4,378 Patentes de mayo de 2012 (pag. 30)

  1. 929.-

    MÉTODOS Y SISTEMAS PARA LA FABRICACIÓN DE DISPOSITIVOS DE CMOS DE MEMS EN DISEÑOS DE NODO INFERIOR

    (05/2012)
    Ver ilustración. Solicitante/s: BAOLAB MICROSYSTEMS SL. Inventor/es: MONTANYA SILVESTRE,JOSEP. Clasificación: B81C1/00.

    Un método para fabricar un circuito integrado que incluye producir capas que forman uno o más elementos eléctricos y/o electrónicos sobre un sustrato de material semiconductor. A continuación, la producción de capas de ILD por encima de las capas que forman uno o más elementos eléctricos y/o electrónicos incluye las etapas de depositar una primera capa de material de barrera ante el ataque químico superficial, depositar una segunda capa de material dieléctrico por encima de la primera capa y en contacto con ella, formar al menos una pista que se extiende a través de las primera y segunda capas, y llenar la al menos una pista con un material no metálico.

  2. 930.-

    ESMALTE CERÁMICO HIDROFÓBICO CON BRILLO METÁLICO Y SU PROCEDIMIENTO DE OBTENCIÓN

    (05/2012)
    Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC). Inventor/es: FERNANDEZ LOZANO,JOSE FRANCISCO, JIMENEZ REINOSA,JULIAN, ROMERO FANEGO,JUAN JOSE, ORTA BOLEA,Vicente, JAQUOTOT GARCÍA,Pedro José, BENGOCHEA ESCRIBANO,Miguel Ángel. Clasificación: C04B41/86, C03C8/14, C04B41/51.

    La presente invención se refiere a una composición basada en óxidos metálicos y arcilla, la cual es empleada en una suspensión acuosa para la formación del recubrimiento de cerámicas, además la invención se refiere a un procedimiento para la obtención de materiales esmaltados con brillo metálico y de elevado carácter hidrófobo.

  3. 931.-

    MÉTODO Y SISTEMA ASOCIADO PARA LA DETECCIÓN Y EL ANÁLISIS DE AGENTES PATÓGENOS Y/O CAPACES DE CAUSAR EL DETERIORO EN ALIMENTOS VEGETALES

    (05/2012)
    Ver ilustración. Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC). Inventor/es: LOPEZ GALVEZ,FRANCISCO, GIL MUÑOZ,MARIA ISABEL, SELMA GARCÍA,Victoria, ALLENDE PRIETO,Ana, BELTRÁN RIQUELME,David. Clasificación: G01N33/569, C12Q1/04, C12Q1/70.

    La presente invención se refiere a un método para la detección de agentes potencialmente patógenos y/o capaces de causar el deterioro en una muestra vegetal, representativa de uno o varios lotes de producto vegetal, caracterizado porque comprende la concentración de una muestra vegetal mediante centrifugación y el análisis de la presencia o la cantidad de los agentes potencialmente patógenos y/o capaces de causar el deterioro en la muestra concentrada obtenida. Asimismo, la presente invención se refiere a un sistema de detección y análisis de agentes potencialmente patógenos y/o capaces de causar el deterioro en una muestra vegetal, para llevar a cabo dicho método.

  4. 932.-

    PLATAFORMA HARDWARE PARA APLICACIONES MÓVILES

    (05/2012)
    Ver ilustración. Solicitante/s: VANIOS CONSULTING S.L. Inventor/es: MORENO,Ivan. Clasificación: G06F17/30, G06F21/00.

    Plataforma de telecomunicaciones para la gestión de peticiones desde terminales externos que incluye una unidad de comunicaciones , una unidad de almacenamiento , una unidad de lectura biométrica para autenticar a un usuario. Además, cuenta con una unidad de cifrado y con una unidad de proceso encargada de procesar las peticiones externas de terminales recibidas por la unidad de comunicaciones ejecutando las operaciones asociadas con cada petición mediante el acceso a los datos requeridos de forma segura, y enviando un resultado cifrado al terminal externo . Gestiona credenciales del usuario, de una manera segura. Tras la autenticación del usuario, la plataforma devuelve, solamente los datos requeridos. Similarmente los problemas de compatibilidad se resuelven enviando un conjunto de instrucciones para adaptar los datos intercambiados que se ejecutan en el terminal externo o alternativamente en la misma plataforma.

  5. 933.-

    MAQUINA PARA EXTENDER, DOSIFICAR, ESPARCIR, NIVELAR Y VIBRAR MATERIALES PARA LA PAVIMENTACION

    (05/2012)

    1. Máquina para extender, dosificar, esparcir, nivelar y vibrar materiales de pavimentación caracterizada por un chasis tubular que realiza la función de bancada y engloba un cuerpo base y un cuerpo de control y que recoge en uno de sus extremos un sistema de rodadura constituido por una plataforma , un sistema basculante de suspensión , un sistema de tracción y unos sistemas de rodadura, mientras que por el otro extremo la máquina dispone de dos brazos que giran en una articulación y enlazan el cuerpo de la máquina con un sistema de rodadura posterior mediante...

  6. 934.-

    Neumático de aire

    (05/2012)

    Un neumatico de aire que comprende: un par de partes de talón ; un nucleo de talón dispuesto en cada parte de talón y que tiene una configuración poligonal en sección transversal; una carcasa radial que se extiende en forma toroidal desde una parte de talón a la otra parte de talón de manera que los respectivos extremos de la misma estan enrollados alrededor de los correspondientes nucleos de talón desde el lado interno al lado externo del neumatico: al menos una capa de chafer de cable dispuesta en el lado exterior de la...

  7. 935.-

    GUÍA CENTRAL PARA TRANSPORTADOR DE ARTÍCULOS

    (05/2012)

    1. Una guía para transportador de artículos que comprende un primer y un segundo elemento de chapa (100d, 100s) extendidos longitudinalmente y destinados, en la utilización, a ser dispuestos a lo largo de un recorrido de transporte para retener y/o encarrilar los artículos transportados, comprendiendo este primer y segundo elemento, cada uno, una respectiva porción sustancialmente plana (105d, 105s), en la cual el primer elemento de chapa y el segundo elemento de chapa están asociados mediante las respectivas porciones sustancialmente planas definiendo dos extremos contrapuestos de un cuerpo de la guía para transportador de artículos, caracterizado porque cada uno de este primer y segundo elemento de chapa comprende además, en un extremo...

  8. 936.-

    ELEMENTO DE CALEFACCIÓN

    (05/2012)

    Elemento de calefacción modular (fig. 1B) que permite aunar, frente a otros productos existentes (fig. 1A), las ventajas y posibilidades caloríficas conocidas de la radiación, convección natural y convección forzada que permitirá obtener, potencias y rendimientos superiores incluido el aprovechamiento efectivo y seguro del confort calorífico que proporciona la radiación de superficies a temperaturas entre 80° - 140°. El elemento de calefacción conjuga al mismo tiempo una constructiva de un cuerpo central extruido portante de las canalizaciones de fluido calefactor y superficies planas previstas para recibir aletas por pegado u otro sistema, una utilización eficiente de la radiación del cuerpo central...

  9. 937.-

    Suela impermeable y respirable para calzado, y calzado fabricado con dicha suela

    (05/2012)

    Suela impermeable y respirable para calzado con una estructura, que está caracterizada porque comprende: - una capa de soporte que, por lo menos en una macroparte predispuesta está realizada en red, fieltro u otro material difusamente perforado; - una membrana que está realizada en un material impermeable al agua y permeable al vapor de agua y está asociada superiormente a dicha capa de soporte por lo menos en dicha por lo menos una macroparte predispuesta realizada en red, fieltro u otro material difusamente perforado,...

  10. 938.-

    Dispositivo de articulación de una tapa o cubierta en un marco, en particular de un registro en calzada

    (05/2012)

    Dispositivo de articulación de una tapa o cubierta en un marco en forma de cuadrilátero, en particular de un registro en calzada, que permite el giro de la tapa en relación con el marco entre una posición bajada de cierre en la que la tapa cierra la abertura rodeada por los lados del marco superponiéndose al menos de manera parcial sobre un rebaje del marco y una posición levantada de acceso a la abertura del marco , el dispositivo comprendiendo dos pares laterales de bieletas que unen la tapa al...

  11. 939.-

    Dispositivo de conexión que tiene un diodo para la conexión de un conductor eléctrico a un cable de conexión

    (05/2012)

    Dispositivo de connexion para connexion de al menos un conductor eléctrico a al menos un cable de conexión, que comprende: un alojamiento de conector que tiene al menos un orificio pasante de cable de conexión para el cable de conexión, y al menos un orificio pasante de conductor para el conductor eléctrico, una disposición de connexion intermedia dispuesta en el alojamiento de conector que tiene una primera área de conexión para conexión del cable de conexión y una segunda área de conexión...

  12. 940.-

    Contador de voltaje medio multifase

    (05/2012)

    Contactor de voltaje medio multifase , que comprende: - para cada fase, un contacto fijo y un contacto móvil asociado posicionable entre una posición abierta, en la que está desconectado funcionalmente de dicho contacto fijo , y una posición cerrada, en la que está conectado funcionalmente a dicho contacto fijo ; - un actuador electromagnético conectado funcionalmente a dicho contacto móvil y posicionable entre una primera posición abierta correspondiente a la posición abierta de dichos contactos...

  13. 941.-

    Sistema expositor de productos en forma de tarjeta

    (05/2012)

    Unidad expositora para colgar productos que comprende: una base sustancialmente plana que tiene un lado delantero, un lado trasero, un borde izquierdo y un borde derecho; un gancho alargado que se extiende hacia delante desde el lado delantero de la base , teniendo el gancho un extremo proximal unido a la base y un extremo distal; un mecanismo de fijación unido al lado trasero de la base , estando adaptado el mecanismo de fijación para fijar de manera selectiva la unidad expositora...

  14. 942.-

    Uso de IL-21 y anticuerpo monoclonal para tratar cánceres sólidos

    (05/2012)

    Un polipéptido que tiene una actividad funcional de IL-21, y un anticuerpo monoclonal, para su uso en el tratamiento de cáncer en un sujeto, en el que el cáncer se selecciona del grupo de carcinoma de células renales, cáncer de mama, glioma y cáncer de colon; y en el que el primer polipéptido tiene al menos 80 % de identidad con un polipéptido de IL-21 que comprende los restos 41 (Gln) a 148 (Ile) de SEC ID Nº: 2 o restos 32 (Gln) a 162 (Ser) de SEC ID Nº:

  15. 943.-

    DISPOSITIVO DOBLADOR DE SOLAPAS PARA MÁQUINA FORMADORA DE CAJAS DE CARTÓN

    (05/2012)

    Dispositivo doblador de solapas para máquina formadora de cajas de cartón. El dispositivo doblador de solapas comprende un miembro doblador asociado a un molde de una máquina formadora de cajas de cartón, la cual comprende además un macho accionado para presionar una preforma plana al interior de dicho molde. El miembro doblador está situado en una posición adecuada para actuar contra una solapa de dicha preforma y doblar dicha solapa a una posición substancialmente perpendicular a una pared lateral de la caja de cartón. El miembro doblador está montado de manera que puede pivotar alrededor de un eje de giro soportado en un conjunto de soporte y un actuador está soportado en dicho conjunto de soporte y conectado operativamente...

  16. 944.-

    PROCEDIMIENTO PARA LA PRODUCCIÓN DE HIDRÓGENO MEDIANTE ELECTROLISIS DE UNA SOLUCIÓN ACUOSA DE PRODUCTOS ORGÁNICOS

    (05/2012)

    Procedimiento para la producción de hidrógeno mediante electrólisis de una solución acuosa de productos orgánicos. La presente invención se refiere a un procedimiento para la producción de hidrógeno caracterizado porque comprende la electrólisis de una solución acuosa que comprende al menos un producto orgánico seleccionado entre un producto residual procedente de la industria y un producto derivado de biomasa, así como cualquiera de sus combinaciones.

  17. 945.-

    PROCESO PARA LA PREPARACIÓN DE SUSPENSIONES DE SALES DE CALCIO Y MÉTODO PARA LA INCORPORACIÓN DE CALCIO EN BEBIDAS ALIMENTICIAS, NUTRACÉUTICAS Y FARMACÉUTICAS

    (05/2012)
    Solicitante/s: UNIVERSIDAD DEL VALLE. Inventor/es: BOLAÑOS BARRERA,Gustavo Eduardo, MEJÍA VILLAREAL,Isabel Maria. Clasificación: A23L1/304, A23L2/00, B01F3/06.

    La presente invención está relacionada con un proceso novedoso para la producción de suspensiones acuosas de micro y nanopartículas de sales de calcio con tamaños inferiores a 10 micras y con un método para el enriquecimiento de bebidas alimenticias, nutracéuticas y farmacéuticas con sales calcio. En el proceso se somete una suspensión acuosa de la sal de calcio a presurización con dióxido de carbono crítico, subcrítico o supercrítico para incrementar la solubilidad de la sal de calcio que presenta tamaño de partícula superior a 30¿m. La solución resultante se expande a través de una boquilla para generar una suspensión de micro y nanopartículas de la sal de calcio que resulta imperceptible a la vista y al gusto.

  18. 946.-

    LUNETA MEJORADA PARA ASIENTO GIRATORIO DE PALAS DE AEROGENERADORES

    (05/2012)
    Ver ilustración. Solicitante/s: NADITEC INGENIERIA, S.L. Inventor/es: LAZCOZ SANTESTEBAN,José María. Clasificación: B23Q1/76, F01D5/14, F03D1/06, B24B19/14.

    Comprende en principio una estructura circunferencial que asienta sobre unos rodillos giratorios acoplados en una plataforma base, asentando la pala sobre tal estructura circunferencial y también sobre un apoyo giratorio extremo donde apoya la pala por su tramo inicial cilindrico. Se caracteriza porque la estructura circunferencial comprende un anillo estructural unido a una estructura central afectada de una amplia abertura frontal donde se aloja una porción de la pala de aerogenerador que se inmoviliza mediante unas mordazas soportadas por la estructura central , a la vez que están dispuestas en correspondencia con los laterales de tal abertura frontal , la cual está delimitada por los bordes de la misma y por un cuerpo arqueado móvil que forma parte del anillo circunferencial.

  19. 947.-

    Uso de oligonucleótidos CPG en el tratamiento de infección por el virus de la hepatitis C

    (05/2012)

    Un ácido nucleico inmunoestimulante CpG clase C que comprende la secuencia TCGTCGTTTTACGGCGCCGTGCCG (SEQ ID NO. 13) .

  20. 948.-

    CAJA DE GRASA PARA RODALES Y BOGIES DE FERROCARRIL

    (05/2012)
    Ver ilustración. Solicitante/s: PATENTES TALGO, S.L. Inventor/es: MIGUEL DE PRIEGO,José Carlos, QUINTANA POLO,Victor, ARENAS PINILLA,Antonio. Clasificación: B61F15/20, B61F15/12.

    Caja de grasa para rodales y bogies de ferrocarril, que consiste en un alojamiento dentro del cual se montan los rodamientos del eje de rodadura del rodal y que comprende un casquillo con taladros roscados sobre el que se apoyan los rodamientos , que es un casquillo interior metálico. Comprende adicionalmente un casquillo exterior metálico, de modo que entre el casquillo interior metálico y el casquillo exterior metálico se fija mediante vulcanizado una goma de característica aniso- trópica, con rigideces independientes en dos direcciones radiales perpendicu- lares entre sí. Comprende adicionalmente sendos anillos axiales laterales , y además comprende al menos un suplemento en forma de semiaro fijado al casquillo exterior , de modo que queda intercalado entre éste y la cuna del bastidor del rodal.

  21. 949.-

    MEJORAS EN EL OBJETO DE LA PATENTE DE INVENCIÓN Nº 200930917 (0) POR: "PUNTO FIJO PARA DISPOSITIVO ANTIRROBO PARA VEHÍCULOS DE DOS O MÁS RUEDAS"

    (05/2012)

    Se refiere a unas mejoras que consisten en varias realizaciones distintas de sistemas de anclaje en dicho punto fijo como alternativas a las descritas y reivindicadas en la patente principal, que aumentan la seguridad y fiabilidad y que son ideales para otro tipo de aplicaciones para los mismos vehículos. Comprenden esencialmente un casquillo dotado de dos partes, un cuerpo cilíndrico mecanizado interior y exteriormente, en el que se acoplan otros componentes, y en la base superior de dicho cuerpo, un cabezal...

  22. 950.-

    NUEVO MÉTODO PARA LA PREPARACIÓN DE (S)-PREGABALINA

    (05/2012)

    Método para la preparación de una sal (III) de pregabalina y ácido (S)-mandélico con un contenido en el diastereómero (S,S) mayor que 80% que comprende las siguientes etapas: (a) reacción de Hofmann del ácido (+-)-3-(carbamoilmetil)-5-metilhexanoico (I) para obtener pregabalina racémica (II) ****IMAGEN-01**** (b) adición de ácido (S)-(+)-mandélico para obtener la correspondiente sal diastereoisomérica con un contenido en el diastereómero (S,S) mayor que 80% ****IMAGEN-02**** (c) opcionalmente purificación de la sal obtenida en la etapa (b); caracterizado porque la etapa (b) se realiza sin aislar el producto...

  23. 951.-

    PASADOR BLOQUEANTE

    (05/2012)

    1. Pasador bloqueante, caracterizado porque comprende un cabezal que es portador de un cerrojo de dimensiones variables y de medios de accionamiento para seleccionar las dimensiones del cerrojo; cuyo cabezal está constituido por un cuerpo que dispone a partir de su superficie externa de un primer y un segundo alojamientos de ejes perpendiculares, de los cuales el segundo alojamiento desemboca interiormente en el primer alojamiento ; y cuyo cerrojo está compuesto por un vástago rígido que va montado a partir de uno de sus extremos...

  24. 952.-

    Dispositivo sensor perfeccionado dotado de filtro para seguimiento solar

    (05/2012)

    1. Dispositivo sensor perfeccionado dotado de filtro para seguimiento solar, destinado a definir la posición solar, mediante la detección de su ángulo de incidencia, para utilización en seguidores del tipo de cilindro parabólico, de uno o dos ejes, con procesado de información y transmisión al exterior para su posterior aprovechamiento por el sistema de actuadores del seguidor solar, caracterizado por constar de un fotosensor compuesto con una pluralidad de células sensibles a la luz, distribuidas sobre el plano de fondo de un...

  25. 953.-

    Escenarios de registro entre redes de comunicación inalámbrica nuevas y heredadas

    (05/2012)

    Un método para su uso en una unidad de transmisión/recepción inalámbrica WRTU (Wireless Transmit/Receive Unit, en inglés) , estando el método caracterizado por: generar un indicador de área de encaminamiento, RAI, elemento de información IE (Information Element, en inglés), basándose en datos del indicador de área de seguimiento, TAI (Tracking Area Indicator, en inglés), en el que el IE del RAI ya no está en los datos del TAI; generar un IE de Identidad de Abonado Temporal de Paquete, P-TMSI - Packet Temporar y Mobile...

  26. 954.-

    SISTEMA Y MÉTODO DE ABATIMIENTO NO CATALÍTICO DE ÓXIDOS DE NITRÓGENO

    (05/2012)
    Ver ilustración. Solicitante/s: INERCO, INGENIERÍA, TECNOLOGÍA Y CONSULTORÍA, S. A. Inventor/es: Tova Holgado, Enrique, CAÑADAS SERRANO,LUIS, MONTAÑES PEREZ,JULIO, RODRÍGUEZ BAREA,Franscisco J, DELGADO LOZANO,Miguel A, BOSCH NAVAL,Enrique, CORTES GALEANO,Vicente Jose. Clasificación: F23J15/00, F23N5/00, F23C3/00.

    Permite reducir los óxidos de nitrógeno en equipos de combustión con una gran eficiencia de reducción en relación a la cantidad de agente reductor nitrogenado empleado. Comprende unos inyectores (9a, 9b, 9c, 9d) para la inyección del agente reductor; un sistema de análisis de concentración de gases CO, CO.

  27. 955.-

    APARATO PARA CURAR INFECCIONES CAUSADAS POR BACTERIAS Y MICROORGANISMOS FOTOSENSIBLES

    (05/2012)

    1. Aparato para curar infecciones causadas por bacterias o infecciones fotosensibles caracterizado porque comprende: - un primer casquete semiesférico que comprende: - una abertura en su centro y - elementos de unión tipo velcro{reg} en el perímetro de la circunferencia formada en su extremo, - un segundo casquete semiesférico que comprende: - un espejo en su cara interior y en su parte central, - al menos un emisor de un haz de luz en su cara interior, junto al espejo y - un elemento de unión...

  28. 956.-

    ESCUADRA PARA LA UNION SELLADA DE PERFILES METALICOS

    (05/2012)

    1. Escuadra para la unión sellada de perfiles metálicos; siendo dicha escuadra del tipo de las que comprenden: dos alas perpendiculares unidas por uno de sus extremos, y destinadas a alojarse en una cámara longitudinal de los respectivos perfiles metálicos a unir; y unos medios de fijación de la escuadra respecto a los mencionados perfiles metálicos; caracterizada porque el punto de unión de los extremos de las alas presenta, en su estructura, una configuración tal que, una vez incorporada la escuadra en los perfiles a...

  29. 957.-

    DISPOSITIVO PUBLICITARIO

    (05/2012)

    1. Dispositivo publicitario, del tipo de los que comprenden: - un soporte con una superficie inferior de apoyo, y superiormente un canal longitudinal , el cual está delimitado por dos paredes laterales que presentan unos orificios transversales ; - unos motivos publicitarios tridimensionales, de un material flexible con memoria de forma y espesor uniforme, que presentan un talón inferior para el acoplamiento en el canal longitudinal del soporte ; y - unos elementos de fijación montados a través de los orificios...

  30. 958.-

    Válvula protésica implantable

    (05/2012)

    Un dispositivo de prótesis implantable por vía subcutánea para sustituir una válvula aórtica nativa deficiente, que comprende: - un stent de soporte plegable y expandible formado por una aleación con memoria de forma, estando el stent de soporte adaptado para enrollarse inicialmente en una configuración estrecha adecuada para cateterización a través de un conducto corporal hasta una ubicación diana, - el stent de soporte que comprende una porción de stent proximal configurado para expandirse hasta un primer...

  31. 959.-

    Método para hacer una estructura laminada de vidrio/película de poliolefina

    (05/2012)

    Un método para hacer una estructura laminada, comprendiendo la estructura (i) una capa de vidrio, (ii) una primera capa de poliolefina (PO) que comprende una PO injertada con un grupo alcoxisilano, (iii) una capa de catalizador, y (iv) una segunda capa de PO que comprende una PO injertada con un grupo alcoxisilano, teniendo cada capa superficies faciales opuestas, y comprendiendo el método las etapas de aplicar en contacto adherente: A. Una superficie facial de la primera capa de PO a una superficie facial de la capa...

  32. 960.-

    Objeto de vidrio hueco

    (05/2012)

    0bjeto de vidrio hueco que presenta, para un espesor de 5 mm, una transmisión luminosa global superior o igual a 70%, siendo calculada dicha transmisión luminosa global tomando en consideración el iluminante C tal como se define por la norma IS0/CIE 10526 y el observador de referencia colorimetrico C.I.E. 1931 tal como se define por la norma IS0/CIE 10527, y un poder filtrante superior o igual a 65%, en particular 70%, estando definido dicho poder filtrante como siendo igual al valor de 100% menos la media aritmetica de...

<< · 15 · 22 · 26 · 28 · < · 30 · > · 33 · 36 · 43 · 56 · 83 · >>