2,757 Patentes de marzo de 2013 (pag. 70)

  1. 2209.-

    Dispositivo de seguridad y vigilancia para puertas, ventanas o similares

    (03/2013)

    Un dispositivo de seguridad y vigilancia con una estructura que contiene las piezas necesarias, preferiblemente como mínimo una placa, un botón de seguridad y un dispositivo de iluminación, así como un recubrimiento giratorio, caracterizado porque el dispositivo de seguridad y vigilancia presenta, para la fijación, una placa de montaje que es atravesada por un lado por un pulsador de accionamiento del botón de seguridad y por un dispositivo de iluminación , porque la placa de montaje está cubierta, en el estado de montaje, por un marco de recubrimiento, y porque el botón de seguridad está rodeado...

  2. 2210.-

    Método para preparar masas autoadhesivas termofusibles de acrilato reticuladas

    (03/2013)

    Método para preparar una masa autoadhesiva de poliacrilato mediante un proceso de termofusión, caracterizado porque al polímero por reticular se le agrega un agente a-disociable polifuncional en forma oligómera, antes de elaborarlo en el proceso de termofusión, y la reticulación UV se efectúa tras la elaboración en el proceso de termofusión.

  3. 2211.-

    Composición adhesiva, acuosa, que contiene un producto de mezcla a base de almidón de leguminosas

    (03/2013)

    Composición adhesiva, acuosa, destinada al encolado o adhesión del cartón ondulado, y que comporta unas partes denominadas primaria y secundaria, elaboradas separadamente, caracterizada por el hecho de que, la parte secundaria, elaborada a partir de almidones no gelatinizados y / o por almidones hinchados, y constituida por éstos, comprende esencialmente un producto de mezcla de almidón(es) de leguminosa(s) y de almidón(es de cereales y / o de tubérculos, de tal forma que, el valor de relación entre el almidón de leguminosas y el almidón de cereales y / o de tubérculos, se encuentra comprendido dentro...

  4. 2212.-

    Composición alimentaria para gatos con mucha proteína y pocos carbohidratos que comprende fibra no fermentable

    (03/2013)

    Una composición alimentaria adecuada para un gato, que comprende de 25 a 70% en peso de proteína, de 10 a 70% en peso de grasa, 0-25% en peso de carbohidratos, y fibra no fermentable - que tiene una velocidad de desaparición de materia orgánica de menos de 15% cuando se fermenta mediante una bacteria fecal de no rumiante in vitro durante un periodo de 24 horas según se mide mediante el Método Oficial de la AOAC 991.43 - de 3 a 15% en peso, en donde la terminología "% en peso" se refiere al % en peso calculado sobre una base de materia seca.

  5. 2213.-

    Sistema tensioactivo para aumentar la absorción del agente antibacteriano por el tejido dental

    (03/2013)

    Una composición oral que exhibe una absorción acrecentada por el tejido dental de los compuestos antibacterianos contenidos en la misma, composición que comprende en un vehículo oralmente aceptable una cantidad terapéutica efectiva de un compuesto antibacteriano tipo difenil éter o fenólico halogenado y una mezcla de tensioactivos aniónicos y zwiteriónicos, incorporándose el agente antibacteriano en la composición en una concentración de 0,05 a 2,0% en peso y estando el tensioactivo aniónico presente en la composición en una concentración de 1,5 a 3% peso y estando el tensioactivo zwiteriónico...

  6. 2214.-

    Uso de polímeros (met)acrílicos en un método para fabricar una suspensión acuosa de carbonato de calcio

    (03/2013)

    El uso, en un método de fabricación de una suspensión acuosa de carbonato de calcio natural a través de: a) una etapa de molienda, b) y posiblemente una etapa de concentración en un medio acuoso,de un homopolímero y/o de un copolímero de ácido (met)acrílico caracterizado por que: - se lleva a cabo durante la etapa de molienda, - presenta un peso molecular de entre 8.000 g/mol y 15.000 g/mol y preferentemente entre 8.000 g/mol y 12.000 g/mol, - y presenta un contenido molar de cadenas poliméricas por peso molecular menor que 3.000 g/mol de menos de 20%,preferentemente 15%, de manera muy...

  7. 2215.-

    Sistema de seguimiento de vídeo activado por eventos

    (03/2013)

    Un sistema de seguimiento de vídeo de activado por eventos, que comprende una primera cámara devideovigilancia que tiene cobertura de vídeo en una primera zona , incluyendo dicha primera cámara devideovigilancia medios para seguir una imagen en dicha primera zona ; y una segunda cámara de videovigilancia que tiene cobertura de vídeo en una segunda zona , teniendo dichaprimera zona y dicha segunda zona una porción solapante, teniendo dicha segunda cámara de videovigilancia medios para adquirir dicha imagen en dicha porción solapante, e incluyendo medios para seguir dicha imagenen dicha...

  8. 2216.-

    Procedimiento y dispositivo para filtrar una corriente y/o voltaje de una salida de filtro de una salida de inversor

    (03/2013)

    Procedimiento para detectar distorsiones relacionadas con el filtro de una corriente o voltaje de lasalida de filtro de un filtro de salida de un inversor u otra fuente de energía conectada a la red, que comprende lasetapas: definir una estructura de señal general para representar una señal estimada de la corriente o voltaje de la salida delfiltro por medio de una función sinusoidal que tiene una onda fundamental y al menos un armónico de orden máselevado, donde la función sinusoidal se define por la frecuencia, amplitud y fase de la onda fundamental y laamplitud y fase de cada armónico, estimar...

  9. 2217.-

    Métodos para la purificación de alfa-1-antitripsina y apolipoproteína A-1

    (03/2013)

    Un método para purificar la apolipoproteína A-1 (ApoA-I) y la alfa-1-antitripsina (AAT) de una única fracción inicial de plasma humano que contiene ambas proteínas que comprende: i) tratar una fracción de plasma humano inicial que contiene ApoA-1 y AAT para separar una fracción que contiene ApoA-1 de una que contiene AAT; II) purificar ApoA-1 hasta un grado de pureza de calidad farmacéutica de la fracción que contiene ApoA-1; y III) purificar AAT hasta un grado de pureza de calidad farmacéutica de la fracción que contiene AAT, donde opcionalmente dicho método se utiliza para la purificación...

  10. 2218.-

    Procedimiento y aparato de medición no invasiva de la presión sanguínea

    (03/2013)

    Procedimiento para medir de manera no invasiva la presión sanguínea de la arteria radial en una muñeca de unpaciente basándose en el método oscilométrico o el método de descarga vascular, comprendiendo el procedimientolas etapas siguientes colocar un depósito flexible de presión y un transductor de pulso arterial en un lugar en la piel sobre el crucede la arteria radial y el sitio más protuberante en el lado anterior del extremo distal del radio, y mantener laposición de dicho transductor de pulso arterial y dicho depósito flexible de presión respecto al lugar sincambios; utilizar dicho...

  11. 2219.-

    Células modificadas mediante ingeniería genética desde el punto de vista metabólico para la producción de resveratrol o un derivado del mismo oligomérico o con unión glucosídica

    (03/2013)

    Un microorganismo que produce resveratrol, y dicho microorganismo tiene una ruta metabólica operativa queproduce ácido 4-cumárico y que produce resveratrol a partir suyo, o un derivado oligomérico o con unión glicosídicadel mismo, en cuya ruta se produce ácido 4-cumárico a partir de L-fenilalanina por la acción de una L-fenilalaninaamoniaco liasa y una cinamato 4-hidroxilasa expresadas en dicho microorganismo, o a partir de tirosina por la acciónde una L-fenilalanina amoniaco liasa o de una tirosina amoniaco liasa expresadas en dicho microorganismo, seforma 4-cumaroil-CoA a partir de dicho ácido...

  12. 2220.-

    Derivados de piridizinona

    (03/2013)

    Un compuesto de acuerdo con la fórmula I*:**Fórmula** o una forma estereoisomérica, una mezcla de formas estereoisoméricas, o una sal farmacéuticamente aceptable delmismo; en la que: cada uno de X y Xa es independientemente CH o N; Y es S(O)q, O o NR15; R1 es un anillo de piperidina o de pirrolidina, opcionalmente sustituido con 1 a 3 grupos R20; R2 es **Fórmula** o en las que: R2 es para en el grupo Y-(CHR4)m-R1;

  13. 2221.-

    Proceso para preparar inhibidores de la metaloproteinasa de la matriz y auxiliares quirales para los mismos

    (03/2013)

    Auxiliar quiral que es (4S)-4-bencil-1,3-tiazolidin-2-ona.

  14. 2222.-

    Método, sistema y política de control y función de reglas de facturación para procesar flujos de datos de servicio

    (03/2013)

    Un método de proceso de servicios para gestionar flujos de datos de servicio de manera discriminada,cuando los flujos de datos de servicio requieren el mismo nivel de QoS, caracterizado porque comprende:obtener, por medio de una Función de Control de Políticas y Reglas de Facturación, entidad PCRF, la informacióndel contexto de políticas que comprende al menos uno de estos factores: tipo de servicio, prioridad del servicio,prioridad del usuario, y prioridad definida a la medida; generar por la entidad PCRF, información de prioridad del portador de acuerdo con la información del contextode...

  15. 2223.-

    Fuente luminosa

    (03/2013)

    Fuente luminosa que tiene una pluralidad de elementos luminosos y un sistema de control paracontrolar dicha pluralidad de elementos luminosos, en la que el sistema de control comprende: - una pluralidad de controladores de elemento luminoso, cada uno conectado a un elementorespectivo de dichos elementos luminosos, y dispuestos para obtener datos de elemento luminoso; y - una interfaz de bus, que se conecta a dichos controladores de elemento luminoso mediante unbus de fuente luminosa, en la que dicha interfaz de bus se dispone para proporcionar a dichos controladores deelemento...

  16. 2224.-

    Estructuras de barrera de protección de aguja

    (03/2013)

    Un sistema extravascular para acceder a la vasculatura de un paciente, que comprende: un catéter ; una aguja dispuesta dentro del catéter ; y un conjunto de protección de punta de aguja que tiene un tapón de aguja, cuyo tapón de agujatiene una protección de aguja, y la protección de aguja tiene como mínimo una barrera configurada de tal manera que la barrera impide la re-penetración de la aguja una vez que la aguja se ha extraído del catéter caracterizada por como mínimo una mella sobre un codo entre la barrera y la protección deaguja

  17. 2225.-

    Conjunto de válvula dispensadora de adhesivo termofusible accionado por un solenoide doble en línea

    (03/2013)

    Un conjunto de válvula dispensadora de material adhesivo termofusible o de otro material termoplástico,que comprende: una boquilla dispensadora para dispensar dicho material adhesivo termofusible u otro material plástico;un miembro de asiento de válvula que tiene un asiento de válvula definido en él; estando dicha boquilladispensadora fabricada preferiblemente como una parte integral de dicho miembro de asiento de válvula;medios de válvula , dispuestos de manera móvil con respecto a dicho asiento de válvula entre unaprimera posición CERRADA y una segunda posición ABIERTA,...

  18. 2226.-

    Polipéptidos de fusión de GLP-1 (péptido 1 de tipo glucagón) con resistencia a peptidasa incrementada

    (03/2013)

    Un mimético de armazón de un péptido de fusión que comprende como componente (I) N-terminalmente (i) GLP-1 del SEQ ID NO: 1 o una secuencia funcional que ejerce los efectos biológicos de GLP-1 en forma dehormona incretina, su acción anti-apoptótica o sus propiedades neurotróficas y que tiene al menos 80% de identidadde secuencia con GLP-1 , o (ii) un péptido GLP-1 modificado que consiste en la secuencia de aminoácidos de formula II: Xaa7-Xaa8-Glu-Gly-Thr-Phe-Thr-Ser-Asp-Xaa16-Ser-Xaa18-Xaa19-Xaa20-Glu-Xaa22-Xaa23-Ala-Xaa25-Xaa26-Xaa27-Phe-Ile-Xaa30-Trp-Leu-Xaa33-Xaa34-Xaa35-Xaa36-Xaa37,...

  19. 2227.-

    Dispositivo y procedimiento para el control de la posición del cable de una instalación de transporte accionada por cable

    (03/2013)

    Dispositivo de control de la posición del cable para el control de la posición de un cable guiado en poleas de una disposición de poleas de una instalación de transporte accionada por cable en al menos unaprimera polea de cable que va a controlarse de la disposición de poleas , en el que el dispositivo decontrol de la posición del cable comprende la disposición de poleas , disposición de poleas quecomprende la al menos una primera polea de cable que va a controlarse y al menos una segunda polea decable que define una polea de referencia , caracterizado porque está previsto...

  20. 2228.-

    Dispositivo de acondicionamiento y de aplicación de un producto cosmético

    (03/2013)

    Dispositivo de acondicionamiento y de aplicación de un producto cosmético que comprende: - un recipiente que contiene dicho producto, y - un aplicador soportado por el recipiente , comprendiendo dicho aplicador: - un obturador , y - un cabezal de aplicador que comprende un conducto de distribución y un orificio de distribución de producto, de eje X, que desemboca hacia el exterior o hacia un elemento de aplicación, según eleje X, por una abertura inclinada con respecto al eje X, siendo el cabezal de aplicador móvilcon respecto al obturador entre unas posiciones...

  21. 2229.-

    Nuevo derivado de indol que tiene actividad inhibidora de cinasa I B

    (03/2013)

    Un compuesto representado por la siguiente fórmula general o su sal [donde R1 representa un átomo de hidrógeno, un grupo alquilo que tiene 1 a 8 átomos de carbono, que puede tenerun sustituyente, un grupo arilo que puede tener un sustituyente, un grupo hidroxi o un grupo alcoxi que tiene 1 a 8átomos de carbono, que puede tener un sustituyente; R2 representa un átomo de halógeno, un grupo alquilo que tiene 1 a 8 átomos de carbono que puede tener unsustituyente, un grupo alquenilo que tiene 2 a 8 átomos de carbono que puede tener un sustituyente, un grupoalquinilo que tiene 2 a 8...

  22. 2230.-

    El uso de la fosfatasa alcalina en el tratamiento de la función renal reducida

    (03/2013)

    Uso de la fosfatasa alcalina (FAL) en la fabricación de un medicamento para mejorar la función renal reducida, enel que dicha función renal se reduce debido a una insuficiencia renal

  23. 2231.-

    Mejora de sistema de radiación óptica usados en tratamientos dermatológicos

    (03/2013)

    Un dispositivo de tratamiento dermatológico para eliminar el pelo, en donde el dispositivo comprende: una fuente luminosa que emite una radiación optica en un impulso de luz que incluye al menos una longitudde onda cercana a la porción de infrarrojos del espectro electromagnético; un elemento de contacto para contactar una superficie de la piel cuyo pelo tiene que eliminarse, en donde elelemento de contacto es ópticamente transparente a la radiación optica emitida; al menos un elemento de vibración acoplado al elemento de contacto ; y Un sensor de contacto para detectar...

  24. 2232.-

    Conjunto de conectores de LED con disipador de calor

    (03/2013)

    Un conjunto de montaje universal para soportar al menos un LED de alta intensidad en un aparato de luz quecomprende: una porción de soporte que incluye: una pared lateral periférica que define una cavidad para aceptar un conjunto de placa decircuito impreso, al menos un miembro de soporte que está dispuesto a lo largo de la pared lateral periférica yconfigurado para soportar el conjunto de placa de circuito impreso ; una pluralidad de elementos de contacto eléctrico ; y un miembro de conducción térmica en comunicación térmica con el conjunto de placa decircuito...

  25. 2233.-

    Revestimiento de pigmento magnéticos, laminados y método para su producción

    (03/2013)

    Un método de fabricación de un material que muestra propiedades anisótropas que producen un efecto ópticode apariencia tri-dimensional, apreciable a simple vista, tras iluminación del material terminado con luz visible,comprendiendo dicho material un componente que comprende partículas, siendo capaz dicho componente deinteraccionar con dicha luz visible para inducir, o contribuir a, dichas propiedades anisótropas del material,pudiéndose mover espacialmente dichas partículas bajo la influencia de un campo magnético o electro-magnético,comprendiendo además dicho material al menos...

  26. 2234.-

    Conmutador eléctrico para vehículo automóvil

    (03/2013)

    Carro contactor destinado a ser montado móvil en translación en un conmutador eléctrico de un vehículoautomóvil, preferentemente en un conjunto de mandos bajo el volante, para establecer, en función de un comandode un usuario, un contacto eléctrico para una o varias posiciones predefinidas del trayecto de dicho carro , quecomprende al menos un emplazamiento de contacto eléctrico, un segundo alojamiento destinado a recibirun elemento contactor de baja corriente, caracterizado porque comprende un primer alojamiento destinadoa recibir un elemento contactor de alta corriente,...

  27. 2235.-

    Composiciones de micorriza líquida

    (03/2013)

    Composición líquida comprendiendo (a) una o más micorrizas en una cantidad de 0,2-5% (p/v); y (b) un bactericida en una cantidad de 50-3000 ppm seleccionado del grupo que consiste en i. 2-bromo-2-nitro-1,3-propanadiol, ii. cloruro de 1-(3-cloroalil)-3,5,7-triaza-1-azoniaadamantano, iii. dibromonitrilopropionamida, iv. 1,2-benzisotiazolin-3-ona, v. 5-cloro-2-metil-4-isostiazolin-3-ona, 2-metil-4-isostiazolin-3-ona, vi. diazolidinil urea, vii. tris(hidroximetil)nitrometano, viii. o-fenilfenato de sodio, ix. arseniatos de cobre, x. óxido de cobre, xi....

  28. 2236.-

    Método, sistema, servidor y terminal para desvio de llamadas

    (03/2013)

    Un método para implementar desvío de llamadas, que comprende: enviar, por parte de un servidor, un mensaje PUSH a un terminal a través de una red troncal de SIP/IP; caracterizado por comprender, además: recibir, por parte del servidor, una petición de desvío desde el terminal; y enviar, por parte del servidor, el mensaje PUSH en función de la petición de desvío; en donde el mensaje PUSHes un mensaje del protocolo de inicio de sesión, SIP, encapsulado mediante la adopción de un protocolo SIP.

  29. 2237.-

    Utilización de péptidos de SCO-espondina para inhibir o prevenir la apoptosis neuronal mediada por los ligandos de receptores de la muerte celular

    (03/2013)

    Polipéptido que comprende la secuencia que consiste en -W-S-G-W-S-S-C-S-R-S-C-G- (SEC ID Nº8), para su utilización en un método para inhibir o prevenir la apoptosis neuronal mediada por al menos un ligando de receptores de la muerte celular seleccionado de TRAIL y FasL.

  30. 2238.-

    Embalaje

    (03/2013)

    Embalaje que incluye un blíster conteniendo una pluralidad de unidades y un envoltorio formado a partir de una formapreliminar de material plegable que rodea el blíster, el envoltorio comprende una lengüeta plegada hacia el interior poruna línea de plegado para contactar con el blíster, inclinándolo hacia una parte opuesta del envoltorio, caracterizado porel hecho de que el embalaje está configurado de manera que una o más unidades contenidas en el blíster se puedavisualizar a través de una abertura en el envoltorio creada por el pliegue de la lengüeta hacia el interior.

  31. 2239.-

    Oligonucleótido antisentido contra la isoforma R de la acetilcolinesterasa humana (ACHE-R) y sus usos

    (03/2013)

    Un oligonucleótido sintético antisentido dirigido contra el ARNm de AChE humano que tiene la secuencia denucleótidos: 5'CTGCCACGTTCTCCTGCACC 3' (SEQ ID NO: 1), en la que dicho oligonucleótido antisentido suprime de formaselectiva la producción de la isoforma AChE-R.

  32. 2240.-

    Composición de catalizador y procedimiento para la oligomerización de etileno

    (03/2013)

    Composición de catalizador que comprende: (a) un complejo de cromo(II) binuclear; (b) un ligando de la estructura general (A) R1R2P-N(R3)-P(R4)-N(R5)-H o (B) R1R2P-N(R3)-P(R4)-N(R5)-PR6R7, en el que R1, R2, R3, R4, R5, R6 y R7 se seleccionan independientemente entre amino, alquilo C1-C10, arilo y arilo sustituido, en el que la unidad PNPN o PNPNP opcionalmente es parte de un sistema de anillo, en el que al menos uno de los átomos de P o de N de la estructura (A) o de la estructura (B) es un miembro de anillo, estando formado el anillo por uno o varios compuestos constitutivos...

<< · 35 · 52 · 61 · 65 · 67 · 68 · < · 70 · > · 72 · 74 · 78 · >>