2,334 Patentes de diciembre de 2014 (pag. 71)

  1. 2241.-

    Composición potenciadora de umami que comprende al menos un compuesto potenciador de umami, en la que dicha composición potenciadora de umami a) puede pasar a través de una membrana de ultrafiltración que tiene un punto de corte de peso molecular de 250 kDa, b) tiene un contenido en licopeno por debajo de 3 ppm, c) contiene un compuesto de menos de 250 kDa, y d) puede potenciar el sabor umami.

  2. 2242.-

    Asiento de vehículo a motor que comprende: - un soporte destinado a fijarse firmemente al suelo de dicho vehículo, - una base que se proyecta hacia arriba y solidaria a la parte posterior de dicho soporte, - un larguero de respaldo montado de forma giratoria solidariamente a la parte superior de dicha base, por medio de una biela posterior , de acuerdo con un primer eje transversal , a fin de permitir el accionamiento de dicho respaldo entre una posición de uso sustancialmente vertical y una posición de plegado sustancialmente horizontal, - un larguero de asiento montado de forma...

  3. 2243.-

    Un sistema amortiguador de vibraciones de un tren de laminación que comprende al menos una caja de laminación que tiene rodillos (1,1') y un sistema de ajuste de flexión (3, 3', 17, 18, 21, 21' y 22, 22'; 23, 23', 24, 24') de los rodillos (1, 1'), comprendiendo el sistema amortiguador de vibraciones: - actuadores hidráulicos (21, 21'; 22, 22'; 23, 23'; 24, 24') para actuar sobre dichos rodillos (1, 1') para ajustar la posición recíproca entre los rodillos (1, 1'), - circuitos hidráulicos para la alimentación de dichos actuadores hidráulicos (21, 21', 22, 22'; 23, 23', 24, 24'), - medios...

  4. 2244.-

    Dispositivo de retención para una hoja semifija que coopera con una hoja móvil para cerrar una abertura, comprendiendo dicho dispositivo: un primer órgano de retención adaptado para ser solidario con un primer objeto entre la hoja semifija y el contorno de la abertura cerca de un punto de encuentro de las dos hojas ; un segundo órgano de retención adaptado para montarse móvil sobre el otro de dichos objetos de tal modo que pueda ocupar una posición de referencia (Z0) en la que el primer y el segundo órganos de retención están adaptados para cooperar juntos para retener la hoja...

  5. 2245.-

    Una secuencia de ácidos nucleicos con una longitud de al menos 19 nucleótidos con una identidad de la secuencia de al menos el 90% con el complemento de un ácido nucleico que comprende al menos 19 nucleótidos consecutivos de la secuencia ACAGCAGGCACAGACAGGCAGU, para uso en el tratamiento, disminución, demora y/o prevención de una enfermedad del corazón.

  6. 2246.-

    Estructura modular que se monta por sí sola para constituir entornos protegidos caracterizada por comprender columnas periféricas (1, 1') de soporte perfiladas en las que se proporcionan puntos (2, 2') de apoyo separados superpuestos, en los que se acoplan las porciones traseras de travesaños (3, 3'), acoplándose los extremos delanteros de los mismos en unos puntos de apoyo superior e inferior (4') de una unidad de control de apertura y cierre; comprendiendo dicha unidad un vástago (7, 7') con una articulación coaxial en la periferia de la cual pivotan radialmente los extremos delanteros...

  7. 2247.-

    Una cepa recombinante de Listeria que expresa un péptido de fusión de un péptido peptidasa relacionada con la calicreína 3 (KLK3) que está unido de forma operativa a un péptido listeriolisina (LLO) N-terminal no hemolítico, comprendiendo dicho péptido de fusión la secuencia de SEQ ID NO: 54 o una secuencia homóloga al menos al 99% a la misma, en la que dicho péptido LLO N-terminal potencia la inmunogenicidad del péptido de fusión, y en la que el péptido KLK3 no contiene una secuencia de señal.

  8. 2248.-

    Un aparato que comprende: un dispositivo médico implantable, que comprende: - un primer generador de tensión de electroestimulación, configurado para generar una primera tensión de electroestimulación; - un primer condensador, acoplado al primer generador de tensión de electroestimulación, y configurado para ser capaz de almacenar la primera tensión de electroestimulación; - un segundo condensador, en el que puede configurarse una capacidad del segundo condensador entre diferentes al menos primer y segundo valores de capacidad; - un procesador, que comprende un modo de detección...

  9. 2249.-

    Una batería que comprende: un alojamiento que tiene una pared que incluye una estructura de casquillo anular que define un agujero de conector de alimentación pasante, donde la estructura de casquillo anular está formada integralmente con la pared, y la estructura de casquillo anular formada integralmente incluye una superficie cilíndrica orientada hacia dentro; un conjunto de electrodo situado dentro del alojamiento y que incluye un ánodo y un cátodo; un poste de conector de alimentación pasante que se extiende a través del agujero de conector de alimentación pasante; una...

  10. 2250.-

    Un método para formar una batería, comprendiendo el método: proporcionar una pluralidad de cátodos de forma no rectangular , donde cada cátodo de forma no rectangular tiene la misma forma aproximada que los otros cátodos de forma no rectangular, donde cada cátodo tiene una lengüeta que se extiende desde el cátodo; proporcionar una pluralidad de ánodos de forma no rectangular , donde cada ánodo de forma no rectangular tiene la misma forma aproximada que los otros ánodos y cátodos de forma no rectangular, donde cada ánodo tiene una lengüeta que se extiende desde el ánodo, estando...

  11. 2251.-

    Celda electroquímica con soporte metálico, que comprende: - un soporte de metal poroso que comprende una primera superficie principal y una segunda superficie principal; - una capa porosa de adaptación termomecánica sobre dicha segunda superficie principal; - una capa porosa, barrera a la difusión de cromo, sobre dicha capa porosa de adaptación termomecánica, siendo esta capa porosa, barrera a la difusión de cromo, de zirconia estabilizada y/o de ceria sustituida, y de un óxido mixto de estructura tipo espinela; - una capa porosa de electrodo de hidrógeno sobre dicha...

  12. 2252.-

    1. Método para preparar nanopartículas superparamagnéticas de maghemita (g-Fe2O3) que comprende las etapas de: a) reducir iones Fe(3+) para dar una composición de materia a base de Fe que comprende nanopartículas amorfas que contienen Fe tratando a temperatura ambiente disoluciones acuosas de sales de Fe(3+) con una disolución acuosa en amoniaco de borohidruro de sodio (NaBH4) y luego calentando la mezcla de reacción hasta 100ºC y manteniendo la misma a esta temperatura durante un tiempo comprendido entre 0,5 y 5,0 horas; b) oxidar la composición a base de Fe que comprende nanopartículas...

  13. 2253.-

    Primer dispositivo de control (PG) de sesión de comunicación comprendido en un primer terminal local (T1) de una red local (LAN), conectado por una pasarela (GTW) a una red de comunicación distante (IMS) a la que está conectado al menos un terminal distante (T4), comprendiendo dicho dispositivo de control: medios de determinación para determinar si otro terminal local (T2, T3) de dicha red local está configurado para aplicar una función proxy para controlar al menos las transacciones de establecimiento de sesión entre el terminal distante (T4) y cada uno de los terminales de la red local;...

  14. 2254.-

    Una antorcha de soldadura por arco metálico con gas para ranura estrecha , que comprende: un bloque de potencia que tiene conexiones para electricidad, alambre de soldadura de suministro, enfriamiento por agua, y gas de protección ; un dieléctrico unido al bloque de potencia; una protección de gas unida al dieléctrico que define un espacio anular entre la protección y el dieléctrico; una punta de contacto unida al bloque de potencia que recibe y controla la curvatura de un alambre de soldadura de suministro , teniendo la porción de la punta de contacto que está...

  15. 2255.-

    Depósito de almacenamiento de hidrógeno por absorción en un material de almacenamiento de hidrógeno, teniendo dicho depósito un eje longitudinal (X) y comprendiendo un recinto y una estructura interna dispuesta en el recinto , comprendiendo la estructura interna una pluralidad de pisos (E1, E2,...En) y un sistema de intercambio de calor en el interior de la estructura interna, comprendiendo cada piso (E1, E2,...En) una pluralidad de compartimentos distribuidos en una pluralidad de filas orientadas según la dirección longitudinal, comprendiendo cada compartimento un fondo (12,...

  16. 2256.-

    Techo solar o construcción de fachada solar que comprende un sistema fotovoltaico con elementos de techo de fibrocemento, hormigón, arcilla, metal, plástico, que están dispuestas en filas escalonadas y zona de solapamiento y no superpuestas donde las células solares , que se pueden conectar eléctricamente entre sí para generar electricidad a través de medios de contacto y con una planta térmica con colectores solares y un sistema de tuberías, que circula en el medio de una transferencia de calor, caracterizado por la zona de no superposición de los elementos del techo está...

  17. 2257.-

    Losa para pavimentos con una capacidad para degradar elementos o gases contaminantes procedentes del medio exterior que comprende un cuerpo provisto de dos capas, una primera capa superficial y una segunda capa base las cuales están solapadas entresí de forma solidaria, comprendiendo dicha capa superficial una pasta solidificada que incluye cemento, arena sílice, dióxidode titanio, zeolitas y óxidos férricos o FeO2, marmolina y materiales reciclados mientras que la capa base comprende una pasta solidificada que incluye cemento, preferentemente del tipo gris, partículas áridas...

  18. 2258.-

    Procedimiento de generación de un modelo de un objeto plano a partir de vistas del objeto plano, en el que el procedimiento genera una representación seleccionada de entre un mapa de profundidad del objeto plano, una representación volumétrica del objeto plano y una representación en malla del objeto plano, mediante al menos las siguientes etapas: i) calibrar al menos una primera cámara y una segunda cámara ; ii) calcular las coordenadas en 3D de al menos tres puntos que pertenecen a un plano del objeto plano; iii) calcular una ecuación del plano comprendido en el...

  19. 2259.-

    Dispositivo de suspensión (10, 10', 10B, 10C, 110, 210, 310, 410, 510, 510') para un somier o una base, que consta de: * una sección superior (12, 12B, 12C, 112, 212, 312, 412, 512) provista de una placa (14, 14', 114, 214) adaptada para sostener un colchón; * una sección inferior (20, 20', 20B, 20C, 120, 220, 320, 420, 520) que comprende unos medios que permiten la fijación del dispositivo de suspensión al somier, estando dicha sección inferior unida a la sección superior mediante unos medios de suspensión ; * unos medios para modificar la rigidez del dispositivo de suspensión...

  20. 2260.-

    Dispositivo electro-fluídico para producir emulsiones y suspensiones de partículas que comprende: un micro-canal que comprende un fluido dieléctrico fluyendo a través de dicho micro-canal , una primera punta capilar (1,1',101,101') sumergida en dicho líquido dieléctrico que fluye a través de dicho micro-canal ; un primer fluido conductor (8, 8', 108, 108') que fluye a través de la primera punta capilar (1,1',101,101') en la misma dirección que el fluido dieléctrico y que es inmiscible i pobremente miscible con dicho fluido dieléctrico ; y un segundo fluido conductor...

  21. 2261.-

    Un receptor solar que comprende: un alojamiento del receptor que se extiende a lo largo de un eje longitudinal (X), que tiene extremos delantero y trasero; una ventana configurada para permitir que la radiación pase a través de la misma, estando montada dicho ventana en dicho extremo delantero y que se prolonga en el interior de dicho alojamiento; una cámara del receptor definida entre el alojamiento y la ventana, teniendo dicha cámara del receptor una entrada de fluido operante para el acceso de fluido operante para ser calentado en la misma, y una salida de fluido...

  22. 2263.-

    Adición a la patente Nº P 200900221 "Sistema para establecer una corriente de fluido mediante succión en una corriente de agua". La corriente que denominamos "corriente primaria", que discurre a través del tubo captador es la existente en una masa de agua, como puede ser un mar, un río, un embalse, o construida por el hombre, etc. El fluido contenido en el tubo secundario , en forma de L, provisto en su extremo inferior por un huso , es succionado por la acción del Efecto Venturi, del tubo 9. La terminación del tubo en forma de huso , tiene por finalidad sustituir...

  23. 2264.-

    Lámina de material compuesto con zonas elásticas e inelásticas, a partir de la cual se pueden separar o bien estampar, que comprende una lámina de tela no tejida que forma un primer lado exterior de la lámina de material compuesto, tiras de lámina dilatables elásticamente, distanciadas entre sí, que están dispuestas sobre la lámina de tela no tejida , un material de tela no tejida , que cubre las tiras de lámina en un segundo lado exterior de la lámina de material compuesto y al menos una tira no elástica de un material de gancho , que puentea un zona entre dos...

  24. 2265.-

    Placa de materia derivada de la madera que comprende - al menos una placa de soporte (2a, 2b), - al menos una capa dispuesta en un lado de la placa de soporte (2a, 2b) que comprende partículas de cuero , - al menos una capa decorativa impresa sobre la capa de partículas de cuero y - al menos una capa de resistencia al desgaste dispuesta sobre la capa decorativa impresa, en donde al menos una capa de resistencia al desgaste está configurada como al menos una capa que comprende fibras naturales o sintéticas, al menos un aglutinante, partículas resistentes...

  25. 2266.-

    Secadora de ropa con un tambor apoyado tal que puede girar en una carcasa , una abertura de carga que puede cerrarse mediante una puerta , así como un ventilador y un dispositivo calentador para generar un flujo de aire de proceso (PL) que fluye sobre un intercambiador de calor , pudiendo reunirse el condensado que se produce durante el proceso de secado en un depósito acumulador de condensado configurado como cajetín en un compartimiento de inserción , caracterizada porque el depósito acumulador de condensado configurado como cajetín interactúa con...

  26. 2267.-

    Dispositivo para la producción de espuma de leche, con una disposición de toberas y una cámara de depresión asignada a la misma, a la cual mediante la aplicación de vapor a la disposición de toberas se puede succionar leche de un tubo de alimentación de leche , a la que puede conectarse un conducto de succión para establecer una conexión conductora del fluido a un depósito de leche , estando previsto aguas abajo de la cámara de depresión una abertura de salida para espuma de leche, comprendiendo el dispositivo un conducto de lavado que puede ser conectado...

  27. 2268.-

    Una motocicleta incluyendo: un motor incluyendo un orificio de escape; un primer dispositivo silenciador ; un segundo dispositivo silenciador separado del primer dispositivo silenciador ; un primer tubo de escape que conecta el orificio de escape y el primer dispositivo silenciador ; y una porción de tubo de conexión que conecta el primer dispositivo silenciador y el segundo dispositivo silenciador ; donde el primer dispositivo silenciador incluye: una primera cámara de expansión para permitir que los gases de escape se expandan, estando...

  28. 2269.-

    Grapadora automática para cerrar envases en forma de tubos flexibles mediante grapas con dispositivos de estrangulación para estrangular el envase y con al menos dos brazos de cierre concebidos para realizar desde diferentes direcciones respectivamente un movimiento de pivotamiento hacia el envase estrangulado, y con un dispositivo de corte en uno de los brazos de cierre para seccionar el envase estrangulado entre los puntos de cierre, que comprende una cuchilla de corte y un accionamiento de cuchilla que está concebido de tal forma que la cuchilla de corte ...

  29. 2270.-

    Banqueta para vehículo automóvil y vehículo que comprende esta banqueta. Banqueta que presenta dos pies con una platina de fijación, fijados a una armadura de cuerpo de asiento fijada en una armadura de respaldo con una viga inferior fijada perpendicularmente a una viga lateral vertical que soporta un órgano de soporte de cinturón de seguridad. La banqueta comprende un pie fijado a la viga inferior con una platina de fijación, y una chapa que soporta un enrollador de cinturón de seguridad, fijada en la viga inferior y con dos platinas de fijación....

  30. 2271.-

    1. Lámina de piedra natural, del tipo de finas losas o placas utilizadas para revestimiento decorativo de paredes, muros y paramentos en la construcción, constituidas por una base soporte de material plástico o mortero sobre la que queda fijada químicamente una fina capa de mármol, granito u otro material pétreo, caracterizada por estar constituida por una lámina mineraloplástica de mortero de resina sintética con armadura de fibra de vidrio incorporada como base soporte de entre 1,5 y 5 mm de espesor, sobre la que...

  31. 2272.-

    1. Elemento de sujeción para bicicletas infantiles caracterizado porque comprende un cuerpo tubular hueco , con forma esencialmente de "U" invertida, que aloja unos segundos cuerpos tubulares , que otorgan de carácter telescópico a dicho cuerpo , y donde estos segundos cuerpos tubulares disponen de sendos orificios por donde se introducen unos medios de fijación roscados que unen dichos cuerpos tubulares a la bicicleta infantil ; y donde para facilitar su regulación telescópica, los segundos cuerpos tubulares ...

<< · 36 · 53 · 62 · 66 · 68 · 69 · < · 71 · > · >>