio. Dichos ensayos pueden emplearse para evaluar, por ejemplo, la inhibición de la unión viral, la entrada viral y la propagación de célula a célula del virus (véase, por ejemplo Burioni et al., (1994) Proc. Natl. Acad. Sci. U.S.A. 91: 355-359; Sanna et al. (2000) Virology 270: 386-3961; y De Logu et al., (1998) J Clin Microbiol 36: 3198-3204). Un experto en la materia puede identificar cualquier ensayo capaz de medir la neutralización viral. Los ensayos de placas convencionales incluyen, por ejemplo, ensayos de reducción de placas, ensayos de reducción del tamaño de placas, ensayos de neutralización y ensayos cinéticos de neutralización. Estos ensayos miden la formación de placas virales (es decir áreas de células lisadas) después de la infección de monocapas de células diana por un virus. Las líneas celulares diana ejemplares que pueden usarse en ensayos de reducción de placas incluyen, pero sin limitación, células Vero, células MRC-5, células RC-37, células BHK-21/C13 y células HEp- 2. Un experto en la materia puede identificar líneas celulares diana apropiadas para su uso en un ensayo de placas. La selección de una línea celular apropiada para un ensayo de placas puede depender de factores conocidos, tales como, por ejemplo, infecciosidad celular y la capacidad del virus para propagarse en y lisar la célula diana. Los Ejemplos 6 y 9 ejemplifican ensayos de neutralización in vitro. Pueden usarse ensayos de reducción de placas para medir la capacidad del anticuerpo anti VSR o fragmento de unión a antígeno del mismo para efectuar neutralización viral en solución. En ensayos de reducción de placas ejemplares, el anticuerpo o fragmento de unión a antígeno del mismo y el virus se preincuban antes de la adición de células diana. Las células diana se infectan después con la mezcla de anticuerpo/virus y se realiza un ensayo de placas después de un periodo de infección predeterminado. Un experto en la materia puede determinar los tiempos de incubación requeridos basándose en ejemplos conocidos en la técnica. Una reducción del número de placas de virus producidas después de infección de las células diana indica la capacidad del anticuerpo o fragmento de unión a antígeno del mismo para prevenir la unión del virus con las células diana independientemente de la unión del anticuerpo o fragmento de unión a antígeno del mismo con la célula diana y/o la internalización del anticuerpo, o fragmento de unión a antígeno del mismo. Pueden usarse ensayos de reducción del tamaño de las placas para medir la capacidad del anticuerpo anti VSR o fragmento de unión a antígeno del mismo para inhibir la propagación viral de célula a célula. En ensayos de reducción del tamaño de las placas ejemplares, las células diana se infectan en primer lugar con el virus durante un periodo de infección predeterminado y después el anticuerpo o fragmento de unión a antígeno del mismo se añade a la célula infectada. Un experto en la materia puede determinar los tiempos de incubación requeridos basándose en ejemplos conocidos en la técnica. Una reducción en el tamaño (es decir diámetro) de las placas de virus indica que el anticuerpo o fragmento de unión a antígeno del mismo es capaz de prevenir la propagación viral de célula a célula. Pueden usarse ensayos de neutralización del virus para medir la capacidad del anticuerpo anti VSR o fragmento de unión a antígeno del mismo para efectuar la neutralización viral en la superficie de célula diana por asociación del anticuerpo o fragmento de unión a antígeno del mismo con la célula diana antes de exposición al virus. En ensayos de neutralización de virus ejemplares, el anticuerpo o fragmento de unión a antígeno del mismo y las células diana se preincuban durante un periodo de tiempo predeterminado para permitir la unión del anticuerpo o fragmento de unión a antígeno del mismo con la célula diana. Después del periodo de preincubación, el anticuerpo no unido se retira y las células diana se infectan con el virus. Una reducción del número de placas en este ensayo indica la capacidad del anticuerpo o fragmento de unión a antígeno del mismo para prevenir la infección viral dependiendo de la unión con la célula diana y/o internalización del anticuerpo o fragmento de unión a antígeno del mismo. Este ensayo también puede usarse para medir la cinética de neutralización variando las concentraciones de anticuerpos o fragmentos de unión a antígeno y los tiempos de preincubación.

Los ensayos ejemplares para inhibición de la formación de sincitio pueden emplearse para medir la inhibición mediada por anticuerpo de efectos citopáticos virales bloqueando la formación de sincitios cuando se usa una cepa

ES 2 553 440 T3   viral fusogénica. Un experto en la materia puede identificar una cepa viral fusogénica apropiada para su uso en el ensayo. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden ensayarse con respecto a su capacidad para inhibir o regular negativamente la replicación de VSR usando técnicas conocidas por los expertos en la materia. Por ejemplo, la replicación de VSR puede ensayarse por un ensayo de placas tal como se describe, por ejemplo, en Johnson et al. (1997) Journal of Infectious Diseases 176: 1215-1224. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden ensayarse con respecto a su capacidad para inhibir o regular negativamente la expresión de polipéptidos de VSR. Pueden usarse técnicas conocidas por los expertos en la materia, incluyendo, pero sin limitación, análisis de transferencia de Western, análisis de transferencia de Northern y RT-PCR para medir la expresión de polipéptidos de VSR. 4. Modelos animales in vivo para evaluar la eficacia de los anticuerpos anti VSR Pueden realizarse estudios in vivo usando modelos animales para evaluar la eficacia de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. Pueden realizarse estudios in vivo usando modelos animales para evaluar cualquier toxicidad de administración de dichos anticuerpos o fragmentos de unión a antígeno de los mismos. Está disponible para los expertos en la materia una diversidad de ensayos, tales como los que emplean modelos animales in vivo, para evaluar la capacidad de los anticuerpos anti VSR para inhibir o tratar la infección por virus VSR y para ensayar cualquier toxicidad. El efecto terapéutico de los anticuerpos anti VSR puede evaluarse usando modelos animales de la infección patógena, incluyendo modelos animales de infección viral. Dichos modelos animales se conocen en la técnica, e incluyen, pero sin limitación, modelos animales para infección por VSR, tales como pero sin limitación rata algodonera, ratón endogámico, ternero, hurón, hámster, cobaya, chimpancé, mono nocturno, mono rhesus, mono verde Africano, mono capuchino, mono ardilla, macaco coronado, babuino (véase, por ejemplo, Prince et al. (1978) Am. J. Pathol. 93: 771-791; Prince et al. (1979) Infect. Immunol. 26: 764-766; Byrd y Prince (1997) Clinical Infectious Diseases 25: 1363-1368, incluyendo referencias citadas en las mismas, para modelos ejemplares de infección por VSR). Para ensayo in vivo de un anticuerpo o fragmento de unión a antígeno o la toxicidad de la composición, puede usarse cualquier sistema de modelo animal conocido en la técnica, incluyendo, pero sin limitación, ratas, ratones, vacas, monos y conejos. 5. Ensayos in vitro e in vivo para medir la eficacia de anticuerpos La eficacia en el tratamiento o prevención de la infección viral puede demostrarse detectando la capacidad de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento para inhibir la replicación del virus, para inhibir la transmisión o evitar que el virus se establezca en su hospedador, para reducir la incidencia de la infección por VSR, o para prevenir, mejorar o aliviar uno o más síntomas asociados con la infección por VSR. El tratamiento se considera terapéutico si hay, por ejemplo, una reducción en la carga viral, mejora de uno o más síntomas, una reducción en la duración de una infección por VSR, una reducción en la mortalidad y/o morbilidad después de la administración de un anticuerpo o composición proporcionada en el presente documento. Además, el tratamiento se considera terapéutico si hay un aumento en la respuesta inmunitaria después de la administración de uno o más anticuerpos o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con uno o más antígenos de VSR.

Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden ensayarse in vitro e in vivo con respecto a la capacidad para inducir la expresión de citocinas tales como IFN-α, IFN-β, IFN-γ, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 e IL-15. Pueden usarse técnicas conocidas por los expertos en la materia para medir el nivel de expresión de citocinas. Por ejemplo, el nivel de expresión de citocinas puede medirse analizando el nivel de ARN de las citocinas, por ejemplo, mediante análisis de RT-PCR y transferencia de Northern, y analizando el nivel de citocinas, por ejemplo, mediante inmunoprecipitación seguido de análisis de transferencia de Western o ELISA. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden ensayarse in vitro e in vivo con respecto a su capacidad para modular la actividad biológica de células inmunitarias, incluyendo células inmunitarias humanas (por ejemplo, linfocitos T, linfocitos B y linfocitos Citolíticos Naturales). La capacidad de un anticuerpo anti VSR o fragmento de unión a antígeno para modular la actividad biológica de células inmunitarias puede evaluarse detectando la expresión de antígenos, detectando la proliferación de células inmunitarias, detectando la activación de moléculas de señalización, detectando la función efectora de células inmunitarias, o detectando la diferenciación de células inmunitarias. Pueden usarse técnicas conocidas por los expertos en la materia para medir estas actividades. Por ejemplo, la proliferación celular puede ensayarse por ensayos de incorporación de 3H-timidina y recuentos de células de azul de tripano. La expresión de antígenos puede ensayarse, por ejemplo, por inmunoensayos incluyendo, pero sin limitación, sistemas de ensayo competitivos y no competitivos usando técnicas tales como transferencias de western, radioinmunoensayos de inmunohistoquímica, ELISA (ensayo inmunoabsorbente ligado a enzimas), inmunoensayos de tipo “sándwich”, ensayos de inmunoprecipitación, reacciones de precipitina, reacciones de precipitina de difusión en gel, ensayos de inmunodifusión, ensayos de aglutinación, ensayos de fijación del complemento, ensayos inmunorradiométricos,

ES 2 553 440 T3   inmunoensayos fluorescentes, inmunoensayos de proteína A y análisis de FACS. La activación de las moléculas de señalización pude ensayarse, por ejemplo, mediante ensayos de quinasa y ensayos de desplazamiento electroforético (EMSA). Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden ensayarse con respecto a su capacidad para inhibir la replicación viral o reducir la carga viral en ensayos in vitro, ex vivo e in vivo. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos también pueden ensayarse con respecto a su capacidad para reducir el ciclo temporal de infección por VSR. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos también puede ensayarse con respecto a su capacidad para aumentar el periodo de supervivencia de seres humanos que padecen infección por VSR en al menos o aproximadamente 25 %, al menos o aproximadamente 50 %, al menos o aproximadamente 60 %, al menos o aproximadamente 75 %, al menos o aproximadamente 85 %, al menos o aproximadamente 95 %, o al menos o aproximadamente 99 %. Además, pueden ensayarse anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos con respecto a su capacidad para reducir el periodo de hospitalización de seres humanos que padecen infección por VSR en al menos o aproximadamente 60 %, al menos o aproximadamente 75 %, al menos o aproximadamente 85 %, al menos o aproximadamente 95 %, o al menos o aproximadamente 99 %. Pueden usarse técnicas conocidas por los expertos en la materia para analizar la función de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento in vivo. De acuerdo con los métodos y usos proporcionados en el presente documento, no es necesario realizar ensayos clínicos con sujetos humanos para demostrar la eficacia profiláctica y/o terapéutica de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento. Los estudios de modelos animales e in vitro usando los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden extrapolarse a seres humanos y son suficientes para demostrar la utilidad profiláctica y/o terapéutica de los anticuerpos anti VSR o fragmentos de unión a antígeno.

H. USOS DE DIAGNÓSTICO Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden usarse en ensayos de diagnóstico para la detección, purificación y/o neutralización de VSR. Los ensayos de diagnóstico ejemplares incluyen detección in vitro e in vivo de VSR. Por ejemplo, se proporcionan ensayos usando los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento para medir cualitativa y cuantitativamente los niveles de VSR, en una muestra biológica aislada (por ejemplo esputo) o in vivo.

Como se describe en el presente documento, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden conjugarse con un resto detectable para detección in vitro o in vivo. Dichos anticuerpos pueden emplearse, por ejemplo, para evaluar la localización y/o persistencia del anticuerpo anti VSR o fragmento de unión a antígeno del mismo en un sitio in vivo, tal como, por ejemplo, un sitio de mucosa. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que se acoplan con un resto detectable pueden detectarse in vivo por cualquier método adecuado conocido en la técnica. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que se acoplan con un resto detectable también pueden detectarse en muestras biológicas aisladas, tales como muestras tisulares o de fluido obtenidas del sujeto después de administración del anticuerpo o fragmento de unión a antígeno del mismo.

1. Detección in vitro de infección patógena En general, puede detectarse VSR en un sujeto o paciente basado en la presencia de una o más proteínas de VSR y/o polinucleótidos que codifican dichas proteínas en una muestra biológica (por ejemplo, sangre, suero, esputo, orina y/u otras células u otros tejidos apropiados) obtenidos de un sujeto o paciente. Dichas proteínas pueden usarse como marcadores para indicar la presencia o ausencia de VSR en un sujeto o paciente. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden emplearse para la detección del nivel de antígeno y/o epítopo que se une con el agente en la muestra biológica. Se conocen una diversidad de formatos de ensayo por los expertos en la materia para usar un anticuerpo anti VSR o fragmento de unión a antígeno del mismo para detectar marcadores polipeptídicos en una muestra (véase, por ejemplo Harlow y Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). En general, la presencia o ausencia de VSR en un sujeto o paciente puede determinarse poniendo en contacto una muestra biológica obtenida de un sujeto o paciente con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento y detectando en la muestra un nivel de polipéptido que se une con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo. En algunos ejemplos, el ensayo implica el uso de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento inmovilizado en un soporte sólido para unirse con y retirar el polipéptido diana del resto de la muestra. El polipéptido unido puede detectarse después usando un reactivo de detección que contiene un grupo indicador y se une específicamente con el complejo de anticuerpo/polipéptido.

ES 2 553 440 T3   Dichos reactivos de detección pueden contener, por ejemplo, un agente de unión que se une específicamente con el polipéptido o un anticuerpo u otro agente que se une específicamente con el agente de unión. En algunos ejemplos, puede utilizarse un ensayo competitivo, en el que un polipéptido se marca con un grupo indicador y se permite que se una con el anticuerpo anti VSR inmovilizado o fragmento de unión a antígeno del mismo después de incubación del anticuerpo anti VSR o un fragmento de unión a antígeno del mismo con la muestra. El grado en que los componentes de la muestra inhiben la unión del polipéptido marcado con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo es indicativo de la reactividad de la muestra con el anticuerpo anti VSR inmovilizado o fragmento de unión a antígeno del mismo. Los polipéptidos adecuados para su uso dentro de dichos ensayos incluyen proteínas F de VSR de longitud completa y partes de las mismas, incluyendo el dominio extracelular de una proteína F de VSR, con la que se une un anticuerpo anti VSR o fragmento de unión a antígeno del mismo, como se ha descrito anteriormente. El soporte sólido puede ser cualquier material conocido por los expertos en la materia con el que puede unirse la proteína. Por ejemplo, el soporte sólido puede ser un pocillo de ensayo en una placa de microtitulación o una membrana de nitrocelulosa u otra adecuada. El soporte también puede ser una perla o un disco, tal como material de vidrio, fibra de vidrio, látex o plástico tal como poliestireno o polivinilcloruro. El soporte también puede ser una partícula magnética o un sensor de fibra óptica, tal como los desvelados, por ejemplo, en la Patente de Estados Unidos N.º 5.359,681. El anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede inmovilizarse en el soporte sólido usando una diversidad de técnicas conocidas por los expertos en la materia. El anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede inmovilizarse por adsorción en un pocillo en una placa de microtitulación o en una membrana. En dichos casos, la adsorción puede conseguirse poniendo en contacto el anticuerpo anti VSR o fragmento de unión a antígeno del mismo, en un tampón adecuado, con el soporte sólido durante una cantidad de tiempo adecuada. El tiempo de contacto varía con la temperatura, pero está típicamente entre aproximadamente 1 hora y aproximadamente 1 día. En general, poner en contacto un pocillo de una placa de microtitulación de plástico (tal como poliestireno o polivinilcloruro) con una cantidad de anticuerpo anti VSR o fragmento de unión a antígeno del mismo que varía de aproximadamente 10 ng aproximadamente 10 µg, y típicamente de aproximadamente 100 ng a aproximadamente 1 µg, es suficiente para inmovilizar una cantidad adecuada de anticuerpo anti VSR o fragmento de unión a antígeno del mismo.

La unión covalente de anticuerpo anti VSR o fragmento de unión a antígeno del mismo con un soporte sólido puede conseguirse en general haciendo reaccionar en primer lugar el soporte con un reactivo bifuncional que reaccionará con el soporte y un grupo funcional, tal como un grupo hidroxilo o amino, en el anticuerpo anti VSR o fragmento de unión a antígeno del mismo. Por ejemplo, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede unirse covalentemente con soportes que tienen un recubrimiento de polímero apropiado usando benzoquinona o por condensación de un grupo aldehído en el soporte con una amina y un hidrógeno activo en el compañero de unión (véase, por ejemplo, Pierce Immunotechnology Catalog and Handbook, 1991, en A12-A13). En algunos ejemplos, el ensayo se realiza en un formato de ensayo de tira o de flujo continuo, en el que el anticuerpo anti VSR o fragmento de unión a antígeno del mismo se inmoviliza en una membrana, tal como nitrocelulosa. En el ensayo de flujo continuo, los polipéptidos dentro de la muestra se unen con el anticuerpo anti VSR inmovilizado o fragmento de unión a antígeno del mismo a medida que la muestra pasa a través de la membrana. Un segundo agente de unión marcado se une después con el complejo de polipéptido-anticuerpo anti VSR o fragmento de unión a antígeno del mismo como una solución que contiene el segundo agente de unión fluye a través de la membrana. Existen protocolos de ensayo adicionales en la técnica que son adecuados para su uso con las proteínas de VSR o anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados. Se pretende que las descripciones anteriores sean solamente ejemplares. Por ejemplo, resultará evidente para los expertos en la materia que los protocolos anteriores pueden modificarse fácilmente para usar polipéptidos de VSR para detectar anticuerpos que se unan con dichos polipéptidos en una muestra biológica. La detección de dichos anticuerpos específicos de proteína puede permitir la identificación de infección por VSR. Para mejorar la sensibilidad, pueden ensayarse marcadores proteicos de VSR múltiples dentro de una muestra dada. Resultará evidente que los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos específicos para diferentes polipéptidos de VSR pueden combinarse dentro de un único ensayo. Además, los múltiples cebadores o sondas pueden usarse simultáneamente. La selección de marcadores de proteínas de VSR puede basarse en experimentos rutinarios para determinar las combinaciones que dan como resultado sensibilidad óptima. Además, o como alternativa, pueden combinarse ensayos para proteínas de VSR proporcionadas en el presente documento con ensayos para otros antígenos de VSR conocidos. 2. Detección in vivo de infección patógena Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden emplearse como un agente de diagnóstico in vivo. Por ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden proporcionar una imagen de tejidos infectados (por ejemplo,

ES 2 553 440 T3   infección por VSR en los pulmones) usando métodos de detección tales como, por ejemplo, captura de imágenes por resonancia magnética, captura de imágenes por rayos X, tomografía de emisión computarizada y otras tecnologías de captura de imágenes. Para la captura de imágenes de tejidos infectados por VSR, por ejemplo, la parte de anticuerpo del anticuerpo anti VSR se unirán en general con VSR (por ejemplo, uniéndose con un epítopo de la proteína F de VSR), y el agente de captura de imágenes será un agente detectable tras la captura de imágenes, tal como un agente paramagnético, radiactivo o fluorescente que esté acoplado con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo. En general, para su uso como un agente de diagnóstico, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo se acopla directa o indirectamente con el agente de captura de imágenes.

Se conocen en la técnica muchos agentes de captura de imágenes apropiados, así como métodos para su unión con los anticuerpos anti VSR o fragmentos de unión a antígeno (véase, por ejemplo, Patentes de Estados Unidos N.º 5.021.236 y 4.472.509). Los métodos de unión ejemplares implican el uso de un complejo de quelante metálico que emplea, por ejemplo, un agente quelante orgánico tal como DTPA unido al anticuerpo o fragmento de unión a antígeno del mismo (Patente de Estados Unidos N.º 4.472.509). Los anticuerpos también pueden hacerse reaccionar con una enzima en presencia de un agente de acoplamiento tal como glutaraldehído o peryodato. Se preparan conjugados con marcadores de fluoresceína en presencia de dichos agentes de acoplamiento o por reacción con un isotiocianato.

Para captura de imágenes de diagnóstico in vivo, se tiene en cuenta el tipo de instrumento de detección disponible cuando se selecciona un radioisótopo dado. El radioisótopo seleccionado tiene un tipo de degradación que es detectable para un tipo de instrumento dado. Otro factor en la selección de un radioisótopo para diagnóstico in vivo es que la semivida del radioisótopo sea suficientemente larga para que aún sea detectable en el momento de máxima captación por la diana, pero suficientemente corta para que la radiación deletérea con respecto al hospedador se minimice. Típicamente, un radioisótopo usado para captura de imágenes in vivo carecerá de una emisión de partículas, pero producirá un gran número de fotones en el intervalo de 140-250 keV, que puede detectarse fácilmente por cámaras gamma convencionales. Para diagnóstico in vivo, los radioisótopos pueden unirse con los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento bien directa o bien indirectamente usando un grupo funcional intermedio. Los grupos funcionales intermedios ejemplares que pueden usarse para unir radioisótopos, que existen como iones metálicos, con anticuerpos incluyen agentes quelantes bifuncionales, tales como ácido dietilendiaminopentaacético (DTPA) y ácido etilendiaminotetraacético (EDTA) y moléculas similares. Los ejemplos de iones metálicos que pueden unirse con los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados incluyen, pero sin limitación, 72Arsénico, 211Astatina, 14Carbono, 51Cromo, 36Cloro, 57Cobalto, 58Cobalto, 67Cobre, 152Europio, 67Galio, 68Galio, 3Hidrógeno, 123Yodo, 125Yodo, 131Yodo, 111Indio, 59Hierro, 32Fósforos, 186Renio, 188Renio, 97Rutenio, 75Selenio, 35Azufre, 99mTecnecio, 201Talio, 90Itrio y 89Circonio. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden marcarse con un isótopo paramagnético para fines de diagnóstico in vivo, como en captura de imágenes por resonancia magnética (IRM) o resonancia de espín electrónico (REE). En general, puede utilizarse cualquier método convencional para visualizar imágenes de diagnóstico. En general, se usan radioisótopos que emiten positrones y gamma para captura de imágenes por cámara e isótopos paramagnéticos para IRM. Los elementos que son particularmente útiles en dichas técnicas incluyen, pero sin limitación, 157Gd, 55Mn, 162Dy, 52Cr y 56 Fe.

Los iones paramagnéticos ejemplares incluyen, pero sin limitación, cromo (III), manganeso (II), hierro (III), hierro (II), cobalto (II), níquel (II), cobre (II), neodinio (III), samario (III), iterbio (III), gadolinio (III), vanadio (II), terbio (III), disprosio (III), holmio (III) y erbio (III). Los iones útiles, por ejemplo, en captura de imágenes por rayos X incluyen, pero sin limitación lantano (III), oro (III), plomo (II) y bismuto (III). La concentración de anticuerpo anti VSR marcado de forma detectable o fragmento de unión a antígeno del mismo que se administra es suficiente para que la unión con VSR sea detectable en comparación con el fondo. Además, es deseable que el anticuerpo anti VSR marcado de forma detectable o fragmento de unión a antígeno del mismo se elimine rápidamente del sistema circulatorio para proporcionar la mejor relación de diana frente a señal de fondo. La dosificación del anticuerpo anti VSR marcado de forma detectable o fragmento de unión a antígeno del mismo para diagnóstico in vivo variará dependiendo de factores tales como la edad, el sexo y el grado de enfermedad del individuo. La dosificación de un anticuerpo monoclonal humano puede variar, por ejemplo, de aproximadamente 0,01 mg/m2 a aproximadamente 5000 mg/m2, de 0,1 mg/m2 a aproximadamente 200 mg/m2, o de aproximadamente 0,1 mg/m2 a aproximadamente 10 mg/m2. Dichas dosificaciones pueden variar, por ejemplo, dependiendo de si se proporcionan múltiples inyecciones, tejido y otros factores conocidos por los expertos en la materia. 3. Control de la infección

ES 2 553 440 T3   Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden usarse in vitro e in vivo para controlar el ciclo de terapia de enfermedad patógena. Por lo tanto, puede medirse, por ejemplo, el aumento o la reducción del número de células infectadas con VSR o cambios en la concentración de las partículas virales del VSR presentes en el cuerpo o en diversos fluidos corporales. Usando dichos métodos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden emplearse para determinar si un régimen terapéutico particular dirigido a mejorar la enfermedad patógena es eficaz. I. USOS PROFILÁCTICOS Y TERAPÉUTICOS Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento y composiciones farmacéuticas que contienen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto para profilaxis y terapia. Por ejemplo, los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados pueden administrarse para el tratamiento de una enfermedad o afección, tal como una infección por VSR. En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados pueden administrarse a un sujeto para usos profilácticos, tales como la prevención y/o la propagación de la infección por VSR, incluyendo, pero sin limitación, la inhibición del establecimiento de infección por VSR en un hospedador o inhibición de la transmisión de VSR entre sujetos. En algunos ejemplos, los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados pueden administrarse a un sujeto para la reducción de la carga viral de VSR en el sujeto. Los anticuerpos o fragmentos de unión a antígeno de los mismos también pueden administrarse a un sujeto para prevenir, tratar y/o aliviar uno o más síntomas de una infección por VSR o para reducir la duración de una infección por VSR. En algunos ejemplos, la administración de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento inhibe la incidencia de la infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la incidencia de la infección por VSR en ausencia del anticuerpo anti VSR o fragmento de unión a antígeno. En algunos ejemplos, la administración de un anticuerpo anti VSR o fragmento de unión a antígeno proporcionado en el presente documento reduce la gravedad de uno o más síntomas de la infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la gravedad del o los síntomas de infección por VSR en ausencia del anticuerpo anti VSR o fragmento de unión a antígeno. 1. Sujetos para terapia Un sujeto o candidato para terapia con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye, pero sin limitación, un sujeto, tal como un paciente humano, que se ha expuesto a un virus VSR, un sujeto, tal como un paciente humano, que muestra uno o más síntomas de una infección por VSR y un sujeto, tal como un paciente humano, que está en riesgo de una infección por VSR. Las infecciones por virus VSR ejemplares incluyen las provocadas por virus VSR, tales como, pero sin limitación, enfermedad de VSR aguda, infección del tracto respiratorio superior por VSR (URI) y/o una infección del tracto respiratorio inferior por VSR (LRI), incluyendo, por ejemplo, bronquiolitis y neumonía. En algunos ejemplos, el sujeto para terapia con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento es un mamífero. En algunos ejemplos, el sujeto para terapia con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento es un primate. En ejemplos particulares, el sujeto para terapia con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento es un ser humano.

Los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos pueden administrarse a un sujeto, tal como un paciente humano, para el tratamiento de cualquier enfermedad mediada por VSR. Por ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto para aliviar uno o más síntomas o afecciones asociados con una infección por virus VSR, incluyendo, pero sin limitación, asma, sibilación, enfermedad de las vías respiratorias reactiva (RAD), y enfermedad pulmonar obstructiva crónica (EPOC). Dichas enfermedades y afecciones se conocen bien y se diagnostican fácilmente por médicos o expertos habituales.

ES 2 553 440 T3   Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto, tal como un paciente humano, que tenga una infección por virus VSR para la terapia de mantenimiento o supresión de enfermedad mediada por virus VSR recurrente.

Los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos puede administrarse a un sujeto, tal como un paciente humano, en riesgo de una infección por virus VSR, incluyendo, pero sin limitación, un bebé nacido prematuramente (antes de término) (por ejemplo, un bebé humano nacido con menos de 38 semanas de edad gestacional, tal como, por ejemplo, 29 semanas, 30 semanas, 31 semanas, 32 semanas, 33 semanas, 34 semanas, 35 semanas, 36 semanas, o 37 semanas de edad gestacional); un bebé (por ejemplo, un bebé humano nacido con más de 37 semanas de edad gestacional), un sujeto que tiene fibrosis quística, displasia broncopulmonar, enfermedad cardiaca congénita, inmunodeficiencia congénita o inmunodeficiencia adquirida (por ejemplo, un paciente con SIDA), leucemia, linfoma no de Hodgkin, un paciente inmunosuprimido, tal como, por ejemplo, un receptor de un trasplante (por ejemplo un trasplante de médula ósea o un trasplante de riñón), o en sujetos ancianos, incluyendo individuos en residencias o centros de rehabilitación. En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto, tal como un bebé antes de término o un bebé expuesto a uno o más factores de riesgo ambientales, tales como, pero sin limitación que van a la guardería, que tienen hermanos en edad escolar, exposición a contaminantes aéreos ambientales, anomalías congénitas de las vías respiratorias y/o enfermedad neuromuscular grave. En algunos ejemplos, los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos pueden administrarse a un sujeto, tal como un bebé o niño que tiene menos de dos años de edad, que tiene enfermedad pulmonar crónica o enfermedad cardiaca congénita, incluyendo insuficiencia cardiaca congestiva, hipertensión pulmonar y enfermedad cardiaca cianótica. Se conocen ensayos para diversos patógenos e infección patógena en la técnica y pueden emplearse para la evaluación de si un sujeto es un candidato para terapia con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. Por ejemplo, se conocen ensayos para infección por virus VSR, e incluyen por ejemplo ensayos de placas de cultivo viral, ensayo de detección de antígenos, ensayos de reacción en cadena de la polimerasa (PCR), y diversos ensayos serológicos de anticuerpos. Pueden realizarse ensayos para infección viral en muestras obtenidas de muestras tisulares o de fluido, tales como líquido raquídeo, sangre u orina.

Los ensayos adicionales incluyen, pero sin limitación rayos X del tórax, que pueden mostrar señales de neumonía, otros análisis de sangre, tales como una exploración química, un recuento sanguíneo completo o análisis de gases de sangre arterial (ABG), y oximetría, para medir la cantidad de oxígeno en la sangre. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto, que tiene un riesgo aumentado de infección por VSR durante momentos particulares del año. La temporada de VSR se extiende típicamente de octubre a mayo. A los sujetos que muestran susceptibilidad aumentada a infección por virus durante este tiempo, tales como bebés, ancianos o pacientes inmunocomprometidos, se les puede administrar un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento para la profilaxis y/o el tratamiento de infección por VSR justo antes de y/o durante la temporada de VSR. En algunos ejemplos, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administra una vez, dos veces, tres veces, cuatro veces o cinco veces durante la temporada de VSR. En algunos ejemplos, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administra una vez, dos veces, tres veces, cuatro veces o cinco veces en un periodo de un mes, dos meses o tres meses, antes de una temporada de VSR.

2. Dosificaciones El anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administra en una cantidad suficiente para ejercer un efecto terapéuticamente útil en ausencia de efectos secundarios indeseables en el paciente tratado. La concentración terapéuticamente eficaz de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo puede determinarse de forma empírica ensayando los polipéptidos en sistemas in vitro e in vivo conocidos tal como usando los ensayos proporcionados en el presente documento o conocidos en la técnica.

Una cantidad eficaz del anticuerpo o fragmento de unión a antígeno del mismo para administrar de forma terapéutica dependerá, por ejemplo, de los objetivos terapéuticos, la vía de administración, y la condición del paciente. Además, el médico a cargo tiene en cuenta diversos factores que se sabe que modifican la acción de los fármacos, incluyendo la gravedad y el tipo de enfermedad, la salud del paciente, el peso corporal, el sexo, la dieta, el aumento y la vía de administración, otras mediciones y otros factores clínicos relevantes. En consecuencia, será necesario que el terapeuta valore la dosificación del anticuerpo o fragmento de unión a antígeno del mismo y modifique la vía de administración según se requiera para obtener el efecto terapéutico óptimo. Típicamente, el especialista clínico administrará el anticuerpo o fragmento de unión a antígeno del mismo hasta que se alcance una dosificación que consiga el efecto deseado. El progreso de esta terapia se controla fácilmente por ensayos convencionales. Se conocen en la técnica ensayos ejemplares para controlar el tratamiento de una infección viral e incluyen, por ejemplo, ensayos de título viral.

ES 2 553 440 T3   En general, los intervalos de dosificación para la administración de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento son lo suficientemente grandes para producir el efecto deseado en el que el síntoma o los síntomas de la enfermedad mediada por patógeno (por ejemplo enfermedad viral) se mejoran o se reduce la probabilidad de infección por virus. En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran en una cantidad eficaz para inducir una respuesta inmunitaria en el sujeto. La dosificación no es tan grande como para provocar efectos secundarios adversos, tales como síndromes de hiperviscosidad, edema pulmonar o insuficiencia cardiaca congestiva. En general, la dosificación variará con la edad, la condición, el sexo y el alcance de la enfermedad en el paciente y puede determinarse por un experto en la materia. La dosificación puede ajustarse por el médico individual en caso de que aparezca cualquier efecto secundario adverso. Las dosificaciones ejemplares para la prevención o el tratamiento de una infección por VSR y/o mejora de uno o más síntomas de infección por VSR incluyen, pero sin limitación, aproximadamente o 0,01 mg/kg a aproximadamente o 300 mg/kg, tal como por ejemplo, aproximadamente o 0,01 mg/kg, aproximadamente o 0,1 mg/kg, aproximadamente o 0,5 mg/kg, aproximadamente o 1 mg/kg, aproximadamente o 5 mg/kg, aproximadamente o 10 mg/kg, aproximadamente o 15 mg/kg, aproximadamente o 20 mg/kg, aproximadamente o 25 mg/kg, aproximadamente o 30 mg/kg, aproximadamente o 35 mg/kg, aproximadamente o 40 mg/kg, aproximadamente o 45 mg/kg, aproximadamente o 50 mg/kg, aproximadamente o 100 mg/kg, aproximadamente o 150 mg/kg, aproximadamente o 200 mg/kg, aproximadamente o 250 mg/kg, o aproximadamente o 300 mg/kg.

En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran a un sujeto a una dosificación eficaz para conseguir un título de suero deseado. En ejemplos particulares, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran para la prevención o el tratamiento de una infección por VSR y/o mejora de uno o más síntomas de una infección por VSR en una cantidad eficaz para conseguir un título en suero de al menos o aproximadamente 1 µg/ml, al menos o aproximadamente 2 µg/ml, al menos o aproximadamente 3 µg/ml, al menos o aproximadamente 4 µg/ml, al menos o aproximadamente 5 µg/ml, al menos o aproximadamente 6 µg/ml, al menos o aproximadamente 7 µg/ml, al menos o aproximadamente 8 µg/ml, al menos o aproximadamente 9 µg/ml, al menos o aproximadamente 10 µg/ml, al menos o aproximadamente 15 µg/ml, al menos o aproximadamente 20 µg/ml, al menos o aproximadamente 25 µg/ml, al menos o aproximadamente 30 µg/ml, al menos o aproximadamente 40 µg/ml, al menos o aproximadamente 50 µg/ml, al menos o aproximadamente 60 µg/ml, al menos o aproximadamente 70 µg/ml, al menos o aproximadamente 80 µg/ml, al menos o aproximadamente 90 µg/ml, al menos o aproximadamente 100 µg/ml, en o aproximadamente 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 7 días, 8 días, 9 días, 10 días, 15 días, 20 días, 25 días, 30 días, 35 días o 40 días después de la administración de una primera dosis del anticuerpo o fragmento de unión a antígeno del mismo y antes de una dosis posterior del anticuerpo o fragmento de unión a antígeno del mismo. En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran por suministro pulmonar a un sujeto a una dosificación eficaz para conseguir un título deseado en una muestra de intubación, esputo o lavado de los pulmones. En ejemplos particulares, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran para la prevención o el tratamiento de una infección por VSR y/o mejora de uno o más síntomas de una infección por VSR en una cantidad eficaz para conseguir un título de 10 ng/mg (ng de anticuerpo anti VSR o fragmento de unión a antígeno del mismo por cada mg de proteína pulmonar) o aproximadamente 10 ng/mg, 15 ng/mg o aproximadamente 15 ng/mg, 20 ng/mg o aproximadamente 20 ng/mg, 25 ng/mg o aproximadamente 25 ng/mg, 30 ng/mg o aproximadamente 30 ng/mg, 40 ng/mg o aproximadamente 40 ng/mg, 50 ng/mg o aproximadamente 50 ng/mg, 60 ng/mg o aproximadamente 60 ng/mg, 70 ng/mg o aproximadamente 70 ng/mg, 80 ng/mg o aproximadamente 80 ng/mg, 90 ng/mg o aproximadamente 90 ng/mg, 100 ng/mg o aproximadamente 100 ng/mg, 110 ng/mg o aproximadamente 110 ng/mg, 120 ng/mg o aproximadamente 120 ng/mg, 130 ng/mg o aproximadamente 130 ng/mg, 140 ng/mg o aproximadamente 140 ng/mg, o 150 ng/mg o aproximadamente 150 ng/mg en una muestra de intubación o lavado de los pulmones en o aproximadamente 10 días, 15 días, 20 días, 25 días, 30 días, 35 días o 40 días después de la administración de una primera dosis del anticuerpo o fragmento de unión a antígeno del mismo y antes de una dosis posterior del anticuerpo o fragmento de unión a antígeno del mismo.

Para el tratamiento de una infección viral, la dosificación de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos puede variar dependiendo del tipo y gravedad de la enfermedad. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden administrarse en una única dosis, en múltiples administraciones separadas, o por infusión continua. Para administraciones repetidas durante varios días o más, dependiendo de la afección, el tratamiento puede repetirse hasta que se produzca una supresión deseada de los síntomas de enfermedad o se consiga la mejora deseada en la condición del paciente. Las administraciones repetidas pueden incluir cantidades aumentadas o reducidas del anticuerpo anti VSR o fragmento de unión a antígeno del mismo dependiendo del progreso del tratamiento. También se contemplan otros regímenes de dosificación.

ES 2 553 440 T3   En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran una vez, dos veces, tres veces, cuatro veces, cinco veces, seis veces, siete veces, ocho veces, nueve veces, diez veces o más por día o durante varios días. En ejemplos particulares, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran una vez, dos veces, tres veces, cuatro veces, cinco veces, seis veces, siete veces, ocho veces, nueve veces, diez veces o más para la prevención o el tratamiento de una infección por VSR y/o la mejora de uno o más síntomas de una infección por VSR a una cantidad eficaz para conseguir un título de suero de al menos o aproximadamente 1 µg/ml, al menos o aproximadamente 2 µg/ml, al menos o aproximadamente 3 µg/ml, al menos o aproximadamente 4 µg/ml, al menos o aproximadamente 5 µg/ml, al menos o aproximadamente 6 µg/ml, al menos o aproximadamente 7 µg/ml, al menos o aproximadamente 8 µg/ml, al menos o aproximadamente 9 µg/ml, al menos o aproximadamente 10 µg/ml, al menos o aproximadamente 15 µg/ml, al menos o aproximadamente 20 µg/ml, al menos o aproximadamente 25 µg/ml, al menos o aproximadamente 30 µg/ml, al menos o aproximadamente 40 µg/ml, al menos o aproximadamente 50 µg/ml, al menos o aproximadamente 60 µg/ml, al menos o aproximadamente 70 µg/ml, al menos o aproximadamente 80 µg/ml, al menos o aproximadamente 90 µg/ml, al menos o aproximadamente 100 µg/ml, en o aproximadamente 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 7 días, 8 días, 9 días, 10 días, 15 días, 20 días, 25 días, 30 días, 35 días o 40 días después de la administración de una primera dosis, segunda dosis, tercera dosis, cuarta dosis, quinta dosis, sexta dosis, séptima dosis, octava dosis, novena dosis, décima dosis del anticuerpo o fragmento de unión a antígeno del mismo y antes de una dosis posterior del anticuerpo o fragmento de unión a antígeno del mismo. En un ejemplo particular, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran cuatro veces para la prevención o el tratamiento de una infección por VSR y/o la mejora de uno o más síntomas de una infección por VSR en una cantidad eficaz para conseguir un título de suero de al menos o aproximadamente 72 µg/ml en o aproximadamente 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 7 días, 8 días, 9 días, 10 días, 15 días, 20 días, 25 días, 30 días, 35 días o 40 días después de la administración de la cuarta dosis del anticuerpo o fragmento de unión a antígeno del mismo y antes de una dosis posterior del anticuerpo o fragmento de unión a antígeno del mismo. En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos se administran en una secuencia de dos o más administraciones, en las que las administraciones se separan por un periodo de tiempo seleccionado. En algunos ejemplos, el periodo de tiempo seleccionado es de al menos o aproximadamente 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 1 semana, 2 semanas, 3 semanas, 1 mes, 2 meses, o 3 meses. En algunos ejemplos, se administra una cantidad profilácticamente eficaz de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento una o más veces justo antes de la temporada de VSR. En algunos ejemplos, se administra una cantidad profilácticamente eficaz de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento una o más veces justo antes de la temporada de VSR y/o una o más veces durante la temporada de VSR. También se puede evaluar la eficacia terapéutica de una dosificación o un régimen de dosificación particular, por ejemplo, midiendo el título viral en el sujeto antes de y después de la administración de una o más dosis del anticuerpo anti VSR o fragmento de unió a antígeno del mismo. Las cantidades de dosificación y/o la frecuencia de administración pueden modificarse dependiendo de la velocidad de eliminación deseada del virus en el sujeto. Como se entenderá por un experto en la materia, el régimen de tratamiento óptimo variará y está dentro del alcance de los métodos de tratamiento evaluar el estado de la enfermedad que se trata y la salud general del paciente antes de, y después de uno o más ciclos de terapia para determinar la dosificación terapéutica y la frecuencia de administración óptimas. Debe entenderse además que para cualquier sujeto particular, los regímenes de dosificación específicos pueden ajustarse a lo largo del tiempo según las necesidades individuales y el criterio profesional de la persona que administra o supervisa la administración de las formulaciones farmacéuticas, y que las dosificaciones expuestas en el presente documento son solamente ejemplares y no se pretende que limiten el alcance del mismo. La cantidad de un anticuerpo anti VSR o fragmento de unión a antígeno del mismo para administrar para el tratamiento de una enfermedad o afección, por ejemplo una infección viral (por ejemplo una infección por virus VSR), puede determinarse por técnicas clínicas convencionales (por ejemplo, ensayos de título viral o detección de antígenos). Además, pueden emplearse ensayos in vitro y modelos animales para ayudar a identificar intervalos de dosificación óptimos. Dichos ensayos pueden proporcionar intervalos de dosificación que pueden extrapolarse a la administración a sujetos, tales como seres humanos. Se conocen bien por los expertos en la materia métodos para identificar intervalos de dosificación óptimos basados en modelos animales. 3. Vías de administración Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse a un sujeto por cualquier método conocido en la técnica para la administración de polipéptidos, incluyendo por ejemplo administración sistémica o local. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden administrarse por vías, tales como la parenteral (por ejemplo, intradérmica, intramuscular, intraperitoneal, intravenosa, subcutánea o intracavitaria), tópica, epidural o mucosa (por ejemplo,

ES 2 553 440 T3   intranasal u oral). Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden administrarse por vía externa a un sujeto, en el sitio de la enfermedad para ejercer acción local o transdérmica. Pueden administrarse composiciones que contienen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos por cualquier vía conveniente, por ejemplo mediante infusión o inyección de embolada, mediante absorción a través de revestimientos epiteliales o mucocutáneos (por ejemplo, mucosa oral, mucosa rectal e intestinal). Las composiciones que contienen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden administrarse junto con otros agentes biológicamente activos. El modo de administración puede incluir administración tópica u otra de una composición sobre, en o en torno a áreas del cuerpo que pueden ponerse en contacto con fluidos, células o tejidos que se infectan, se contaminan o tienen un virus asociado con ellos, tal como un virus VSR. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse por vías tópica o de aerosol para suministro directamente a órganos diana, tales como el pulmón (por ejemplo, por aerosol pulmonar). En algunos ejemplos, los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos pueden administrarse como una formulación de liberación controlada tal como por una bomba (véase, por ejemplo, Langer (1990) Science 249: 1527-1533; Sefton (1987) CRC Crit. Ref. Biomed. Eng. 14: 20; Buchwald et al. (1980) Surgery 88: 507; y Saudek et al. (1989) N. Engl. J. Med. 321: 574) o mediante el uso de diversos polímeros conocidos en la técnica y descritos en otra parte del presente documento. En algunos ejemplos, un sistema de liberación controlada o sostenida puede colocarse próximo a la diana terapéutica, por ejemplo, a los pulmones, requiriendo de este modo solamente una fracción de la dosis sistémica (véase, por ejemplo, Goodson, en Medical Applications of Controlled Release, mencionado anteriormente, vol. 2, pp. 115-138(1984)). En ejemplos particulares, los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos se administran por suministro pulmonar (véase, por ejemplo, Patentes de Estados Unidos N.º 6.019.968, 5.985.320, 5.985.309, 5.934.272, 5.874.064, 5.855.913, 5.290.540 y 4.880.078; y Publicaciones de PCT N.º WO 92/19244, WO 97/32572, WO 97/44013, WO 98/31346, y WO 99/66903). Se conocen en la técnica métodos ejemplares de suministro pulmonar e incluyen, pero sin limitación, métodos de aerosol, tales como inhaladores (por ejemplo, inhaladores de dosis medida presurizada (MDI), inhaladores de polvo seco (DPI), nebulizadores (por ejemplo, nebulizadores a chorro o ultrasónicos) y otros sistemas líquidos de inspiración única), instilación intratraqueal e insuflación. En algunos ejemplos, puede potenciarse por la coadministración por la coadministración de o administración de una coformulación que contiene los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento y un potenciador de la permeación, tales como, por ejemplo, tensioactivos, ácidos grasos, sacáridos, agentes quelantes e inhibidores enzimáticos, tales como inhibidores de proteasa.

Pueden seleccionarse métodos apropiados para suministro, tales como suministro pulmonar, por un experto en la materia basándose en las propiedades de la cantidad de dosificación del anticuerpo anti VSR o fragmento de unión a antígeno del mismo o la composición farmacéutica que contiene el anticuerpo o fragmento de unión a antígeno del mismo. Dichas propiedades incluyen, pero sin limitación, solubilidad, higroscopicidad, propiedades de cristalización, punto de fusión, densidad, viscosidad, flujo, estabilidad y perfil de degradación.

En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento aumentan la eficacia de la inmunización de la mucosa contra un virus. Por lo tanto, en ejemplos particulares los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos se administran a una superficie mucosa. Por ejemplo, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos pueden suministrarse mediante vías tales como oral (por ejemplo, bucal, sublingual), ocular (por ejemplo, corneana, conjuntival, intravítrea, inyección intraacuosa), intranasal, genital (por ejemplo, vaginal), rectal, pulmonar, estomacal o intestinal. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse de forma sistémica, tal como por vía parenteral, por ejemplo, mediante inyección o mediante infusión gradual a lo largo del tiempo o por vía entérica (es decir, tracto digestivo). Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden administrarse por vía tópica, tal como por ejemplo, mediante instalación o aplicación tópica (por ejemplo, instilación intratraqueal e insuflación usando un broncoscopio u otra vía respiratoria artificial) de soluciones líquidas, geles, pomadas, polvos o por inhalación (por ejemplo, pulverizaciones nasales, inhaladores (por ejemplo, inhaladores de dosis medida presurizada (MDI), inhaladores de polvo seco (DPI), nebulizadores (por ejemplo, nebulizadores a chorro o ultrasónicos) y otros sistemas líquidos de inspiración única)). La administración puede efectuarse antes de la exposición al virus o después de la exposición al virus. 4. Terapias de combinación Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse solos o en combinación con uno o más agentes terapéuticos o terapias para la profilaxis y/o el tratamiento de una enfermedad o afección. Por ejemplo, los anticuerpos anti VSR proporcionados o fragmentos de unión a antígeno de los mismos pueden administrarse en combinación con uno o más agentes antivirales para la profilaxis y/o el tratamiento de una infección viral, tal como una infección viral respiratoria. En algunos ejemplos, la infección viral respiratoria es una infección por VSR. Los agentes antivirales pueden incluir agentes para reducir y/o eliminar la infección patógena o agentes para aliviar uno o más síntomas de una infección

ES 2 553 440 T3   patógena. En algunos ejemplos, también puede administrarse una pluralidad de anticuerpos o fragmentos de unión a antígeno de los mismos (por ejemplo, uno o más anticuerpos antivirales) en combinación, en los que al menos uno de los anticuerpos es un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, puede administrarse una pluralidad de anticuerpos en combinación para la profilaxis y/o el tratamiento de una infección por VSR o múltiples infecciones virales, en los que al menos uno de los anticuerpos es un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. En algunos ejemplos, los anticuerpos anti VSR proporcionados pueden administrarse en combinación con uno o más anticuerpos antivirales, que se unen con y neutralizan un virus, tal como VSR. En algunos ejemplos, los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados pueden administrarse en combinación con uno o más anticuerpos, que pueden inhibir o aliviar uno o más síntomas de una infección viral, tal como una infección por VSR. En algunos ejemplos, dos o más de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento se administran en combinación. El o los agentes adicionales pueden administrarse de forma simultánea, secuencial o intermitente con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo. Los agentes pueden coadministrarse con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo, por ejemplo, como parte de la misma composición farmacéutica o el mismo método de suministro. En algunos ejemplos, los agentes pueden coadministrarse con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo en el mismo sitio que el anticuerpo anti VSR o fragmento de unión a antígeno del mismo, pero por un medio diferente de suministro. Los agentes también pueden administrarse en un momento diferente que la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo, pero suficientemente cerca en el tiempo para que la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo tenga un efecto profiláctico o terapéutico combinado. En algunos ejemplos, el o los agentes adicionales se administran después de o antes de la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo separados por un periodo de tiempo seleccionado. En algunos ejemplos, el periodo de tiempo es 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 1 semana, 2 semanas, 3 semanas, 1 mes, 2 meses o 3 meses. En algunos ejemplos, el o los agentes adicionales se administran múltiples veces y/o el anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administran múltiples veces. En algunos ejemplos, la administración de la combinación inhibe la incidencia de una infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la incidencia de la infección por VSR en ausencia de la combinación. En algunos ejemplos, la administración de la combinación reduce la gravedad de uno o más síntomas de infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 ’ %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la gravedad del o los síntomas de infección por VSR en ausencia de la combinación. En algunos ejemplos, la combinación inhibe la unión de VSR con su receptor de célula hospedadora en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la unión de VSR con su receptor de célula hospedadora en ausencia de la combinación. En algunos ejemplos, la combinación inhibe la replicación de VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la replicación de VSR en ausencia de la combinación. Puede usarse cualquier terapia que se sabe que es útil, o que se usa o se ha usado para la prevención, el control, el tratamiento o la mejora de una infección por VSR o uno o más síntomas de la misma en combinación con anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento (véase, por ejemplo,

ES 2 553 440 T3   Gilman et al., Goodman y Gilman: The Pharmacological Basis of Therapeutics, 10ª ed., McGraw-Hill, Nueva York, 2001; The Merck Manual of Diagnosis and Therapy, Berkow, M. D. et al. (eds.), 17ª Ed., Merck Sharp & Dohme Research Laboratories, Rahway, N. J., 1999; Cecil Textbook of Medicine, 20ª Ed., Bennett y Plum (eds.), W. B. Saunders, Filadelfia, 1996, para información con respecto a terapias (por ejemplo, agentes profilácticos o terapéuticos) que se han usado o se usan para prevenir, tratar, controlar o aliviar una infección por VSR o uno o más síntomas de la misma). Los ejemplos de dichos agentes incluyen, pero sin limitación, agentes inmunomoduladores, agentes antiinflamatorios (por ejemplo, adenocorticoides, corticosteroides (por ejemplo, beclometasona, budesonida, flunisolida, fluticasona, triamcinolona, metilprednisolona, prednisolona, prednisona, hidrocortisona), glucocorticoides, esteroides, fármacos antiinflamatorios no esteroideos (por ejemplo aspirina, ibuprofeno, diclofenaco e inhibidores de COX-2)), analgésicos, antagonistas de leucotrienos (por ejemplo, montelukast, metil xantinas, zafirlukast y zileutón), broncodilatadores, tales como agonistas β2 (por ejemplo, bambuterol, bitolterol, clembuterol, fenoterol, formoterol, indacaterol, isoetarina, metaproterenol, pirbuterol, procaterol, reproterol, rimiterol, salbutamol (Albuterol, Ventolín), levosalbutamol, salmeterol, tulobuterol y terbutalina) y agentes anticolinérgicos (por ejemplo, bromuro de ipratropio y bromuro de oxitropio), sulfasalacina, penicilamina, dapsona, antihistamínicos, agentes antimalaria (por ejemplo, hidroxicloroquina) y agentes antivirales. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden administrarse en combinación con una o más terapias para el tratamiento de una infección por VSR, incluyendo pero sin limitación, administración o infusión intravenosa de inmunoglobulina, administración de oxígeno complementario y fluidos o respiración asistida. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden administrarse en combinación con uno o más agentes que regulan la maduración pulmonar y expresión de proteínas tensioactivas, tales como, pero sin limitación, glucocorticoides, ligandos de PPARγ, y factor de crecimiento celular endotelial vascular (VEGF). Los agentes antivirales ejemplares que pueden seleccionarse para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen, pero sin limitación, compuestos antivirales, proteínas antivirales, péptidos antivirales, conjugados de proteínas antivirales y conjugados de péptidos antivirales, incluyendo, pero sin limitación, análogos de nucleósidos, análogos de nucleótidos, inmunomoduladores (por ejemplo interferones) e inmunoestimulantes. Se contempla terapia de combinación usando anticuerpos y/o anticuerpos anti VSR y fragmentos de unión a antígeno proporcionados con la presente así como combinación con los anticuerpos y/o anticuerpos anti VSR y fragmentos de unión a antígeno proporcionados en el presente documento con otros anticuerpos anti VSR y anticuerpos anti VSR y fragmentos de unión a antígeno. Los agentes antivirales ejemplares para el tratamiento de infecciones virales que pueden administrase en combinación con los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen, pero sin limitación, aciclovir, famciclovir, ganciclovir, penciclovir, valaciclovir, valganciclovir, idoxuridina, trifluridina, brivudina, cidofovir, docosanol, fomivirsen, foscarnet, tromantadina, imiquimod, podofilotoxina, entecavir, lamivudina, telbivudina, clevudina, adefovir, tenofovir, boceprevir, telaprevir, pleconarilo, arbidol, amantadina, rimantadina, oseltamivir, zanamivir, peramivir, inosina, interferón (por ejemplo, Interferón alfa- 2b, Peginterferón alfa-2a), ribavirina/taribavirina, abacavir, emtricitabina, lamivudina, didanosina, zidovudina, apricitabina, estampidina, elvucitabina, racivir, amdoxovir, estavudina, zalcitabina, tenofovir, efavirenz, nevirapina, etravirina, rilpivirina, lovirida, delavirdina, atazanavir, fosamprenavir, lopinavir, darunavir, nelfinavir, ritonavir, saquinavir, tipranavir, amprenavir, indinavir, enfuvirtida, maraviroc, vicriviroc, PRO 140, ibalizumab, raltegravir, elvitegravir, bevirimat, vivecon, incluyendo formas tautoméricas, análogos, isómeros, polimorfos, solvatos, derivados o sales de los mismos. Los agentes antivirales ejemplares para la profilaxis y/o el tratamiento de infecciones por VSR que pueden administrarse en combinación con los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento incluyen, pero sin limitación, ribavirina, NIH-351 (Gemini Technologies), vacuna de VSR recombinante (Aviron), RSVf-2 (Intracel), F-50042 (Pierre Fabre), T-786 (Trimeris), VP-36676 (ViroPharma), RFI-641 (American Home Products), VP-14637 (ViroPharma), PFP-1 y PFP-2 (American Home Products), vacuna de VSR (Avant Immunotherapeutics), F-50077 (Pierre Fabre), y otros anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos.

Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento también pueden administrarse en combinación con uno o más agentes capaces de estimular la inmunidad celular, tal como inmunidad de mucosa celular. Puede usarse cualquier agente con capacidad de inmunidad celular estimulante. Los agentes inmunoestimulantes ejemplares incluyen citocinas, tales como, pero sin limitación, interferones (por ejemplo, IFN-α, β, γ, ω), linfocinas y factores de crecimiento hematopoyético, tales como, por ejemplo, GM-CSF (factor estimulante de colonias de macrófagos y granulocitos), Interleucina-2 (IL-2), Interleucina-3 (IL-3), Interleucina-4 (IL-4), Interleucina-7 (IL-7), Interleucina-10 (IL-10), Interleucina-12 (IL-12), Interleucina-14 (IL-14), y Factor de Necrosis Tumoral (TNF). Para terapias de combinación con agentes antipatógenos, se conocen en la técnica dosificaciones para la administración de dichos compuestos o pueden determinarse por un experto en la materia de acuerdo con factores clínicos conocidos (por ejemplo, especie del sujeto, tamaño, área de superficie corporal, edad, sexo,

ES 2 553 440 T3   inmunocompetencia y salud general, duración y vía de la administración, el tipo y estadio de la enfermedad, y si se administran simultáneamente otros tratamientos, tales como otros agentes antipatógenos). a. Anticuerpos antivirales para terapia de combinación Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden administrarse en combinación con uno o más anticuerpos adicionales o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, el o los anticuerpos adicionales son anticuerpos antivirales. En algunos ejemplos, el o los anticuerpos adicionales se unen con un antígeno viral. En algunos ejemplos, el o los anticuerpos adicionales se unen con un antígeno viral que es una proteína de superficie, tal como una proteína de cápsida viral o una proteína de envoltura viral. En algunos ejemplos, el o los anticuerpos adicionales se unen con un antígeno viral que se expresa en la superficie de una célula infectada. En algunos ejemplos, el o los anticuerpos adicionales se unen con un antígeno viral que se expresa intracelularmente (es decir, dentro de una célula infectada). En algunos ejemplos, el o los anticuerpos adicionales se unen con un virus que provoca enfermedad respiratoria, tal como, pero sin limitación, VSR, virus paragripal (PIV) o metaneumovirus humano (hMPV). También se proporcionan en el presente documento composiciones que contienen las mezclas de anticuerpos. Los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionados en el presente documento incluyen, pero sin limitación, anticuerpos monoclonales, anticuerpos multiespecíficos, anticuerpos sintéticos, anticuerpos humanos, anticuerpos humanizados, anticuerpos quiméricos, intracuerpos, Fv monocatenarios (scFv), anticuerpos monocatenarios, fragmento Fab, fragmentos F(ab’), Fv con enlaces disulfuro (sdFv) y anticuerpos antiidiotípicos (anti Id) (incluyendo, por ejemplo, anticuerpos anti Id para anticuerpos proporcionados en el presente documento) y fragmentos de unión a epítopo de cualquiera de los anteriores. Los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden ser de cualquier tipo (por ejemplo, IgG, IgE, IgM, IgD, IgA e IgY), clase (por ejemplo, IgG1, IgG2, IgG3, IgG4, IgA1 e IgA2) o subclase de molécula de inmunoglobulina. Los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden ser de cualquier origen animal, incluyendo aves y mamíferos (por ejemplo, ser humano, murino, burro, oveja, conejo, cabra, cobaya, camello, caballo o pollo). Típicamente, los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento son anticuerpos humanos o humanizados. Los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden ser monoespecíficos, biespecíficos, triespecíficos o de mayor multiespecificidad.

Los anticuerpos para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden incluir anticuerpos derivados que se modifican, por ejemplo, mediante la unión de cualquier tipo de molécula con el anticuerpo o fragmento de unión a antígeno del mismo tal como por unión covalente. Los derivados ejemplares de anticuerpo o fragmento de unión a antígeno del mismo incluyen anticuerpos que se han modificado, por ejemplo, por glucosilación, acetilación, pegilación, fosforilación, amidación, derivatización por grupos protectores/de bloqueo conocidos, escisión proteolítica, enlace con un ligando celular u otra proteína, o contienen dominio Fc heterólogo con mayores afinidades por el receptor FcRN (véase, por ejemplo, Patente de Estados Unidos N.º 7.083.784). Puede llevarse a cabo cualquiera de numerosas modificaciones químicas por técnicas conocidas, incluyendo, pero sin limitación, escisión química específica, acetilación, formilación o síntesis en presencia de tunicamicina. Adicionalmente, el derivado puede contener uno o más aminoácidos no clásicos. El o los anticuerpos adicionales para uso en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden administrarse simultáneamente, secuencialmente o intermitentemente con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo. El o los anticuerpos adicionales pueden coadministrarse con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo, por ejemplo, como parte de la misma composición farmacéutica o el mismo método de suministro. En algunos ejemplos, el o los anticuerpos adicionales pueden coadministrarse con el anticuerpo anti VSR o fragmento de unión a antígeno del mismo al mismo tiempo que el anticuerpo anti VSR o fragmento de unión a antígeno del mismo, pero por un medio de suministro diferente. El o los anticuerpos adicionales también pueden administrarse en un momento diferente de la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento, pero suficientemente cerca en el tiempo a la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo para tener un efecto profiláctico o terapéutico combinado. En algunos ejemplos, el o los anticuerpos adicionales se administran después de o antes de la administración del anticuerpo anti VSR o fragmento de unión a antígeno del mismo separado por un periodo de tiempo seleccionado. En algunos ejemplos, el periodo de tiempo es 1 día, 2 días, 3 días, 4 días, 5 días, 6 días, 1 semana, 2 semanas, 3 semanas, 1 mes, 2 meses o 3 meses. En algunos ejemplos, el o los anticuerpos adicionales se administran múltiples veces y/o el anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administra múltiples veces.

ES 2 553 440 T3   i. Anticuerpos anti VSR En algunos ejemplos, el o los anticuerpos antivirales adicionales son anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento se administra en combinación con el o los anticuerpos anti VSR adicionales o fragmentos de unión a antígeno de los mismos para la profilaxis y/o el tratamiento de una infección por VSR. Los anticuerpos anti VSR ejemplares o fragmentos de unión a antígeno de los mismos para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos que se unen inmunoespecíficamente con y neutralizan VSR. En algunos ejemplos, el o los anticuerpos anti VSR adicionales o fragmentos de unión a antígeno de los mismos incluyen un anticuerpo o fragmento de unión a antígeno del mismo que se une inmunoespecíficamente con el subtipo VSR A y/o el subtipo VSR B. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno proporcionado en el presente documento incluyen un anticuerpo anti VSR que se une con una proteína de unión a VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1520), una proteína estructural grande de subunidad beta de ARN polimerasa de VSR) (proteína L) (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1521), una proteína de nucleocápsida de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1522), una nucleoproteína de VSR (N) (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1523), una fosfoproteína P de VSR (por ejemplo, que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1524), una proteína de matriz de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1525), una proteína hidrófoba pequeña (SH) de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1526), una polimerasa dependiente de ARN de VSR, una proteína F de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1527), una proteína G de VSR (por ejemplo que tiene una secuencia de aminoácidos expuesta en SEC ID Nº: 1528) o una variante alélica de cualquiera de las anteriores. En ejemplos particulares, el o los anticuerpos antivirales adicionales incluyen un anticuerpo anti VSR que se une con una proteína F de VSR. En ejemplos particulares, el o los anticuerpos antivirales adicionales que se unen con una proteína F de VSR se unen con los sitios antigénicos A, B, C, I, II, IV, V o VI de una glucoproteína F de VSR (véase, por ejemplo, Lopez et al. (1998) J. Virol. 72: 6922-6928). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye, pero sin limitación, palivizumab (SYNAGIS®), motavizumab (NUMAX®), AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, Alh5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, (véase Patente de Estados Unidos N.º 5.824.307 y 6.818.216), rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23 (véase Patente de Estados Unidos N.º 6.685.942), RF-1, RF-2 (véase Patente de Estados Unidos N.º 5.811.524), o fragmentos de unión a antígeno de los mismos. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una cadena VH y/o cadena VL que tiene la secuencia de aminoácidos de una cadena VH y/o cadena VL de palivizumab (SYNAGIS®), motavizumab (NUMAX®), AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2- 15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1 o RF-2. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una o más CDR de palivizumab (Synagis®), motavizumab (Numax®), AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3- 3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, o RF-2. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una o más CDR de un anticuerpo monoclonal de ratón anti VSR tal como, pero sin limitación, MAb 1153, 1142, 1200, 1214, 1237, 1129, 1121, 1107, 1112, 1269, 1269, 1243 (Beeler et al. (1989) J. Virology 63(7): 2841- 2950), MAb151 (Mufson et al. (1987) J. Clin. Microbiol. 25: 1635-1539), MAb 43-1 y 13-1 (Fernie et al. (1982) Proc. Soc. Exp. Biol. Med. 171: 266-271), MAb 1436C, 1302A, 1308F y 1331H (Anderson et al. (1984) J. Clin. Microbiol. 19: 934-936). Los anticuerpos ejemplares adicionales o fragmentos de unión a antígeno de los mismos que pueden usarse para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno proporcionado en el presente documento incluyen, pero sin limitación, anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos descritos en, por ejemplo, las Patentes de Estados Unidos N.º 6.413.771, 5.840.298, 5.811.524, 6.656.467, 6.537.809, 7.364.742, 7.070.786, 5.955.364, 7.488.477, 6.818.216, 5.824.307, 7.364.737, 6.685.942 y 5.762.905 y las Publicaciones de Patente de Estados Unidos N.º 2007-0082002, 2005-0175986, 2004-0234528, 2006-0198840, 2009-0110684, 2006-0159695, 2006-0013824, 2005-0288491, 2005-0019758, 2008-0226630, 2009-0137003 y 2009-0092609. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una cadena VH que tiene una secuencia de aminoácidos expuesta en una cualquiera de las SEC ID Nº: 103, 113, 122, 131, 137, 144, 149, 155, 161, 167, 172, 176, 179, 182,

ES 2 553 440 T3   186, 190, 194, 198, 201, 205, 210, 215, 222, 356, 363, 369, 376, 382, 387, 1607 y 1611. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene un dominio VH que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 104, 114, 123, 132, 138, 145, 150, 156, 162, 168, 173, 187, 206, 357, 362, 364, 370, 377, 383 y 388. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR1 de VH que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 105, 115, 124, 1608 y 1612. En ejemplos particulares, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR1 de VH que tiene la secuencia de aminoácidos TSGMSVG (SEC ID Nº: 105), TAGMSVG (SEC ID Nº: 115), AYAMS (SEC ID Nº: 1608), o GYTMH (SEC ID Nº: 1612). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR2 de VH que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 106, 125, 133, 157, 226-235, 365, 389, 397-408, 1609 y 1613. En un ejemplo particular, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR2 de VH que tiene la secuencia de aminoácidos DIWWDDKKDYNPSLKS (SEC ID Nº: 106) o DIWWDDKKHYNPSLKD (SEC ID Nº: 125), GISGSGDSTDYADSVKG (SEC ID Nº: 1609), o SITGGSNFINYSDSVKG (SEC ID Nº: 1613). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR3 de VH que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 107, 116, 126, 139, 188, 236- 238, 371, 1610 y 1614. En un ejemplo particular, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR3 de VH que tiene la secuencia de aminoácidos SMITNWYFDV (SEC ID Nº: 107), DMIFNFYFDV (SEC ID Nº: 126), HLPDYWNLDYTRFFYYMDV (SEC ID Nº: 1610) o APIAPPYFDH (SEC ID Nº: 1614). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene una cadena VL que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 108, 117, 127, 134, 140, 146, 152, 158, 164, 169, 174, 177, 180, 183, 189, 191, 195, 199, 202, 207, 211, 216, 220, 223, 358, 366, 372, 378, 384, 390, 393, 1615, 1619 y 1623. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen un anticuerpo o fragmento de unión a antígeno del mismo que contiene un dominio VL que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 109, 118, 128, 135, 141, 147, 153, 159, 165, 170, 175, 178, 181, 184, 192, 196, 200, 203, 208, 212, 217, 221, 224, 359, 367, 373, 379, 385, 391 y 394. En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR1 de VL que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 110, 119, 129, 142, 154, 166, 239-255, 257-297, 299-314, 374, 380, 395, 409-544, 1616, 1620 y 1624. En un ejemplo particular, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR1 de VL que tiene la secuencia de aminoácidos KCQLSVGYMH (SEC ID Nº: 110), SASSRVGYMH (SEC ID Nº: 154), RATQSISSNYLA (SEC ID Nº: 1616), KASQNINDNLA (SEC ID Nº: 1620) o RATQSVSNFLN (SEC ID Nº: 1624). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR2 de VL que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 111, 120, 136, 143, 160, 171, 185, 218, 225, 315-355, 360, 368, 375, 381, 386, 392, 396, 545-1509. 1617, 1621 y 1625.

En un ejemplo particular, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR2 de VL que tiene las secuencias de aminoácidos DTSKLAS (SEC ID Nº: 111), DTLLLDS (SEC ID Nº: 218), GASNRAT (SEC ID Nº: 1617), GASSRAT (SEC ID Nº: 1621), o DASTSQS (SEC ID Nº: 1625). En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR3 de VL que tiene una secuencia de aminoácidos expuesta en cualquiera de SEC ID Nº: 112, 121, 193, 1510-1511, 1618, 1622 y 1626. En un ejemplo particular, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo que contiene una CDR3 de VL que tiene la secuencia de

ES 2 553 440 T3   aminoácidos FQGSGYPFT (SEC ID Nº: 112), QQYDISPYT (SEC ID Nº: 1618), QQYGGSPYT (SEC ID Nº: 1622) o QASINTPL (SEC ID Nº: 1626). En algunos ejemplos, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede administrarse en combinación con suero hiperinmunitario o globulina inmunitaria enriquecida con respecto a anticuerpos anti VSR, tal como, por ejemplo, globulina hiperinmunitaria de VSR (RSV IVIG; RespiGam®; MedImmune Inc, Gaithersburg, MD; véase, por ejemplo, Groothius et al. (1993) New Eng. J. Med 329: 1524-1530).

ii. Anticuerpos contra otros virus respiratorios En algunos ejemplos, el o los anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluye un anticuerpo o fragmento de unión a antígeno del mismo para un virus respiratorio distinto de VSR, por ejemplo, seleccionado de entre un anticuerpo anti metaneumovirus humano (hMPV), un anticuerpo anti virus paragripal (PIV), un anticuerpo anti neumovirus aviar (APV) y otro anticuerpo antiviral conocido en la técnica. En algunos ejemplos, en los que uno o más anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento sea un anticuerpo anti PIV, un anticuerpo que se une inmunoespecíficamente con un antígeno de PIV, tal como, por ejemplo, una fosfoproteína de la nucleocápsida de PIV, una proteína de fusión (F) de PIV, una fosfoproteína de PIV, una proteína grande (L) de PIV, una proteína de matriz (M) de PIV, una glucoproteína de hemaglutinina- neuraminidasa (HN) de PIV, una ARN polimerasa dependiente de ARN de PIV, una proteína Y1 de PIV, una proteína D de PIV, una proteína C de PIV, o una variante alélica de cualquiera de las anteriores. En ejemplos particulares, el antígeno de PIV es una proteína F de PIV. En algunos ejemplos, el anticuerpo anti PIV es un anticuerpo que se une inmunoespecíficamente con un antígeno de PIV humano de tipo 1, PIV humano de tipo 2, PIV humano de tipo 3 y/o PIV humano de tipo 4. En algunos ejemplos, en los que uno o más anticuerpos antivirales adicionales para terapia de combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento es un anticuerpo anti hMPV, un anticuerpo que se une inmunoespecíficamente con un antígeno de hMPV, tal como, por ejemplo, una nucleoproteína de hMPV, una fosfoproteína de hMPV, una proteína de matriz de hMPV, una proteína hidrófoba pequeña de hMPV, una ARN polimerasa dependiente de ARN de hMPV, una proteína F de hMPV, una proteína G de hMPV, o una variante alélica de cualquiera de las anteriores. En ejemplos particulares, el antígeno de hMPV es la proteína F de PIV. En algunos ejemplos, el anticuerpo anti hMPV es un anticuerpo que se une inmunoespecíficamente con un antígeno de hMPV de tipo A y/o hMPV de tipo B. En algunos ejemplos, el anticuerpo anti hMPV es un anticuerpo que se une inmunoespecíficamente con un antígeno del hMPV de subtipo A1 y/o A2 y/o hMPV de subtipo B1 y/o B2.

Los anticuerpos administrados en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento pueden ser de cualquier tipo de anticuerpo o fragmento de unión a antígeno conocido en la técnica. Por ejemplo, un anticuerpo o fragmento de unión a antígeno del mismo administrado en combinación con un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede incluir, pero sin limitación, un anticuerpo monoclonal, un anticuerpo humano, un anticuerpo no humano, un anticuerpo producido de forma recombinante, un anticuerpo quimérico, un anticuerpo humanizado, un anticuerpo multiespecífico (por ejemplo, un anticuerpo biespecífico), un intracuerpo y un fragmento de anticuerpo, tal como, pero sin limitación, un fragmento Fab, un fragmento Fab’, un fragmento F(ab’)2, un fragmento Fv, un Fv con enlaces disulfuro (dsFv), un fragmento Fd, un fragmento Fd’, un Fv monocatenario (scFv), un Fab monocatenario (scFab), un diacuerpo, un anticuerpo antiidiotípico (anti Id), o fragmentos de unión a antígeno de cualquiera de los anteriores. Los anticuerpos administrados en combinación con un anticuerpo anti VSR proporcionado en el presente documento pueden incluir miembros de cualquier tipo de inmunoglobulina (por ejemplo, IgG, IgM, IgD, IgE, IgA e IgY), cualquier clase (por ejemplo, IgG1, IgG2, IgG3, IgG4, IgA1 e IgA2) o subclase (por ejemplo, IgG2a e IgG2b).

En algunos ejemplos, la administración de la combinación de anticuerpos antivirales o fragmentos de unión a antígeno inhibe la incidencia de la infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la incidencia de infección por VSR en ausencia de anticuerpo anti VSR o fragmento de unión a antígeno. En algunos ejemplos, la administración de la combinación de anticuerpos antivirales o fragmentos de unión a antígeno reduce la gravedad de uno o más síntomas de infección por VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o

ES 2 553 440 T3   aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la gravedad del uno o más síntomas de la infección por VSR en ausencia de la combinación de anticuerpos antivirales o fragmentos de unión a antígeno. En algunos ejemplos, la combinación de anticuerpos antivirales o fragmentos de unión a antígeno inhibe la unión de VSR con su receptor de célula hospedadora en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la unión de VSR con su receptor de célula hospedadora en ausencia de la combinación de anticuerpos antivirales o fragmentos de unión a antígeno. En algunos ejemplos, la combinación de anticuerpos antivirales o fragmentos de unión a antígeno inhibe la replicación del VSR en al menos o aproximadamente 99 %, al menos o aproximadamente 95 %, al menos o aproximadamente 90 %, al menos o aproximadamente 85 %, al menos o aproximadamente 80 %, al menos o aproximadamente 75 %, al menos o aproximadamente 70 %, al menos o aproximadamente 65 %, al menos o aproximadamente 60 %, al menos o aproximadamente 55 %, al menos o aproximadamente 50 %, al menos o aproximadamente 45 %, al menos o aproximadamente 40 %, al menos o aproximadamente 35 %, al menos o aproximadamente 30 %, al menos o aproximadamente 25 %, al menos o aproximadamente 20 %, al menos o aproximadamente 15 %, o al menos o aproximadamente 10 % en relación con la replicación de VSR en ausencia de la combinación de anticuerpos antivirales o fragmentos de unión a antígeno. 5. Terapia génica En algunos ejemplos, se administran ácidos nucleicos que comprenden secuencias que codifican los anticuerpos anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos, para tratar, prevenir o aliviar uno o más síntomas asociados con infección por VSR, por medio de terapia génica. La terapia génica se refiere a terapia realizada mediante la administración a un sujeto de un ácido nucleico expresado o expresable. En este ejemplo, los ácidos nucleicos producen su anticuerpo codificado o fragmento de unión a antígeno del mismo que media en un efecto profiláctico o terapéutico. Cualquiera de los métodos para terapia génica disponibles en la técnica puede emplearse para administración de ácido nucleico que codifica los anticuerpos anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos. Se describen posteriormente métodos ejemplares.

Para revisiones generales de los métodos de terapia génica, véase, por ejemplo, Goldspiel et al. (1993) Clinical Pharmacy 12: 488-505; Wu y Wu (1991) Biotherapy 3: 87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32: 573-596; Mulligan (1993) Science 260: 926-932; Morgan y Anderson (1993) Ann. Rev. Biochem. 62: 191-217; y TIBTECH 11(5): 155-215. Se describen métodos habitualmente conocidos en la técnica de tecnología de ADN recombinante que pueden usarse en Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); y Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). En algunos ejemplos, una composición proporcionada en el presente documento contiene ácidos nucleicos que codifican un anticuerpo anti VSR, un fragmento de unión a antígeno y/o derivado del mismo, en los que los ácidos nucleicos son parte de un vector de expresión que expresa el anticuerpo anti VSR, fragmento de unión a antígeno y/o derivado del mismo en un hospedador adecuado. En particular, dichos ácidos nucleicos tienen promotores, tales como promotores heterólogos, unidos operativamente con la región codificante del anticuerpo, siendo dicho promotor inducible o constitutivo y, opcionalmente, específico de tejido. En otra realización particular, se usan moléculas de ácido nucleico en las que la secuencia codificante de anticuerpo y cualquier otra secuencia deseada se flanquean por regiones que promueven la recombinación homóloga en un sitio deseado en el genoma, proporcionando de este modo expresión intracromosómica de los ácidos nucleicos que codifican anticuerpo (Koller y Smithies (1989) Proc. Natl. Acad. Sci. USA 86: 8932-8935; Zijlstra et al. (1989) Nature 342: 435-438). En algunos ejemplos, la molécula de anticuerpo expresada es un anticuerpo monocatenario. En algunos ejemplos, las secuencias de ácido nucleico incluyen secuencias que codifican las cadenas pesadas y ligeras, o fragmentos de las mismas, del anticuerpo. En un ejemplo particular, las secuencias de ácido nucleico incluyen secuencias que codifican un fragmento Fab anti VSR. En un ejemplo particular, las secuencias de ácido nucleico incluyen secuencias que codifican un anticuerpo anti VSR de longitud completa. En algunos ejemplos, el anticuerpo anti VSR codificado es un anticuerpo quimérico.

El suministro de los ácidos nucleicos a un sujeto puede ser directo, en cuyo caso el sujeto se expone directamente al ácido nucleico o vectores portadores de ácido nucleico, o indirecto, en cuyo caso, las células se transforman en

ES 2 553 440 T3   primer lugar con los ácidos nucleicos in vitro, después se trasplantan al sujeto. Estos dos enfoques se conocen, respectivamente, como terapia génica in vivo o ex vivo. En algunos ejemplos, las secuencias de ácido nucleico se administran directamente in vivo, donde se expresa para producir el producto codificado. Esto puede conseguirse por cualquiera de numerosos métodos conocidos en la técnica, por ejemplo, construyéndolos como parte de un vector de expresión de ácido nucleico apropiado y administrándolo de modo que se haga intracelular, por ejemplo, mediante infección usando vectores retrovirales u otros virales defectuosos o atenuados (véase Patente de Estados Unidos N.º 4.980.286), o mediante inyección directa de ADN desnudo, o mediante el uso de bombardeo de micropartículas (por ejemplo, una pistola génica; Biolistic, Dupont), o recubriendo con lípidos o receptores de superficie celular o agentes de transfección, encapsulación en liposomas, micropartículas o microcápsulas o administrándolos en enlace con un péptido que se sabe que entra en el núcleo, administrando el enlace con un ligando sujeto a endocitosis mediada por receptor (véase, por ejemplo, Wu y Wu (1987) J. Biol. Chem. 262: 4429-4432) que puede usarse, por ejemplo, para dirigir a tipos celulares que expresan específicamente los receptores. En algunos ejemplos, pueden formarse complejos de ácido nucleico-ligando en los que el ligando contiene un péptido viral fusogénico para alterar endosomas, permitiendo que el ácido nucleico evite la degradación lisosómica. En algunos ejemplos, el ácido nucleico puede dirigirse in vivo a captación y expresión específica de célula, dirigiendo un receptor específico (véase, por ejemplo, Publicaciones de PCT WO 92/06180; WO 92/22635; WO 92/203 16; WO 93/14188, y WO 93/20221). Como alternativa, el ácido nucleico puede introducirse de forma intracelular e incorporarse dentro del ADN de la célula hospedadora, para expresión, por recombinación homóloga (Koller y Smithies (1989) Proc. Natl. Acad. Sci. USA 86: 8932-8935; y Zijlstra et al. (1989) Nature 342: 435-438). En algunos ejemplos, se usan vectores virales que contienen secuencias de ácido nucleico que codifican un anticuerpo anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos. Por ejemplo, puede usarse un vector retroviral (véase, por ejemplo, Miller et al. (1993) Meth. Enzymol. 217: 581-599). Los vectores retrovirales contienen los componentes necesarios para el empaquetamiento correcto del genoma viral y su integración en el ADN de la célula hospedadora. Las secuencias de ácido nucleico que codifican el anticuerpo o fragmento de unión a antígeno del mismo para usar en terapia génica se clonan en uno o más vectores, lo que facilita el suministro del gen a un sujeto. Pueden encontrarse más detalles acerca de vectores retrovirales, por ejemplo, en Boesen et al.

(1994) Biotherapy 6: 291-302. Otras referencias que ilustran el uso de vectores retrovirales en terapia génica incluyen, por ejemplo, Clowes et al. (1994) J. Clin. Invest. 93: 644-651; Klein et al. (1994) Blood 83: 1467-1473; Salmons y Gunzberg (1993) Human Gene Therapy 4: 129-141; y Grossman y Wilson (1993) Curr. Opin. in Genetics and Devel. 3: 110-114.

Los adenovirus también son vectores virales que pueden usarse en terapia génica. Los adenovirus son vehículos especialmente atrayentes para suministrar genes a epitelios respiratorios. Los adenovirus infectan de forma natural epitelios respiratorios en los que provocan una enfermedad leve. Otras dianas para sistemas de suministro basados en adenovirus incluyen el hígado, sistema nervioso central, células endoteliales y músculo. Los adenovirus tienen la ventaja de ser capaces de infectar células que no están en división. Kozarsky y Wilson (1993) Current Opinion in Genetics and Development 3: 499-503 presentan una revisión de terapia génica basada en adenovirus. Bout et al. (1994) Human Gene Therapy 5: 3-10 demostró el uso de vectores de adenovirus para transferir genes al epitelio respiratorio de monos rhesus. Pueden encontrarse otros casos del uso de adenovirus en terapia génica, por ejemplo, en Rosenfeld et al. (1991) Science 252: 431-434; Rosenfeld et al.

(1992) Cell 68: 143-155; Mastrangeli et al. (1993) J. Clin. Invest. 91: 225-234; Publicación de PCT WO 94/12649; y Wang et al. (1995) Gene Therapy 2: 775-783. En un ejemplo particular, se usan vectores de adenovirus para suministrar el ácido nucleico que codifica los anticuerpos anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos proporcionados en el presente documento.

También pueden usarse en terapia génica virus adenoasociados (AAV) (Walsh et al. (1993) Proc. Soc. Exp. Biol. Med. 204: 289-300; y Patente de Estados Unidos N.º 5.436.146). En un ejemplo particular, se usan vectores de virus adenoasociados (AAV) para suministrar ácido nucleico que codifica los anticuerpos anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos proporcionados en el presente documento.

Otro enfoque para la terapia génica implica transferir un gen a células en cultivo tisular por métodos tales como electroporación, lipofección, transfección mediada por fosfato cálcico o infección viral. En general, el método de transferencia incluye la transferencia de un marcador seleccionable a las células. Las células se colocan después en selección para aislar las células que han captado y expresan el gen transferido. Las células que expresan el gen se suministran después a un sujeto.

En algunos ejemplos, el ácido nucleico que codifica un anticuerpo anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos proporcionados en el presente documento se introduce en una célula antes de la administración in vivo de la célula recombinante resultante. Dicha introducción puede llevarse a cabo por cualquier método conocido en la técnica, incluyendo, pero sin limitación, transfección, electroporación, microinyección, infección con un vector viral o bacteriófago que contiene las secuencias de ácido nucleico, fusión celular, transferencia génica mediada por cromosoma, transferencia génica mediada por microcélula y fusión de

ES 2 553 440 T3   esferoplastos. Se conocen en este campo numerosas técnicas para la introducción de genes ajenos en células (véase, por ejemplo, Loeffler y Behr (1993) Meth. Enzymol. 217: 599-618; Cohen et al. (1993) Meth. Enzymol. 217: 618-644; Cline (1985) Pharmacol. Ther. 29: 69-92) y pueden usarse para la administración de ácido nucleico que codifica un anticuerpo anti VSR, fragmento de unión a antígeno y/o derivado del mismo proporcionado en el presente documento, siempre que las funciones de desarrollo y fisiológicas necesarias de las células receptoras no se alteren. La técnica proporciona la transferencia estable del ácido nucleico a la célula, de modo que el ácido nucleico sea expresable por la célula y típicamente heredable y expresable por su descendencia celular. Las células recombinantes resultantes pueden suministrarse a un sujeto por diversos métodos conocidos en la técnica. Las células sanguíneas recombinantes (por ejemplo, células madre hematopoyéticas o progenitoras) pueden administrarse por vía intravenosa. La cantidad de células para administración depende de diversos factores, incluyendo, por ejemplo, el efecto profiláctico y/o terapéutico deseado y el estado del paciente y pueden determinarse por un experto en la materia.

Las células en las que puede introducirse un ácido nucleico para fines de terapia génica abarcan cualquier tipo celular deseado, disponible, e incluyen, pero sin limitación, células epiteliales, células endoteliales, queratinocitos, fibroblastos, células musculares, hepatocitos; células sanguíneas tales como linfocitos T, linfocitos B, monocitos, macrófagos, neutrófilos, eosinófilos, megacariocitos, granulocitos; diversas células madre o progenitoras, en particular células madre o progenitoras hematopoyéticas, por ejemplo, como se obtienen de médula ósea, sangre del cordón umbilical, sangre periférica e hígado fetal. En ejemplos particulares, la célula usada para terapia génica es autóloga del sujeto. En algunos ejemplos en los que se usan células recombinantes en terapia génica, se introducen secuencias de ácido nucleico que codifican un anticuerpo anti VSR, fragmentos de unión a antígeno y/o derivados de los mismos proporcionados en el presente documento en las células de modo que sean expresables por las células o su descendencia, y después se administran las células recombinantes in vivo para efecto terapéutico. En un ejemplo particular, se usan células madre o progenitoras. Puede usarse cualquier célula madre y/o progenitora que pueda aislarse y mantenerse in vitro (véase por ejemplo, Publicación de PCT WO 94/08598; Stemple y Anderson (1992) Cell 7 1: 973-985; Rheinwald (1980) Meth. Cell Bio. 21A: 229; y Pittelkow y Scott (1986) Mayo Clinic Proc. 61: 771).

En un ejemplo particular, el ácido nucleico para introducir para fines de terapia génica contiene un promotor inducible unido operativamente con la región codificante, de modo que la expresión del ácido nucleico sea controlable controlando la presencia o ausencia del inductor apropiado de la transcripción.

J. Composiciones farmacéuticas, combinaciones y artículos de fabricación/kits 1. Composiciones farmacéuticas Se proporcionan en el presente documento composiciones farmacéuticas que contienen un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento. La composición farmacéutica puede usarse para aplicaciones terapéuticas, profilácticas y/o de diagnóstico. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento pueden formularse con un vehículo o diluyente farmacéutico aceptable. En general, dichas composiciones farmacéuticas utilizan componentes que no alterarán significativamente las propiedades biológicas del anticuerpo o fragmento de unión a antígeno del mismo, tales como la unión con su epítopo específico (por ejemplo unión con un epítopo de una proteína F de VSR). Cada componente es farmacéutica y fisiológicamente aceptable en el sentido de ser compatible con los otros ingredientes y no perjudicial para el paciente. Las formulaciones pueden presentarse convenientemente en forma de dosificación unitaria y pueden prepararse por métodos bien conocidos en la técnica de la farmacia, incluyendo pero sin limitación, comprimidos, píldoras, polvos, soluciones o suspensiones líquidas (por ejemplo, incluyendo formulaciones inyectables, ingeribles y tópicas (por ejemplo, colirios, geles o pomadas), aerosoles (por ejemplo, pulverizaciones nasales), liposomas, supositorios, solución inyectable e infundible y formas de liberación sostenida. Véase, por ejemplo, Gilman, et al. (eds. 1990) Goodman y Gilman’s: The Pharmacological Bases of Therapeutics, 8ª Ed., Pergamon Press; y Remington’s Pharmaceutical Sciences, 17ª ed. (1990), Mack Publishing Co., Easton, Pa.; Avis, et al. (eds. 1993) Pharmaceutical Dosage Forms: Parenteral Medications, Dekker, NY; Lieberman, et al. (eds.

1990) Pharmaceutical Dosage Forms: Tablets, Dekker, NY; y Lieberman, et al. (eds. 1990) Pharmaceutical Dosage Forms: Disperse Systems, Dekker, NY. Cuando se administre de forma sistemática, la composición terapéutica es estéril, sin pirógenos, generalmente sin materia en partículas, y en una solución parenteralmente aceptable teniendo debidamente en cuenta el pH, la isotonicidad y la estabilidad. Los expertos en la materia conocen estas condiciones. Los métodos para preparar composiciones administrables por vía parenteral se conocen bien o resultarán evidentes para los expertos en la materia y se describen en más detalle, por ejemplo, en “Remington: The Science and Practice of Pharmacy (Formerly Remington’s Pharmaceutical Sciences)”, 19ª ed., Mack Publishing Company, Easton, Pa. (1995). Las composiciones farmacéuticas proporcionadas en el presente documento pueden estar en diversas formas, por ejemplo, en forma sólida, semisólida, líquida, en polvo, acuosa o liofilizada. Se conocen en la técnica ejemplos de vehículos farmacéuticos adecuados e incluyen pero sin limitación agua, agentes tamponantes, soluciones salinas,

ES 2 553 440 T3   soluciones salinas tamponadas con fosfato, diversos tipos de agentes humectantes, soluciones estériles, alcoholes, goma arábiga, aceites vegetales, alcoholes bencílicos, gelatina, glicerina, carbohidratos tales como lactosa, sacarosa, amilosa o almidón, estearato de magnesio, talco, ácido silícico, parafina viscosa, aceite perfumado, monoglicéridos y diglicéridos de ácidos grasos, ésteres de ácidos grasos de pentaeritritol, hidroxi metilcelulosa, polvos, entre otros. Las composiciones farmacéuticas proporcionadas en el presente documento pueden contener otros aditivos incluyendo, por ejemplo, antioxidantes, conservantes, agentes antimicrobianos, agentes analgésicos, aglutinantes, disgregantes, colorantes, diluyentes, excipientes, expansores, emolientes, solubilizantes, estabilizantes, agentes de tonicidad, vehículos, agentes de viscosidad, agentes saporíferos, emulsiones, tales como emulsiones de aceite/agua, agentes emulsionantes y de suspensión, tales como goma arábiga, agar, ácido algínico, alginato sódico, bentonita, carbómero, carragenina, carboximetilcelulosa, celulosa, colesterol, gelatina, hidroxietil celulosa, hidroxipropil celulosa, hidroxipropil metilcelulosa, metilcelulosa, octoxinol 9, alcohol oleílico, povidona, monoestearato de propilenglicol, lauril sulfato sódico, ésteres de sorbitán, alcohol estearílico, tragacanto, goma xantana y derivados de los mismos, disolventes e ingredientes misceláneos tales como celulosa cristalina, celulosa microcristalina, ácido cítrico, dextrina, dextrosa, glucosa líquida, ácido láctico, lactosa, cloruro de magnesio, metafosfato potásico, almidón, entre otros (véase, en general, Alfonso R. Gennaro (2000) Remington: The Science and Practice of Pharmacy, 20ª Edición. Baltimore, MD: Lippincott Williams & Wilkins). Dichos vehículos y/o aditivos pueden formularse por métodos convencionales y pueden administrarse al sujeto a una dosis adecuada. Los agentes estabilizantes tales como lípidos, inhibidores de nucleasa, polímeros y agentes quelantes pueden conservar las composiciones de degradación dentro del cuerpo.

Las composiciones farmacéuticas adecuadas para su uso incluyen composiciones en las que uno más anticuerpos anti VSR están contenidos en una cantidad eficaz para conseguir su fin pretendido. La determinación de una cantidad terapéuticamente eficaz está dentro de la capacidad de los expertos en la materia. Las dosificaciones terapéuticamente eficaces pueden determinarse usando métodos in vitro e in vivo como se describen en el presente documento. En consecuencia, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento, cuando esté en una preparación farmacéutica, puede estar presente en formas de dosis unitaria para administración. Un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede liofilizarse para almacenamiento y reconstituirse en un vehículo adecuado antes de su uso. Se ha mostrado que está técnica es eficaz con inmunoglobulinas convencionales y preparaciones de proteínas y pueden emplearse técnicas de reconstitución y liofilización conocidas en este campo. Un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento puede proporcionarse como una composición de liberación controlada o liberación sostenida. Se conocen en la técnica materiales poliméricos para la formulación de píldoras y cápsulas que pueden conseguir liberación controlada o sostenida de los anticuerpos o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento (véase, por ejemplo, Medical Applications of Controlled Release, Langer y Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen y Ball (eds.), Wiley, Nueva York (1984); Ranger y Peppas (1983) J., Macromol. Sci. Rev. Macromol. Chem. 23: 61; véase también Levy et al. (1985) Science 228: 190; During et al. (1989) Ann. Neurol. 25: 351; Howard et al. (1989) J. Neurosurg. 7 1: 105; Patentes de Estados Unidos N.º 5.679.377, 5.916.597, 5.912.015, 5.989.463, 5.128.326; Publicaciones de PCT N.º WO 99/15154 y WO 99/20253). Los ejemplos de polímeros usados en formulaciones de liberación sostenida incluyen, pero sin limitación, poli(2-hidroxi etil metacrilato), poli(metil metacrilato), poli(ácido acrílico), poli(etilen-co-vinil acetato), poli(ácido metacrílico), poliglicólidos (PLG), polianhídridos, poli(N-vinil pirrolidona), poli(alcohol vinílico), poliacrilamida, poli(etilenglicol), polilactidas (PLA), poli(lactida-co-glicolidas) (PLGA) y poliortoésteres. En general, el polímero usado en una formulación de liberación sostenida es inerte, sin impurezas lixiviables, estable en almacenamiento, estéril y biodegradable. Puede usarse cualquier técnica conocida en este campo para la producción de formulación de liberación sostenida para producir una formulación de liberación sostenida que contiene uno o más anticuerpos anti VSR o fragmentos de unión a antígeno proporcionados en el presente documento. En algunos ejemplos, la composición farmacéutica contiene un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento y uno o más anticuerpos adicionales. En algunos ejemplos, el o los anticuerpos adicionales incluyen, pero sin limitación, palivizumab (SYNAGIS®), y derivados del mismo, tales como, pero sin limitación, motavizumab (NUMAX®), AFFF, P 12f2, P 12f4, P11d4, Ale9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, y A4B4-F52S (véase Patentes de Estados Unidos N.º 5.824.307 y 6.818.216), rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23 (véase, por ejemplo, Patentes de Estados Unidos N.º 5.824.307, 6.685.942 y 6.818.216), un anticuerpo anti VSR humano, tal como, pero sin limitación, rsv6, rsv11, rsv13, rsv19 (es decir Fab 19), rsv21, rsv22, rsv23, RF-1, RF-2 (véase, por ejemplo, Patentes de Estados Unidos N.º 6.685.942 y 5.811.524), un anticuerpo humanizado derivado de un anticuerpo monoclonal de ratón anti VSR tal como, pero sin limitación, MAb 1153, 1142, 1200, 1214, 1237, 1129, 1121, 1107, 1112, 1269, 1269, 1243 (Beeler et al. (1989) J. Virology 63(7): 2841-2950), MAb151 (Mufson et al. (1987) J. Clin. Microbiol. 25: 1635-1539), MAb 43-1 y 13-1 (Fernie et al. (1982) Proc. Soc. Exp. Biol. Med. 171: 266-271), MAb 1436C, 1302A, 1308F y 1331H (Anderson et al. (1984) J. Clin. Microbiol. 19: 934-936), o fragmento de unión a antígeno de los mismos. Los anticuerpos ejemplares adicionales o

ES 2 553 440 T3   fragmentos de unión a antígeno de los mismos que pueden usarse en una composición farmacéutica que contiene un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento incluyen, pero sin limitación, anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos descritos en, por ejemplo, las Patentes de Estados Unidos N.º 6.413.771, 5.840.298, 5.811.524, 6.656.467, 6.537.809, 7.364.742, 7.070.786, 5.955.364, 7.488.477, 6.818.216, 5.824.307, 7.364.737, 6.685.942 y 5.762.905 y Publicaciones de Patente de Estados Unidos N.º 2007-0082002, 2005-0175986, 2004-0234528, 2006-0198840, 2009-0110684, 2006- 0159695, 2006-0013824, 2005-0288491, 2005-0019758, 2008-0226630, 2009-0137003 y 2009-0092609. 2. Artículos de fabricación/kits Las composiciones farmacéuticas de anticuerpos anti VSR o ácidos nucleicos que codifican anticuerpos anti VSR, o un derivado o una parte biológicamente activa de los mismos pueden envasarse como artículos de fabricación que contienen material de envasado, una composición farmacéutica que es eficaz para profilaxis (es decir vacunación, inmunización pasiva) y/o tratamiento de la enfermedad o el trastorno mediado por VSR, y una etiqueta que indica que el anticuerpo o molécula de ácido nucleico es para usar para vacunación y/o tratamiento de la enfermedad o el trastorno. Las composiciones farmacéuticas pueden envasarse en formas de dosificación unitaria que contienen una cantidad de la composición farmacéutica para una única dosis o múltiples dosis. Las composiciones envasadas pueden contener un polvo liofilizado de las composiciones farmacéuticas que contiene los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados, que pueden reconstituirse (por ejemplo con agua o solución salina) antes de su administración. Los artículos de fabricación proporcionados en el presente documento contienen materiales de envasado. Los materiales de envasado para su uso en el envasado de productos farmacéuticos se conocen bien por los expertos en la materia. Los ejemplos de materiales de envasado farmacéutico incluyen, pero sin limitación, envases de blíster, frascos, tubos, inhaladores, inhaladores (por ejemplo inhaladores de dosis medida presurizados (MDI), inhaladores de polvo seco (DPI), nebulizadores (por ejemplo, nebulizadores a chorro o ultrasónicos) y otros sistemas de líquido de inspiración única), bombas, bolsas, viales, recipientes, jeringas, frascos y cualquier otro material de envasado adecuado para una formulación y modo pretendido de administración y tratamiento seleccionados. La composición farmacéutica también puede incorporarse en, aplicarse a o recubrir una barrera u otro dispositivo protector que se usa para protección de la infección. Los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos, moléculas de ácido nucleico que codifican los anticuerpos de los mismos, composiciones farmacéuticas o combinaciones proporcionadas en el presente documento también pueden proporcionarse como kits. Los kits pueden incluir opcionalmente uno o más componentes tales como instrucciones para su uso, dispositivos y reactivos adicionales (por ejemplo, agua esterilizada o soluciones salinas para dilución de las composiciones y/o reconstitución de la proteína liofilizada) y componentes, tales como tubos, recipientes y jeringas para la práctica de los métodos. Los kits ejemplares pueden incluir los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento, y pueden incluir opcionalmente instrucciones para su uso, un dispositivo para administrar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos a un sujeto, un dispositivo para detectar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos en un sujeto, un dispositivo para detectar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos en muestras obtenidas de un sujeto, y un dispositivo para administrar un agente terapéutico adicional a un sujeto.

El kit puede, opcionalmente, incluir instrucciones. Las instrucciones típicamente incluyen una expresión tangible que describe los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos y, opcionalmente, otros componentes incluidos en el kit, y métodos para administración, incluyendo métodos para determinar el estado apropiado del sujeto, la cantidad de dosificación apropiada, los regímenes de dosificación y el método de administración apropiado para administrar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. Las instrucciones también pueden incluir orientación para controlar el sujeto durante la duración del tiempo de tratamiento. Los kits también pueden incluir una composición farmacéutica descrita en el presente documento y un artículo para diagnóstico. Por ejemplo, dichos kits pueden incluir un artículo para medir la concentración, cantidad o actividad del anticuerpo anti VSR seleccionado o fragmento de unión a antígeno del mismo en un sujeto. En algunos ejemplos, el anticuerpo anti VSR o fragmento de unión a antígeno del mismo se proporciona en un kit de diagnóstico para la detección de VSR en una muestra biológica aislada (por ejemplo, una muestra de fluido, tal como sangre, esputo, lavado, muestra de intubación pulmonar, saliva, orina o linfa obtenida de un sujeto). En algunos ejemplos, el kit de diagnóstico contiene un panel de uno o más anticuerpos anti VSR o fragmentos de unión a antígenos de los mismos y/o uno o más anticuerpos de control (es decir anticuerpos que no se unen con VSR), en los que uno o más anticuerpos en el panel son un anticuerpo anti VSR o fragmento de unión a antígeno proporcionados en el presente documento.

Los kits proporcionados en el presente documento también pueden incluir un dispositivo para administrar los anticuerpos anti VSR o fragmentos de unión a antígenos de los mismos a un sujeto. Puede incluirse cualquiera de

ES 2 553 440 T3   una diversidad de dispositivos conocidos en la técnica para administrar mediaciones a un sujeto en los kits proporcionados en el presente documento. Los dispositivos ejemplares incluyen, pero sin limitación, un inhalador (por ejemplo, inhalador de dosis medida presurizado (MDI), inhalador de polvo seco (DPI), nebulizador (por ejemplo, nebulizadores a chorro o ultrasónico) y otro sistema líquido de inspiración única), una aguja hipodérmica, una aguja intravenosa, un catéter y un dosificador de líquido tal como un cuentagotas. Típicamente el dispositivo para administrar los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos del kit será compatible con el método deseado de administración de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos. Por ejemplo, un anticuerpo anti VSR o fragmento de unión a antígeno del mismo para suministrar por administración pulmonar puede incluirse en un kit con o está contenido en un inhalador o un nebulizador.

3. Combinaciones Se proporcionan combinaciones de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados en el presente documento y un segundo agente, tal como un segundo anticuerpo anti VSR o fragmento de unión a antígeno del mismo u otro agente terapéutico o de diagnóstico. Una combinación puede incluir cualquier anticuerpo anti VSR o fragmento de unión a antígeno del mismo o reactivo para efectuar terapia del mismo de acuerdo con los métodos proporcionados en el presente documento. Por ejemplo, una combinación puede incluir cualquier anticuerpo anti VSR o fragmento de unión a antígeno del mismo y un agente antiviral. Las combinaciones también pueden incluir un anticuerpo anti VSR o fragmento de unión a antígeno del mismo proporcionado en el presente documento con uno o más anticuerpos terapéuticos adicionales. Las combinaciones de los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos proporcionados también pueden contener composiciones farmacéuticas que contienen los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos o células hospedadoras que contienen ácidos nucleicos que codifican los anticuerpos anti VSR o fragmentos de unión a antígeno de los mismos como se describe en el presente documento. Las combinaciones proporcionadas en el presente documento pueden formularse como una única composición o en composiciones separadas. K. Ejemplos Ejemplo 1 Expresión de la proteína F de VSR En este ejemplo, la proteína de fusión de VSR (proteína F) del Virus Sincitial Respiratorio cepa A2 se expresó y purificó por captura en placas de ELISA usando un anticuerpo monoclonal anti VSR clon 2F7, que reconoce las subunidades tanto F0 como F1 de la glucoproteína de fusión. En el primer ejemplo, se clonó la proteína F de VSR recombinante que contenía solamente el dominio extracelular (SEC ID Nº: 25) y se expresó en células 293F. En el segundo ejemplo, se expresó la proteína F de VSR nativa mediante infección de células HEp-2 con cepa A2 de VSR (SEC ID Nº: 1629).

A. Proteína F de VSR recombinante En este ejemplo, se clonó y se expresó el gen que codifica la proteína F de VSR de la cepa de VSR A2. El gen F de VSR A2 (SEC ID Nº: 21), que contiene solamente el dominio extracelular (la proteína F de VSR A2 de longitud completa se expone en SEC ID Nº: 1630) se sintetizó de acuerdo con protocolos de síntesis de ADN convencionales por GeneArt (Burlingame, CA). El gen F de VSR A2 se modificó técnicamente para contener una secuencia de Kozak (nucleótidos 7-16 de SEC ID Nº: 21), una secuencia c-myc (nucleótidos 1600-1629 de SEC ID Nº: 21) y un marcador His 6X (nucleótidos 1645-1662 de SEC ID Nº: 21). Adicionalmente, se introdujeron técnicamente sitios de restricción Nhel (SEC ID Nº: 22) y HindIII (SEC ID Nº: 23) en los extremos 5’ y 3’, respectivamente, para permitir la clonación en un vector de expresión. El ADN se digirió usando técnicas de biología molecular convencionales y se ligó en el vector de expresión de mamíferos digerido de forma similar pcDNA™3.1/myc-His(-) C (SEC ID Nº: 24, Invitrogen). El vector que contenía el gen F de VSR A2 se transformó en células XL1-Blue electrocompetentes (Strategene). Se seleccionaron y cultivaron colonias individuales, y se purificó ADN plasmídico. La presencia del inserto del gen F de VSR A2 en el vector aislado se verificó por secuenciación de ADN, y se usó un clon que contenía el inserto para producir preparaciones a gran escala de ADN (kit Megaprep, Qiagen).

La proteína F de VSR A2 se expresó en células de mamífero usando el Sistema de Expresión FreeStyle™ 293 (Invitrogen) de acuerdo con las instrucciones del fabricante. Brevemente, se cotransfectaron 3 x 107 células con 30 µg de ADN del plásmido VSR A2 F/pcDNA3.1/myc-His(-) C y 5 µg de pAdVAntage (Promega) y se incubó a 37 ºC durante 72 horas. Las células se sedimentaron por centrifugación y se añadieron 3 ml de tampón de lisis frío (NaCl 300 mM, NaH2PO4 50 mM, Triton X-100 1 %, cóctel de Inhibidor de Proteasa Complete™ (Cat. n.º sc-29131, Santa Cruz), pH 8) por cada 3 x 107 células 293-F transfectadas con F de VSR. La mezcla se agitó a 4 ºC durante 30 minutos seguido de centrifugación a 14.000 rpm durante 30 minutos a 4 ºC. El sobrenadante clarificado se transfirió a un tubo nuevo y se congeló a -80 ºC hasta que estuvo listo para su uso. Antes de la captura de una placa de ELISA, el sobrenadante se descongeló, se centrifugó brevemente y se diluyó 1:1 v/v con PBS que contenía leche en polvo desnatada al 0,8 % (concentración final de leche en polvo desnatada al 0,4 %).

ES 2 553 440 T3   B. Proteína F de VSR nativa En este ejemplo, se purificó proteína F de VSR nativa a partir de la cepa de VSR A2 (aminoácidos expuestos en SEC ID Nº: 1629) a partir de células HEp-2 infectadas por VSR de la siguiente manera. Brevemente, se siembran células HEp-2 en una apiladora de cultivo celular de diez capas (Coming 3270) usando EMEM completo (ATCC 30- 2003; que contiene FBS 10 %, L-glutamina 1 % y pen-estrep 1 %) y se incubó a 37 ºC y CO2 5 %. Una vez que las células alcanzaron el 80 % de confluencia, la monocapa de HEp-2 se infectó con el virus VSR A2 (ATCC VR-1540) a una multiplicidad de infección (MOI) de 0,01-0,1. Las células infectadas se cultivaron durante 3-5 días hasta que se observó un sincitio celular evidente. Las células infectadas se lavaron una vez con PBS y las células se recogieron añadiendo 500 ml de PBS con EDTA 5 mM a la apiladora de cultivo e incubando a 37 ºC durante 1 hora. Las células se recogieron en tubos cónicos de 50 ml (5 x 107 células por tubo) y se sedimentaron por centrifugación. Los sedimentos celulares se lavaron 2x con PBS y se centrifugaron a 1200 rpm durante 5 minutos. Los sedimentos celulares se almacenaron a -20 ºC hasta su procesamiento adicional. Las células congeladas se descongelaron y se añadieron 3 ml de tampón de lisis frío (NaCl 300 mM, NaH2PO4 50 mM, Triton X-100 1 %, cóctel de Inhibidor de Proteasa Complete™ (Cat. n.º sc-29131, Santa Cruz), pH 8) a cada sedimento celular. Las células se agitaron a 4 ºC durante 30 minutos seguido de sonicación (3 pulsos durante 10 segundos cada uno al 10 % de potencia) y finalmente se centrifugaron a 14.000 rpm durante 30 minutos a 4 ºC. El sobrenadante clarificado se transfirió a un tubo nuevo y se congeló a -80 ºC hasta que estuvo listo para su uso. Antes de la captura en una placa de ELISA, el sobrenadante se descongeló, se centrifugó brevemente y se diluyó 1:2000.

C. Captura con mAb anti VSR Se recubrieron placas de ELISA usando 50 µl/pocillo de una dilución 1:400 de mAb anti VSR (Cat. n.º NB110-37246, clon 2F7, Novus Biologicals) en PBS. El anticuerpo no unido se retiró y las placas se usaron inmediatamente para ELISA (véase Ejemplos 2 y 4). Como alternativa, las placas se congelaron durante hasta 2 semanas a -20 ºC. Inmediatamente antes de su uso, las placas se bloquearon con leche en polvo desnatada al 4 % en PBS 1x durante 2 horas a 37 ºC. Las placas se lavaron dos veces con PBS que contenía Tween-20 0,05 % (tampón de lavado) antes de la adición del lisado. Se efectuó captura de la proteína F de VSR (bien recombinante o bien nativa) añadiendo 50 µl de uno de los lisados preparados anteriormente a cada pocillo de la placa de ELISA de mAb anti VSR e incubando a 37 ºC durante 2 horas. Ejemplo 2 Aislamiento de anticuerpos Fab anti VSR a partir de linfocitos B transformados con VEB En este ejemplo, se aislaron anticuerpos anti VSR a partir de linfocitos B de memoria donantes transformados con virus de Epstein Barr estimulados, que se exploraron con respecto a unión con proteína F de VSR seguido de generación de anticuerpos in vitro.

A. Purificación de células mononucleares de sangre periférica de donante Se obtuvieron células mononucleares de sangre periférica (PMBC) de un trabajador de guardería que puede haberse expuesto al VSR mediante contacto con niños. Se aislaron PBMC por centrifugación de densidad sobre Ficoll Hypaque, de acuerdo con las instrucciones del fabricante.

1. Aislamiento de CD22+ y activación de linfocitos B CD22+ Se aislaron 3,2 x 106 linfocitos B CD22+ a partir de PBMC donantes usando perlas magnéticas de CD22 (Miltenyi, cat. n.º 130-046-401) y columnas LS (Miltenyi, cat. n.º 130-042-401). Se cultivaron linfocitos B CD22+ aislados a 1 x 106 células por pocillo en una placa de 48 pocillos en RPMI (Hyclone, cat. n.º SH30096.01) que contenía suero bovino fetal de IgG bajo inactivado por calor al 10 % (FBS, Invitrogen, cat. n.º 16250-078), antibióticos al 1 % (Hyclone, cat. n.º SV30010), piruvato sódico 1 % (Hyclone, cat. n.º SH30239.01) y L-glutamina 1 % (Hyclone, cat. n.º SH30034.01). Los linfocitos B aislados se activaron con una selección de agentes estimulantes de linfocitos B policlonales para inducir la proliferación y la producción de anticuerpos.

2. Inmortalización mediada por VEB de linfocitos B IgG+ Se lavaron 4,5 x 106 linfocitos B CD22+ activados y se incubaron con 40 µl de anticuerpos anti IgM conjugados con FITC (BD Biosciences, cat. n.º 555782), 40 µl de anti IgD conjugado con FITC (BD Biosciences, cat. n.º 555778) y 4 µl de anti IgA conjugado con FITC (Jacksons Immunoresearch, cat. 309-096-043) durante 15 minutos a 4 ºC. Las células se lavaron 1X en PBS (que contenía BSA al 0,5 % y EDTA 2 mM) y se resuspendieron en 90 µl del mismo tampón. Los linfocitos B IgG+ se enriquecieron por selección negativa de células que expresaban IgM, IgD, IgA usando 10 µl de perlas magnéticas anti FITC (Miltenyi, cat. n.º 130-048-701) y columnas LS (Miltenyi, cat. n.º 130- 042-401) de acuerdo con las instrucciones del fabricante.

ES 2 553 440 T3   Se realizó inmortalización en masa de linfocitos B incubando 1,87 x 106 linfocitos B enriquecidos IgG+, CD22+ con 0,5 ml de sobrenadante de VEB (50 % v/v en RMPI-1640 con FCS 10 %, ATCC Cat. n.º VR-1492 de linfocitos B95- 8) durante 16 horas. Después de la infección las células se lavaron y se cultivaron (106/ml en cada uno de dos pocillos en RPMI (Hyclone, cat. n.º SH30096.01) que contenían suero bovino fetal bajo en IgG inactivado por calor al 10 % (FBS, Invitrogen, cat. n.º 16250-078), antibióticos al 1 % (Hyclone, cat. n.º SV30010), piruvato sódico 1 % (Hyclone, cat. n.º SH30239.01) y L-glutamina 1 % (Hyclone, cat. n.º SH30034.01), rhIL-2 200 UI/ml (R&D Systems Cat. n.º 202-IL-50) con 0,5 x 106 células de alimentación irradiadas por cada pocillo de una placa de 24 pocillos durante 9 días adicionales.

3. Clonación de linfocitos B a. Preparación de células de alimentación empobrecidas en linfocitos B irradiadas para clonación de linfocitos B Se usaron células de alimentación empobrecidas en linfocitos B irradiadas para ayudar a mantener el crecimiento de los linfocitos B transformados con VEB. Se obtuvieron PBMC de una mezcla de 3 donantes sanos por separación de Ficoll, se irradiaron con 3250 rad (en el Centro de Cáncer de Moore de la UCSD), y se empobrecieron en linfocitos B usando perlas magnéticas anti CD19 (Miltenyi Biotec, Cat. n.º 130-050-301) y columnas LD (Miltenyi Biotec, cat. n.º 130-091-509). Brevemente, las PMBC congeladas e irradiadas, obtenidas de separación por Ficoll se descongelaron, se lavaron dos veces y se contaron. Las células se centrifugaron después a 300 g durante 10 minutos, y se aspiró el sobrenadante. El sedimento celular se resuspendió en 80 µl de tampón MACS (PBS con BSA 0,5 % y EDTA 2 mM) por cada 107 células y se añadieron 20 µl de Microperlas CD19 (por cada 107 células). Después de una mezcla exhaustiva, las células se incubaron a 4 ºC durante 15 minutos. Las células se lavaron después añadiendo 1-2 ml de tampón (por cada 107 células) seguido de centrifugación a 300 g durante 10 minutos y se aspiró el sobrenadante. Se resuspendieron después hasta 108 células en 500 µl de tampón. La separación magnética se efectuó colocando una columna LD (compuesta de esferas ferromagnéticas cubiertas con un recubrimiento de plástico para permitir la separación rápida y suave de las células) en el campo magnético de un separador de MACS. La columna LD se lavó con 2 ml de tampón y la suspensión celular se aplicó a la parte superior de la columna. Se recogieron células distintas de linfocitos B a medida que pasaban a través de la columna después de la adición de 2 x 1 ml de tampón.

b. Clonación de linfocitos B Se cocultivaron aproximadamente 20 linfocitos B transformados con VEB con agentes estimulantes de linfocitos B policlonales y 50.000 células de alimentación empobrecidas en linfocitos B irradiadas en una placa de 96 pocillos y se cultivaron durante 13 días. Se generó un total de 120 placas de 96 pocillos. 4. Exploración del sobrenadante de linfocitos B con respecto a unión con proteína F de VSR Se transfirieron sobrenadantes de cada pocillo a una nueva placa de 96 pocillos y las células se lavaron 1X en PBS y se congelaron a -80 ºC en 100 µl de tampón RLT (Qiagen, cat. n.º 79216) que contenía 2-mercaptoetanol 10 µl/ml. El sobrenadante se usó en un ELISA para determinar qué pocillos producían anticuerpos que eran capaces de unirse con la proteína F de VSR. Brevemente, el ELISA se realizó de la siguiente manera: (1) se prepararon placas de ELISA de Proteína F de VSR como se ha descrito en el Ejemplo 1 usando placas de media área de 96 pocillos con las siguientes modificaciones: se usó mAb anti VSR (clon 2F7, líquido ascítico de ratón, Cat. n.º ab43812, Abcam) como el anticuerpo de captura y se incubó la proteína F de VSR con el anticuerpo de captura durante una noche a 4 ºC. (2) Se añadieron 10 µl de sobrenadante de linfocitos B de cada uno de 2 pocillos (un total de 20 µl recogidos) a una placa de ELISA de 96 medios pocillos y se incubó durante 2 horas a 37 ºC. Se usó plasma de un grupo de donantes del Banco de Sangre (recogido y congelado después de separación por Ficoll Hypaque, diluido 1:1000) como un control positivo. (3) Se lavaron placas 4X como anteriormente y se añadieron 50 µl de anticuerpo conjugado con HRP anti IgG Fc humano de cabra (diluido 1:1000 en PBS con Tween20 0,05 %) a cada pocillo y la placa se incubó a 37 ºC durante 1 hora. (4) Las placas se lavaron 6X como anteriormente y se revelaron usando 50 µl de sustrato de solución de TMB:peróxido 1:1 v/v (Pierce, Cat n.º 34021) y se permitió que se revelaran durante 7 minutos. La reacción se detuvo inmediatamente mediante la adición de 50 µl de H2SO4 2N y se midió la absorbancia a 450 nm usando un lector de placas de ELISA. La unión positiva se indicó por una DO450 mayor de 0,5 (0,5-0,9 es unión moderada > 1 es unión fuerte) y una respuesta que estaba 3 veces por encima del fondo. Para determinar cuál de los dos pocillos agrupados contenían anticuerpos anti VSR, se volvieron a ensayar 20 µl de sobrenadante de linfocitos B (diluido 1:2 v/v con PBS/Tween 20 0,05 %) de cada pocillo individualmente contra proteína F de VSR capturada.

Se exploró un total de 18 placas (o 1080 pocillos) con respecto a unión con el lisado de F de VSR (como se ha purificado en el Ejemplo 1). Se identificó que seis pocillos tenían unión con el lisado de F de VSR. Se reconfirmaron cinco de los seis pocillos mediante un ELISA adicional y se usaron para generar anticuerpos anti VSR por PCR (descrito posteriormente).

ES 2 553 440 T3   B. Generación de anticuerpos anti VSR por PCR Después de la exploración inicial de linfocitos B transformados con VEB para la producción de anticuerpos que se unen con proteína F de VSR, los genes que codificaban anticuerpos individuales se amplificaron a partir de ARN de linfocitos B por PCR. Se seleccionaron para clonación cinco pocillos identificados como aciertos en la Sección A. 1. Extracción de ARN Se extrajo ARN de los linfocitos B (para cada pocillo correspondiente a uno con unión positiva con la proteína F de VSR) usando un Micro Kit RNeasy (Qiagen, Cat. n.º 1402-2408) de acuerdo con las instrucciones del fabricante con las siguientes modificaciones: 1) se congelaron linfocitos B en 100 µl de tampón RLT con β-mercaptoetanol (10 µl por ml de tampón); 2) las células no se homogeneizaron; 3) las células se lacaron con 70 % de etanol (en agua sin RNasa) y 4) se llevó a cabo tratamiento con DNasa “en columna” de acuerdo con el protocolo complementario del fabricante. El ARN se eluyó en un volumen final de 26 µl.

2. Síntesis de ADNc de primera cadena Después de la extracción de ARN, se generó ADNc de acuerdo con el protocolo de Síntesis de Primera Cadena de Superscript III (Invitrogen; Cat n.º 19090-051). Brevemente, se combinaron 8 µl de ARN (aislado como se ha descrito anteriormente), 1 µl de cebador de oligo dT y 1 µl de dNTP en un tubo de 0,2 ml estéril y se incubó a 65 ºC durante 5 minutos seguido de incubación en hielo durante 1 minuto. Posteriormente, se añadieron al tubo 2 µl de DTT 0,1 mM, 4 µl de MgCl2 25 mM, 2 µl de tampón RT, 1 µl de RNaseOut, y 1 µl de SuperScript III RT, y la mezcla de reacción se incubó a 50 ºC durante 50 minutos seguido de incubación a 80 ºC durante 15 minutos. El ADNc se usó inmediatamente o se congeló a -80 ºC para su uso al largo plazo.

3. Aislamiento de genes de cadena ligera kappa y lambda y de cadena pesada de IgG mediante amplificación por PCR Se generaron cadenas pesadas y cadenas ligeras kappa y lambda de IgG mediante amplificación por PCR a partir de la reacción de síntesis de ADNc de primera cadena de linfocitos B (véase anteriormente). Los genes de cadena ligera kappa se amplificaron por una PCR de una única etapa, mientras que los genes de cadena pesada y genes de cadena ligera lambda se amplificaron usando un enfoque de PCR anidada, de dos etapas. Los genes de cadena pesada y ligera amplificados se unieron posteriormente en un único casete usando “PCR solapante”. Etapa 1. Amplificación de genes de cadena pesada y genes de cadena ligera lambda de IgG

En la Etapa I, se usaron 2 µl de ADNc generado por Síntesis de Primera Cadena (véase anteriormente) como un molde para amplificar individualmente cadenas pesadas de IgG por PCR. En esta etapa, se utilizaron grupos de cebadores de la Etapa I (véase Tabla 3A posterior). Las condiciones de reacción fueron las siguientes: PCR de Etapa I: Cadena pesada: Reactivo µl H2O 16 tampón 10x 2,5 tampón potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 ADNc 2,0 líder del grupo VH (9 µM cada uno) 0,5 grupo inverso VH (20 µM) 0,25 Pfx50 0,5 En la Etapa I, se usaron 2,5 µl de ADNc de Cadena Ligera Lambda, generado por Síntesis de Primera Cadena (véase anteriormente) como un molde para amplificar individualmente cadenas pesadas de IgG por PCR. En esta etapa, se utilizó un grupo de cebadores de la Etapa I para los cebadores directos y se usó pCALCL(T)-R como el cebador inverso (véase Tabla 3B posterior). Las condiciones de reacción fueron las siguientes: PCR de Etapa I: Cadena ligera lambda Reactivo µl H2O 16 tampón 10x 2,5 tampón potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 ADNc 2,0 grupo de Vλ (14,2 µM cada uno) 0,5

ES 2 553 440 T3   pCALCL(T)-R (20 µM) 0,25 Pfx50 0,5 Para la reacción de PCR, se implementó un enfoque touchdown para añadir especificidad a la amplificación de reacción. En cada etapa touchdown, la temperatura de hibridación se reduce en 1 ºC en cada ciclo. Las condiciones de termociclador de PCR fueron las siguientes.

1) 94 ºC durante 2 minutos 2) 10 ciclos de: - 94 ºC durante 15 segundos; 62 ºC durante 20 segundos (Touchdown); 68 ºC durante 1 minuto 3) 25 ciclos de: 94 ºC durante 15 segundos; 52 ºC durante 20 segundos; 68 ºC durante 1 minuto 4) 68 ºC durante 3 minutos 5) mantenimiento a 4 ºC Las mezclas de reacción resultantes se usaron como ADN molde para la Etapa II (véase a continuación) sin ninguna purificación adicional.

Tabla 3A. Cebadores de Etapa I para amplificar genes de cadena pesada de IgG Grupo de cebadores directos VH: SEC ID Nº VH1a GGATCCTCTTCTTGGTGGCAGCAG 26 VH1b GCATCCTTTTCTTGGTGGCAGCAC 27 VH1c GGGTCTTCTGCTTGCTGGCTGTAG 28 VH1d GGATCCTCTTCTTGGTGGGAGCAG 29 VH2a CTGACCATCCCTTCATGGCTCTTG VH2b CTGACCACCCCTTCCTGGGTCTTG 31 VH3a GCTATTTTARAAGGTGTCCAGTGT 32 VH3b GCTCTTTTAAGAGGTGTCCAGTGT 33 VH3c GCTATTTAAAAAGGTGTCCAATGT 34 VH4a CTGGTGGCAGCTCCCAGATGGGTC VH5a CTCCTGGCTGTTCTCCAAGGAGTC 36 Grupo de cebadores inversos VH: SEC ID Nº VH-g 1- INV ACAAGATTTGGGCTCAACTTTCTTGTCC 37 VH-g 2- INV TTTGCGCTCAACTGTCTTGTCCACCTTG 38 VH-g 3- INV TTTGAGCTCAACTCTCTTGTCCACCTTG 39 VH-g 4- INV ATATTTGGACTCAACTCTCTTGTCCACC Tabla 3B. Cebadores de Etapa I para amplificar genes de cadena ligera lambda Grupo de cebadores directos VH: SEC ID Nº 5’ L Vλ 1 GGTCCTGGGCCCAGTCTGTGCTG 1631 5’ L Vλ 2 GGTCCTGGGCCCAGTCTGCCCTG 1632 5’ L Vλ 3 GCTCTGTGACCTCCTATGAGCTG 1633 5’ L Vλ 4/5 GGTCTCTCTCSCAGCYTGTGCTG 1634 5’ L Vλ 6 GTTCTTGGGCCAATTTTATGCTG 1635 5’ L Vλ 7 GGTCCAATTCYCAGGCTGTGGTG 1636 5’ L Vλ 8 GAGTGGATTCTCAGACTGTGGTG 1637 Cebador inverso: SEC ID Nº pCALCL(T)-R 80 Etapa II. Amplificación de genes de cadena pesada y cadena ligera lambda de IgG En la Etapa II, las mezclas de reacción de cadena pesada y cadena ligera lambda de la Etapa I se usaron como moldes para reacciones de PCR de segundo ciclo con grupos de cebadores directos e inversos que amplifican de la región marco conservada 1 de cada cadena al final de la primera región constante (CH1 para cadena pesada, CL para cadena ligera). Los cebadores directos de cadena pesada (véase Tabla 4) se diseñaron para introducir un sitio de restricción SfiI (SEC ID Nº: 41). Las condiciones de reacción fueron las siguientes:

ES 2 553 440 T3   PCR II: Cadena pesada Reactivo µl H2O 12,75 tampón 10x 2,5 potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 Reacción de Etapa I 2,5 grupo de pCAL24VH-F (2 µM cada uno) 2,5 grupo de CH1-R-Sfi (20 µM) 1 Pfx50 0,5 Los cebadores directos de cadena ligera lambda (véase Tabla 6) se diseñaron para introducir un sitio de restricción SfiI (SEC ID Nº: 41). Las condiciones de reacción fueron las siguientes: PCR II: Cadena ligera lambda Reactivo µl H2O 15,5 tampón 10x 2,5 potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 Reacción de Etapa I 2,5 grupo de cebadores Vλ (2 µM) 0,5 pCALCL(T)-R (20 µM) 0,25 Pfx50 0,50 Las condiciones de termociclador de PCR para reacciones de Etapa II fueron las siguientes: 1) 94 °C durante 2 minutos 2) 30 ciclos de: 94 ºC durante 15 segundos; 52 ºC durante 20 segundos; 68 ºC durante 1 minuto 3) 68 ºC durante 3 minutos 4) mantenimiento a 4 ºC Para amplificación de genes de cadena ligera, se usaron 2 µl de ADNc generado por Síntesis de primera Cadena (véase anteriormente) como un molde para amplificar individualmente cadenas ligeras kappa y lambda de IgG por PCR. Los cebadores directos de cadena ligera kappa (véase Tabla 5) se usaron como grupos de cebadores y se diseñaron para introducir un sitio de restricción Sfil (SEC ID Nº: 41). Las condiciones de reacción fueron las siguientes: PCR II: Cadena ligera kappa Reactivo µl H2O 16 tampón 10x 2,5 potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 ADNc de primera cadena 2 grupo de cebadores Vκ (9,1 µM) 0,5 pCALCK(G)L (20 µM) 0,25 Pfx50 0,50 Las condiciones de termociclador de PCR para reacciones de Etapa II fueron las siguientes: 1) 94 ºC durante 2 minutos 2) 35 ciclos de: 94 ºC durante 15 segundos; 54 ºC durante 20 segundos; 68 ºC durante 1 minuto 3) 68 ºC durante 3 minutos 4) mantenimiento a 4 ºC

ES 2 553 440 T3   Después de la amplificación, los productos de reacción de PCR se separaron en un gel de agarosa al 1 % y la banda correspondiente a la cadena pesada (675 pb) y la cadena ligera (650 pb) se purificaron por extracción en gel (Kit de Extracción en Gel Qiagen; Cat. n.º 28706). Los productos de PCR se eluyeron en 30 µl.

Tabla 4. Cebadores para amplificar genes de cadena pesada IgG Grupo de cebadores directos SEC ID Nº pCa130 VH1a 42 pCa130 VH1b 43 pCa130 VH1c 44 pCa130 VH1d pCa130 VH2a 46 pCa130 VH3a 47 pCa130 VH4a 48 pCa130 VH4b 49 pCa130 VH5a pCa130 VH6 51 pCa130 VH6 52 Grupo de cebadores inversos SEC ID Nº VHII-g1-Inv 53 VHII-g2-Inv 54 VHII-g3-Inv VHII-g4-Inv 56 Tabla 5. Cebadores para amplificar genes de cadena ligera kappa Grupo de cebadores directos SEC ID Nº VK1a AAggcccagccggccatggccgccggtGACATCCAGATGACCCAG 57 VK1b AAggcccagccggccatggccgccggtGACATCCAGTTGACCCAG 58 VK1c AAggcccagccggccatggccgccggtGCCATCCGGTTGACCCAG 59 VK2a AAggcccagccggccatggccgccggtGATATTGTGATGACYCAG VK3a AAggcccagccggccatggccgccggtGAAATTGTGTTGACGCAG 61 VK3b AAggcccagccggccatggccgccggtGAAATTGTGTTGACACAG 62 VK3c AAggcccagccggccatggccgccggtGAAATAGTGATGACGCAG 63 VK4a AAggcccagccggccatggccgccggtGACATCGTGATGACCCAG 64 VK5a AAggcccagccggccatggccgccggtGAAACGACACTCACGCAG VK6a AAggcccagccggccatggccgccggtGAAATTGTGCTGACTCAG 66 VK6b AAggcccagccggccatggccgccggtGATGTTGTGATGACACAG 67 Cebador inverso SEC ID Nº pCALCK(G)L 68 Tabla 6. Cebadores para amplificar genes de cadena ligera lambda Grupo de cebadores directos SEC ID Nº VL1-F 69 VL2-F VL3A-F 71 VL3B-F 72 VL3C-F 73

ES 2 553 440 T3   VL4A-F 74 VL4B-F 75 VL5/9-F 76 VL6-F 77 VL7/8-F 78 VL10-F 79 Cebador inverso SEC ID Nº pCALCL(T)-R 80 Etapa III. PCR solapante En la Etapa III, los segmentos de ADN de cadena pesada y cadena ligera generados en la Etapa II 1) se unieron en una reacción solapante con un enlazador Fab (véase Tabla 7, a continuación) que hibrida con el extremo 3’ de la cadena ligera y el extremo 5’ de la cadena pesada y 2) se amplificaron con cebadores directos e inversos de Sfi (véase Tabla 7, a continuación), permitiendo de este modo la amplificación de un fragmento de anticuerpo de 1200 pares de bases (pb) que contiene la cadena ligera-enlazador-cadena pesada.

El Enlazador Kappa Fab se amplificó a partir del vector 2g12/pCAL (SEC ID Nº: 81). Las condiciones de reacción de PCR para la formación del enlazador Fab fueron las siguientes: Enlazador Kappa Fab H2O 19,75 tampón 10x 2,5 dNTP (10 mM cada uno) 0,75 Vector 2g12/pCAL (10 ng) 1 Enlazador Fab-Directo (20 µM) 0,25 Enlazador Fab-Inverso (20 µM) 0,25 Pfx50 0,5 25 µl El Enlazador Lambda Fab se amplificó a partir del vector 28d11/pCAL (SEC ID Nº: 1638). Las condiciones de reacción de PCR para la formación del Enlazador Lambda Fab fueron las siguientes: Enlazador Lambda Fab Reactivo µl H2O 35,5 tampón 10x potenciador 10x dNTP (10 mM cada uno) 1,5 Vector 28d11/pCAL (10 ng) 1 Enlazador FabCλ Directo (20 µM) 0,5 Enlazador Fab-Inverso IT* (20 µM) 0,5 Pfx50 0,5 Las condiciones de termociclador de PCR para la formación de los Enlazadores Fab fueron las siguientes: 1) 94 ºC durante 2 minutos 2) 30 ciclos de: 94 ºC durante15 segundos; 54 ºC durante 20 segundos; 68 ºC durante 1 minuto 3) 68 °C durante 3 minutos 4) mantenimiento a 4 ºC La reacción de PCR se procesó en un gel de agarosa al 1 % y el enlazador de 120 pb se extrajo en gel según el protocolo de Extracción en Gel Qiagen. Se usaron 2 µl del enlazador purificado para cada reacción solapante.

ES 2 553 440 T3   Las condiciones de PCR para solapamiento fueron las siguientes (se añaden Cebadores D/I de Sfi a la reacción de PCR después de los primeros 15 ciclos): PCR III: Solapante Reactivo µl H2O 24,5 tampón 10x potenciador 10x dNTP (10 mM cada uno) 1,5 Producto de cadena ligera Producto de cadena pesada Enlazador 2 Cebadores D/I de Sfi (20 µM) 1 Pfx50 1 Las condiciones de termociclador de PCR fueron las siguientes: 1) 94 ºC durante 2 minutos 2) 15 ciclos de: 94 ºC durante 15 segundos; 68 °C durante 1 minuto; Añadir cebadores D/I de Sfi (1 µl), después: 3) 94 ºC durante 2 minutos 4) 30 ciclos de: 94 ºC durante 15 segundos; 60 ºC durante 20 segundos; 68 ºC durante 2 minutos 5) 68 ºC durante 3 minutos 6) mantenimiento a 4 ºC Después de la amplificación, se separaron 10 µl de los 50 µl totales del producto de reacción solapante de PCR cadena ligera-enlazador-cadena pesada en un gel de agarosa al 1 % para determinar el tamaño y se purificaron los 40 µl restantes del producto de PCR por el Kit de Purificación de PCR Qiagen (Qiagen; Cat. n.º 28106) en 30 µl de volumen total. Brevemente, se añade 5 veces del volumen de reacción de PCR de tampón PBI al producto de PCR.

La mezcla se unió con la columna de Centrifugación QIA y se lavó dos veces con tampón PE. La muestra se eluyó en 30 µl y se centrifugó durante 1,5 minutos a máxima velocidad para eluir los 30 µl. Aproximadamente 1 µg de producto solapante fue el rendimiento típico por cada 50 µl de reacción solapante.

Tabla 7. Oligonucleótidos de Etapa III Oligonucleótido SEC ID Nº Enlazador FabCK-Directo 82 Enlazador Fab-Inverso 83 Enlazador Fab Cλ-Directo 1639 Enlazador Fab-Inv-IT* 1640 Directo Sfi TCGCggcccagccggccatggc 84 Inverso Sfi TGCGGCCGGCCTGGCCGA 85 Etapa IV. Digestión con Sfi y clonación en el vector de expresión pCAL o el vector de expresión pCAL IT* Después de la reacción de PCR solapante y la purificación del producto PCR, el producto de reacción se digirió con SfiI. A los 30 µl de eluato (véase anteriormente), se añadió lo siguiente para la digestión: 4 µl Tampón de reacción 2 (New England Biolabs) 0,4 µl BSA 1,6 µl Enzima Sfil (New England Biolabs) 4 µl H2O 40 µl Volumen total

ES 2 553 440 T3   La reacción se incuba durante 1 hora a 37 ºC. Después de digestión, el producto solapante digerido se separó en un gel de agarosa al 1 % y la banda correspondiente al anticuerpo (∼1,45 kB) se purificó por extracción en gel (Kit de Purificación de Extracción en Gel Qiagen Cat. n.º 28706). Brevemente, el corte de gel se digirió con 500 µl de tampón QC (Qiagen). Se añadieron 150 µl de isopropanol para digerir y la muestra se aplicó a la columna de QiaSpin. La columna se lavó dos veces con tampón PE (Qiagen) y el tampón se eluyó en 30 µl de tampón EB (Qiagen). Se recuperan aproximadamente 15 ng/µl de muestra digerida de aproximadamente 1 µg de producto solapante de PCR. Finalmente, el producto solapante digerido se ligó en un vector de expresión bacteriano pCAL (SEC ID Nº: 86) o el vector de expresión bacteriano pCAL IT* (SEC ID Nº: 1641). Las condiciones de reacción de ligamiento fueron las siguientes: 25 ng Vector pCAL o pCAL IT* digerido con Sfil 25 ng producto solapante digerido 1 µl T4 Ligasa (NEB Cat. n.º MC202L, 400.000 unidades/ml) ajustado a un volumen total de 20 µl con H2O La muestra se ligó durante 1 hora a temperatura ambiente. Se diluyó 1 µl de ligamiento en 4 µl de H2O antes de proceder a la transformación. Etapa V. Transformación en E. coli

Después del ligamiento, el producto de ligamiento se transformó en células de Máxima Eficacia DH5α (Invitrogen; Cat. n.º 18258; Genotipo: F- ϕ80lacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ- thi-1 gyrA96 relA1). Brevemente, se añadió 1 µl de producto de ligamiento (dilución 1/5) a 50 µl de DH5α y se incubó en hielo durante 30 minutos. La transformación se efectuó por choque térmico a 42 ºC durante 45 segundos seguido de 2 minutos en hielo. Se añadieron 0,9 ml de medio SOC y se permitió que las células se recuperaran a 37 ºC durante 1 hora con agitación. Las células se sembraron en placas LB complementadas con carbenicilina (100 µg/ml) y glucosa 20 mM. Las placas se incubaron durante una noche a 37 ºC. Etapa VI. Selección de colonias individuales

Para cada amplificación de anticuerpo, se seleccionó un total de 88 colonias individuales y se cultivaron en 1 ml de Caldo Super (SB) complementado con 1 carbenicilina (100 µg/ml) en una placa de 96 pocillos durante 2 horas a 37 ºC. Se generó una placa descendiente transfiriendo 500 µl de cada cultivo a otra placa bacteriana de formato de 96 pocillos con 500 µl de SB complementado con glucosa 40 mM (final 20 mM) y 100 µg/ml de carbenicilina. Se proporcionó a la placa original o madre 500 µl de SB complementado con carbenicilina 100 µg/ml. La placa se cultivó a 30 ºC durante noche y la placa descendiente (que contenía glucosa) se cultivó a 37 ºC durante una noche. El lisado celular de la placa de 30 ºC se usó para ELISA bacterianos (véase Ejemplo 4 posterior) y los cultivos de placa a 37 ºC se usaron para preparaciones de ADN de mini-prep (Qiagen).

Sumario Los cinco pocillos identificados como aciertos se amplificaron usando cebadores de cadena ligera kappa y se clonaron en el vector de expresión pCAL.

Ejemplo 3 Aislamiento de anticuerpos Fab anti-VSR por clasificación de células individuales En este ejemplo, se aislaron anticuerpos anti-VSR de células CD19/CD27/IgG positivas. Las células CD19/CD27/IgG positivas se obtuvieron mediante 1) aislamiento de linfocitos B; y 2) clasificación de células individuales por FACS. Las células clasificadas se usaron después para aislar ARN que actuó como un molde para la producción in vitro de anticuerpos Fab. Aislamiento de linfocitos B Se aislaron linfocitos B de PBMC (recogidas de un donante de banco de sangre anónimo) usando un Kit de Aislamiento de Linfocitos B (Miltenyi Biotec, Cat. n.º 130-091-151). El kit se usa para aislar linfocitos B altamente puros por marcaje magnético y empobrecimiento de células que expresan CD2, CD14, CD16, CD36, CD43 y CD235a (linfocitos B activados, células plasmáticas y linfocitos B-1a CD5+) y células distintas de linfocitos B (por ejemplo, linfocitos T, linfocitos NK, células dendríticas, macrófagos, granulocitos y células eritroides). De acuerdo con el protocolo del fabricante, las células distintas de linfocitos B se marcaron magnéticamente de forma indirecta usando un cóctel de anticuerpos monoclonales conjugados con biotina como un reactivo de marcaje primario (Cóctel

ES 2 553 440 T3   de Biotina-Anticuerpo) y anticuerpo monoclonal anti-biotina conjugado con microperlas como un reactivo de marcaje secundario (Microperlas Anti-Biotina). Las células distintas de linfocitos B se retiraron después de los linfocitos B en reposo puros por separación magnética.

Brevemente, las PMBC congeladas, obtenidas de separación por Ficoll, se descongelaron, se lavaron dos veces y se contaron. Las células se centrifugaron después a 300 g durante 10 minutos, y se aspiró el sobrenadante. El sedimento celular se resuspendió en 40 µl de tampón MACS (por cada 107 células) y se añadieron 10 µl de Cóctel de Biotina-Anticuerpo (por cada 107 células). Después de mezcla exhaustiva, las células se incubaron a 4 ºC durante 10 minutos. Después del periodo de incubación, se añadieron 30 µl de tampón (por cada 107 células) y 20 µl de Microperlas Anti-Biotina (por cada 107 células). Después de mezcla exhaustiva, las células se incubaron a 4 ºC durante 15 minutos. Las células se lavaron después añadiendo 1-2 ml de tampón (por cada 107 células) seguido de centrifugación a 300 g durante 10 minutos y se aspiró el sobrenadante. Hasta 108 células se resuspendieron después en 500 µl de tampón.

Se efectuó separación magnética colocando una columna LS (compuesta de esferas ferromagnéticas cubiertas con un recubrimiento de plástico para permitir la separación rápida y suave de las células) en el campo magnético de un separador de MACS. La columna LS se lavó con 3 ml de tampón y la suspensión celular se aplicó a la parte superior de la columna. Se recogieron linfocitos B no marcados a medida que pasaban a través de la columna después de la adición de 3 x 3 ml de tampón.

Clasificación de células individuales En este ejemplo, se clasificaron linfocitos B aislados por especificidad antigénica usando un Citómetro de Flujo FACSAria (BD Biosciences). Las células seleccionadas fueron CD19/CD27/IgG positivas. El antígeno F-VSR se marcó con Alexa Fluor 647 siguiendo las instrucciones del fabricante (Molecular Probes, A-20186). Brevemente, los linfocitos B aislados se separaron en alícuotas en 16 tubos separados. Catorce tubos recibieron 1x105 células y se usaron para determinar los ajustes del fotomultiplicador y parámetros de clasificación en el FACSAria. Las 1,8x106 células restantes se marcaron con Alexa Fluor 647/VSR-F a una concentración final de 20 nM. Se añadió proteína marcada a la muestra 15 minutos antes de la adición de anticuerpos. Se usaron anticuerpos CD19 y CD27 a una dilución de 1:20 mientras que se usó anticuerpo IgG a una dilución de 1:50. Después de la adición de Alexa Fluor 647/proteína VSR-F y anticuerpos, los tubos se incubaron en hielo durante 30 minutos y posteriormente se lavaron dos veces. Se efectuó clasificación de células individuales usando el Citómetro de Flujo FACSAria (BD Biosciences). Los marcadores incluyeron PE-Cy5 (CD19 antihumano), PE-Cy7 (CD27 antihumano), PE (Fcg de cabra anti-IgG humano), Pacific Blue (anti-CD3 humano de ratón), FITC (anti-IgG humano de ratón, anti- IgM humano de ratón, anti-IgA humano de ratón y anti-CD14 humano de ratón), yoduro de propidio y AlexaFluor 647 (proteína F de VSR marcada). Se realizó clasificación celular excluyendo en primer lugar células muertas seguido de exclusión de células CD3 positivas. Se identificaron adicionalmente células CD19 y CD27 positivas y dentro de esta población, las células se seleccionaron con respecto a expresión de Frγ IgG. Las células que expresaban IgD, IgM e IgA se excluyeron de las células restantes. Finalmente, se clasificaron células CD19/CD27/Fcγ IgG positivas con respecto a unión con F de VSR y cada linfocito B positivo se depositó en un pocillo individual de una placa de 96 pocillos que contenía 2 µl de tampón de reacción de ADNc (tampón 10X Superscript III, Invitrogen; Cat n.º 19090-051), 0,5 µl de RNaseOUT y 7,5 µl de agua estéril. Las placas se almacenaron a -80 ºC hasta su procesamiento posterior. Síntesis de ADNc de primera cadena Después de la clasificación, se generó ADNc individualmente en cada pocillo de acuerdo con el protocolo de Síntesis de Primera Cadena de Invitrogen. Brevemente, se añadieron 0,5 µl de NP-40 al 10 %, 1 µl de cebador de oligo dT y 1 µl de dNTP a cada pocillo y la placa se incubó a 65 ºC durante 5 minutos seguido de incubación en hielo durante 1 minuto. Posteriormente, se añadieron 2 µl de DTT, 4 µl de MgCl2 y 1 µl de SuperScript III RT y la mezcla de reacción se incubó a 50 ºC durante 1 hora seguido de incubación a 85 ºC durante 5 minutos. El ADNc se usó inmediatamente o se congeló a -80 ºC para almacenamiento a largo plazo.

Amplificación de cadena pesada y cadena ligera kappa de IgG Se generaron posteriormente cadenas pesadas y cadenas ligeras kappa de IgG por cuatro etapas secuenciales de PCR.

Etapa 1. Amplificación En la Etapa I, se usaron 2,5 µl de ADNc generado por Síntesis de Primera Cadena (véase anteriormente) como un molde para amplificar individualmente cadenas ligeras kappa y cadenas pesadas de IgG por PCR. En esta etapa, se

ES 2 553 440 T3   utilizaron grupos de cebadores de la Etapa I (véanse Tablas 8 y 9 posteriormente). Las condiciones de reacción fueron las siguientes: PCR Etapa I: H2O 16 tampón 10x 2,5 tampón potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 ADNc 2,5 grupo de Etapa I (20 µM cada uno) 0,25 Cebador inverso (20 µM) 0,25 Pfx50 0,25 25 µl Las condiciones de termociclador de PCR fueron las siguientes: 1) 94 ºC durante 2:00 2) 10 ciclos de: 94 ºC durante 0:15; 62 ºC durante 0:20 (TOUCHDOWN); 68 ºC durante 1:00 3) 40 ciclos de 94 ºC durante 0:15; 52 °C durante 0:20; 68 ºC durante 1:00 4) 68 ºC durante 3:00 5) mantenimiento a 4 ºC Las mezclas de reacción se usaron como ADN molde para la Etapa II (véase posteriormente) sin ninguna purificación adicional.

Tabla 8. Cebadores de Etapa I para amplificar cadenas ligeras kappa Grupo de cebadores directos SEC ID Nº 5’ LVκ1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 87 5’ LVκ3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 8 8 5’ LVκ4 ATTTCTCTGTTGCTCTGGATCTCTG 89 Cebador inverso SEC ID Nº VK-Inv GCACTCTCCCCTGTTGAAGCTCTTTG 90 Tabla 9. Cebadores de Etapa I para amplificar cadenas pesadas de IgG Grupo de cebadores directos SEC ID Nº 5’ L-VH1 ACAGGTGCCCACTCCCAGGTGCAG 9 5’ L-VH3 AAGGTGTCCAGTGTGARGTGCAG 92 5’ L-VH4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG 93 5’ L-VH5 CAAGGAGTCTGTTCCGAGGTGCAG 94 Cebador inverso SEC ID Nº 3’ CγCH1 GGAAGGTGTGCACGCCGCTGGTC 95 Etapa II. Amplificación

En la Etapa II las mezclas de reacción de la Etapa I se usaron como moldes para segundas reacciones de PCR con grupos de cebadores directos e inversos para la cadena ligera o cadena pesada, respectivamente. Estas reacciones amplificaron el ADN a partir de la región marco conservada 1 de cada cadena. Los cebadores directos de cadena ligera (véase Tabla 10) se diseñaron para introducir un sitio de restricción de Sfil (SEC ID Nº: 41). Las condiciones de reacción fueron las siguientes: PCR II: Cadena ligera H2O 15,75 tampón 10x 2,5 potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 Reacción de etapa I 2,5 grupo de cebadores Vk (9,1 µM) 0,5 pCALCK(G)L (20 µM) 0,25

ES 2 553 440 T3   PCR II: Cadena ligera Pfx50 0,25 25 µl Los cebadores directos de cadena pesada (véase Tabla 11) se diseñaron para introducir un sitio de restricción Sall (SEC ID Nº: 96). Las condiciones de reacción fueron las siguientes: PCR II: Cadena pesada H2O 14,25 tampón 10x 2,5 potenciador 10x 2,5 dNTP (10 mM cada uno) 0,75 Reacción de etapa I 2,5 grupo de pCAL24VH-F (2 µM) 2 grupo de Saill JH-Inv (20 µM) 0,25 Pfx50 0,25 25 µl Las condiciones de termociclador de PCR fueron las siguientes: 1) 94 ºC durante 2 minutos 2) 50 ciclos de: 94 ºC durante 15 segundos; 54 ºC durante 20 segundos; 68 ºC durante 1 minuto 3) 68 ºC durante 3 minutos 4) mantenimiento a 4 ºC Después de la amplificación, los productos de reacción de PCR se separaron en un gel de agarosa al 1 % y la banda correspondiente a la cadena pesada (400 pb) y la cadena ligera (650 pb) se purificación por extracción en gel (Qiagen).

Tabla 10. Cebadores para amplificar cadenas ligeras kappa Grupo de cebadores directos SEC ID Nº VK1a 57 VK1b 58 VK1c 59 VK2a VK3a 61 VK3b 62 VK3c 63 VK4a 64 VK5a VK6a 66 VK6b 67 Cebador inverso SEC ID Nº pCALCK (G) L 68 Tabla 11. Cebadores para amplificar cadenas pesadas de IgG Grupo de cebadores directos SEC ID Nº pCal30 VH1a 42 pCal30 VH1b 43 pCal30 VH1c 44

ES 2 553 440 T3   pCal30 VH1d pCal30 VH2a 46 pCal30 VH3a 47 pCal30 VH4a 48 pCal30 VH4b 49 pCal30 VH5a pCal30 VH6 51 pCal30 VH7 52 Grupo de cebadores inversos SEC ID Nº 3’ SalIJH 1/2/4/5 TGCGAAGTCGACGCTGAGGAGACGGTGACCAG 97 3’ SalIJH3 TGCGAAGTCGACGCTGAAGAGACGGTGACCATTG 98 3’ SalIJH6 TGCGAAGTCGACGCTGAGGAGACGGTGACCGTG 99 Etapa III. PCR solapante En la Etapa III, los segmentos de ADN de cadena pesada y cadena ligera generados en la etapa II: 1) se unieron en una reacción solapante con un enlazador Fab (véase Tabla 12, posteriormente) que hibrida con el extremo 3’ de la cadena ligera y el extremo 5’ de la cadena pesada y 2) se amplificaron con cebador directo de Sfi (véase Tabla 12, posteriormente) que hibrida con el extremo 5’ de la cadena ligera y cebadores inversos JH (véase Tabla 11, anteriormente) que hibridan con el extremo 3’ de la cadena pesada, permitiendo de este modo la amplificación de un fragmento de anticuerpo de 1200 pares de bases (pb) que contiene la cadena ligera-enlazador-cadena pesada. Las condiciones de reacción fueron las siguientes (el enlazador se generó como se ha descrito en el Ejemplo 2 anterior): H2O 24,5 tampón 10x potenciador 10x dNTP (10 mM cada uno) 1,5 Cadena ligera Cadena pesada Cebadores de Sfi D/JH-I (20 µM) 1 Pfx50 1 50 µl Las condiciones de termociclador de PCR fueron las siguientes: Solapamiento con enlazador 1) 94 ºC durante 2 minutos 2) 15 ciclos de: 94 ºC durante 15 segundos; 68 ºC durante 1 minuto Añadir cebadores 3) 94 ºC durante 2 minutos 4) 30 ciclos de: 94 ºC durante 15 segundos; 60 ºC durante 20 segundos, 68 ºC durante 1 minuto 5) 68 ºC durante 3 minutos 6) mantenimiento a 4 ºC Después de la amplificación, el producto de reacción de PCR cadena ligera-enlazador-cadena pesada se separó en un gel de agarosa al 1 % y se purificó por extracción en gel (Qiagen).

Etapa IV. Introducción de región CH1 Después de solapamiento, se digirió cadena ligera-enlazador-cadena pesada amplificado con SaI I y se ligó con una región constante de cadena pesada digerida con Sal1 1 (región CHγ1) introduciendo un sitio de restricción Sfil en el

ES 2 553 440 T3   extremo 3’ de la región constante de cadena pesada. Las condiciones de reacción de ligamiento fueron las siguientes: 2 µl de tampón de reacción de ligamiento 2 µl de CH1 5 µl de producto purificado en gel de 1,2 kB de la etapa III 10 µl de agua 1 µl de T4 ligasa La mezcla de reacción de ligamiento se incubó durante 30 minutos a temperatura ambiente. Después del ligamiento, el Fab de longitud completa se amplificó por PCR con cebadores Directo e Inverso de Sfil (véase Tabla 12, posteriormente) dando como resultado un fragmento de 1,45 kb. Las condiciones de reacción fueron las siguientes: H2O 31,5 tampón 10x potenciador 10x dNTP (10 mM cada uno) 1,5 Mezcla de reacción de ligamiento 5 Cebadores D/I de Sfi (20 µM) 1 Pfx50 1 50 µl Las condiciones de termociclador de PCR fueron las siguientes: 1) 94 ºC durante 2 minutos 2) 30 ciclos de: 94 ºC durante 15 segundos; 60 ºC durante 20 segundos; 68 ºC durante 1 minuto 3) 68 ºC durante 3 minutos 4) mantenimiento a 4 ºC El producto de reacción fue un fragmento de 1,45 kB de una cadena ligera y una cadena pesada unidas entre sí en un único casete.

Tabla 12. Oligonucleótidos de Etapa III y Etapa IV Oligonucleótido SEC ID Nº Enlazador Fab 100 Directo Sfi TCGCggcccagccggccatggc 84 Inverso Sfi TGCGGCCGGCCTGGCCGA 85 Fragmento CH1 101 Etapa V. Digestión con Sfi y clonación en vector de expresión pCAL Después de reacción de PCR solapante y purificación del producto de PCR, el producto de reacción se digirió con SfiI. Al eluato de 30 µl (véase anteriormente), se añadió lo siguiente para la digestión:

ES 2 553 440 T3   4 µl Tampón de reacción 2 (New England Biolabs) 0,4 µl BSA 1,6 µl Enzima Sfil (New England Biolabs) 4 µl H2O 40 µl Volumen total La reacción se incuba durante 1 hora a 37 ºC. Después de digestión, el producto solapante digerido se separó en un gel de agarosa al 1 % y la banda correspondiente al anticuerpo (∼1,45 kB) se purificó por extracción en gel (Kit de Purificación de Extracción en Gel Qiagen Cat. n.º 28706). Brevemente, el corte de gel se digirió con 500 µl de tampón QC (Qiagen). Se añadieron 150 µl de isopropanol a la digestión y la muestra se aplicó a la columna QiaSpin. La columna se lavó dos veces con tampón PE (Qiagen) y el tampón se eluyó en 30 µl de tampón EB (Qiagen). Se recuperan aproximadamente 15 ng/µl de muestra digerida de aproximadamente 1 µg de producto solapante de PCR. Finalmente, el producto solapante digerido se ligó en un vector de expresión bacteriano pCAL (SEC ID Nº: 86). Las condiciones de reacción de ligamiento fueron las siguientes: 25 ng Vector pCAL digerido con Sfil 25 ng producto solapante digerido 1 µl T4 Ligasa (NEB Cat. n.º MC202L, 400.000 unidades/ml) 20 µl volumen total La muestra se ligó durante 1 hora a temperatura ambiente. Se diluyó 1 µl del ligamiento en 4 µl de H2O antes de proceder a la transformación.

Etapa VI. Transformación en E. coli Después del ligamiento, el producto de ligamiento se transformó en células de Máxima Eficacia DH5α (Invitrogen; Cat. n.º 18258; Genotipo: F- ϕ80lacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-

thi-1 gyrA96 relA1). Brevemente, se añadió 1 µl de producto de ligamiento (dilución 1/5) a 50 µl de DH5α y se incubó en hielo durante 30 minutos. La transformación se efectuó por choque térmico a 42 ºC durante 45 segundos seguido de 2 minutos en hielo. Se añadieron 0,9 ml de medio SOC y se permitió que las células se recuperaran a 37 ºC durante 1 hora con agitación. Las células se sembraron en placas LB complementadas con carbenicilina (100 µg/ml) y glucosa 20 mM. Las placas se incubaron durante una noche a 37 ºC.

Etapa VII. Selección de colonias individuales Se seleccionó un total de 88 colonias individuales y se cultivaron en 1 ml de Caldo Super (SB) complementado con 1 carbenicilina (100 µg/ml) en una placa de 96 pocillos durante 2 horas a 37 ºC. Se generó una placa descendiente transfiriendo 500 µl de cada cultivo a otra placa bacteriana de formato de 96 pocillos con 500 µl de SB complementado con glucosa 40 mM (final 20 mM) y carbenicilina 100 µg/ml. Se proporcionó a la placa original o madre 500 µl de SB complementado con carbenicilina 100 µg/ml. La placa original se cultivó a 30 ºC durante una noche y la placa descendiente (que contenía glucosa) se cultivó a 37 ºC durante una noche. El lisado celular de la placa a 30 ºC se usó para ELISA bacterianos (véase Ejemplo 4 posterior) y los cultivos en placa a 37 ºC se usaron para preparaciones de ADN de mini-prep (Qiagen). Ejemplo 4 Unión del anticuerpo con proteína F de VSR

En este ejemplo, los anticuerpos Fab generados en los Ejemplos 2 y 3 se ensayaron con respecto a su capacidad para unirse con lisado de F1 de VSR purificado por ELISA. Brevemente, se añadieron 50 µl del lisado celular bacteriano diluido 1 volumen en 3 volúmenes totales con PBS/BSA al 3 %/Tween 20 0,01 % a una placa de ELISA de 96 pocillos previamente recubierta con lisado de F1 de VSR (véase Ejemplo 1, anterior). La placa se incubó a 37 ºC durante 2 horas, como alternativa a 4 ºC durante una noche, seguido de lavado 4x con tampón de lavado (PBS/Tween 20 0,05 %). Se añadieron 50 µl de anticuerpo F(ab)=HRP de cabra anti-IgG humano (Jackson Labs Cat. n.º 109-036-097) diluido 1:1000 en PBS/BSA al 3 %/Tween 20 0,01 % y la placa se incubó a 37 ºC durante 1 hora. Después de lavar 6x con tampón de lavado, se añadieron 50 µl de solución de TMB:peróxido 1:1 v/v (Pierce, Cat. n.º 34021) y se permitió que se revelara durante 7 minutos. La reacción se detuvo inmediatamente mediante la adición de 50 µl de H2SO4 2N y se midió la absorbancia a 450 nm usando un lector de placas de ELISA. La unión positiva se indicó por una DO450 mayor de 0,5 (0,5-0,9 es unión moderada, >1 es unión fuerte) y una respuesta que estaba 3 veces por encima del fondo. Además de la unión con el lisado de F1 de VSR, también se utilizaron varios antígenos de control positivo y negativo. Se usó plasma de un grupo de donantes de Banco de Sangre (recogido y congelado después de

ES 2 553 440 T3   separación por Ficoll Hypaque, diluido 1:1000) como un control positivo para unión del lisado de F1 de VSR. Como control positivo para determinar que cada lisado de células bacterianas contiene un Fab intacto, se usó un anticuerpo de cabra anti-F(ab)2 humano Affinipure (1 µg/ml Jackson Immunoresearch Cat. n.º 109-006-097) para recubrir una placa de ELISA de 96 pocillos para capturar Fab intacto. Este anticuerpo se une solamente con la parte F(ab) de un anticuerpo IgG. Después se detectó la expresión de Fab usando Peroxidasa anti-HA (Roche, Cat. n.º 12013819001; los Fab expresados bacterianos tienen un marcador de HA). Se usó actina (1 µg/ml, Sigma Cat. n.º A3653) como un control negativo para unión de Fab con cualquier proteína y como un control positivo para la reacción de ELISA usando anticuerpo de ratón anti-actina (1,25 µg/ml, Sigma Cat. n.º A3853) y anticuerpo de cabra F(ab)-HRP anti-IgG de ratón (Santa Cruz Biotech Cat. n.º SC3697). El mAb de ratón anti-VSR (clon 2F7, líquido ascítico de ratón, Cat. n.º ab43812, Abcam) también se incluyó como un control negativo para especificidad de unión con la proteína F de VSR ya que este anticuerpo se empleó para unir la proteína F de VSR con la placa de ELISA y por lo tanto estaba presente en las placas de ELISA durante la exploración de los anticuerpos anti-VSR humanos. A. Unión de lisados celulares para Fab generados a partir de linfocitos B transformados con VEB (véase Ejemplo 2) Los ochenta y ocho (88) lisados celulares generados en el Ejemplo 2 anterior se ensayaron por ELISA con respecto a su capacidad para 1) unirse con un anticuerpo anti-Fab; y 2) unirse con el lisado de F1 de VSR. El ELISA confirmó que 76 de los 88 lisados celulares eran positivos para producción de Fab mientras que 59 de los 88 lisados celulares se unían con el lisado de F de VSR. El ELISA de confirmación reveló que 72 de los 76 lisados celulares producían de hecho Fab y 46 de los 59 aciertos positivos iniciales se reconfirmaron como agentes de unión para el lisado de F de VSR. Tres de los agentes de unión positivos se identificaron por secuenciación de ADN de la preparación de ADN correspondiente. La secuenciación reveló que todos tenían la misma secuencia, identificada como Fab 58c5, que tiene las siguientes cadenas ligeras y pesadas: Fab 58c5 Cadena ligera (SEC ID Nº: 5) Cadena pesada

(SEC ID Nº: 1) B. Unión de lisados celulares para Fab generados de clasificación de células individuales (véase Ejemplo 3) Los resultados indicaron que 64 de los 88 lisados celulares generados en el Ejemplo 3 se unieron con la proteína F1 de VSR. Se identificaron veinticuatro con unión positiva por secuenciación de ADN de la preparación de ADN correspondiente. Uno de los agentes de unión positivos identificados fue Fab sc5 que tiene las siguientes cadenas ligera y pesadas: Fab sc5

Cadena ligera (SEC ID Nº: 13) Cadena pesada

ES 2 553 440 T3   (SEC ID Nº: 9) Los dominios de anticuerpo y regiones de CDR de Fab 58c5 y sc5 aislados se proporcionan en la Tabla 13A-13B a continuación.

Tabla 13A. Dominios de anticuerpo y regiones CDR de Fab aislados Ab Cadena Dominio VH VH CDR1 VH CDR2 VH CDR3 VH 58c5 SEC ID Aminoácidos 1-125 de GASINSDNYYWT HISYTGNTYYTP CGAYVLISNCG Nº: 1 SEC ID Nº: 1 (SEC ID Nº: 2) SLKS WFDS (SEC ID Nº: 3) (SEC ID Nº: 4) sc5 SEC ID Aminoácidos 1-125 de GDSISGSNWWN EIYYRGTTNYKS GGRSTFGPDYY Nº: 9 SEC ID Nº: 9 (SEC ID Nº: 10) SLKG YYMDV (SEC ID Nº: 11) (SEC ID Nº: 12) Cadena dominio VL VL CDR1 VL CDR2 VL CDR3 VL 58c5 SEC ID Aminoácidos 1-107 de QASQDISTYLN (SEC GASNLET (SEC ID QQYQYLPYT Nº: 5 SEC ID Nº: 5 ID Nº: 6) Nº: 7) (SEC ID Nº: 8) sc5 SEC ID Aminoácidos 1-107 de RASQNIKNYLN AASTLQS (SEC ID QQSYNNQLT Nº: 13 SEC ID Nº: 13 (SEC ID Nº: 14) Nº: 15) (SEC ID Nº: 16) Tabla 13B. CDR1 de cadena pesada (numeración de Kabat) Ab VH CDR1 Ab VH CDR1 58C5 SDNYYWT (SEC ID Nº: 1627) sc5 GSNWWN (SEC ID Nº:1628) Ejemplo 5 Expresión y purificación de Fab aislados En este ejemplo, se expresaron posteriormente anticuerpos Fab individuales que se había determinado que se unían con el lisado de F de VSR por ELISA usando el lisado celular y se purificaron a partir de las células bacterianas usando cromatografía en columna. Se transformó el ADN que codifica cada anticuerpo Fab individual en células Top 10 (Invitrogen) para expresión. Cada anticuerpo Fab se cultivó en 2 l de SB a 37 ºC hasta una DO600 de 0,8. Se indujo expresión de proteínas mediante la adición de IPTG 1 mM y se permitió que se produjera durante una noche a 30 ºC. Después de la expresión, los cultivos bacterianos se centrifugaron y el sedimento celular se resuspendió en 10 ml de Solución Salina Tamponada con Fosfato (PBS) con inhibidores de proteasa (Cóctel Inhibidor de Proteasa Complete, Santa Cruz Biotech, Cat. n.º sc-29131). Se añadió lisozima (0,2 mg) a las células resuspendidas y la mezcla se incubó a temperatura ambiente durante 15 minutos. Las células se lisaron por dos ciclos de congelación/descongelación. Brevemente, las células bacterianas resuspendidas se congelaron en un baño de etanol/hielo seco seguido de descongelación en un baño de agua a 37 ºC. Una vez lisado, el lisado bacteriano se centrifugó a 18000 rpm y el sobrenadante se filtró y se esterilizó pasando a través de un filtro de 0,4 micrómetros. Cada anticuerpo Fab individual se purificó después por cromatografía en columna de afinidad. Brevemente, el sobrenadante filtrado se pasó lentamente sobre una columna de Proteína A/anti-Fab permitiendo que la proteína Fab se uniera. Después de lavar con 50 ml de PBS, el Fab unido se eluyó con 9 ml de glicina 0,2 M, pH 2,2 y se recogió en un tubo cónico que contenía 1 ml de Tris 2 M, neutralizando de este modo la proteína eluida. El Fab eluido se dializó después usando un casete de diálisis de PCPM de 10 K (Pierce) frente a 4 l de PBS. La proteína se almacenó a 4 ºC durante una noche y posteriormente se concentró hasta un volumen de 1ml usando un Filtro Amicon Ultra de 10 kDa (Millipore). La unión de cada anticuerpo Fab purificado con el lisado de F de VSR (fuente recombinante, Ejemplo 1A) y lisado de HEp2 (fuente nativa, Ejemplo 1B) se reconfirmó después por ELISA (véase Ejemplo 4 anterior). Adicionalmente, cada anticuerpo Fab purificado se ensayó con respecto a su capacidad para neutralizar VSR usando el ensayo descrito en el Ejemplo 6. Unión de Fab 58c5 y sc5 con el lisado de F de VSR y proteína F de VSR purificada

La unión de los anticuerpos 58C5 y sc5 con proteína F de VSR capturada a partir de células 293 transfectadas (recombinante) o proteína F de VSR purificada de células Hep2 infectadas por VSR A2 (nativa) se midió por ELISA. Los resultados indican que Fab 58c5 y Fab sc5 se unen con la proteína F de VSR (recombinante) de una manera

ES 2 553 440 T3   dependiente de dosis pero solamente sc5 fue capaz de reconocer la proteína F purificada (nativa) (véase Tablas 14- 15 posteriores).

Tabla 14. Unión de Fab sc5 y 58c5 con el lisado de F de VSR capturado (recombinante) Fab [µg/ml] sc5 58c5 2 2,963 2,9165 0,4 2,827 2,9705 0,08 2,151 2,518 0,016 0,651 1,433 0,0032 0,3205 0,5905 0,00064 0,284 0,415 0,000128 0,337 0,3785 0,0000256 0,22 0,2485 Tabla 15. Unión de Fab sc5 y 58c5 con Proteína F de VSR purificada (nativa) Fab [µg/ml] sc5 58c5 2 2,623 0,417 0,4 2,704 0,2665 0,08 2,744 0,1505 0,016 2,66 0,098 0,0032 1,7685 0,0805 0,00064 0,6035 0,087 0,000128 0,2325 0,1065 0,0000256 0,1445 0,13 Ejemplo 6 Ensayo de neutralización de VSR En este ejemplo, se analizaron los anticuerpos anti-VSR con respecto a su capacidad para unirse con y neutralizar el virus VSR en solución como se evalúa por un ensayo de reducción de placas. En este experimento, el virus VSR y los anticuerpos se preincubaron en ausencia de células diana. La mezcla se añadió después a las células y se midió la infección por virus por un ensayo de reducción de placas convencional descrito en el presente documento. Los anticuerpos anti-VSR se analizaron con respecto a su capacidad para neutralizar varias cepas de virus VSR, incluyendo VSR A2 (ATCC Cat. n.º VR-1540), lavado de VSR B (ATCC Cat. n.º VR-1580, cepa 18537), y VSR B-1 (ATCC Cat. n.º 1400). Se emplearon células Vero (ATCC, cat n.º CCL-81; Manassas, VA) para infección de células hospedadoras. Las células Vero se cultivaron en DMEM (HyClone, cat n.º SH 30285.01) con suero bovino fetal al 10 % (FBS) (HyClone, cat n.º SH30070.03), se complementaron con L-Glutamina al 1 % (HyClone, cat n.º SH30034.01) y solución de Penicilina-Estreptomicina al 1 % (HyClone, cat n.º SV30010). Las células Vero se mantuvieron en una incubadora a 37 ºC con CO2 al 5 % y se pasaron dos veces por semana. El día 1 del experimento, las células Vero se cultivaron en placas de cultivo celular de 24 pocillos. Las células se sembraron en placas a una densidad (aproximadamente 1x106 células por pocillo) que permite la formación de una monocapa celular (>90 % de confluencia) el día 2. El día 2, cada anticuerpo se diluyó en serie en medio esencial mínimo de Eagle puro (EMEM, ATCC, cat. n.º: 30-2003) (concentraciones de anticuerpos finales ensayadas: 20 µg/ml, 4 µg/ml, 0,8 µg/ml, 0,16 µg/ml, 0,032 µg/ml y 0,006 µg/ml). El virus VSR también se diluyó en EMEM sencillo a una concentración de 2 x 103 ufp/ml (100 ufp/50 µl) y se añadieron 110 µl del virus VSR diluido a 110 µl de cada solución de anticuerpo diluida y se mezcló por pipeteo. Para la muestra de control de virus, se añadieron 110 µl del virus VSR diluido a 110 µl de EMEM sencillo. Las mezclas de anticuerpo-virus o control de virus se incubaron a 37 ºC durante 2 horas. Después de la incubación, el medio de cultivo se decantó de las placas de cultivo celular de 24 pocillos que se contenían las células hospedadoras Vero y se transfirieron 100 µl de la mezcla de virus-anticuerpo o control de virus pre-incubada a cada pocillo. Cada muestra de ensayo y de control se preparó por triplicado. Las células se incubaron a 37 ºC durante una hora con mezcla cada 15 minutos. Después del periodo de incubación, el medio de cultivo que contenía la mezcla del anticuerpo-virus o control de virus se aspiró y se añadió 1 ml de medio de superposición a cada pocillo (el medio de superposición contenía EMEM, FBS 2 %, L-glutamina 1 %, metilcelulosa 0,75 %). Las placas de cultivo celular de 24 pocillos se incubaron después a 37 ºC (con CO2 al 5 %) durante aproximadamente 72 horas. Las placas celulares se fijaron con formalina al 10 % durante 1 hora a temperatura ambiente, se lavaron 10 veces con ddH2O y se bloquearon con leche en polvo desgrasada al 5 % (NFDM) en PBS con Tween 20 0,05 %) a 37 ºC durante una hora.

ES 2 553 440 T3   Después de la incubación, la solución de bloqueo se decantó y se añadieron 200 µl de anticuerpo anti-VSR de ratón (ab10018, Abcam; dilución 1:1000 en NFDM 5 %) a cada pocillo. Las placas se incubaron a 37 ºC durante 2 h, se lavaron 10 veces con ddH2O y 200 µl de IgG conjugado con HRP de cabra anti-ratón (Pierce, Cat. n.º 31432, dilución 1:1000 en NFDM 5 %) a cada pocillo. Las placas se incubaron a 37 ºC durante 2 h. Las placas se lavaron 10 veces con ddH2O y se añadieron 200 µl de sustrato de peroxidasa TrueBlue™ (KPL Cat. n.º 50-78-02) a cada pocillo. Las placas se revelaron durante 10 min a temperatura ambiente. Las placas se lavaron dos veces con ddH20 y se secaron en un papel de cocina y se contó el número de placas azules. Se calculó la DE50 (dilución eficaz para neutralización al 50 %) usando Prism (GraphPad). La tasa de reducción de placas se calculó de acuerdo con la siguiente fórmula: Tasa de reducción de placas (percentil) = (1 – número promedio de placas en cada dilución de anticuerpo / número promedio de placas en pocillos de control de virus) * 100 Los datos se muestran en las Tablas 16-18 a continuación. La Tabla 16 enumera la DE50 para cada Fab para las diversas cepas de VSR. La Tabla 17 enumera los recuentos de placas para las diversas cepas de VSR y a las diversas concentraciones para FAb 58c5. La Tabla 18 enumera la tasa de reducción de placas para Fab 58c5. Los resultan indican que Fab 58c5 es capaz de neutralizar las 3 cepas de VSR mientras que Fab sc5 neutraliza solamente VSR A2 y VSR B-1, aunque a concentraciones de anticuerpo mucho mayores. Basándose en los datos obtenidos en el ensayo de neutralización y el peso molecular del fragmento Fab 58c5 (aproximadamente 50 kDa), se estimó que la CE50 de Fab 58c5 para neutralización in vitro de VSR era de aproximadamente 320 pM.

Tabla16. Datos de neutralización de DE50 para Fab 58c5 y Fab sc5 Fab 58c5 Fab sc5 Antígeno DE50 DE50 VSR A2 320 pM (0,016 µg/ml) 0,016 mM (0,8 µg/ml) VSR B/lavado 500 pM (0,025 µg/ml) > 0,2 mM (> 10 µg/ml) VSR B-1 840 pM (0,042 µg/ml) 0,042 mM (2,1 µg/ml) Tabla 17. Recuento de placas promedio para neutralización con Fab 58c5 Antígeno 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml VSR A2 5,7 28,7 52,3 57,7 VSR B/lavado 1,3 0,7 16,3 23,3 26,3 VSR B-1 0,3 4,7 8,7 11,7 12,3 Tabla 18. Tasa de reducción de placas (%) para neutralización con Fab 58c5 Antígeno 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml VSR A2 100 100 100 90 9,4 VSR B/lavado 95 97 100 81 38 11 VSR B-1 97,6 100 100 62 29 Ejemplo 7 Clonación y expresión de IgG En este ejemplo, se convirtieron anticuerpos Fab que mostraron potencial para neutralizar VSR en IgG clonándolos en el vector de expresión de mamíferos pCALM (SEC ID Nº: 102). Se generaron cebadores específicos para cada anticuerpo y las cadenas pesadas y ligeras de cada Fab como se clonaron originalmente en el vector pCAL (véase Ejemplo 2) se amplificaron por PCR. La amplificación de cadena ligera dio como resultado un fragmento de 650 pb y la amplificación de cadena pesada dio como resultado un fragmento de 400 pb. Adicionalmente, se generó un enlazador que permitía el solapamiento de la cadena pesada y la cadena ligera. El enlazador también incluía una región constante de cadena pesada convencional. El solapamiento de las cadenas pesadas y ligeras dio como resultado un casete de 2,1 kB para cada anticuerpo que tenía sitios de restricción SfiI (SEC ID Nº: 41) en ambos extremos. Cada casete se digirió con SfiI y se clonó en el vector pCALM. Después de confirmar la secuencia correcta en bacterias, se aisló ADN de transfecciones de mamífero usando un Kit Maxi Prep (Qiagen).

Para expresar cada IgG, cada vector pCALM se usó para infectar aproximadamente 200 millones de células 293F dando como resultado aproximadamente 200 microgramos de IgG. Las células 293F se transfectaron con 293 fectina (Invitrogen, Cat. nº 51-0031) y se permitió que produjeran IgG durante 72 horas. Después de 72 horas después de la transfección, se recogió el medio celular, se centrifugó para retirar las células, y se esterilizó por filtración a través de una unidad de filtro de 0,4 micrómetros. La purificación se efectuó por cromatografía en columna usando una columna de Proteína A. El medio filtrado, que contenía la IgG expresada, se pasó dos veces a través de una columna de proteína A. Después de lavado con 50 ml de PBS, se eluyó IgG con 9 ml de glicina 0,2 M a pH 2,2 y se recogió en Tris 2 M para efectuar la neutralización. El eluato se dializó frente a 4 litros de PBS usando

ES 2 553 440 T3   un casete de diálisis de 10 kDa (Pierce). La muestra se concentró hasta 1 ml con un Amicon Ultra de 10 kDa (Millipore). Ejemplo 8 Ensayos de unión de IgG En este ejemplo, la forma de IgG de 58c5, generada como se ha descrito en el Ejemplo 7 anterior, y el anticuerpo anti VSR Motavizumab (Wu et al. (2007) J. Mol. Biol. 368(3): 652-665) se ensayaron con respecto a su capacidad para unirse con la proteína F de VSR (recombinante) o el lisado de proteína F de VSR (nativa) por ELISA (véase Ejemplo 4 anterior). Las CE50 estimadas para la unión (determinadas valorando cada IgG) se exponen en la Tabla 19 posterior. La forma IgG de 58c5 tiene una afinidad por la proteína F de la cepa de VSR A2 aproximadamente igual que motavizumab.

Tabla 19. Unión de IgG con la Proteína F de VSR Antígeno CE50 de IgG (estimada) Forma IgG de 58c5 24 pM Motavizumab 27 pM Ejemplo 9 Ensayos de neutralización de VSR por la forma IgG de 58c5 En este ejemplo la forma IgG de 58c5, generada en el Ejemplo 7 anterior, y motavizumab se ensayaron con respecto a su capacidad para neutralizar diversas cepas de VSR. Adicionalmente, la forma IgG de 58c5 se analizó con respecto a su capacidad para neutralizar diversos mutantes de escape de VSR resistentes a anticuerpos monoclonales (MARM). Un MARM es una cepa de VSR mutante que ya no puede neutralizarse por el anticuerpo contra el que se generó. Por lo tanto, la capacidad de la forma IgG de 58c5 para neutralizar un MARM específico indica que el epítopo de unión de 58c5 es diferente de el del anticuerpo con que el que se generó el MARM. A. Neutralización de VSR La forma IgG de 58c5 y motavizumab se ensayaron con respecto a su capacidad para neutralizar VSR (como se ha descrito en el Ejemplo 6 anterior). Los datos se muestran en las Tablas 19-21 posteriores. La Tabla 20 enumera la DE50 (dilución eficaz para el 50 % de neutralización) para cada cepa de VSR. La Tabla 21 enumera los recuentos de placas para las diversas cepas de VSR y a las diversas concentraciones de anticuerpo. La Tabla 22 enumera la tasa de reducción de placas para las diversas cepas de VSR y a diversas concentraciones de anticuerpo. Los resultados indican que la forma IgG de 58c5 es capaz de neutralizar las tres cepas de VSR. Basándose en los datos obtenidos en el ensayo de neutralización y el peso molecular de la forma IgG del fragmento 58c5 (aproximadamente 150 kDa), se estimó que la CE50 de la forma IgG de 58c5 para neutralización in vitro de VSR era de aproximadamente 133 pM. Motavizumab tiene una CE50 correspondiente de 360 pM.

Tabla 20. Datos de Neutralización de IgG (DE50) Antígeno VSR A2 VSR B-1 VSR B/lavado Forma IgG de 58c5 133 pM (0,02 µg/ml) 280 pM (0,042 µg/ml) 193 pM (0,029 µg/ml) Motavizumab 360 pM 833 pM 2,9 nM Tabla 21. Recuento Promedio de Placas para Neutralización con forma IgG de 58c5 Antígeno 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml VSR A2 0,3 0,7 16,3 31 40,3 57,7 VSR B/lavado 1:3 7,7 16,3 20,7 26,3 VSR B-1 0,3 4 9,3 11,7 12,3

ES 2 553 440 T3   Tabla 22. Tasa de reducción de placas (%) para Neutralización con forma IgG de 58c5 Antígeno 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml VSR A2 99,5 100 99 72 46 VSR B/lavado 100 100 95 71 38 21 VSR B-1 100 100 97,6 67,5 24 B. Neutralización de mutantes de escape de VSR resistentes a anticuerpo monoclonal de VSR La forma IgG de 58c5 también se ensayó con respecto a su capacidad para neutralizar varios mutantes de escape de VSR resistentes a anticuerpos monoclonales (proporcionados por el Dr. James Crowe, Universidad de Vanderbilt), como se ha descrito en el Ejemplo 6 anterior. Los MARM, enumerados en la Tabla 23 posterior, derivaron de la cepa de tipo silvestre de VSR A2. MARM 19, generado contra Fab 19 humano (véase, por ejemplo, Crowe et al., Virology, 252: 373-375 (1998)), contiene la mutación de aminoácido isoleucina 266 a metionina. MARM 151, generado contra mAb murino 151, contiene la mutación de aminoácido lisina 272 a asparagina. MARM 1129, generado contra el mAB murino 1129 que es el anticuerpo parental para palivizumab (SYNAGIS), contiene la mutación de aminoácidos serina 275 a fenilalanina. La forma IgG de 58c5 también se ensayó con respecto a su capacidad para neutralizar varios Mutantes Resistentes a Anticuerpos Monoclonales (MARM) de VSR. Los datos se muestran en las Tablas 23-24 posteriores. La Tabla 23 enumera los recuentos de placas para neutralización contra los diversos MARM a diversas concentraciones de anticuerpo. La Tabla 24 enumera la tasa de reducción de placas para neutralización contra los diversos MARM a diversas concentraciones de anticuerpo. Los resultados indican que IgG 58c5 es capaz de neutralizar los tres MARM de VSR. Por lo tanto, el 58c5 se une con un epítopo diferente de la cepa A2 de VSR que Fab 19, mAb murino 1129 y mAb murino 151.

Tabla 23. Recuento de Placas Promedio para Neutralización de la Forma IgG de 58c5 frente a MARM de VSR MARM 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml MARM 19 0,7 16,7 72 89,3 135 143 156 MARM 151 15,3 64,7 112 128 151 151 MARM 1129 2,3 5,7 11,7 17,7 22,3 Tabla 24. Tasa de reducción de placas para Neutralización de la forma IgG de 58c5 frente a MARM de VSR MARM 10 µg/ml 2 µg/ml 0,4 µg/ml 0,08 µg/ml 0,016 µg/ml 0,003 µg/ml 0 µg/ml MARM 19 100 89 53,8 42,7 14 8 MARM 151 100 90 57 26 MARM 1129 100 100 90 74 47 21 Ejemplo 10 Ensayos de competición En este ejemplo, se realizaron ensayos de competición en los que se ensayó IgG Motavizumab IgG (Wu et al. (2007) J. Mol. Biol. 368(3): 652-665) con respecto a su capacidad para competir con Fab 58c5 por la unión con la proteína F de VSR. Como control positivo para competición, la forma IgG de 58c5 compitió contra Fab 58c5.

Brevemente, se prepararon placas de ELISA como se ha descrito en el Ejemplo 1 anterior, con proteína F de VSR cepa A2 recombinante o nativa. Las placas se bloquearon con leche en polvo desgrasada al 4 % en PBS 1x durante 2 horas a 37 ºC seguido de lavado 4x con tampón de lavado (PBS/Tween 20 0,05 %). Se valoró Fab 58c5 en PBS/BSA 3 %/Tween 20 0,01 % de 9 µg/ml a 0,0001 µg/ml (concentraciones reales ensayadas: 9, 3, 1, 0,3, 0,1, 0,03, 0,01, 0,003, 0,001, 0,0003, 0,0001 µg/ml). La forma IgG de 58c5 y Motavizumab se añadieron a concentraciones fijas de 0,5 µg/ml, 0,1 µg/ml, 0,05 µg/ml y 0,01 µg/ml (como se indica en la Tabla 25 posterior). Se añadieron 50 µl de cada uno de los Fab diluidos e IgG de concentración fija simultáneamente a cada pocillo de una placa, por duplicado, como se indica en la Tabla 26 posterior, y las placas se incubaron a 37 ºC durante 2 horas seguido de lavado 4x con tampón de lavado. Se añadió Fc-gamma HRP de cabra anti IgG humano (Jackson

ES 2 553 440 T3   ImmunoResearch, Cat. nº 109-035-098), diluido 1:1000, y las placas se incubaron a 37 ºC durante 1 hora. Después de lavar 6x con tampón de lavado, se añadieron 50 µl de solución de TMB:peróxido 1:1 v/v (Pierce, Cat nº 34021) y se permitió que se revelara durante 7 minutos. La reacción se detuvo inmediatamente mediante la adición de 50 µl de H2SO4 2N y se midió la absorbancia a 450 nm usando un lector de placas de ELISA.

Tabla 25. Ensayos de Competición Antígeno Fab 58c5 Proteína F recombinante Proteína F nativa 9 a 0,0001 µg/ml Forma IgG de 58c5 0,05 µg/ml Forma IgG de 58c5 0,05 µg/ml IgG motavizumab 0,1 µg/ml IgG motavizumab 0,01 µg/ml Los resultados se resumen en la Tabla 26 a continuación. Motavizumab no compite contra Fab 58C5 por la unión con la proteína F de cepa A2 de VSR ni nativa ni recombinante.

Tabla 26. Sumario de Ensayos de Competición IgG Motavizumab Forma IgG de 58c5 Fab 58C5 NO SÍ Ejemplo 11 Generación de MARM de VSR y ensayos de neutralización En este ejemplo, se generaron mutantes de escape de VSR resistentes a anticuerpo monoclonal (MARM) para Motavizumab y la forma IgG de 58C5. Motavizumab y la forma IgG de 58C5 se analizaron adicionalmente con respecto a su capacidad para neutralizar los MARM de nueva generación. A. Generación de MARM 1. Motavizumab Se determinó previamente que la concentración de IgG motavizumab que reduce los títulos virales de VSR en 3 log (correspondiente al 99,9 % de inhibición del virus VSR A2 por ensayo de neutralización) era 3,2 µg/ml. Se preincubaron partículas virales de VSR A2 (2 x 106) con diluciones de IgG motavizumab y esta mezcla se usó para infectar monocapas de células Vero (como se ha descrito en el Ejemplo 6 anterior). Se seleccionaron pocillos con las mayores concentraciones de anticuerpos que aún demostraban efectos citotóxicos para ciclos adicionales de selección. Después de 10 ciclos de selección, se obtuvieron placas de virus que crecieron en presencia de motavizumab 8 µg/ml. Se ensayaron partículas de virus de estas placas en ensayos de neutralización (como se ha descrito en el Ejemplo 6 anterior) y se preparó ARN de partículas positivas usando un kit de extracción RNeasy (Qiagen). Se seleccionaron seis mutantes de escape y el gen F se amplificó por PCR. El ADN se secuenció y los seis clones codificaban una única sustitución de aminoácido de lisina por ácido glutámico en la posición 272 (K272E, SEC ID Nº: 1642) en comparación con la cepa de VSR A2 parental (expuesta en SEC ID Nº: 1629).

La Tabla 27 a continuación expone la mayor concentración de anticuerpo que demuestra efectos citopáticos (CPE) para cada ciclo de selección. Como se muestra en la Tabla 27 a continuación, se identificaron mutantes de escape de motavizumab después de 7 ciclos de selección, como se identificó por una concentración de anticuerpo que demostraba CPE mayor que la concentración de motavizumab que corresponde al 99,9 % de inhibición del virus VSR A2 como se determinó por ensayo de neutralización (es decir, > 3,2 µg/ml).

Tabla 27. Selección de MARM de Motavizumab Ciclo de Selección Concentración de Anticuerpos (µg/ml) 1 0,5 2 0,5 3 0,75 4 1 2

ES 2 553 440 T3   6 3 7 4 8 8 9 8 8 2. La forma IgG de 58C5 Se determinó que la concentración de la forma IgG de 58C5 que reduce los títulos virales de VSR en 3 log (correspondiente a 99,9 % de inhibición del virus VSR A2 por ensayos de neutralización) era 0,8 µg/ml. Las partículas virales de VSR A2 (2 x 106) se preincubaron con diluciones de IgG 58C5 y esta mezcla se usó para infectar monocapas de células Vero (como se ha descrito en el Ejemplo 6 anterior). Se seleccionaron pocillos con las mayores concentraciones de anticuerpo que aún demostraban efectos citotóxicos para ciclos adicionales de selección. Después de 12 ciclos de selección, se obtuvieron placas de virus que habían crecido en presencia de 2 µg/ml de la forma IgG de 58C5. Se ensayaron partículas de virus de estas placas en ensayos de neutralización (como se ha descrito en el Ejemplo 6 anterior) y se preparó ARN de partículas positivas usando un kit de extracción RNeasy (Qiagen). Se seleccionaron cinco mutantes de escape y el gen F se amplificó por PCR. El ADN se secuenció y los cinco clones codificaban tres sustituciones de aminoácidos (N63K, M115K y E295G; SEC ID Nº: 1643) en comparación con la cepa de VSR A2 parental (expuesta en SEC ID Nº: 1629).

La Tabla 28 a continuación expone la mayor concentración de anticuerpo que demuestra efectos citopáticos (CPE) para cada ciclo de selección. Como se muestra en la Tabla 28 a continuación, la forma IgG de los mutantes de escape de 58C5 se identificaron después de 10 ciclos de selección, como se identificó por una concentración de anticuerpos que demostraba CPE mayor que la concentración de la forma IgG de 58C5 que corresponde al 99,9 % de inhibición del virus VSR A2 como se determinó por ensayo de neutralización (es decir, > 0,8 µg/ml).

Tabla 28. Forma IgG de Selección de MARM 58C5 Ciclo de Selección Concentración de Anticuerpos (µg/ml) 1 0,2 2 0,2 3 0,3 4 0,4 0,6 6 0,6 7 0,6 8 0,6 9 0,6 1,2 11 1,6 12 2 B. Ensayos de neutralización Se ensayó motavizumab y la forma IgG de 58C5 con respecto a su capacidad para neutralizar la cepa de virus parental VSR A2, el MARM de motavizumab y la forma IgG de MARM de 58C5. El procedimiento de ensayo de neutralización se ha descrito en el Ejemplo 6 anterior. Los datos se muestran en las Tablas 29-32 posteriores. La Tabla 29 enumera la tasa de reducción de placas para neutralización contra el virus parental VSR A2. La Tabla 30 enumera la tasa de reducción de placas para neutralización contra el MARM de Motavizumab. La Tabla 31 enumera la tasa de reducción de placas para neutralización contra la forma IgG de MARM de 58C5. La Tabla 32 es un sumario de los datos de neutralización (valores de DE50). Los resultados indican que ambos anticuerpos son capaces de neutralizar la cepa de VSR A2 parental, mostrando IgG 58C5 la actividad más fuerte (véase Tabla 29). La forma IgG de 58C5 neutraliza fuertemente el MARM de

ES 2 553 440 T3   motavizumab sin ninguna diferencia en comparación con la cepa parental (véase Tabla 30). Como se esperaba, motavizumab no puede neutralizar el MARM de motavizumab a ninguna de las concentraciones ensayadas. Motavizumab neutraliza fuertemente la forma IgG de MARM de 58C5 sin ninguna diferencia en la potencia de neutralización (véase Tabla 31). Como se esperaba, la forma IgG de 58C5 no puede neutralizar la forma IgG de MARM de 58C5 a ninguna de las concentraciones ensayadas. Los resultados muestran que ambas formas IgG de 58C5 neutralizan el MARM de motavizumab lo que indica ausencia de competición.

Tabla 29. Tasa de reducción de placas para Neutralización de virus parental VSR A2 Anticuerpo 10000 ng/ml 2000 ng/ml 400 ng/ml 80 ng/ml 16 ng/ml 3,2 ng/ml Motavizumab 100,0 z 98,87 82,27 50,40 19,25 0,40 Forma IgG de 58C5 100,0 100,0 99,6 87,0 49,2 6,1 Tabla 30. Tasa de reducción de placas para Neutralización de MARM de Motavizumab Anticuerpo 10000 ng/ml 2000 ng/ml 400 ng/ml 80 ng/ml 16 ng/ml 3,2 ng/ml Motavizumab 13,3 1,7 0,0 0,2 3,3 0,0 IgG 58C5 97,6 95,8 92,0 74,6 43,0 1,5 Tabla 31. Tasa de reducción de placas para Neutralización de MARM de IgG 58C5 Anticuerpo 10000 ng/ml 2000 ng/ml 400 ng/ml 80 ng/ml 16 ng/ml 3,2 ng/ml Motavizumab 94,8 92,9 83,9 47,1 6,5 0,0 IgG 58C5 3,3 0,0 0,0 0,0 0,0 0,0 Tabla 32. Sumario de valores de Neutralización (DE50) VSR A2 Parental (DE50) MARM de Motavizumab (DE50) MARM de IgG 58C5 (DE50) Motavizumab 519 pM >66,7 nM 641 pM IgG 58C5 115 pM 173 pM >66,7 nM Ya que resultarán evidentes modificaciones para los expertos en la materia, se pretende que la presente invención se limite solamente por el alcance de las reivindicaciones adjuntas.

ES 2 553 440 T3  

REIVINDICACIONES

1. Un anticuerpo o fragmento de unión a antígeno del mismo que comprende: una CDR1 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 2; una CDR2 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 3; una CDR3 de VH, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 4; una CDR1 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 6; una CDR2 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 7; y una CDR3 de VL, que comprende la secuencia de restos de aminoácidos expuesta en SEC ID Nº: 8, en el que el anticuerpo o fragmento de unión a antígeno se une inmunoespecíficamente con la proteína de fusión (F) del Virus Sincitial Respiratorio (VSR) y neutraliza VSR.

2. El anticuerpo o fragmento de unión a antígeno de la reivindicación 1, que comprende una cadena pesada expuesta en SEC ID Nº: 1 y una cadena ligera expuesta en SEC ID Nº: 5. 3. El anticuerpo o fragmento de unión a antígeno de la reivindicación 1 o 2, que comprende un dominio VH, en el que la secuencia de aminoácidos del dominio VH se expone como los aminoácidos 1-125 de SEC ID Nº: 1.

4. El anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-3, que comprende una cadena pesada, en el que la secuencia de aminoácidos de la cadena pesada se expone en a SEC ID Nº: 1. 5. El anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-4, que comprende un dominio VL, en el que la secuencia de aminoácidos del dominio VL se expone como los aminoácidos 1-107 de SEC ID Nº: 5. 6. El anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-5, que comprende una cadena ligera, en el que la secuencia de aminoácidos de la cadena ligera se expone en SEC ID Nº: 5.

7. El anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-6 que se une directamente o mediante un enlazador con un dominio de multimerización o se une con un enlazador polipeptídico. 8. El anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-7, que comprende además un dominio de transducción de proteínas.

9. El anticuerpo o fragmento de unión a antígeno de la reivindicación 8, en el que el dominio de transducción de proteínas comprende una secuencia de aminoácidos expuesta en una cualquiera de SEC ID Nº: 1529-1600. 10. Un anticuerpo multivalente, que comprende: una primera parte de unión a antígeno que comprende un anticuerpo o fragmento de unión a antígeno del mismo de la reivindicación 7 en el que la primera parte de unión a antígeno que comprende un anticuerpo o fragmento de unión a antígeno del mismo se conjuga con un dominio de multimerización; y una segunda parte de unión a antígeno que comprende un fragmento de unión a antígeno de un anticuerpo antiviral conjugado con un segundo dominio de multimerización, en el que: el primer dominio de multimerización y el segundo dominio de multimerización son complementarios o iguales, por lo que la primera parte de unión a antígeno y la segunda parte de unión a antígeno forman un anticuerpo multivalente; y las primera y segunda partes de unión a antígeno son iguales o diferentes.

11. El anticuerpo multivalente de la reivindicación 10, en el que la segunda parte de unión a antígeno comprende un anticuerpo anti VSR o fragmento de unión a antígeno del mismo. 12. El anticuerpo multivalente de la reivindicación 10 o reivindicación 11, en el que el anticuerpo anti VSR se selecciona de entre palivizumab, motavizumab, AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsv22, rsv23, RF-1, RF-2 y fragmentos de unión a antígeno de los mismos o un anticuerpo que comprende 58c o sc5 o es un fragmento de unión a antígeno de los mismos.

13. El anticuerpo multivalente de la reivindicación 12, en el que la segunda parte de unión a antígeno se une inmunoespecíficamente con un antígeno de virus paragripal (PIV) o metaneumovirus humano (hMPV). 14. El anticuerpo multivalente de cualquiera de las reivindicaciones 10-13, en el que el dominio de multimerización se selecciona de entre una región constante de inmunoglobulina (Fc), una cremallera de leucina, regiones

ES 2 553 440 T3   hidrófobas complementarias, regiones hidrófilas complementarias y dominios de interacción proteína-proteína compatibles. 15. Una combinación, que comprende: un anticuerpo aislado o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-9 o un anticuerpo multivalente de cualquiera de las reivindicaciones 10-14; y uno o ambos de un agente antiviral y uno o más anticuerpos antivirales adicionales que difieren del primer anticuerpo.

16. La combinación de la reivindicación 15: el o los anticuerpos antivirales adicionales se seleccionan de entre palivizumab, motavizumab, AFFF, P12f2, P12f4, P11d4, A1e9, A12a6, A13c4, A17d4, A4B4, A8c7, 1X-493L1, FR H3-3F4, M3H9, Y10H6, DG, AFFF(1), 6H8, L1-7E5, L2-15B10, A13a11, A1h5, A4B4(1), A4B4L1FR-S28R, A4B4-F52S, rsv6, rsv11, rsv13, rsv19, rsv21, rsy22, rsv23, RF-1, RF-2 y fragmentos de unión a antígeno de los mismos; y/o el o los anticuerpos antivirales adicionales se seleccionan de entre un anticuerpo o fragmento de unión a antígeno del mismo que se une inmunoespecíficamente con un antígeno de virus paragripal (PIV) o metaneumovirus humano (hMPV).

17. Un método para detectar infección por VSR que comprende: (a) ensayar el nivel de antígeno de VSR en un fluido, célula o muestra tisular usando un anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-9; (b) comparar el nivel ensayado de antígeno de VSR con un nivel de control de modo que un aumento en el nivel ensayado de antígeno de VSR en comparación con el nivel de control del antígeno de VSR es indicativo de una infección por VSR.

18. Una molécula o moléculas de ácido nucleico que codifican el anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-9. 19. Una célula aislada, que comprende el anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-9, o las moléculas de ácido nucleico de la reivindicación 18.

20. Un método para producir un anticuerpo o fragmento de unión a antígeno del mismo, que comprende cultivar la célula de la reivindicación 19 en condiciones en las que se expresa el anticuerpo codificado o fragmento de unión a antígeno. 21. Anticuerpo o fragmento de unión a antígeno de cualquiera de las reivindicaciones 1-9 o un anticuerpo multivalente de cualquiera de las reivindicaciones 10-14 para uso en el tratamiento o la prevención de una infección viral.