4,378 Patentes de mayo de 2012 (pag. 110)

  1. 3489.-

    DISPOSITIVO SUPERVISOR DE ENERGIA EN LOS EDIFICIOS

    (05/2012)

    Dispositivo supervisor de energía en los edificios. El dispositivo reivindicado consiste en un circuito electrónico programable y con conexión a redes de diversos protocolos, especializado en la medida, análisis y transmisión de las variables relacionadas con el consumo de energía en los edificios. Diversos módulos de adquisición pueden ser distribuidos en distintas localizaciones del edificios y tienen como función principal la adquisición, procesamiento y transmisión de la información de campo pertinente al flujo de energía. Cada uno de los módulos, una vez configurado, es autosuficiente para gestión local de los datos recibidos con el objetivo de llevar a cabo una gestión eficiente de la energía.

  2. 3490.-

    Exoesqueleto robotizado vestible para brazo humano

    (05/2012)

    La presente invención se refiere a un exoesqueleto robotizado accionado por cables y mecanismos paralelos de reducido peso y volumen, permitiendo al usuario moverse cómodamente y realizar terapias médicas, ayudas a la realización de fuerzas del tipo ortésico, actividades relacionadas con prácticas deportivas o entrenamientos especializados que requieran secuencias de movimientos o ayuda para las tareas cotidianas. El sistema está formado por un chaleco , al cual están adosados el exo-brazo , el exo-antebrazo , una estructura de cinemática paralela del hombro que permite efectuar un seguimiento de los desplazamientos del hombro respecto al cuerpo, un sistema de compensación del peso del conjunto articulado, accionamientos de potencia...

  3. 3491.-

    PROCEDIMIENTO PARA CODIFICAR Y DESCODIFICAR CÓDIGOS

    (05/2012)

    El procedimiento para codificar y descodificar códigos, que comprende la etapa de proporcionar un primer código en función de unas coordenadas; y se caracteriza por el hecho de que comprende la etapa adicional de proporcionar un segundo código en función de una clave. Dicho primer código comprende preferentemente por lo manos un primar elemento y por un segundo elemento. Se aumenta la seguridad, ya que el usuario debe conocer dicha clave, que debe ser fácil para memorizarse, para poder codificar o descodificar el segundo código.

  4. 3492.-

    MEDALLA DE IDENTIFICACIÓN AUTOPORTANTE

    (05/2012)

    1. Medalla de identificación autoportante, caracterizada porque comprende un cuerpo principal aplanado que presenta en su contorno dos elementos longitudinales, contenidos en el mismo plano que contiene el cuerpo principal de la medalla y que comprenden cada uno de ellos un primer extremo de unión a dicho cuerpo principal, quedando dichos extremos separados una cierta distancia entre sí y, un segundo extremo libre de cada elemento a cierta distancia del cuerpo principal, quedando uno de los elementos de forma envolvente al otro...

  5. 3493.-

    FUNDA ATRIL

    (05/2012)

    1. Funda atril para computadores portátiles tipo tableta, caracterizada porque, realizada en cartón corrugado, polipropileno celular u otros materiales de similares características, se compone de varios elementos laminares encolados y troquelados, comprendiendo: - un primer elemento conformado por una pieza laminar rectangular dividida transversalmente por dos hendiduras centrales que permiten su doblado y determinan un lomo , una base y una cubierta ; en que dicha cubierta cuenta con varias hendiduras interiores destinadas a permitir el doblado de la misma hacia atrás para de apoyo a la base quedando esta inclinada a modo de atril; - y un segundo...

  6. 3494.-

    EQUIPO DE LIMPIEZA PARA FILTRO DE MALLA ROTATIVO

    (05/2012)

    1. Equipo de limpieza para filtro de malla rotativo utilizado para conducciones de agua en riego y aplicaciones industriales, destinado a retener cualquier partícula orgánica o inorgánica en cualquier fluido, caracterizado por comprender una bomba de presurización , acoplada sobre la carcasa exterior del filtro de malla rotativo , directamente relacionado con un colector dotado con varias boquillas proyectoras de fluido, incorporándose además un detector de atascamiento sobre el propio filtro de malla rotativo o en un cuadro electrónico de control. 2. Equipo de limpieza para filtro de malla rotativo según la anterior reivindicación, caracterizado...

  7. 3495.-

    Dispositivo para destruir las imágenes emitidas por una fuente de luz

    (05/2012)

    1. Dispositivo para destruir las imágenes emitidas por una fuente de luz, caracterizado porque está constituido por un cerco que limita una serie de tabiques aptos para definir compartimientos aislados, cuyos tabiques están operativamente dispuestos para quedar perpendiculares a la pantalla del aparato, estando cubierto uno de los dos planos formados por dicho conjunto de tabiques mediante una lámina translúcida difusora de luz. 2. Dispositivo para destruir las imágenes emitidas por una fuente de luz, de conformidad con la reivindicación 1, caracterizado porque los tabiques pueden ser ortogonales, radiales, circulares o de cualquier otra...

  8. 3496.-

    DISPOSITIVO DE FILTRADO DE PINTURA

    (05/2012)

    1. Dispositivo de filtrado de pinturas que comprende una carcasa portafiltros , caracterizado por comprender: - una tapa dispuesto en la parte superior de la carcasa , - un racor dispuesto en la parte inferior de la carcasa , - un filtro , - un adaptador dispuesto en la parte inferior interior de la carcasa , unido al racor por uno de sus extremos y por el otro al filtro . 2. Dispositivo de filtrado de pinturas según reivindicación 1 caracterizado porque comprende un segundo adaptador dispuesto en la parte superior interior de la carcasa , unido a la tapa por uno de sus extremos y por el otro al filtro . 3....

  9. 3497.-

    ASIDERO AUTOMÁTICO PARA EL INTERIOR DE VEHÍCULOS AUTOMÓVILES

    (05/2012)

    1. Asidero automático para el interior de vehículos automóviles, que comprende una empuñadura unida por su base a al menos un soporte fijado en la proximidad de una puerta , siendo dicha empuñadura pivotante alrededor de al menos un eje de dicho soporte , caracterizado porque la empuñadura pivota automáticamente alrededor del eje en función del estado de la puerta , entre al menos una posición superior y una posición inferior. 2. Asidero automático para el interior de vehículos automóviles, según la reivindicación 1, caracterizado porque la empuñadura es en forma...

  10. 3498.-

    Procedimiento para precalentar aglomerados de hierro

    (05/2012)

    Procedimiento para precalentar aglomerados de hierro mediante un flujo de gas caliente, que comprende las siguientes etapas: disposición de los aglomerados de hierro en un lecho de aglomerados de hierro; calentamiento del gas a la temperatura de precalentamiento en un cambiador de calor, y conducción del gas caliente a través del lecho de aglomerados de hierro en el que el flujo de gas es de tal manera que la caída de temperatura del gas caliente se lleva a cabo a través de una capa relativamente delgada en dicho lecho, de manera que en el transcurso del calentamiento un frente de temperatura...

  11. 3499.-

    Procedimiento y dispositivo para hallar daños en elementos de máquina que se mueven cíclicamente

    (05/2012)

    Procedimiento para hallar daños en al menos un elemento de máquina que se mueve cíclicamente, en que una señal provocada por el movimiento es captada por un sensor , al menos un componente con un periodo ajustable es separado de la señal, y la parte restante de la señal es sometida a un análisis de daños, caracterizado porque para la separación de componentes periódicos de señal la señal es aportada como señal de entrada a una memoria anular rotatoria , que es formada por elementos de memoria dispuestos cíclicamente, que reciben consecutivamente la señal de entrada aplicada actualmente...

  12. 3500.-

    Dispositivo para la regulación del ángulo de ataque de una pala de rotor de una instalación de energía eólica y su lubricación

    (05/2012)

    Dispositivo para la regulación selectiva del ángulo de ataque de una pala de rotor alojada giratoria con su raíz de pala en un cubo de un rotor de una instalación de energía eólica , con un dentado y una rueda dentada de accionamiento que engrana con el dentado , con una instalación de lubricación, que presenta un piñón de lubricación que engrana con el dentado o con la rueda dentada de accionamiento , y la cual en al menos un diente de lubricación definido del piñón de lubricación puede producir una provisión de lubricante , estando la instalación de lubricación...

  13. 3501.-

    Aparato y método para reducir la relación de potencia pico a potencia promedio en un sistema de multiplexación por división de frecuencia ortoganal

    (05/2012)

    Un método para reducir la relación de potencia pico a potencia promedio PAPR utilizando tonos reservados en un aparato de transmisión de un sistema de comunicación de Multiplexación por División de Frecuencia Ortogonal OFDM, el método comprende: detectar un intervalo de separación subportador y un número de símbolos espaciados basados en un patrón piloto predeterminado, y determinar las posiciones de tonos reservados desplazados de acuerdo con el intervalo de separación del subportador detectado y el número de símbolos espaciados; determinar una forma de onda de impulso obtenida...

  14. 3502.-

    Banda gástrica autoajustable con procesamiento de datos de presión

    (05/2012)

    Un sistema de banda gástrica ajustable para su uso en controlar la obesidad en un paciente que comprende: una banda gástrica que comprende un anillo interno expansible dimensionado para acoplarse al estómago de un paciente y/o esófago para formar un estoma, teniendo el anillo interno expansible una luz de fluido; un montaje de bomba conectado a la luz; un controlador operable para instruir al montaje de bomba para inyectar un primer volumen de fluido en el anillo interno expansible para proporcionar un primer volumen de fluido en la banda gástrica; un sensor operablemente...

  15. 3503.-

    Módulo de perforación de cápsulas

    (05/2012)

    Una máquina de producción de bebidas diseñada para producir una bebida a partir de una cápsula , teniendo la máquina de producción de bebidas un módulo comprendiendo: un primer elemento de acoplamiento de la cápsula que puede desplazarse en relación a un segundo elemento cooperante de acoplamiento de la cápsula , entre una posición abierta de introducción de cápsula y una posición cerrada de acoplamiento de cápsula, en el que el módulo está diseñado para inyectar agua dentro de una cápsula y extraer una bebida desde la cápsula mientras la cápsula está en una posición...

  16. 3504.-

    Composiciones farmacéuticas de un esteroide neuroactivo y usos de las mismas

    (05/2012)

    Composición farmacéutica, que comprende 3α-hidroxi-3β-metoximetil-21-(1'-imidazolil)-5α-pregnan-20-ona o una sal o un solvato farmacéuticamente aceptable de la misma, y uno o más excipientes farmacéuticamente aceptables, para ser usada en el tratamiento del trastorno obsesivo compulsivo, el trastorno de estrés postraumático, o el trastorno de ansiedad social en un sujeto humano, en donde la composición proporciona niveles de estado estacionario en plasma de 3α-hidroxi-3β-metoximetil-21-(1'-imidazolil)-5α-pregnan-20-ona en un intervalo de entre 5 ng/ml...

  17. 3505.-

    Procedimiento para la detección de HPV, y sondas, cebadores y kits

    (05/2012)

    Un procedimiento para la detección y/o la tipificación del Virus del Papiloma Humano (HPV) presente en una muestra biológica, procedimiento que comprende las etapas de: (i) amplificación de un fragmento de ácido polinucleico que comprende los nucleótidos 6566-6596 de la secuencia de referencia del HPV 5 16 K02718 (o K02718.1) que tiene la secuencia 5' TTATTGGTTACAACGAGCACAGGGCCACAAT3' o región equivalente de otros tipos de HPV (Región B) de la muestra mediante el uso de: - un cebador 5' que se hibrida específicamente con la región "A" del genoma del HPV 16 o región equivalente...

  18. 3506.-

    Composición detergente

    (05/2012)

    Una composición detergente que comprende; a) un coadyuvante de detergencia distinto de fósforo, que es un compuesto basado en aminoácidos y es la sal tetrasódica del ácido glutámico-N,N-diacético, b) una o más enzimas, que son desestabilizadas por el coadyuvante de d 5 etergencia distinto de fósforo, y c) un sistema de estabilización para la una o más enzimas, comprendiendo el sistema de estabilización uno o más compuestos o sales de metal divalente y uno o más tensioactivos no iónicos, siendo la composición detergente una composición en pasta, gel o líquida al menos...

  19. 3507.-

    Busqueda de sistema candidato y transferencia suave entre frecuencias en un sistema de multiportadora de comunicaciones móviles

    (05/2012)

    Una estación móvil que comprende: un transmisor para transmitir señales salientes desde la estación móvil; y un receptor para recibir señales entrantes, estando acoplado dicho receptor a dicho transmisor y teniendo dicho receptor N subreceptores, siendo N un entero mayor que uno y siendo cada uno de dichos N subreceptores sintonizable independientemente a una frecuencia deseada, e incluyendo dichos N subreceptores uno de: (a) un primer subreceptor y un segundo subreceptor de dichos N subreceptores que tienen una primera banda de frecuencias y una segunda banda de frecuencias,...

  20. 3508.-

    Nuevas inmunologías multivalentes

    (05/2012)

    Una inmunoglobulina multivalente que se une específicamente a al menos dos moléculas de la superficie celular de una sola célula, en que la inmunoglobulina se une específicamente a al menos un primer epítopo y comprende al menos una modificación en al menos una región de bucles estructurales de CH3 de dicha inmunoglobulina que da lugar a una sustitución, supresión y/o inserción de uno o más nucleótidos o aminoácidos para introducir un nuevo sitio ligante de antígenos que se une a una molécula de la superficie celular.

  21. 3509.-

    Sistema de transferencia de energía y métodos asociados

    (05/2012)

    Sistema de transferencia de energía comprendiendo un dispositivo de transferencia de energía incluyendo al menos una entrada de agua y una salida de agua , estando dicho dispositivo de transferencia de energía situado adyacente a una estructura , y separado de una fuente de agua , al menos una tubería de entrada de agua con un primer extremo conectado a la entrada de agua y un segundo extremo opuesto al primer extremo en comunicación con la fuente de agua , y una tubería de salida de agua con un primer extremo conectado a la salida de agua y un segundo...

  22. 3510.-

    SISTEMA DE AMARRE DE EMBARCACIONES A UNA ESTRUCTURA FIJA

    (05/2012)

    Sistema de amarre de embarcaciones a una estructura fija Comprende: - una plataforma de acceso unida a la estructura fija (E); - una pasarela de acceso unida de manera articulada por un primer extremo (2a) a un elemento móvil vinculado a dicha estructura fija (E), de manera que puede pivotar respecto de un eje horizontal o sustancialmente horizontal; y - un muelle de amarre flotante (M) fijado a un segundo extremo (2b) de la pasarela de acceso .

  23. 3511.-

    Método para modificar madera y madera obtenida de ese modo

    (05/2012)

    Un método para modificar madera que comprende las etapas de: a) impregnar dicha madera con una composición polimerizable que comprende un compuesto de fórmula I y/o fórmula II en las que n es 0, 1, 2, 3, 4 o 5 en la que t y s son cada una independientemente 1 o 2, en las que w y z son cada una independientemente 0 o 1, en las que X e Y son cada una independientemente O, S o N-R21 y en las que R2, R3, R4, R5, R6, R7, R9, R10, R11, R12, R13, R14, R15, R16, R18, R19, R21 son cada uno independientemente...

  24. 3512.-

    DISPENSADOR Y PRETRATADOR PARA LÍQUIDOS VISCOSOS

    (05/2012)

    1. Un envase de dispensación inferior que contiene un producto envasado de lavado de ropa que comprende una composición fluida de lavado de ropa, en el que: (i) la composición fluida de lavado de ropa tiene una viscosidad de al menos 100 Pa.s, preferiblemente al menos 500 Pa.s, cuando está en reposo o hasta un esfuerzo de cizallamiento de 10 Pa y comprende al menos un tensioactivo y al menos un hidrotropo; y (ii) el envase de dispensación inferior comprende un recipiente compresible en el que está almacenada la composición fluida de lavado de ropa y un dispositivo de dispensación que incorpora un dispositivo de pretratamiento de materiales textiles, estando ubicados el dispositivo de dispensación y el dispositivo de pretratamiento...

  25. 3513.-

    Motores de combustión interna así como dispositivo de reglaje del motor

    (05/2012)

    Procedimiento para hacer funcionar un motor estacionario de combustión interna, con un dispositivo de compresión con geometría variable del compresor, el cual comprime el gas alimentado al motor de combustión interna, y con un dispositivo de estrangulamiento instalado a continuación del dispositivo de compresión, con el que se puede modificar la cantidad del gas comprimido alimentado al motor de combustión interna, reglándose el motor de combustión interna mediante el accionamiento de al menos dos elementos de ajuste, caracterizado porque el motor de combustión interna se regula en una magnitud de control del motor, y porque en caso de una desviación de la magnitud de control del motor, de un valor teórico, se...

  26. 3514.-

    Detección de polimorfismos basada en amplificación

    (05/2012)

    Un método para detectar una secuencia de ácido nucleico diana sospechosa de tener deleciones o inserciones de una base sencilla o múltiple en una muestra de ensayo que comprende las etapas de: (a) poner en contacto la muestra de ensayo con reactivos de amplificación que comprenden una polimerasa, un par de cebadores y una sonda para formar una mezcla de reacción; (b) realizar un ciclo que comprende las etapas de: (i) mantener la mezcla de reacción durante un tiempo y a una temperatura por encima de 90 ºC suficientes para disociar las secuencias de ácido nucleico bicatenario, (ii) mantener la mezcla de reacción durante un tiempo y durante una temperatura de 45 ºC a 65 ºC para permitir que los cebadores y sonda hibriden...

  27. 3515.-

    Tarrina de cartón para consumo de productos alimenticios

    (05/2012)

    1. Tarrina de cartón para consumo de productos alimenticios, que obteniéndose a partir del desarrollo de una lámina de cartón con un fondo que puede ser cuadrangular o rectangular, extensiones tanto laterales como extremas para formar los correspondientes laterales y testeros de la propia tarrina, e incluyendo, bien en los laterales o bien en los testeros, prolongaciones dobles formando aletas que se encolan en el primer caso a los testeros y en el segundo caso a los laterales, para formar chaflanes en correspondencia con las aristas y rigidización en la conformación de la tarrina definitiva, caracterizada porque el fondo está determinado por dos mitades unidas mediante una pareja de sectores intermedios con línea...

  28. 3516.-

    Joya destinada a llevarse en el dedo, de manera flexible y cómoda

    (05/2012)

    Joya destinada a llevarse en el dedo, caracterizada por el hecho de poseer una pluralidad de rodillos intercalados y de rotación libre según un eje de rotación entre por lo menos dos anillos , el eje de rotación de los rodillos tiene por lo menos un componente orientado según la dirección principal de inserción de la joya en el dedo, y porque los anillos se superponen según la dirección principal de inserción de la joya en el dedo.

  29. 3517.-

    Proceso para la producción de ácido araquidónico y/o ácido eicosapentanóico

    (05/2012)

    Un proceso para la producción de ácido araquidónico o ácido eicosapentanóico o ácido araquidónico y ácido eicosapentanóico en plantas transgénicas que producen semillas maduras con un contenido de por lo menos 1 5 % en peso de dichos compuestos denominados como el contenido total de lípidos de dicho organismo que comprende las siguientes etapas: a) introducción de por lo menos una secuencia de ácidos nucleicos en dicha planta transgénica, que codifica un polipéptido que tiene una actividad A-1 2-desaturasa- y Δ-15-desaturasa, y b) introducción de por lo menos una segunda secuencia de ácidos nucleicos en dicha planta transgénica, que codifica un polipéptido que tiene una actividad Δ-9-elongasa,...

  30. 3518.-

    Máquina de envasado

    (05/2012)

    Una máquina de envasado para producir envases sellados de un producto alimenticio a partir de una banda de material de envasado; comprendiendo dicha banda un primer y un segundo bordes longitudinales opuestos entre ellos; comprendiendo dicha máquina : - medios de formación que definen un conducto forzoso para dicha banda , y que mantienen dichos primer y segundo bordes longitudinales superpuestos para formar un tubo del material de envasado, y están situados en el exterior de dicho tubo ; definiendo dichos primer y segundo bordes longitudinales , cuando están superpuestos, una superficie de grosor desigual orientada hacia el interior de dicho tubo 10; y por lo menos un rodillo de presión...

  31. 3519.-

    Derivados de la pirrolo-[2, 3-c]-piridina como agentes inhibidores de la quinasa p38

    (05/2012)

    Un compuesto representado por la fórmula química (A) o una sal farmacéuticamente aceptable del mismo, en la que: L se selecciona entre el grupo que consiste en: (f) -S(O)n- , en la que n es 0, 1 ó 2; Ar1 es un anillo de seis átomos aromático o heteroaromático opcionalmente mono, di o trisustituido, en el que el anillo heteroaromático puede contener 1, 2 ó 3 heteroátomos seleccionados entre N, S y O, en el que los sustituyentes se seleccionan independientemente entre el grupo que consiste en: (a) halo, (b) - alquiloC1-4, (c) -O- alquiloC1-4, (d) -CF3, (e) -NH2, (f) -NH-CH3, (g) -CN, (h) -C(O)NH2, y (i) -S(O)n-CH3; Ar2 es un anillo heterocíclico bicíclico 5,6 condensado...

  32. 3520.-

    Dispositivo de cierre para arcas de teléfonos públicos

    (05/2012)

    Dispositivo de cierre para arca, preferiblemente para teléfonos públicos, comprendiendo dicha arca un cuerpo dotado de una embocadura frontal a la que se acopla una puerta , preferiblemente abisagrada, caracterizado porque incorpora un soporte , solidarizado al cuerpo del arca, y sobre el que está montado un moto-reductor eléctrico cuyo eje de salida y a través de una excéntrica actúa sobre un brazo de transmisión que transmite el movimiento de giro del motor a al menos un actuador (10-10') que a su vez suministra el movimiento giratorio a un eje principal que a su vez actúa sobre un trinquete alojado en el seno del soporte y actuante a su vez sobre una pluralidad de bolas , susceptibles...

<< · 55 · 82 · 96 · 103 · 106 · 108 · < · 110 · > · 113 · 116 · 123 · >>