1,715 Patentes de noviembre de 2015 (pag. 35)

  1. 1089.-

    Procedimiento de producción de un componente de motor y componente de motor

    (11/2015)

    Procedimiento de producción de un componente de motor, en particular de un émbolo para un motor de combustión, en el que se cuela una aleación de aluminio en el procedimiento de colada a presión, en el que la aleación de aluminio está compuesta por los siguientes elementos de aleación: silicio: del 11 % en peso al 14,5 % en peso, níquel: del 3,6 % en peso al 5 % en peso, opcionalmente del 3,8 % en peso al 4,5 % en peso cobre: del 3,7 % en peso al 5,2 % en peso, magnesio: del 0,5 % en peso al 1,5 % en peso, hierro: del 0,6 % en peso al 1,5 % en peso, opcionalmente del 0,9 % en peso al 1,1 % en peso manganeso: del 0,2 % en peso al 0,4 % en peso, circonio:...

  2. 1090.-

    Composición insecticida y miticida de amplio espectro que comprende una espinosina y al menos otro insecticida o miticida

    (11/2015)

    Uso de una composición para proteger plantas y/o productos de planta de plagas de insectos o ácaros, en el que la composición es una composición insecticida y miticida, medioambientalmente segura, no fitotóxica, que comprende: al menos una espinosina; al menos uno de un insecticida y miticida adicional de la familia de los ácidos grasos seleccionado del grupo que consiste en un éster de azúcar de ácido graso, y una sal de ácido graso seleccionada de sales de ácidos grasos de potasio, sodio y amonio de ácidos grasos saturados o insaturados con longitudes de cadena de carbono que oscilan de C8 a C18; y al menos uno de un disolvente y un soporte, en...

  3. 1091.-

    DISPOSITIVO Y PROCEDIMIENTO PARA LA MEDICIÓN DE LA HUMEDAD EN MOLDES DE FUNDICIÓN A PRESIÓN

    (11/2015)
    Solicitante/s: FONDAREX S.A. Inventor/es: BAUMGARTNER,KONRAD, HUGUENIN-VUILLEMIN YVES,Gérard Laurent. Clasificación: B22D17/32, B22D17/14, B22D2/00.

    La invención se refiere a un dispositivo y a un procedimiento para la medición de la humedad en moldes de fundición a presión , cuyo espacio hueco del molde está conectado a través de un conducto de ventilación con un dispositivo de ventilación . El dispositivo configurado de manera modular puede conectarse con el conducto de ventilación y comprende una disposición de sensores (S), mediante la cual puede medirse la humedad de gases extraídos del espacio hueco del molde . La disposición de sensores (S) presenta un emisor que emite radiación electromagnética y un receptor que detecta radiación electromagnética. Debido a los valores de medición determinados durante el proceso de evacuación, puede determinarse si la cantidad de una mezcla de agua y medio desmoldeador, que se inyecta antes del proceso de fundición propiamente dicho en el espacio hueco del molde , ha de modificarse.

  4. 1092.-

    Estuche de maquillaje para bolso

    (11/2015)

    1. Estuche de maquillaje para bolso que comprende una base dotada de una tapa caracterizada por tener un espejo que ocupa la totalidad del espacio interior de dicha tapa. 2. Estuche de maquillaje para bolso, según reivindicación 1, caracterizado por la estructura rígida de sus piezas y articuladas y abatibles una sobre la otra, y también caracterizado por sus dimensiones no menores de: largo 16 x ancho x 12 x alto 2 centímetros, y no mayores de: largo 38 x ancho 26 x alto 5 centímetros. 3. Estuche de maquillaje para bolso, según reivindicaciones 1 y 2, donde su base contiene en su interior una plataforma dotada de alveolos caracterizados...

  5. 1093.-

    Dispositivo de limpiaparabrisas

    (11/2015)

    Dispositivo de limpiaparabrisas, en particular para un limpiaparabrisas de una luneta de un vehículo a motor, con un motor del limpiaparabrisas con uno o varios árboles de salida , con uno o varios brazos del limpiaparabrisas que respectivamente pueden fijarse a una sección del extremo (3a) del árbol de salida mediante un mecanismo de fijación , donde el mecanismo de fijación presenta una pieza de unión , en donde se proporciona una perforación realizada de forma complementaria con respecto a la sección del extremo (3a) del árbol de salida , en donde puede insertarse el árbol de salida para la fijación de la pieza de unión en el motor...

  6. 1094.-

    Uso de flibanserina para el tratamiento de trastornos del deseo sexual después de la menopausia

    (11/2015)

    El uso de flibanserina, opcionalmente en la forma de la base libre, las sales de adición de ácido farmacéuticamente aceptables y/o opcionalmente en la forma de hidratos y/o solvatos de las mismas para la preparación de un medicamento para el tratamiento del trastorno del deseo sexual hipoactivo adquirido en mujeres después de la menopausia, caracterizado porque se administran 100 mg de flibanserina una vez al día solo al anochecer de forma consecutiva durante un periodo de tiempo.

  7. 1095.-

    Antena para la recepción de TV digital terrestre

    (11/2015)

    Antena para la recepción de televisión digital terrestre que comprende un reflector que comprende un orificio pasante , una barra de unión y un elemento de soporte en el que se distribuyen una pluralidad de elementos directores , siendo la barra de unión y el elemento de soporte dos elementos diferentes, atravesando la barra de unión el orificio pasante y estando un extremo de la barra de unión alojado en el interior del elemento de soporte caracterizada porque el reflector está unido a la barra de unión mediante un mecanismo de anclaje rápido que comprende al menos un pitón asociado a la barra de unión , y al menos un orificio...

  8. 1096.-

    Dispositivo que impide el reflujo para su instalación entre un dispositivo sanitario y el suministro de agua

    (11/2015)

    Dispositivo de comprobación de flujo que puede ser conectado entre un sistema sanitario y un sistema de agua corriente, que comprende: un depósito que presenta una abertura de entrada de agua prevista en una parte superior del depósito y una abertura de salida de agua para la comunicación fluídica con el sistema sanitario; una válvula que puede ser conectada entre la abertura de entrada de agua del depósito y el sistema de agua corriente de manera que se regule un flujo de agua del sistema de agua corriente a la abertura de entrada de agua del depósito; un paso de rebose que presenta una entrada de rebose dispuesta en el interior...

  9. 1097.-

    Uso de VEGF y homólogos para tratar trastornos neurológicos

    (11/2015)

    Uso de la isoforma VEGF145 o VEGF189 de VEGF-A para la fabricación de un medicamento para tratar cualquiera de: demencia del lóbulo frontotemporal, enfermedad de Alzheimer, enfermedad de Parkinson, enfermedad de Huntington y trastornos de las neuronas motoras.

  10. 1098.-

    Polo de uñas con punto de centrado

    (11/2015)

    Máquina eléctrica , particularmente alternador trifásico para vehículos, con un estator y un rotor , que comprende un primero y un segundo polos de uñas , desde los que se extienden dedos de polo de uñas en la dirección axialmente de las raíces del polo de uñas , caracterizada porque en un radio posterior de las raíces del polo de uñas se configura un medio de centrado para una herramienta.

  11. 1099.-

    Palé de transporte para recipientes de gas comprimido

    (11/2015)

    Palé de transporte para transportar bombonas de gas comprimido por medio de un vehículo transportador de suelo, que comprende una placa de fondo y una estructura de bastidor unida con la placa de fondo para asegurar las bombonas de gas comprimido contra su caída lateral durante el transporte, caracterizado por que la placa de fondo está dispuesta de manera verticalmente desplazable con respecto a la estructura de bastidor y puede ser inmovilizada en al menos dos posiciones de funcionamiento, descansando la placa de fondo sobre un suelo en una primera posición de funcionamiento y presentando dicha placa en una segunda posición de funcionamiento...

  12. 1100.-

    Procedimiento de tratamiento de una pieza de titanio o aleación de titanio y pieza obtenida

    (11/2015)

    Procedimiento de tratamiento de superficie de al menos una pieza de titanio o de aleación a base de titanio según el que: - se dispone la o las piezas en un contenedor que se coloca en un recipiente de tratamiento que contiene un medio gaseoso, - se calienta la o las piezas a una temperatura de tratamiento, - se genera al menos una especie química activada por activación del medio gaseoso en el exterior del contenedor, estando la pared del contenedor cerrada con excepción de al menos un intersticio cuya dimensión de abertura impide la ignición del plasma en el interior del contenedor pero permite el paso de al menos una especie activada, -...

  13. 1101.-

    Dispositivo de aislamiento sísmico con múltiples núcleos y engranajes

    (11/2015)

    Dispositivo de aislamiento sísmico con múltiples núcleos y engranajes. La presente invención es un sistema de aislamiento basado en la rodadura para la protección antisísmica de sistemas estructurales y no estructurales. Proporciona en una única unidad todas las funciones necesarias de: 1) soporte vertical rígido; 2) flexibilidad horizontal con garantía de estabilidad; 3) disipación de energía; 4) resistencia a vibraciones menores; 5) recentrado; 6) limitación de desplazamientos máximos. La invención proporciona puntos de contacto múltiples durante la rodadura en lugar de un punto de contacto único como en los dispositivos rodantes existentes....

  14. 1102.-

    Dispositivo de alimentación de emergencia aplicable a instalaciones de iluminación con lámparas LED

    (11/2015)

    Dispositivo de alimentación de emergencia aplicable a instalaciones de iluminación con lámparas LED; que comprende: un circuito de alimentación (CAlim.) de una lámpara LED; un cargador (Carg.) de baterías (Bat.), conectado a una red de suministro de corriente alterna a una instalación principal de iluminación; una batería (Bat.) conectada al cargador (Carg.) y al circuito de alimentación (CAlim.) de la lámpara de LED a través de un convertidor de tensión (Conv.) que suministra una tensión de salida al circuito de alimentación (CAlim.) de la lámpara LED (LLED); un interruptor (Int2) que conecta el circuito de alimentación (CAlim.) de la...

  15. 1103.-

    Procedimiento para la eficiente omisión del exón (44) en distrofia muscular de Duchenne y medios asociados

    (11/2015)

    Un oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEC ID Nº: 5).

  16. 1104.-

    Caja apilable

    (11/2015)

    1. Caja apilable, que estando obtenida a partir del desarrollo de una lámina esencialmente rectangular con líneas de corte y doblez para definir un sector central y mayoritario que define el fondo de la caja, dos sectores laterales dobles que van a formar los laterales de la caja y otros sectores extremos, también con extensiones para formar una doble pared en correspondencia con los testeros, contando además con unas prolongaciones laterales en correspondencia con los testeros, con líneas de plegado transversales para formar tres sectores plegables y adosables al lateral y testero en correspondencia con cada esquina de la caja, definiéndose un...

  17. 1105.-

    Evaporador por termosifón

    (11/2015)

    Evaporador para el intercambio térmico entre fluidos, que comprende un alojamiento que tiene al menos una entrada y al menos una salida para cada fluido, estando la entrada y la salida para cada fluido conectadas entre sí por una trayectoria del flujo , comprendiendo la trayectoria del flujo de un primer fluido múltiples módulos de intercambio térmico al menos un tubo hueco longitudinal , en el que los módulos se disponen en una pila separada del alojamiento dejando libre un hueco , en el que el evaporador comprende un primer distribuidor para conectar la entrada para el primer fluido a la trayectoria del flujo del...

  18. 1106.-

    Placa de cocina por inducción

    (11/2015)

    Una placa de cocina por inducción que comprende una pluralidad de inductores que no se solapan dispuestos con sus centros en unas circunferencias concéntricas , en donde el tamaño de dichos inductores de dicha pluralidad sigue una ley monótona decreciente a medida que aumenta la distancia desde el centro de dichas circunferencias, caracterizada por que dicha placa de cocina por inducción comprende además un inductor central cuyo centro coincide sustancialmente con el centro de dichas circunferencias concéntricas , en donde dicho inductor central es mayor que los inductores de dicha pluralidad de inductores.

  19. 1107.-

    Procedimiento para la asignación de recursos en modo paquete en un sistema de radiocomunicaciones móviles

    (11/2015)

    Procedimiento para la asignación de recursos en modo paquete en un sistema de radiocomunicaciones móviles en modo paquete de tipo GPRS, procedimiento que consta de una etapa en la que: - una estación móvil (MS) transmite a la red (BSS), para unas necesidades de transferencia de datos de señalización, en una celda que soporta el mensaje EGPRS Packet Channel Request, un mensaje EGPRS Packet Channel Request que incluye una causa que especifica las necesidades de transferencia de datos de señalización.

  20. 1108.-

    Cápsula, sistema y método para preparar una bebida

    (11/2015)

    Sistema para preparar una cantidad predeterminada de bebida adecuada para el consumo usando un producto extraíble, que comprende: una cápsula intercambiable ; y un aparato que comprende un dispositivo dispensador de fluido para suministrar una cantidad de un fluido, tal como agua, bajo una presión de al menos seis bars a la cápsula intercambiable, y un receptáculo para contener la cápsula intercambiable; en donde la cápsula intercambiable comprende una primera pared circunferencial , una segunda pared que cierra la primera pared circunferencial en un primer extremo , y una tercera pared que cierra la primera...

  21. 1109.-

    Tobera de rotor para un aparato de limpieza de alta presión

    (11/2015)

    Tobera de rotor para un aparato de limpieza de alta presión con una carcasa , que presenta al menos una entrada que desemboca tangencialmente en la carcasa para un líquido y que está dotada, en una pared frontal , de una depresión en forma de cubeta atravesada centralmente, y con un cuerpo de tobera dispuesto en la carcasa , que presenta un canal de paso y que se apoya con un extremo esférico en la depresión en forma de cubeta, cuyo eje longitudinal está inclinado respecto al eje longitudinal de la carcasa , en donde el líquido en la carcasa puede hacerse rotar alrededor del eje longitudinal de la carcasa mediante...

  22. 1110.-

    Uso de inhibidores de la vía del complemento para tratar enfermedades oculares

    (11/2015)

    Un inhibidor del complemento para uso en un método para el tratamiento de una enfermedad ocular asociada con la activación del complemento de un sujeto, en donde el inhibidor del complemento es un anticuerpo o un fragmento de unión a antígeno del mismo o un ácido nucleico que codifica el anticuerpo o fragmento de unión a antígeno, en donde el anticuerpo o fragmento de unión a antígeno del mismo se une específicamente a Factor D.

  23. 1111.-

    Proyector y órgano de pulverización de producto de revestimiento y procedimiento de proyección que emplea dicho proyector

    (11/2015)

    Proyector rotatorio (P) de producto de revestimiento que consta de: - un cuerpo fijo , - un órgano de pulverización del producto de revestimiento, - medios impulsores en rotación (T) del órgano de pulverización alrededor de un eje de rotación (X1; X101; X201; X301; X401), - medios de alimentación del órgano de pulverización con producto de revestimiento, Comprendiendo el órgano de pulverización del producto de revestimiento: - al menos una superficie de flujo que recibirá el producto de revestimiento, - al menos una arista para pulverizar el producto de revestimiento, estando la arista en comunicación...

  24. 1112.-

    Caracterización de la función génica usando inhibición por ARN bicatenario

    (11/2015)

    Un método para introducir ARNbc o ADN capaz de producir ARNbc en un organismo no humano, comprendiendo dicho método suministrar a dicho organismo un microorganismo adecuado que comprende un vector de expresión que comprende un promotor o promotores orientados en relación con una secuencia de ADN de manera que sean capaces de iniciar la transcripción de dicha secuencia de ADN en ARN bicatenario tras la unión de un factor de transcripción apropiado a dicho promotor o promotores o suministrar a dicho organismo directamente dicho vector de expresión.

  25. 1113.-

    Utensilios de higiene bucodental

    (11/2015)

    Un cepillo dental o recambio de cepillo dental que tiene una parte de cabezal dimensionada para su inserción en una boca humana, comprendiendo la parte de cabezal: una base ; y una pluralidad de elementos elastoméricos que se extienden desde la base, definiendo cada elemento elastomérico uno o más bordes, siendo un número total de bordes definidos por la pluralidad de elementos elastoméricos que tienen un radio de punta inferior a aproximadamente 0,1524 mm superior a aproximadamente 250, y estando la dureza Shore A de los elementos elastoméricos en un intervalo de entre 8 Shore A y 95 Shore A, y siendo una separación intra- y/o entre-elementos...

  26. 1114.-

    Dispositivo de bloqueo de seguridad con mecanismo de desbloqueo para escape

    (11/2015)

    Dispositivo de bloqueo de seguridad que comprende: a) una unidad de cerrojo para montar sobre el lado seguro en una puerta hacia una zona de peligro, esta unidad de cerrojo comprende una guía que puede fijarse en la puerta y un cerrojo guiado en la guía con manipulador , b) una jaula de cerrojo para montar en un marco de puerta que actúa conjuntamente con la puerta . c) y un mecanismo de desbloqueo para escape para desbloquear el dispositivo de bloqueo de seguridad para abrir la puerta bloqueada desde la zona de peligro y poder huir de la zona de peligro, caracterizado por que e) la jaula de cerrojo...

  27. 1115.-

    Proteína E1E2 del VHC adyuvantada con MF59 más vector de alfavirus que codifica E1E2 del VHC para provocar linfocitos T específicos del VHC

    (11/2015)

    Una primera composición que comprende un complejo de proteína E1E2 del virus de la hepatitis C (VHC) y un adyuvante MF59, para su uso en un procedimiento de estimulación de una respuesta inmunitaria en un sujeto vertebrado, comprendiendo dicho procedimiento: administrar al menos una vez la primera composición a dicho sujeto vertebrado; y posteriormente administrar al menos una vez una segunda composición que comprende un vector de alfavirus que comprende un ácido nucleico que codifica un complejo de E1E2 del VHC a dicho sujeto vertebrado, por la cual el ácido nucleico que codifica un complejo de E1E2 del VHC se expresa en una...

  28. 1116.-

    Polímeros funcionalizados de hidroxiarilo

    (11/2015)

    Un método para preparar un polímero funcional que comprende al menos una unidad de funcionalización y uno o más tipos de meros de polieno, comprendiendo dicha unidad de funcionalización un grupo arilo que tiene al menos un grupo OR directamente enlazado en donde R es un grupo protector hidrolizable, comprendiendo dicho método: a) proporcionar una solución que comprende un compuesto iniciador y uno o más tipos de monómeros etilénicamente insaturados que incluyen al menos un tipo de polieno y un compuesto representado por la fórmula general CH2≥CHR1 donde R1 es un grupo arilo sustituido o no sustituido que tiene al menos...

  29. 1117.-

    Dispositivo de compensación activo de corrientes armónicas

    (11/2015)

    Dispositivo de compensación activo de las corrientes armónicas de una corriente principal para una conexión en paralelo en un circuito de entrada de un convertidor , que consta de: - un sensor de corriente de alimentación; - un generador de corriente apto para inyectar una corriente de entrada del convertidor en función de la intensidad de la corriente armónica medida por el sensor de corriente en una línea de suministro de potencia, siendo el generador de corriente apto para generar e inyectar en la entrada del convertidor , además de la corriente armónica, una corriente k veces superior a la corriente armónica...

  30. 1118.-

    Método para reparar un componente de aleación de aluminio

    (11/2015)

    Un método para reparar un componente de aleación de aluminio endurecida por precipitación, incluyendo los pasos de: a) depositar por pulverización en frío sobre dicho componente a reparar una porción de material suministrado que tiene una composición idéntica a la de dicho componente a reparar, obteniendo así un componente parcialmente reparado; b) someter dicho componente parcialmente reparado a un tratamiento térmico, obteniendo así un componente reparado, seleccionándose las condiciones para realizar dicho tratamiento térmico en función de la composición y de las tolerancias dimensionales de dicho componente, caracterizado...

  31. 1119.-

    Concentrador de oxígeno

    (11/2015)

    Un concentrador de oxígeno por adsorción de tipo inversor de presión provisto de una cama de absorción rellena con un adsorbente que selectivamente adsorbe nitrógeno respecto de oxígeno y de un dispositivo de suministro de aire comprimido configurado para suministrar aire comprimido a la cama de adsorción, adsorbiendo y eliminando nitrógeno de aire como materia prima para producir oxígeno no adsorbido, el concentrador comprende: un dispositivo de ajuste del caudal para suministrar el gas oxígeno a un caudal determinado y un sensor de concentración de oxígeno configurado para detectar la concentración de gas...

  32. 1120.-

    Pasador para puertas cortafuego de dos hojas

    (11/2015)

    Con el fin de impedir que la puerta se abra en caso de incendio, preservando así la estanqueidad del recinto protegido frente a la acción del fuego, y, permitir que la puerta se abra por los ocupantes del recinto en caso de evacuación, se diseña la presente invención. El pasador para puertas cortafuego de dos hojas está compuesto por dos piezas metálicas: una lengüeta y una chapa de enganche en la hoja, que están unidas mecánicamente a las hojas de la puerta y enfrentadas entre sí, de forma que el conjunto se ensambla perfectamente al cerrarse la puerta y deja una holgura suficiente entre las piezas que permite que éstas...

<< · 18 · 26 · 30 · 32 · 33 · < · 35 · > · 37 · 39 · 44 · >>