953 Patentes de enero de 2013 (pag. 8)

  1. 225.-

    Suela exterior antideslizante y un método para proveer dicha suela exterior

    (01/2013)

    Una suela exterior antideslizante, que comprende, en la superficie diseriadapara el contacto con el suelo, una pluralidad de inserciones antideslizantes hechas de tejido o tela no tejida, caracterizada por el hecho de que dichas inserciones estan provistas por tubos hechos de tejido o tela no tejida, dispuestos ortogonalmenterespecto de la superficie diseriada para el contacto con el suelo.

  2. 226.-

    Montaje de distribución

    (01/2013)

    Un montaje de distribución para dispensar fluido para uso agrícola, que comprende al menos un cuerpode soporte provisto de al menos un puerto de entrada para un fluido presurizado, al menos un primer puertode descarga para la descarga de excesos de fluido, y al menos un segundo puerto de descarga para laentrega de dicho fluido a al menos un punto de consumo para dispensarlo; dicho cuerpo de soporte comprendiendouna pluralidad de asientos predefinidos (6, 8a, 8b, 16), un primero de los cuales es para acomodar al menos unprimer elemento de válvula de presión máxima del montaje que está conectado a dicho cuerpo de entrada y...

  3. 227.-

    Uso de lactoferrina bovina para el tratamiento de inflamación destructiva de membranas mucosas

    (01/2013)

    Lactoferrina bovina para su uso en el tratamiento de inflamación destructiva (patológica) que afecta a membranas mucosasasociada con infección aguda o crónica, y opcionalmente asociada con estados de hipoferremia y/o anemia cuando las membranas mucosas están seleccionadas de entre una o más de membranas mucosas vaginales,anales o de la cavidad orofaríngea y la lactoferrina bovina es para uso tópico cuando la inflamación destructiva (patológica)no está asociada con hipoferremia y/o anemia, y combinada con el uso oral de lactoferrina bovina cuando la inflamacióndestructiva (patológica) está asociada con hipoferremia y/o anemia,...

  4. 228.-

    Derivados de benzimidazol alquilados en N3 como inhibidores de MEK

    (01/2013)

    Una composición farmacéutica para inhibir el crecimiento celular anómalo en un mamífero que comprende una cantidad de (2-hidroxi-etoxi)-amiduro de ácido 6-(4-bromo-2-cloro-fenilamino)-7-fluoro-3-metil-3H-benzimidazol-5- carboxílico, o una de sus sales farmacéuticamente aceptables, combinado con una cantidad de un agente quimioterapéutico, donde las cantidades del compuesto o sal y del agente quimioterapéutico son eficaces en conjunto para inhibir el crecimiento celular anómalo.

  5. 229.-

    Tratamiento de enfermedades neurodegenerativas con selenato

    (01/2013)

    Selenato o una sal farmacéuticamente aceptable del mismo para su uso en el tratamiento o la prevención de unaenfermedad neurodegenerativa.

  6. 230.-

    Planta de calentamiento para la producción de agua caliente doméstica

    (01/2013)
    Ver ilustración. Solicitante/s: ALFA LAVAL CORPORATE AB. Inventor/es: PERRIN,MATTHIEU. Clasificación: F24D17/00, F24D11/00, F24D3/08, F24D12/02.

    Planta de calentamiento para la producción de agua caliente doméstica, comprendiendo dicha planta un primer intercambiador de calor conectado a dos circuitos de fluido y en la que un primer fluido de un circuito primario transmite energia térmica a un segundo fluido de un círcuito secundario constituido por el agua caliente doméstica caracterizada porque dicho circuito primario comprende.

  7. 231.-

    Composición de moldeo de polietileno con una relación de craqueo por tensión/rigidez y resistencia al impacto mejoradas

    (01/2013)

    Una composición de polietileno de alta densidad para moldeo, que tiene una distribución de peso molecularmultimodal, que posee una densidad de acuerdo con la norma ISO 1183 a 23 °C, comprendida en el intervalo de 945 a965 kg/m3 y un MFR190/2 de acuerdo con la norma ISO 1133, comprendido en el intervalo de 0,05 a 25 g/10 min, dondedicha composición de polietileno para moldeo comprende al menos tres fracciones de polímero de etileno, las cualesposeen diferentes pesos moleculares, a saber: A) del 15 al 50 % en peso de una fracción de homopolímero de etileno de bajo peso molecular, con un pesomolecular promedio en peso Mw comprendido...

  8. 232.-

    Sistema de placa para huesos

    (01/2013)

    Un sistema para fijar partes de un hueso fracturado que incluye una placa para huesos y tornillos para huesos,estando la placa para huesos adaptada para cooperar con los tornillos para huesos, cada uno con una cabeza y un vástago del tornillo e incluyendo dos tipos de tornillos para huesos, teniendo el primer tipode tornillo la cabeza con un resalte redondeado y teniendo el segundo tipo de tornillo la cabeza con la rosca en una parte superior cilíndrica y una parte cónica inferior adyacente al vástago deltornillo, comprendiendo la placa para huesos - un cuerpo de placa en forma de tira de material rígido con...

  9. 233.-

    Accionamiento regulador de válvula con acoplamiento de sobrecarga

    (01/2013)

    Accionamiento regulador para una válvula, sobre todo para una válvula de un equipo decalefacción, ventilación y/o climatización que presenta * una carcasa , * un eje , que está ubicado por lo menos en parte dentro de la carcasa y está acoplado directa oindirectamente a la válvula, de manera que la válvula se puede ajustar con un giro del eje * un elemento de mando manual , el cual se puede acoplar al eje , y * un acoplamiento de sobrecarga , ubicado entre el elemento de mando manual y el eje ,que limita a un valor máximo preestablecido un par de fuerzas que es transmitido al eje por elelemento de mando...

  10. 234.-

    Inhibición mediada por interferencia de ARN de una expresión de gen usando ácido nucleico de interferencia corto (ANic)

    (01/2013)

    Una molécula de ácido nucleico de interferencia corto (ANic) sintética modificada químicamente capaz de regular deforma negativa la expresión de un gen diana en células por interferencia de ARN (ARNi), en la que el ANic comprende: (a) una cadena con sentido y una cadena antisentido; (b) cada cadena de la molécula de ácido nucleico es de forma independiente de 18 a 24 nucleótidos de longitud y ladoble cadena de ANic comprende de 17 a 23 pares de bases; (c) 5, 6, 7, 8, 9 ó 10 nucleótidos de pirimidina de la cadena con sentido y/o 5, 6, 7, 8, 9 ó 10 nucleótidos de pirimidinade la antisentido se modifican químicamente...

  11. 235.-

    Oligonucleótidos contra la infección de VIH y su uso en la prevención y tratamiento del síndrome de inmunodeficiencia adquirida

    (01/2013)

    Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 7 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 7 y la secuencia complementariade éste: accacacacaaggcuacuucccugau (SEC.ID Nº:7); donde dicho(s) fragmento (s) de SEC.ID Nº:7 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº: 7; un fragmento de 19 nt de SEC. ID Nº: 7; un fragmento de 20 nt de SEC. ID Nº: 7; un fragmento...

  12. 236.-

    Análogos de la 1-desamino-8-d-arginil vasopresina

    (01/2013)

    Un análogo de 1-desamino-8-D-arginil vasopresina, en donde dicho análogo tiene la siguiente fórmula general: donde, Mpa es un radical de ácido 3-mercaptopropanoico de la fórmula SH-CH2-CH2-COOH; X es el aminoácido alanina o valina; e Y es el aminoácido glutamina.

  13. 237.-

    Procedimiento y sistema para la irradiación y elución de una cápsula

    (01/2013)

    Una cápsula de elución que comprende: un tubo con una primera porción terminal que tiene un primer diámetro (D2) interno, una segundaporción terminal que tiene un segundo diámetro (D3) interno, y una porción intermedia existenteentre la primera porción terminal y la segunda porción terminal que tiene un diámetro (D4) interno máspequeño que los diámetros interno de las primera y segunda porciones terminales, en la que una superficiede contacto situada entre la primera porción terminal y la porción intermedia, forma un primer resalto yuna superficie de contacto situada entre la segunda poción terminal y...

  14. 238.-

    Dispositivo de bloqueo de cable de carga y procedimiento para bloquear un cable

    (01/2013)

    Dispositivo de bloqueo de cable de carga para vehículos eléctricos con - un alojamiento en el lado de vehículo para alojar un cable de carga que puede conectarse a unaestación de carga, y - una unidad de bloqueo dispuesta en el alojamiento , - estando formada la unidad de bloqueo para bloquear y liberar el cable de carga con respecto alalojamiento , en el que - la unidad de bloqueo está acoplada con una unidad de cierre del vehículo , de tal manera queal activar la unidad de cierre el cable de carga puede bloquearse con el alojamiento y que aldesactivar la unidad de cierre el cable de carga...

  15. 239.-

    Dispositivo de anclaje óseo

    (01/2013)

    Dispositivo de anclaje óseo , que comprende: una parte receptora destinada a recibir un elemento de implante en forma de varilla ,comprendiendo la parte receptora : un primer orificio coaxial a un eje longitudinal de laparte receptora y que se extiende desde un primer extremo de la parte receptora, yuna cavidad que se extiende desde el primer extremo para realizar la inserción del elemento deimplante en forma de varilla; un tornillo óseo con una sección roscada para su inserción en el hueso;un elemento de fijación dispuesto en el primer orificio para fijar una sección rígida delelemento de implante...

  16. 240.-

    Dispositivo de inspección en vía pública

    (01/2013)

    Dispositivo de inspección en vía pública, particularmente un registro de inspección, comprendiendo un marcorectangular cuyas paredes laterales y de los extremos delimitan una abertura, al menos una tapa cuyolado (8a) está montado articulado con relación a una pared del extremo adyacente del marco mediante almenos una bisagra de articulación que presenta un juego funcional para permitir a la tapa bascular entre unaposición alzada de liberación de la abertura del marco y una posición de cierre de esta abertura que estáapoyada sobre una pared de asiento periférica interna del marco y que está inscrita...

  17. 241.-

    Válvula hidráulica de toma con una carcasa de válvula de plástico para recipientes de transporte y almacenamiento para líquidos

    (01/2013)

    Válvula hidráulica de toma con una carcasa de la válvula hidráulica, en especial, una llave de mariposa o esférica, para recipientes de transporte y almacenamiento de líquidos, que están equipados con un recipiente interior de plástico con un tubo de alimentación cerradizo y un tubo de descarga para conectar la válvula hidráulica de toma, con una envoltura exterior de rejilla metálica o de chapa así como un bastidor metálico en f orma de paleta o un material plástico parcialmente conductor eléctrico para soporte de la recipiente interior, y con un cable flexible de puesta a tierra conectado a la carcasa de la válvula...

  18. 242.-

    Contenedor apilable multiposición

    (01/2013)

    Un contenedor que comprende: una base ; una pluralidad de paredes que se extienden hacia arriba desde la base ; y un soporte movible entre una posición de anidamiento, en la cual un contenedor idéntico (10') puede serencajado entre la pluralidad de paredes , y una posición de apilamiento, en la cual un contenedor idéntico(10') puede ser soportado sobre el soporte ; en el que al menos una de la pluralidad de paredes incluye al menos una superficie de contacto que puede sersoportada sobre el soporte (18') de aquel contenedor idéntico cuando el soporte (18') del contenedor idéntico(10') está en la...

  19. 243.-

    Procedimiento de transmisión de información de posición de un mapa digital y aparato utilizado para el procedimiento

    (01/2013)

    Sistema para identificar una posicion de un area especifica, que se especifica en un primer mapa digitalalmacenado en un aparato de transmision, en un segundo mapa digital almacenado en un aparato de recepcion ydiferente de dicho primer mapa digital, comprendiendo el sistema: el aparato de transmision que incluye: una unidad de generacion de informacion de posicion que genera informacion de posicion que comprendedatos de coordenadas de un primer conjunto de nodos, en el que los nodos estan situados a lo largo del limitedel area especifica en el primer mapa digital, una unidad de transmision que transmite la informacion...

  20. 244.-

    Formulación transdérmica que comprende un analgésico opioide y una composición de aloe

    (01/2013)

    Parche transdérmico que comprende - un analgésico opioide del grupo de fenantreno o una sal farmacéuticamente aceptable del mismo comoprincipio activo, - una composición de aloe como agente de penetración transdérmica y - una capa de recubrimiento, un adhesivo sensible a presión y un revestimiento de liberación, en el que eladhesivo consiste en o comprende un adhesivo de goma seleccionado de un copolímero en bloque deestireno-butadieno-estireno y un copolímero en bloque de estireno-butadieno.

  21. 245.-

    Implante articular expansible

    (01/2013)

    Dispositivo implantable, expansible, blando dimensionado para crear una separación entre huesospequeños caracterizado porque comprende una primera superficie lisa sobre la que puede deslizarse un primerhueso pequeño.

  22. 246.-

    Unidad de control de grúa para el control de un mecanismo de elevación de una grúa

    (01/2013)

    Unidad de control de grúa para el control de un mecanismo de elevación de una grúa, que durante el control delmecanismo de elevación considera la dinámica de oscilaciones que se basa en la capacidad de extensión del cablede elevación, y que se reduce mediante el control apropiado del mecanismo de elevación, en donde la velocidad deaccionamiento del mecanismo de elevación se limita para la limitación de la sobreoscilación en una velocidad deaccionamiento máxima fiable, caracterizado porque la velocidad de accionamiento máxima admisible delmecanismo de elevación, se determina mediante un modelo físico que describe...

  23. 247.-

    Estabilización de sustratos alimentarios calentados con microondas

    (01/2013)

    Un procedimiento de fabricación de un producto alimentario que comprende las etapas de: impregnar total o parcialmente un sustrato con una composición estabilizadora, comprendiendo el sustratotrozos de carne, de aves de corral, de pescado, de hortalizas, de fruta o de productos lácteos; en el que la composición estabilizadora co 5 mprende agua y en peso en seco: goma de celulosa 5-25 % almidón modificado 16-50 % componente espesante 32-79 % en donde los porcentajes de los ingredientes se seleccionan entre los intervalos citados hasta un total del 100%; y ingredientes adicionales opcionales y revestir...

  24. 248.-

    Máquina gimnástica

    (01/2013)

    Una máquina gimnástica que comprende una estructura que soporta unos primeros medios deactuación y a la que se dota de al menos un par de primeras palancas , cada una de las cualespresenta un respectivo implemento adecuado para funcionar como interfaz de usuario; unos medios decarga que se proporcionan en conjunción con dichas primeras palancas para disipar la energía aplicadaa cada dicho implemento en una proporción definible a voluntad; dichos medios de carga que sediseñan con el fin de mantener dichas primeras palancas en oposición de fase; caracterizada porcomprender unos segundos medios...

  25. 249.-

    JUGUETE

    (01/2013)

    El juguete de invención está constituido a partir de dos cuerpos básicamente discoidales , acoplable entre sí a través de los correspondientes medios de fijación establecidos sobre sus caras internas, definiendo entre ellos una cámara interna en la que es insertable parcialmente un elemento laminar , alargado verticalmente. Con los citados elementos discoidales colaboran una pareja de patas escamoteables , de configuración en forma de sector circular truncado, basculante con respecto a dicho conjunto, que en disposición de inoperancia quedan alineadas con el borde perimetral circular del juguete,...

  26. 250.-

    DISPOSITIVO TRANSDUCTOR DIGITAL PORTÁTIL PROGRAMABLE CON ALTA DISCRIMINACIÓN EN BAJA FRECUENCIA Y DE BAJA INTENSIDAD

    (01/2013)

    Dispositivo transductor digital portátil, programable con alta discriminación en baja frecuencia y de baja intensidad que consiste en un dispositivo generador de campos electromagnéticos digital, portátil, modular, que puede ser utilizado para un gran número de aplicaciones médicas. El dispositivo permite ser programado mediante software en lo que se refiere a sus principales parámetros (amplitud, forma de onda, frecuencia, secuencia de pulsos, modelo positivo-negativo ... etc.), y además es completamente portátil con un reducido peso, alimentado por baterías recargables. Su alto grado de modularidad...

  27. 251.-

    SENSOR NO INVASIVO PARA DETERMINAR CARACTERÍSTICAS FUNCIONALES DE LA CÓRNEA Y DISPOSITIVO QUE INCLUYE DICHO SENSOR

    (01/2013)

    Sensor no invasivo para determinar características funcionales de la córnea y dispositivo que incluye dicho sensor. Comprende unos microelectrodos de contacto (I+, V+, I-, V-) dispuestos sobre un sustrato , siendo el tamaño y disposición de dichos microelectrodos de contacto (I+, V+, I-, V-) adecuados para hacer contacto con una córnea humana. Permite medir la bioimpedancia de la córnea de un modo no invasivo en el rango de frecuencias desde 10 Hz hasta 1 MHz; y obtener, en función de la bioimpedancia medida y de la frecuencia a la que se realiza la medida, datos útiles para el diagnóstico del...

  28. 252.-

    DISPOSITIVO PARA EL TRATAMIENTO DE LA CELULITIS

    (01/2013)

    Dispositivo para el tratamiento de la celulitis que comprende medios de masaje por aspiración, un cuerpo cuadrangular con una pluralidad de elementos de apoyo , al menos uno por vértice del cuerpo, en donde dichos elementos de apoyo finalizan en punta redondeada la cual está en contacto con la piel a tratar y que se caracteriza porque sobre el cuerpo cuadrangular quedan alojados una pluralidad de emisores láser , mientras que en los elementos de apoyo quedan alojados una pluralidad de electrodos emisores de corriente , al menos uno por elemento de apoyo; y donde dichos electrodos definen...

  29. 253.-

    SISTEMA DE ANÁLISIS Y GESTIÓN DE IMÁGENES QUIRÚRGICAS

    (01/2013)

    Sistema de análisis y gestión de imágenes quirúrgicas. Se describe un sistema de análisis y gestión de imágenes quirúrgicas que permite monitorizar y registrar en tiempo real toda la actividad de un quirófano o entorno médico-quirúrgico complejo mediante la integración de imágenes o señales de video procedentes de los dispositivos de uso habitual en quirófano, señales de video procedentes de ordenadores y equipos informáticos de uso en quirófano, imágenes de los estudios radiológicos y datos de la historia clínica desde redes hospitalarias o soportes convencionales y señales de cámaras...

  30. 254.-

    MÉTODO Y SISTEMA PARA COMPENSAR ABERRACIONES ÓPTICAS EN UN TELESCOPIO

    (01/2013)

    Método y sistema para compensar aberraciones ópticas en un telescopio. El método está aplicado a un telescopio donde el elemento receptor de un haz primario es un dispositivo de adquisición de imágenes , y comprende utilizar un algoritmo sin sensor de procesamiento de imágenes para: a) detectar unas aberraciones ópticas que afectan al foco primario, mediante el análisis de las imágenes adquiridas por el dispositivo de adquisición de imágenes , b) calcular y generar unos primeros valores de corrección posicionales, mediante el procesamiento de los valores de las aberraciones ópticas...

  31. 255.-

    MÉTODO DE FABRICACIÓN DE DISPOSITIVOS RB-IGBT

    (01/2013)

    Método de fabricación de dispositivos RB-IGBT. Se presenta un método de fabricación de dispositivos IGBT, con capacidad de bloqueo en inversa. Para ello, se ha utilizado la técnica de aislamiento por trinchera donde el proceso de impurificación de la misma se ha realizado utilizando una fuente sólida con obleas de boro, resultando en un abaratamiento tanto en material de partida como en una reducción del tiempo de proceso.

  32. 256.-

    PERSIANA ENRROLLABLE DE LAMAS ORIENTABLES

    (01/2013)

    Persiana enrollable de almas orientables en donde el giro de las lamas para su graduación viene provocado al engranarse un eje solidario, existente al menos en cada una de las lamas orientables, con un barra vertical de tal forma que al variar en altura la posición de las lamas o de la barra vertical dicha, se provoca el giro de los ejes dichos. La barra vertical y los ejes de las lamas se engranan o desengranan al acercarse o alejarse el carril por el que discurren las lamas en su recorrido ascendente o descendente y la barra vertical dicha.

<< · 4 · 6 · < · 8 · > · 10 · 13 · 19 · >>