1,715 Patentes de noviembre de 2015 (pag. 11)

  1. 321.-

    Producción aumentada de lípidos que contienen ácidos grasos polienoicos mediante cultivos de alta densidad de microbios eucariotas en fermentadores

    (11/2015)

    Procedimiento para producir lípidos que contienen ácidos grasos polienoicos a partir de microorganismos eucariotas capaces de producir por lo menos aproximadamente el 20% de su biomasa en forma de lípidos, que comprende añadir a un medio de fermentación que comprende dichos microorganismos una fuente de carbono no alcohólica y una fuente de nutrientes limitadora en una proporción suficiente para incrementar la densidad de biomasa de dicho medio de fermentación hasta por lo menos aproximadamente 100 g/l.

  2. 322.-

    LÍQUIDOS ZWITTERIÓNICOS GEMINALES RAMIFICADOS, PROCESO DE OBTENCIÓN Y USO COMO MODIFICADORES DE LA MOJABILIDAD CON PROPIEDADES REDUCTORAS DE LA VISCOSIDAD

    (11/2015)

    La presente invención se relaciona con el proceso de obtención y uso de líquidos zwitteriónicos geminales ramificados base bis-N,N-dialquil-N-poliéter-betaína o bis-N,N-dialquenil-N-poliéter-betaína o bis-N,N-dicicloalquil-N-poliéter-betaína o bis-N,N-diaril-N-poliéter-betaína, como modificadores de la mojabilidad de rocas como caliza, dolomita, arenisca, cuarzo o litologías heterogéneas, en presencia de salmueras con alto contenido de iones divalentes como calcio, magnesio, bario y estroncio, alta temperatura y alta presión en procesos de recuperación mejorada de petróleo para incrementar la producción de petróleo. Los líquidos zwitteriónicos...

  3. 323.-

    COMPOSICIONES ALIMENTARIAS QUE COMPRENDEN SALES DE TUNGSTENO (VI)

    (11/2015)
    Solicitante/s: OXOLIFE, S. L. Inventor/es: CANALS ALMAZÁN,Ignacio, ARBAT BUGIÉ,Agnès. Clasificación: A23L1/304, A23L2/52.

    Composiciones alimentarias que comprenden sales de tungsteno (VI) así como su preparación, para favorecer la fertilidad y la reproducción normal en un mamífero hembra no diabético.

  4. 324.-

    Vacuna neumocócica y usos de la misma

    (11/2015)

    Una vacuna neumocócica que comprende sacáridos de los serotipos 4, 6B, 9V, 14, 18C, 19F y 23F conjugados individualmente a CRM197 y al menos un agonista de TLR-9 como coadyuvante, en la que dicho, al menos un, agonista de TLR-9 es un oligonucleótido de CpG que tiene la secuencia de ácidos nucleicos seleccionada del grupo que consiste en: 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEC ID N.º: 3), 5' TCGTCGTTTTTCGGTCGTTTT 3' (SEC ID N.º: 4), 5' TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEC ID N.º: 5), 5' TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEC ID N.º: 6) y 5' TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEC ID N.º: 7) para su uso en la prevención o el tratamiento de enfermedades provocadas por infección...

  5. 325.-

    Oligosacáridos de algina y derivados de los mismos, así como fabricación y uso de los mismos

    (11/2015)

    Derivados del oligosacárido de alginato de acuerdo con la siguiente fórmula (II), o sales farmacéuticamente aceptables de los mismos, en los que el oligosacárido de alginato está compuesto por ácido β-D-manurónico unido mediante enlaces α-1,4 glucosídicos:**Fórmula** en la que n representa 0 o un número entero de 1 a 19.

  6. 326.-

    Disposición de iluminación que comprende una moqueta con iluminación posterior para proporcionar efectos de luz dinámicos con la moqueta

    (11/2015)

    Una disposición de iluminación que comprende una estructura de moqueta y una unidad de control , en la que la estructura de moqueta comprende: • un sistema de iluminación posterior de moqueta que comprende una unidad de iluminación posterior de moqueta que presenta una cara delantera de unidad de iluminación que comprende una fuente de luz dispuesta para generar luz , comprendiendo además el sistema de iluminación posterior de moqueta una pluralidad de dichas fuentes de luz ; • una unidad de moqueta transmisora de luz que comprende una cara delantera de unidad de moqueta y un lado trasero de unidad de moqueta , caracterizada...

  7. 327.-

    Producto de material compuesto de aglomerante inorgánico y fibras vegetales, y método para su fabricación

    (11/2015)

    Producto de material compuesto de aglomerante inorgánico y fibras vegetales celulósicas; constituido dicho producto en forma de placa, que comprende: - una primera capa externa constituida por una pasta rica en aglomerante y sin fibras de refuerzo, - una matriz inorgánica mineral, que contiene cemento, cal o yeso, material puzolánico y aditivo fluidificante; e incluye varias capas de tejido no tejido (T), superpuestas, con un espesor de 2 a 4 milímetros, con un gramaje comprendido entre 200 y 600 gr/m2; constituidas por fibras vegetales celulósicas de una longitud comprendida entre 3 y 6 centímetros, unidas por punzonado y - una segunda capa externa...

  8. 328.-

    Balanza de autoservicio antirrobo

    (11/2015)

    Balanza de autoservicio antirrobo para productos en bolsa , con una estructura que comprende dispositivo de pesaje , panel selector de producto , sistema impresión de etiquetas con ranura , y unidad de control de funcionamiento, y además sistema de cierre automático de las bolsas asociado a la unidad de control y sistema de etiquetado automático. Sistema de cierre automático asociado al dispositivo de pesaje con dispositivo de agarre mecanismo de desplazamiento y dispositivo de cierre de la bolsa. Sistema de etiquetado automático en que la ranura está situada en un punto donde las etiquetas se incorporan por sí mismas a la bolsa...

  9. 329.-

    Tablero para sistema de ocultación y/o de cierre de láminas orientables y persiana enrollable que comporta tal tablero

    (11/2015)

    Tablero para sistema de ocultación y/o de cierre de edificio que comporta láminas orientables (2A) diseñadas capaces de ser empujadas en una posición calada o de cierre bajo la acción de medios de transmisión 5 adaptados, comportando este tablero: - medios de accionamiento al nivel de los extremos laterales de las láminas (2; 2A 2B) para el control del despliegue y del repliegue de dicho tablero , mientras que los medios de transmisión son: - asociados con dichos medios de accionamiento con una movilidad relativa respecto a estos últimos 10 para, en posición desplegada del tablero , controlar, según el caso, la apertura o el cierre de...

  10. 330.-

    Agentes antibacterianos

    (11/2015)

    Un compuesto de acuerdo con la fórmula I:**Fórmula** o un estereoisómero, sal farmacéuticamente aceptable o éster de la misma, en el que E está ausente o está seleccionado del grupo que consiste en H, alquilo C1-C6 sustituido o sin sustituir, arilo sustituido o sin sustituir, heterociclilo sustituido o sin sustituir, y heteroarilo sustituido o sin sustituir; L está ausente o está seleccionado del grupo que consiste en alquilo C1-C6 sustituido o sin sustituir, -(NH)0-1-(CH2)j-NR3L-(CH2)k-, -(NH)0-1C(R1L, R2L)-NR3L-C(R1L, R2L)-, -C(R1L, R2L)-O-C(R1L, R2L)-, -(CH2)j-NR3L-C(R1L, R2L-CONH-(CH2)k-, ...

  11. 331.-

    Pinza de aneurisma

    (11/2015)

    Pinza quirúrgica , especialmente pinza de aneurisma, con dos partes de pinza (2a, 2b) unidas entre sí que pueden girar, que presentan respectivamente un brazo de sujeción (5a, 5b), un brazo operativo (6a, 6b) y una sección anular (7a, 7b) situada en medio con una abertura (8a, 8b), y con un resorte de brazos que pretensa las dos partes de pinza (2a, 2b) en una posición de giro inicial, estando formado el cojinete giratorio de las dos partes de pinza (2a, 2b) por un casquillo de cojinete , estando dispuesto el resorte de brazos con su cuerpo de espiras (4a) al menos parcialmente dentro del casquillo de cojinete y siendo circulares las aberturas...

  12. 332.-

    Cocina encimera y procedimiento para controlarla

    (11/2015)

    Una cocina encimera que comprende una superficie de soporte adaptada para recibir por lo menos una olla (4, 4b), una interfaz de usuario (5, 5b) que permite a un usuario ajustar un parámetro de funcionamiento de dicha cocina encimera, y una unidad de control adaptada para detectar la posición de dicha por lo menos una olla (4, 4b) y para controlar el funcionamiento de dicha cocina encimera en función de comandos recibidos a través de dicha interfaz de usuario (5, 5b), donde dicha unidad de control está adaptada para situar dicha interfaz de usuario (5, 5b) cerca de dicha posición detectada de dicha por lo menos una olla (4, 4b), caracterizada...

  13. 333.-

    Boquilla de inyección multicombustible mejorada

    (11/2015)

    Boquilla multicombustible para un motor de una turbina de gas que comprende: un cuerpo principal anular que comprende una pluralidad de canales para gas combustible, todos dispuestos circunferencialmente alrededor del eje longitudinal de un cuerpo principal; un cuerpo anular para fueloil dispuesto dentro del cuerpo principal anular y que comprende un canal central de combustible coaxial con el eje longitudinal del cuerpo principal; un canal anular de aire de refrigeración entre el cuerpo principal anular y el cuerpo para el fueloil; y un cuerpo independiente para el aire de refrigeración que comprende una guía configurada para...

  14. 334.-

    Material de moldeo, material preimpregnado, material compuesto reforzado con fibra, laminado de material compuesto reforzado con fibra y proceso para la producción de material de base de moldeo reforzado con fibra

    (11/2015)

    Un material de moldeo que comprende: un material compuesto que comprende del 1 al 50 % en peso de (A) un haz de fibras de refuerzo continuas y del 0,1 al 40 % en peso de (B) un prepolímero de poli(sulfuro de arileno) o (B') un poli(sulfuro de arileno); y del 10 al 98,9 % en peso de (C) una resina termoplástica adherida a dicho material compuesto; en el que dicho material compuesto comprende además (D) un compuesto de metal de transición de valencia cero o (E) un compuesto de hierro de valencia baja en una cantidad del 0,001 al 20 % en moles basado en la cantidad de átomos de azufre contenida en dichos componentes (B) o (B').

  15. 335.-

    Quemador modulante para combustibles líquidos y caldera modulante

    (11/2015)

    El objeto de la presente invención es un quemador modulante para combustibles líquidos de aplicación doméstica, así como la caldera que comprende dicho quemador. El quemador comprende medios que permiten también que pueda ser alimentada con gasóleo C, biodiesel o aceites vegetales en proporciones adecuadas.

  16. 336.-

    PROCEDIMIENTO Y SISTEMA DE ELIMINACIÓN DE MICROCONTAMINANTES ORGÁNICOS EN AGUAS RESIDUALES MEDIANTE UN REACTOR ENZIMÁTICO DE MEMBRANA CERÁMICA

    (11/2015)
    Ver ilustración. Solicitante/s: UNIVERSIDADE DE SANTIAGO DE COMPOSTELA. Inventor/es: LEMA RODICIO,JUAN MANUEL, FEIJOO COSTA,GUMERSINDO, MOREIRA VILAR,MARIA TERESA, EIBES GONZÁLEZ,Gemma, ARCA RAMOS,Adriana. Clasificación: C02F3/34.

    Procedimiento y sistema de eliminación de microcontaminantes orgánicos en aguas residuales mediante un reactor enzimático de membrana cerámica. La invención se refiere a un procedimiento y sistema de eliminación de microcontaminantes orgánicos presentes en efluentes secundarios de EDAR o efluentes industriales por enzimas ligninolíticas, del tipo peroxidasa o lacasa, en reactores enzimáticos de membrana (REM) cerámica de ultrafiltración o nanofiltración. El agua a tratar, tras un pretratamiento de filtración para minimizar la concentración de coloides, se introduce en el reactor, donde se encuentra la enzima: peroxidasa o lacasa, en forma libre. La salida del reactor se bombea a la membrana cerámica, separándose en dos corrientes. La corriente de retenido, que contiene la enzima, se recircula al reactor. La corriente de permeado, que constituye el efluente del REM, está libre de microcontaminantes y puede descargarse al ambiente acuático.

  17. 337.-

    MÉTODO DE OBTENCIÓN DE DATOS ÚTILES PARA EL DIAGNÓSTICO DE HEPATOCARCINOMA EN PACIENTES ALCOHÓLICOS CON HEPATITIS C

    (11/2015)
    Solicitante/s: SERVICIO ANDALUZ DE SALUD. Inventor/es: FERRÍN SÁNCHEZ,Gustavo, DE LA MATA GARCÍA,Manuel, RODRÍGUEZ PERÁLVAREZ,Manuel Luis. Clasificación: G01N33/50, G01N33/533.

    Método de obtención de datos útiles para el diagnóstico de hepatocarcinoma en individuos alcohólicos con hepatitis Ca partir de muestras biológicas, kit y usos.

  18. 338.-

    SISTEMA DINÁMICO DE CALEFACCIÓN

    (11/2015)
    Ver ilustración. Solicitante/s: MARTÍ FIBLA, Lluc. Inventor/es: MARTÍ FIBLA,Lluc, MARTIN SERRANO,Lara. Clasificación: F24D13/02.

    Sistema dinámico de calefacción, que se constituye en forma de una superficie radiante, comprendiendo una formación de cubrimiento mediante baldosas, cada una de las cuales incorpora en su interior al menos una resistencia eléctrica calefactora y un sensor térmico medidor de temperatura, disponiéndose por debajo de la formación de cubrimiento una red de conexión en forma de malla, sobre cuyos nudos se conectan las baldosas eléctricamente y en comunicación de datos, mientras que dicha red de conexión se conecta con un controlador programable que establece un suministro eléctrico individual a cada una de las baldosas en función de la temperatura.

  19. 339.-

    PROCEDIMIENTO DE FABRICACION DE TEJIDOS FOSFORESCENTES DE LARGA DURACIÓN Y TEJIDOS OBTENIDOS A PARTIR DEL MISMO

    (11/2015)
    Solicitante/s: UNIVERSIDAD DE CANTABRIA. Inventor/es: GONZALEZ FERNANDEZ,FRANCISCO, MORENO GRACIA,FERNANDO, SAIZ VEGA,JOSE MARIA, SANZ CASADO,Juan Marcos, ALCARAZ DE LA OSA,Rodrigo, ASPEEL,Bruno, GONZÁLEZ,Roberto, MARTÍNEZ,Vicente. Clasificación: D06P1/00, A41D31/00, D06N3/00, D06N3/14, C09D5/22, C09K11/77.

    La invención describe un nuevo procedimiento para la fabricación de tejidos fosforescentes de larga duración, y de prendas que comprenden dicho tejido para su uso en los ámbitos tales como el de la seguridad, doméstico, deportivo, sanitario, profesional, etc. El procedimiento comprende (i) preparar una composición para tinción que comprende un pigmento de aluminato de estroncio dopado con europio y disprosio (ii) recubrir un tejido de partida con dicha composición mediante rasqueta al aire o cilindro, (iii) Secado y (iv) Polimerizado. Los tejidos así obtenidos presentan propiedades fosforescentes de larga duración y una alta resistencia al lavado, manteniendo las especificaciones de fábrica del tejido de partida con respecto a sus propiedades mecánicas, de comodidad, de transpirabilidad y/o sus propiedades de alta visibilidad, en su caso.

  20. 340.-

    Profármacos de triptolida

    (11/2015)

    Un compuesto de fórmula I:**Fórmula** en la que: cada R1 es independientemente H, alquilo(C1-C6), arilalquilo(C1-C6), cicloalquilo (C3-C6) o arilo y cada R2 es independientemente H, alquilo(C1-C6), arilalquilo(C1-C6), cicloalquilo (C3-C6) o arilo; o R1 y R2, junto con el átomo al cual están unidos, forman un cicloalquilo (C3-C7); en donde cualquier alquilo o cicloalquilo de R1 o R2 pueden estar opcionalmente sustituidos con uno o más grupos seleccionados de halo, alcoxi (C1-C6) y NRaRb y en donde cualquier arilo de R1 o R2 puede estar opcionalmente sustituido con uno o más grupos seleccionados de halo, alquilo(C1-C6), alcoxi (C1-C6),...

  21. 341.-

    Proceso para preparar bisulfato de atazanavir y nuevas formas

    (11/2015)

    Un proceso para preparar bisulfato de atazanavir en la forma de cristales de Forma A, que comprende hacer reaccionar una solución de base libre de atazanavir en un disolvente orgánico, que es acetona o una mezcla de acetona y N-metilpirrolidona, con una primera porción de ácido sulfúrico concentrado en una cantidad para reaccionar con menos de aproximadamente el 15 % en peso de la base libre de atazanavir, agregar semillas de los cristales de Forma A de bisulfato de atazanavir a la mezcla de reacción, como cristales de forma de bisulfato de atazanavir, agregar ácido sulfúrico concentrado adicional en etapas múltiples a una velocidad incrementada...

  22. 342.-

    Métodos para producir sales de viloxazina y polimorfos novedosos de las mismas

    (11/2015)

    Un método de fabricación de una morfolina 2-sustituida que comprende proporcionar un compuesto diol de acuerdo con la siguiente fórmula: **Fórmula** en la que Ra es un grupo ariloxi sustituido o sin sustituir o un grupo alcoxi sustituido o sin sustituir; y hacer reaccionar dicho compuesto diol en un sistema de disolvente con una base y un agente de ciclación para producir una morfolina 2-sustituida que tiene la siguiente fórmula: **Fórmula** en la que Rb es un grupo protector de nitrógeno, siendo dicho grupo protector de nitrógeno un grupo bencilo, y en la que dicho método comprende adicionalmente eliminar dicho grupo protector...

  23. 343.-

    Sistema de soporte para el montaje de una rejilla de panel o estructura de soporte de pared

    (11/2015)

    Sistema de soporte para el montaje de una rejilla de panel en una estructura de soporte de techo o de pared, comprendiendo el citado sistema: - una pluralidad de perfiles de retención que tienen cada uno una sección transversal en forma de T invertida con - una porción de mallado que tiene una porción de bulbo en su extremo distal, y - un par de pestañas de soporte para soportar y retener los paneles de pared o de techo; y - una pluralidad de enganches con medios de montaje para la fijación de los enganches a la estructura de soporte, y medios de recepción para recibir y retener la porción de bulbo de la pata de...

  24. 344.-

    Base adecuada del flujo para un aparato de fluidización

    (11/2015)

    Base adecuada del flujo para un aparato de lecho fluidizado con orificios pasantes y tiras de deflexión 1 dispuestas por encima en una disposición de solape, en la que las tiras de deflexión tienen una forma alargada y tienen espaciadores que forman una sección transversal de derrame en la periferia de la tira de deflexión para el gas de fluidización, en la que los orificios pasantes de la base pueden estar formados ventajosamente con una sección transversal alargada, caracterizada por que las tiras de deflexión están dispuestas longitudinalmente en el aparato de lecho fluidizado , paralelamente a la dirección principal de...

  25. 345.-

    Polipéptidos anti-TNFR1 estables, dominios variables de anticuerpos y antagonistas

    (11/2015)

    Un dominio variable sencillo de inmunoglobulina del receptor anti-TNFα de tipo 1 (TNFR1; p55) que comprende la secuencia de aminoácidos de SEC ID Nº 59.

  26. 346.-

    Material que contiene agente aromatizante para cigarrillo, método de producción del mismo, y cigarrillo

    (11/2015)

    Un proceso para producir un material con forma de lámina que contiene un aromatizante para cigarrillos, caracterizado porque el proceso comprende las etapas de: (i) mezclar un polisacárido con agua y calentar la mezcla hasta una temperatura de 60 a 90ºC para preparar una solución acuosa del polisacárido. (ii) añadir un aromatizante y un emulsionante a la solución acuosa del polisacárido y amasar y emulsionar la solución para obtener una suspensión emulsionada, y (iii) verter sobre un sustrato la suspensión emulsionada y secarla para obtener una forma de lámina, en el que el polisacárido es un sistema de un solo componente...

  27. 347.-

    Método para teñir/desteñir de un mechón de cabello

    (11/2015)

    Utensilio para teñir/desteñir un mechón de cabello , que comprende una estructura multiestrato hecha de materiales con forma de hoja que comprende una primera tira (3a), una segunda tira (3b) y una tercera tira (3c) todas hechas de materiales con forma de hoja, donde dicha primera tira (3a), hecha de un material adhesivo, es extraíble de dicha estructura ; la segunda tira (3b), hecha de material adhesivo, es extraíble de dicha estructura para ser superpuesta al cabello de manera de formar y retener por adhesión un mechón al azar de cabello a teñir/desteñir; y la tercera tira (3c), hecha de material no adhesivo, es extraíble...

  28. 348.-

    Dispositivos para el tratamiento de la apnea del sueño obstructiva

    (11/2015)

    Dispositivo para alterar la forma de una pared faríngea implantando un dispositivo en tejido bajo la pared faríngea, el dispositivo comprende: Un elemento retráctil , que tiene una configuración apretada y una amplia distinta de la configuración apretada; y Un elemento tisular de sujeción conectado a un elemento retráctil , el elemento tisular de sujeción adaptado para fijarse al tejido bajo la pared faríngea; y con lo cual, se altera la forma de la pared faríngea cuando el elemento retráctil cambia desde la configuración apretada a la amplia, que se caracteriza por el hecho de que dicho dispositivo, además,...

  29. 349.-

    Dispositivo de trituración

    (11/2015)

    Dispositivo para triturar conglomerados de materiales de forma mecánica de materiales con distintas densidades y/o consistencias, comprendiendo una cámara de trituración con un lado de entrada y un lado de salida, estando rodeada dicha cámara de trituración por una pared de cámara de trituración, especialmente en forma circular, cilíndrica o cónica, extendida hacia abajo y presentando dos secciones sucesivas en sentido axial, en las que se dispone, respectivamente, al menos un rotor de forma coaxial a la cámara de trituración, de forma que cada rotor presenta un eje de rotor y herramientas de percusión que se extienden,...

  30. 350.-

    Placa de separación y centrífuga con placas de separación de este tipo

    (11/2015)

    Placa de separación para una centrífuga, que está constituida por un primer material, caracterizada por un tratamiento de la superficie que modifica al menos por secciones la energía de la superficie, de tal manera que la placa de separación está provista al menos por secciones con al menos un revestimiento , que modifica la energía de la superficie con relación al primer material, de al menos otro material, y porque en el primer material está infundido al menos por secciones otro material que modifica la energía de la superficie con relación al primer material.

  31. 351.-

    DISPOSITIVO Y PROCEDIMIENTO DE MEDIDA DE IMPEDANCIA DE UN ELEMENTO DE ALMACENAMIENTO ENERGÉTICO

    (11/2015)

    La invención se refiere a un dispositivo de medida de impedancia de un elemento de almacenamiento energético , que comprende: - medios de generación de un estímulo de corriente i(f) en el dominio de la frecuencia con un contenido espectral dado; - medios de transformación de dicho estímulo de corriente i(f) a una señal de corriente en el dominio del tiempo; - medios para ajustar esta señal de corriente a un nivel de carga del elemento de almacenamiento energético y para excitar dicho elemento con esta señal de corriente ajustada; - medios para medir unas señales de tensión y corriente, Vbat, Ibat en el dominio del tiempo...

  32. 352.-

    SISTEMA MODULAR DE DISPENSADOR DE BEBIDA

    (11/2015)
    Ver ilustración. Solicitante/s: BANÚS RICOMA, Esteban. Inventor/es: BANÚS RICOMA,Esteban, BANUS RICOMA,Fernando. Clasificación: B67D1/00.

    Sistema modular de dispensador de bebida que presenta una modularidad de todos sus elementos y que comprende un módulo de almacenamiento que comprende a su vez un cuerpo de almacenamiento a modo de contenedor para envases de líquido, presentando el módulo de almacenamiento por lo menos una boquilla conectable en cada envase de líquido; un módulo de bombeo que comprende un cuerpo de bombeo que alberga a su vez unos medios de bombeo en comunicación fluida con cada una de las boquillas dispuestas en el módulo de almacenamiento; un módulo de control que comprende un dispositivo dispensador de bebida en comunicación fluida con los medios de bombeo y unos medios de control en comunicación de datos con el módulo de bombeo, en el que el cuerpo de almacenamiento, el cuerpo de bombeo y el dispositivo dispensador presentan unos medios de unión vinculables entre sí de forma liberable.

<< · 6 · 8 · 9 · < · 11 · > · 13 · 16 · 21 · 32 · >>