4,723 Patentes de marzo de 2012 (pag. 30)

  1. 929.-

    Conjunto de rodamiento que comprende una doble inyección de líquido lubricante, e ingenio aeronáutico qie incorpora al menos un conjunto de ese tipo

    (03/2012)

    Conjunto de rodamiento que comprende una pieza fija , una pieza giratoria , así como un rodamiento intercalado entre las citadas piezas fija y giratoria , comprendiendo el citado rodamiento un anillo interior y un anillo exterior que presentan, cada uno de ellos, una pista de circulación en contacto con elementos de rodadura de dicho rodamiento, y estando fijados respectivamente a una de las citadas piezas fija y giratoria y a la otra de estas mismas piezas, comprendiendo además el citado conjunto un primer inyector de líquido lubricante destinado a ser alimentado exclusivamente con líquido lubricante no reciclado, caracterizado porque el anillo fijado a la citada pieza fija está atravesado...

  2. 930.-

    Xilanasas modificadas que exhiben expresión mejorada

    (03/2012)

    Una xilanasa de la Familia 11 fúngica modificada que comprende, una secuencia que introduce un sitio de Nglucosilación consensus eucariótico funcional que consiste de la secuencia de aminoácidos Asn-Xaa-Ser/Ihr (N-X5 S/T) que no se encuentra de otra forma en la xilanasa de la Familia 11 de la que se deriva la xilanasa de la Familia 11 modificada, el sitio de N-glucosilación producido por la sustitución de un aminoácido (X) en una asparagina (N) en una posición seleccionada del grupo que consiste de la posición 34 (X34N), posición 131 (X131N), posición 180 (X180N), posición 182 (X182N), y una combinación de las mismas, la posición determinada de la alineación de secuencia de la xilanasa de la Familia 11...

  3. 931.-

    Dispositivo de control hidráulico

    (03/2012)

    Dispositivo de control (S) hidráulico para al menos un consumidor hidráulico (V), cuya al menos una tubería de trabajo se puede unir por medio de una válvula distribuidora de control (W) con una fuente de presión (P) y un retorno (R), con un circuito de control de presión de carga (L), y con un sistema de desconexión de apagado de emergencia (N), que entre la fuente de presión (P) y una tubería de suministro que lleva a la válvula distribuidora de control (W) presenta una válvula de desconexión (T) regulada previamente por presión a una posición de paso, solicitada por resorte a la posición de cierre, así como una electroválvula de conmutación (M) prevista entre la fuente de presión (P) y la válvula...

  4. 932.-

    Producto de lavado protector del color

    (03/2012)

    Procedimiento de lavado de materiales textiles coloreados en soluciones acuosas que contienen tensioactivos, caracterizado porque se utiliza una solución acuosa con tensioactivos, que contiene un derivado de triazina de las fórmulas generales I, II o III: T (NH-Ar (SO3Na) a) bHalc (I) X (NH-T (NH-Ar (SO3Na) a) eHalf) 2 (II) X (NH-T (NH-Ar (SO3Na) d-NH-T (NH-Ar (SO3Na) a) Hal) Hal) 2 (III) en las que: T significa un resto 1, 3, 5-triazinilo, Ar significa un grupo naftaleno o benceno, X significa una cadena de hidrocarburo lineal o ramificada, eventualmente interrumpida por grupos NH, que tiene de 1 a 20 átomos de C, en especial de 2 a 12, o un grupo estilbeno o bifenilo eventualmente sustituido...

  5. 933.-

    Derivados de la piperazina y su uso como agentes terapéuticos

    (03/2012)

    Un compuesto de fórmula : en donde: x e y son cada uno independientemente 1, 2, o 3; W es -N (R1) C (O) -, -C (O) N (R1) -, -OC (O) N (R1) -, -N (R1) C (O) N (R1) -, -O-, -N (R1) -, -S (O) t, - (donde t es 0, 1 o 2), N (R1) S (O) 2-, -S (O) 2N (R1) -, -C (O) -, -OS (O) 2N (R1) -, -OC (O) -, -C (O) O-o -N (R1) C (O) O-; V es -C (O) -, -C (O) O-, -C (S) -, -C (O) N (R1) -, -S (O) 2-, -S (O) 2N (R1) -o -C (R10) H-; G, J, L y M cada uno se selecciona independientemente de -N= o -C (R4) =; a condición de que al menos dos de G, J, L y M sean -N=, y a condición de que cuando G y J sean ambos -C (R4) =, L y M no pueden ser ambos -N=, y cuando L y M sean ambos -C (R4) =, G y J no pueden ser ambos...

  6. 934.-

    PROCEDIMIENTO PARA LA PREPARACIÓN DE DISOLUCIÓN LÍQUIDA DE TIOSULFATO DE CALCIO A PARTIR DE CAL, AZUFRE Y DIÓXIDO DE AZUFRE

    (03/2012)

    Se describe un método discontinuo o semicontinuo eficaz de producción de tiosulfato de calcio (CaS2O3), que contiene bajo contenido en subproducto, de concentración relativa alta, a partir de cal, azufre o polisulfuro de calcio, y dióxido de azufre en condiciones de temperatura de reacción elevada. El producto es una emulsión de tiosulfato de calcio líquido y subproductos sólidos. En las condiciones de la técnica, incluyendo las razones molares de cal con respecto a azufre, la temperatura del procedimiento de reacción y las condiciones de reacción del dióxido de azufre, incluyendo la tasa y la duración, los subproductos se reducen hasta aproximadamente el 2% en peso.

  7. 935.-

    SISTEMA PASIVO DE PROTECCIÓN CONTRA INCENDIO EN AEROGENERADORES

    (03/2012)

    Sistema pasivo de protección contra incendio en aerogeneradores constituidos por una torre, una zapata inferior y una góndola superior, que comprende una barrera térmica a modo de manta aplicada sobre el revestimiento interno de las paredes correspondientes a determinados habitáculos del interior de la góndola del aerogenerador, tales como el habitáculo del correspondiente transformador, la zona de ubicación del sistema de freno y otros, con la particularidad de que dicha manta térmica tiene propiedades ignífugas y de baja inflamabilidad.

  8. 936.-

    DISPOSITIVO DE CUBRIMIENTO, CIERRE Y SIMILARES

    (03/2012)

    Dispositivo de cubrimiento, cierre y similares. Comprende un marco exterior fijo , una tapa que en la posición de cierre queda acoplada sobre el marco , y medios de cierre para asegurar la tapa al marco accesibles desde una abertura en la tapa . Se caracteriza por el hecho de que dichos medios de cierre comprenden un elemento protector susceptible de cubrir dichos medios de cierre según una posición inicial, siendo dicho elemento protector desplazable hasta una posición final de acceso a dichos medios de cierre . Se consigue un dispositivo de cubrimiento que garantiza un correcto funcionamiento de los medios de cierre.

  9. 937.-

    AEROGENERADOR EÓLICO DE TURBINA DE EJE VERTICAL CON ACUMULADOR DE ENERGÍA HIDRÁULICO DE NITRÓGENO

    (03/2012)

    Aerogenerador eólico de turbina de eje vertical con acumulador de energía hidráulico de nitrógeno de turbina izable con cinco, seis u ocho brazos , provistos de velas rotativas por su eje central, brazos con sistema de contrapesos sobre guía de desplazamiento lineal según la velocidad de giro, contando con una bomba hidráulica acumulador generador motor y freno hidráulico . Adicionalmente, el mástil se sitúa sobre una plataforma enclavada en el mar incorporando paletas y flotadores que, por oleaje, accionan una bomba hidráulica que genera energía que se acumula en un depósito de aceite hidráulico con nitrógeno. También adicionalmente, incorpora hélices...

  10. 938.-

    Pasamanos para una escalera mecánica o un pasillo móvil

    (03/2012)

    Escalera mecánica o pasillo móvil consistente en un armazón , una banda de escalones con escalones o una banda de plataformas con plataformas, para el transporte de personas y/u objetos, y a cada lado una balaustrada con un pasamanos sujeta mediante un zócalo de balaustrada , accionándose el pasamanos por un accionamiento de pasamanos por un accionamiento de pasamanos que presenta una rueda de fricción que acciona el pasamanos por adherencia de fricción por su cara exterior y presionándose el pasamanos contra la rueda de fricción mediante unos rodillos de presión dispuestos en la cara interior del pasamanos, caracterizada...

  11. 939.-

    Compuestos heterocíclicos antivíricos

    (03/2012)

    Un compuesto de la fórmula I (I) X2 A2 en la que: A1 es fenileno o piridinileno; A2 es fenilo o piridinilo opcionalmente sustituidos por 1-3 grupos elegidos con independencia entre el grupo formado por halógeno, alquilo C1-6, haloalquilo C1-6, ciano y alcoxi C1-6; R1 es hidrógeno, alquilo C1-10, cicloalquilo C3-7, alcoxi C1-10 o halógeno; Y es NR2R3, hidroxialquilo C1-6, acilo C1-6 o heteroarilo elegido entre el grupo formado por pirrolilo, pirazolilo isoxazolilo, dicho heteroarilo está opcionalmente sustituido por uno o dos grupos elegidos entre alquilo C1-3, haloalquilo C1-3, alcoxi C1-3, halógeno o pirrolidinilo, en el que el átomo...

  12. 940.-

    Sistema de acoplamiento de cristales de gafas sin montura alrededor de los cristales

    (03/2012)

    Par de gafas sin montura alrededor de los cristales que comprende dos cristales de gafas unidos por encima de la nariz, estando dichos cristales acoplados por un elemento de unión, caracterizado porque el elemento de unión entre los dos cristales comprende una lengüeta que constituye una pata de ensamblaje para los cristales que actúa conjuntamente con ranuras dispuestas en cada uno de los dos cristales de gafas.

  13. 941.-

    MÉTODO Y SISTEMA PARA RECOMENDAR FOTOGRAFÍAS

    (03/2012)

    Método para recomendar fotografías escogidas de un conjunto de fotografías digitales, que comprende: - una etapa de etiquetado para etiquetar las fotografías digitales de acuerdo con determinados parámetros objetivos obtenidos a partir de sus propias características, y determinados parámetros subjetivos obtenidos a partir del comportamiento de los usuarios en relación con las mencionadas fotografías; - una etapa de afinamiento para obtener una puntuación de afinamiento, puntuaciónt, para cada fotografía, mediante pesar sus parámetros objetivos y subjetivos de acuerdo con una función relevante; - a partir de la puntuación de afinamiento...

  14. 942.-

    Protector de pantalla táctil

    (03/2012)

    1. Protector de pantalla táctil para un dispositivo electrónico portátil que tiene una cara frontal que incluye una parte de pantalla táctil y un perímetro exterior, caracterizado porque comprende: una película de plástico que tiene unos lados frontal y trasero, un perímetro exterior que corresponde al del dispositivo y una ventana transparente que corresponde en tamaño a la parte de pantalla táctil; y un separador dispuesto en el lado trasero de la película de plástico a lo largo del perímetro exterior de la película de plástico rodeando continuamente la ventana transparente , presentando un espesor comprendido entre aproximadamente 0,05 y aproximadamente...

  15. 943.-

    Composición abrasiva, en particular para la fabricación de ruedas abrasivas

    (03/2012)

    Composición abrasiva que es adecuada para la fabricación de herramientas abrasivas mediante el moldeo de dicha composición en un molde, comprende abrasivo inerte y una parte en polvo mezclada con una parte líquida para permitir el moldeo de dicha composición en un molde, estando dicha parte líquida formada por una solución de cloruro de magnesio o de sulfato/cloruro de magnesio, estando dicha parte líquida presente en una cantidad en peso que es al menos igual al 70% de dicha parte en polvo, y está caracterizada por el hecho de que dicha parte en polvo comprende: • oxido de magnesio en una cantidad comprendida entre aproximadamente un 99, 0% y un 99, 99% del peso total...

  16. 944.-

    Modificación de la superficie

    (03/2012)

    Procedimiento para la modificacion al menos por zonas de una superficie de un soporte de al menos un sustrato mediante deposicion de un recubrimiento mediante polimerizacion por plasma, generandose el recubrimiento al menos por zonas con espacios libres para acomodar al menos una solucion realizandose antes de o durante la polimerizacion por plasma una activacion de la superficie del sustrato en el plasma y generandose al menos por zonas un polimero de plasma hinchable, asi como formandose mediante el recubrimiento una estructura tridimensional, caracterizado porque en la activacion se realiza un acoplamiento de potencia de 5 a 20 veces mayor que en la polimerizacion por plasma.

  17. 945.-

    Evaporador de azufre

    (03/2012)

    Evaporador de azufre provisto de una fuente de calor en forma de serpentín de calefacción accionado eléctricamente e integrado en un material cerámico, y un recipiente tipo vasija que presenta una pared y que comprende un compartimiento receptor para el azufre que se debe evaporar , en el que dicho recipiente esencialmente se realiza en un material cerámico, y de modo que la fuente de calor en forma de serpentín de calefacción junto con el recipiente y el compartimiento receptor del azufre que se debe evaporar forman un cuerpo de una sola pieza, y en el que dicho serpentín de calefacción se disponga, por lo menos parcialmente, en la pared del recipiente...

  18. 946.-

    Procedimiento para producir una estructura de superficie de una chapa metálica embutida, una banda continua o un rodillo de estampación cilíndrico

    (03/2012)

    Procedimiento para producir una estructura de superficie de una chapa embutida metálica, una banda continua o un rodillo de estampación cilíndrico con la ayuda de al menos un láser, comprendiendo las fases de: - suministro y aplicación de datos digitalizados de una topografía en 3D de una estructura de superficie moldeada, - aplicación de datos digitalizados para el control de posicionamiento de al menos un láser en un plano definido por una coordenada en X y una en Y - aplicación de la coordenada en Z para focalizar al menos un rayo láser, determinando la coordenada en Z, la topografía en 3D perpendicularmente desde arriba hacia la estructura de superficie, -...

  19. 947.-

    Envase con tapa

    (03/2012)

    Envase con tapa para el alojamiento y para el transporte de productos de llenado líquidos en particular peligrosos, con un cuerpo de envase exterior , con una tapa superior de envase y con un revestimiento interior de pared fina insertado, en el que la tapa del envase se puede fijar por medio de un cierre de anillo tensor en forma de U o sin anillo tensor como tapa de encaje elástico por medio de cierre de encaje elástico o como tapa roscada por medio de cierre roscado sobre el orificio superior del envase del cuerpo de envase en un borde de pestaña configurado de forma correspondiente, en el que la tapa de envase está constituida de material termoplástico...

  20. 948.-

    Secador de depósito basado en membrana

    (03/2012)

    Un dispositivo para impedir la penetración de contaminantes y humedad en, y para eliminar la humedad de, un depósito de fluido para aceite de un sistema de lubricación e hidráulico, que comprende: un depósito de fluido para contener un fluido en su interior; una abertura de depósito de fluido que comprende un respiradero para permitir un intercambio de gas entre el interior del depósito de fluido y el exterior del depósito de fluido, y un secador de depósito situado en comunicación fluida con el depósito de fluido , comprendiendo el secador de depósito una fuente de gas comprimido y un secador de gas para secar el gas comprimido con el fin de aumentar...

  21. 949.-

    Maximización de eficiencias energética y espectral para modulaciones por capas y convencional

    (03/2012)

    Un procedimiento para transmitir señales y recibir señales en un receptor heredado y un receptor de modulación por capas, caracterizado por: amplificar una parte de señal de capa superior de una señal de enlace descendente con una primera proporción de ancho de banda en exceso a un primer nivel de potencia dentro de una banda de frecuencia de la señal de enlace descendente, en el que la señal de capa superior se modula de acuerdo con una primera portadora; amplificar una parte de señal de capa inferior de la señal de enlace descendente con una segunda proporción de ancho de banda en exceso a un segundo nivel de potencia dentro de la banda de frecuencia...

  22. 950.-

    Sujetador para unir de forma soltable un perfil a un contraperfil

    (03/2012)

    Sujetador para unir de forma soltable un perfil a un contraperfil , que comprende un perno excentrico montado para giro en una carcasa, el cual, aparte de un disco excentrico situado en el interior de la carcasa, presenta tambien una cabeza de perno sobresaliente de la carcasa y destinada a realizar una maniobra de giro , una placa en la carcasa, que puede ser desplazada longitudinalmente por el disco excentrico entre una posición de extracción y una posición de inserción , al menos un gancho en el extremo exterior de la placa , el cual sobresale de la carcasa, y al menos un chaflan en la placa que discurre inclinado con respecto a la dirección de desplazamiento longitudinal y que...

  23. 951.-

    PUERTA CORREDERA PARA MAMPARA DE DUCHA

    (03/2012)

    La presente invención tiene por objeto una puerta corredera para mampara de ducha que presenta unos medios de nivelado integrados en la propia puerta corredera que permiten al usuario final nivelar la puerta respecto a la parte superior del marco de la misma del que se encuentra suspendido para conseguir que la puerta corredera se mantenga paralela a dicha parte superior del marco y en consecuencia el cierre a tope con la parte lateral de dicho marco.

  24. 952.-

    APARATO DE REVESTIMIENTO

    (03/2012)

    Esta invención se propone proporcionar un aparato de revestimiento que comprende una unidad de revestimiento (A) para rociar un agente aglutinante líquido sobre granos que se están transfiriendo a una cámara de revestimiento a fin de revestir así los granos con el agente aglutinante, una unidad de adherencia (B) para añadir un material de revestimiento pulverizado a los granos que se están transfiriendo a una cámara de adherencia a fin de adherir así el material de revestimiento pulverizado a las capas de agente aglutinante de los granos, y una unidad de secado (C) que incluye una cámara de secado para transferir los granos mientras...

  25. 953.-

    INSTRUMENTO SUPRAPÚBICO DE ESPECIAL APLICACIÓN EN CIRUGÍA ENDOSCOPICAPROSTÁTICA

    (03/2012)

    Instrumento suprapúbico de especial aplicación en cirugía endoscópica prostática. Complementario a la técnica empleada por un resectoscopio , combina en una sola herramienta la realización del puncionado, y la posterior extracción del líquido de irrigación y restos de tejidos extirpados, optimizando dichos procesos y permitiendo aumentar el tiempo de intervención, pudiendo tratar próstatas o cálculos de la vejiga de mayor tamaño. Dicho instrumento suprapúbico comprende unos medios de puncionado , adaptados para realizar un corte en la zona exterior suprapúbica del paciente coincidente con su vejiga , en la...

  26. 954.-

    DISPOSITIVO PARA LA DETECCIÓN SELECTIVA DE GAS BENCENO, PROCEDIMIENTO PARA SU OBTENCIÓN Y DETECCIÓN DEL GAS CON EL MISMO

    (03/2012)

    Dispositivo para la detección selectiva de gas benceno, procedimiento para la obtención y detección del gas con el mismo. Se refiere a un dispositivo para detectar selectivamente gas benceno que comprende en un sustrato base una combinación de por lo menos un sensor de nanotubos de carbono multi- o simple pared funcionalizados y decorados con clústers de rodio, y por lo menos un sensor de nanotubos de carbono multi- o simple pared funcionalizados y decorados con clústers de metales seleccionados entre oro, paladio, níquel y titanio, y/o no decorados, donde dicho sustrato comprende además medios para...

  27. 955.-

    MÁQUINA LAVAVAJILLAS CON UN DISPOSITIVO ROCIADOR

    (03/2012)

    Máquina lavavajillas con un dispositivo rociador. Una máquina lavavajillas doméstica (GS) con un espacio de lavado (SB) para el alojamiento de vajilla, cubiertos o artículo a lavar (SG1; SG2) similar que ha de ser limpiado, donde al espacio de lavado (SB) es suministrable a través de al menos un dispositivo rociador (SA) agua y/o líquido de limpieza, y donde este dispositivo rociador (SA) está dispuesto por encima de una cesta para vajilla (UK), es configurada de tal modo que el dispositivo rociador (SA) está dispuesto excéntricamente de tal manera que, junto...

  28. 956.-

    CIRCUITO DE AHORRO DE ENERGÍA EN INSTALACIONES DE ILUMINACIÓN DE ZONAS COMUNES EN VIVIENDAS

    (03/2012)

    Circuito de ahorro de energía en instalaciones de iluminación de zonas comunes en viviendas. La invención consiste en la incorporación de un circuito asociado a los nodos de conexión en paralelo de los circuitos de iluminación de cada planta y que se conectan con el circuito automático de escalera, circuito que cuenta con una pareja de relés del tipo de los que incorporan una pareja de contactos de alimentación de una bobina de núcleo magnetizable a través de la que se controla la comunicación eléctrica entre parejas de conectores asociados a cada relé,...

  29. 957.-

    DISPOSITIVO MECÁNICO-ÓPTICO PARA VISIONAR IMÁGENES REALES DE OBJETOS O PERSONAS

    (03/2012)

    Dispositivo mecánico-óptico para visionar imágenes reales de objetos o personas. Según la invención el dispositivo mecánico-óptico comprende un bastidor con ramas de bastidor , formando un diedro y respectivos espejos planos , cada uno montado en una respectiva rama de bastidor. Las citadas ramas de bastidor están dispuestas formando un ángulo comprendido entre 77 y 90 grados; adicionalmente puede resultar una ventaja cuando las ramas de bastidor se disponen articuladamente a modo de bisagra alrededor de un eje (E) en el vértice del...

  30. 958.-

    Configuración de ojiva

    (03/2012)

    Configuración de ojiva para formar un orificio con un diámetro grande a través de una pared de un objetivo, comprendiendo la configuración de ojiva: (a) una carga hueca de material explosivo, presentando dicha carga un eje y una parte superficial frontal anular que circunscribe dicho eje , estando configurada dicha parte superficial frontal anular de tal modo que presente un perfil cóncavo cuando se observa en sección transversal a través de dicha carga hueca que pasa a través de dicho eje , estando...

  31. 959.-

    Método de detección de herpesvirus en una muestra de ensayo

    (03/2012)

    Un método de detección de HSV'-1, HSV-2 y VZV que comprende la amplificación en un único tubo de una muestra que comprende material genético viral con el par de cebadores: HSV1S-18 (CCTTCGAACAGCTCCTGG) (SEQ ID Nº 3) y HSV1-AS (ATGACGCCGATGTACTTTTTCTT) (SEQ ID Nº 2); HSV2S-20 (TCCATTTTCGTTTTGTGCCG) (SEQ ID Nº 4) y HSV1-AS (ATGACGCCGATGTACTTTTTCTT) (SEQ ID Nº 2); y VV1S (AAGGTTATATATGGAGATACGGA) (SEQ ID Nº 9) y VV1AS (ATTACCCCAATGTACTTTTTCTT) (SEQ ID Nº 10), para obtener productos de amplificación...

  32. 960.-

    Combinación de mueble-refrigerador

    (03/2012)

    Una combinación de mueble-refrigerador con un aparato refrigerador empotrable revestido con placas de pared , caracterizada por que las placas de pared están montadas en soportes verticales , los cuales se encuentran dispuestos en las esquinas del aparato refrigerador empotrable y soportan una placa de cubierta sobre el aparato refrigerador .

<< · 15 · 22 · 26 · 28 · < · 30 · > · 33 · 37 · 44 · 59 · 89 · >>