3,126 Patentes de junio de 2012 (pag. 48)

  1. 1505.-

    Sistema de campo abierto para cirugía magnética

    (06/2012)

    Un sistema para la navegación de un dispositivo médico magnético que comprende una pluralidad de bobinas magnéticas a fin de aplicar un campo magnético en una dirección determinada para orientar el dispositivo médico magnético dentro de esa parte de un paciente situada dentro de una zona de operación del sistema en una dirección seleccionada, caracterizado por: una pluralidad de bobinas magnéticas que son efectivas para orientar de forma controlable el dispositivo médico dentro sustancialmente de la totalidad de la zona de operación, estando dicha zona de operación colocada de forma que dicha parte del paciente puede ser localizada...

  2. 1506.-

    MÉTODO PARA EL CONTROL DE POLÍTICAS Y DE COBROS SOBRE FLUJOS DE DATOS EN UNA RED CON CAPACIDAD Gx

    (06/2012)

    Método para el control de políticas y de cobros sobre flujos de datos en una red con capacidad Gx Comprende proporcionar de forma dinámica reglas PCC desde una PCRF a una PCEF, a través de una interfaz de Gx aplicando AVP, y llevar a cabo las siguientes etapas: - solicitar, la PCRF a la PCEF, ser notificada por esta última acerca de la detección de flujos de datos para uno o más servicios específicos, indicados por la PCRF o predefinidos en la PCEF, y - detectar, por medio de la PCEF, flujos de datos para los uno o más servicios específicos indicados y notificar dicha detección a la PCRF. Dichas etapas se llevan a cabo...

  3. 1507.-

    PLANCHA DE VAPOR ELECTRICA Y VALVULA

    (06/2012)

    Se da a conocer una plancha de vapor eléctrica 33 con un depósito de agua 4 y una purga de aire del depósito 8, que presenta una válvula 34 con un cuerpo de válvula 30 alojado en una carcasa 14, que al llenar el depósito 4 se asienta de modo estanco en un asiento 20 controlando el cierre de la purga 8. Durante el llenado máximo en el depósito 4 se forma una oquedad 32, y en una posición vertical de reposo de la plancha 33, con la purga 8 en posición abierta, la válvula 34 presenta un orificio 16 para que el fluido penetre dentro de la oquedad 32. De esta forma se segura el equilibrado de presiones en un depósito de agua, tanto...

  4. 1508.-

    SISTEMA PARA LA PREPARACION DE SUPERFICIES A RECUBRIR

    (06/2012)

    Sistema para la preparación de superficies a recubrir, según el cual en una cámara de vaporización se realiza la vaporización sin ebullición de un producto de imprimación líquido, formándose producto vaporizado , el cual es conducido hasta una cámara cerrada de aplicación, por la cual pasan las piezas a tratar, de manera que el producto vaporizado se deposita por condensación sobre las piezas en dicha cámara cerrada de aplicación, mientras que el producto vaporizado sobrante, así como el producto condensado que se decanta en la mencionada cámara cerrada de aplicación, son retornados a la cámara de vaporización...

  5. 1509.-

    SISTEMA BASADO EN RFID PARA EL CONTROL DE PACIENTES FUERA DEL ENTORNO SANITARIO

    (06/2012)

    1. Sistema basado en RFID para el control de pacientes fuera del entorno sanitario caracterizado por el hecho de utilizar pulseras dotadas de transpondedores con capacidad para almacenar datos personales de los pacientes. 2. Sistema basado en RFID para el control de pacientes fuera del entorno sanitario, según la reivindicación 1, caracterizado por el hecho de poder utilizar transpondedores activos o pasivos. 3. Sistema basado en RFID para el control de pacientes fuera del entorno sanitario, según la reivindicación 1, caracterizado...

  6. 1510.-

    Producto farmacéutico para inyección

    (06/2012)

    Producto farmacéutico para inyección que comprende un recipiente que incluye un cierre adecuado para preparaciones para inyección, conteniendo el recipiente un compuesto seleccionado del grupo de 5-difluorometoxi-2[ (3, 4-dimetoxi-2-piridinil) metilsulfinil]-1H-bencimidazol (pantoprazol), una sal del mismo, un solvato de pantoprazol y una sal del mismo, en el que el recipiente y el cierre están hechos de material que esencialmente no libera iones de zinc, con lo que el cierre es un tapón de caucho de tipo 1 según la Farmacopea Europea...

  7. 1511.-

    Aparato médico

    (06/2012)

    Aparato médico, el cual, se puede conectar a un conducto de agua para el suministro de agua o de agua tratada al aparato médico, que contiene un adaptador, el cual presenta una primera sección de alimentación con una pieza de acoplamiento por el extremo, para la conexión con el conducto de agua , con un sensor de presión posterior y dos válvulas de cierre posteriores, dispuestas en serie, y dos segundas secciones de alimentación las cuales, mediante una pieza de ramificación se ramifican a partir de la primera sección...

  8. 1512.-

    Composiciones que comprenden cepas de lactobacillus plantarum en combinación con tanino y nuevas cepas de lactobacillus plantarum

    (06/2012)

    Una composición que comprende una o más cepas productoras de tanasa de Lactobacillus plantarum seleccionadas del grupo que consiste en Lactobacillus plantarum HEAL 9, DSM 15312, Lactobacillus plantarum HEAL 19, DSM 15313 y Lactobacillus plantarum HEAL 99, DSM 15316 y tanino.

  9. 1513.-

    Método para producir una estructura de emisor y estructuras de emisor que resultan del mismo

    (06/2012)

    Un método para formar una estructura de emisor sobre un sustrato en un dispositivo fotovoltaico, comprendiendo el método: formar, sobre el sustrato , una primera capa que comprende un material semiconductor; texturizar una superficie de la primera capa , formando así una primera región de emisor desde la primera capa , teniendo la primera región de emisor una primera superficie texturizada; formar una segunda región de emisor en la primera superficie texturizada, teniendo la segunda región de emisor...

  10. 1514.-

    Terapia anti-pecam para la supresión de la metástasis

    (06/2012)

    Uso de un anticuerpo anti-PECAM-1 en la fabricación de un medicamento para administración sistémica destinado a reprimir la metástasis o la invasividad de una célula neoplásica en un mamífero.

  11. 1515.-

    Procedimiento de gestión de un flujo de datos, pasarela doméstica y dispositivos correspondientes

    (06/2012)

    Procedimiento de gestión de un flujo de datos cuyo establecimiento entre un dispositivo de origen (T1) y un dispositivo de destino (T2) implica el paso de un flujo de señalización por una pasarela doméstica (PAD), siendo uno de dichos dispositivos (T1) un primer dispositivo distante conectado a una red de comunicación (RES1) y siendo el otro de dichos dispositivos (T2) un segundo dispositivo conectado a dicha red de comunicación (RES1) por intermedio de la dicha pasarela doméstica (PAD), caracterizado porque comprende: -...

  12. 1516.-

    Conector polivalente para aplicación enteral

    (06/2012)

    Conector polivalente con tres conexiones distales (A', A", A"') distintas, concéntricas una dentro de otra y coaxiales entre sí, para la conexión de sistemas de trasvase enterales a recipientes de depósito, con aberturas configuradas con formas diversas, en el que en el lado proximal opuesto de las conexiones para los recipientes de depósito, en particular recipientes de líquido de alimentación y de equilibrado, se encuentran otras dos conexiones , caracterizado porque está previsto un canal de ventilación...

  13. 1517.-

    SALES ESTABLES DE NUEVOS DERIVADOS DE 3,3-DIFENIL-PROPIL-AMINAS

    (06/2012)

    Compuestos de la fórmula general I fórmula I en la que R representa alquilo de C1-C6, cicloalquilo de C3-C10, fenilo sin sustituir o sustituido, y X- representa el radical ácido de un ácido inorgánico u orgánico fisiológicamente compatible.

  14. 1518.-

    Maleta para vehículos de motor con un dispositivo de apertura facilitado

    (06/2012)

    Maleta para vehículos de motor, provista de unos medios de fijación amovible a una placa de soporte sobre el vehículo de motor, que comprende una parte de base y una tapa articuladas entre sí y provistas de un mecanismo de bloqueo que se puede controlar mediante unos medios de control desde una primera posición que sujeta la tapa en una posición cerrada hasta una segunda posición que libera la tapa para permitir su apertura, comprendiendo el mecanismo de bloqueo unos medios destinados a desplazar parcialmente la tapa desde la parte de base que actúan positivamente sobre la tapa cerrada en el paso del mecanismo de bloqueo de la posición de sujeción a la posición de liberación, comprendiendo la maleta...

  15. 1519.-

    Procedimiento y dispositivos para generar informaciones de peaje en un sistema de peaje viario

    (06/2012)

    Procedimiento para generar informaciones de peaje (tci) a partir de los movimientos de aparatos de vehículo en un sistema de peaje viario , que comprende al menos una central de peaje y una pluralidad de balizas conectadas a ésta y repartidas geográficamente para la comunicación vía radio de corto alcance con los aparatos de vehículo , caracterizado por los siguientes pasos: a) puesta a disposición de un juego (mi) de datos de ubicación de geo-objetos sujetos a peaje (oij) a partir del respectivo entorno local (Ui) de una baliza en esta baliza , b) registro de una secuencia (ti) de datos de posición (pi) de un aparato de vehículo en este aparato de vehículo , c) si el aparato de vehículo mencionado...

  16. 1520.-

    Procedimiento de estabilización de un crioprecipitado de proteinas plasmáticas destinado a someterse a un tratamiento térmico de inactivación viral

    (06/2012)

    Procedimiento de obtención de proteínas crioprecipitables exentas de hidratos de carbono y de tampón tris, que comprende una etapa de inactivación viral mediante tratamiento térmico de un liofilizado de dichas proteínas, caracterizado porque comprende, antes de poner las proteínas en forma de liofilizado, una etapa inicial de adición, a dichas proteínas, de una formulación estabilizadora y solubilizadora exenta de hidratos de carbono y de tampón tris, que comprende una mezcla de arginina, con al menos un aminoácido hidrófobo y citrato trisódico.

  17. 1521.-

    SISTEMA PARA LA CONSTRUCCIÓN DE MUROS UTILIZANDO BLOQUES PROVISTOS CON MEDIOS DE ACOPLAMIENTO

    (06/2012)
    Ver ilustración. Solicitante/s: ALVAREZ MOYSEN, Arturo Ramon. Inventor/es: ALVAREZ MOYSEN,Arturo Ramon. Clasificación: E04C1/39, E04B2/16, E04B2/24.

    Sistema para la construcción de muros utilizando bloques provistos con medios de acoplamiento, que comprende bloques con: lengüetas que embonan en ranuras, bases que embonan en canales, cavidades por donde se desplaza el adhesivo, muescas donde de ubican conductos para instalaciones, perforaciones para reforzamiento del muro con cable pos-tensado o varilla, provisiones para construir marcos para puertas o ventanas, túneles para albergar castillos, entre otros elementos, que en conjunto permiten la construcción de un muro sin la necesidad de mano de obra calificada, ahorrando material y disminuyendo el tiempo de construcción.

  18. 1522.-

    PROCESO DE PURIFICACION Y ESTABILIZACION DE LA ENZIMA GLUCONATO DESHIDROGENASA (GADH, EC 1.1.99.3); ENZIMA GLUCONATO DESHIDROGENASA (GADH, EC 1.1.99.3); Y USO DE LA ENZIMA GLUCONATO DESHIDROGENASA (GADH, EC 1.1.99.3)

    (06/2012)
    Solicitante/s: BIOLAN MICROBIOSENSORES, S.L. Inventor/es: ALONSO RODRIGUEZ,Pablo, QUIROS FERNANDEZ,Luis Manuel, CASTAÑON DE LA TORRE,Sonia, CRESPO SUSPERREGUI,Ainara, MAZA DEL RIO,Sonia. Clasificación: C12N9/02, C12N9/04, C12H1/15.

    Proceso de purificación y estabilización de la enzima Gluconato Deshidrogenasa (GADH, EC 1.1.99.3) recombinante o no, a partir de varios microorganismos como por ejemplo: Pseudomonas aeruginosa, Pseudomonas fluorescens, Gluconobacter oxydans, Gluconobacter industrius, Serratia marcescens Klebsiella pneumoniae y Eschericia coli y su uso como elemento de reconocimiento biológico en biosensores para la determinación del acido glucónico en muestras de interés. Biosensor bío-catalítico con transduccion electroquímica libre de interferentes gracias a la alta selectividad de la enzima obtenida mediante el método detallado y estabilizada con los agentes químicos optimizados.

  19. 1523.-

    DETERMINACIÓN DE VIRULENCIA DEL VIRUS DE NECROSIS PANCREÁTICA INFECCIOSA EN PECES

    (06/2012)

    Un método para determinar la virulencia en el virus de la necrosis pancreática infecciosa (IPNV) serotipo Sp en una muestra de peces, que comprende: a) determinar la presencia del IPNV en una población de peces tomando una muestra de tejido desde los mismos y seleccionar aquellas muestras con mayor carga viral; b) extraer el RNA de las muestras seleccionadas de la etapa a); c) amplificar la región discreta de la proteína VP2 que contiene los residuos 271 y 221 a partir de un eluído del ARN extraído en la etapa b) usando los siguientes partidores IPNa1: GGGACGTCATTGTCAAGGCC e IPNs7: CGTCCGCCTAGAGGACGAGAC';...

  20. 1524.-

    Composición para adhesivo estructural

    (06/2012)

    Composición utilizable en un adhesivo estructural, estando formado dicho adhesivo estructural por dicha composición y por un agente catalizador que comprende un cebador de polimerización radicálica de tipo peróxido, comprendiendo dicha composición: (a) al menos un monómero de éster metacrilato (b) un promotor de la adhesión basado en éster fosfato (c) un acelerador de la polimerización que comprende una amina terciaria de fórmula I: en la que: - el grupo R3 es un grupo electrodonante por resonancia que comprende al menos un grupo aromático que es capaz de formar con el radical: y en combinación con dicho cebador de polimerización radicálica,...

  21. 1525.-

    Abrazadera de toma de carga rígida multidiámetro para conducciones plásticas o rígidas de agua

    (06/2012)

    Abrazadera de toma de carga multidiamétro para conducciones plásticas o rígidas de agua, estando la abrazadera de una anchura determinada dividida en dos secciones circulares, una sección de grifo y una sección de cierre de circuito , pudiendo las dos secciones ser desolidarizadas entre sí a nivel de dos uniones con el fin de abrir la abrazadera y que pueden ser solidarizadas y apretadas juntas con el fin de formar una abrazadera propiamente dicha que puede rodear una conducción, comprendiendo la sección de grifo una corona de toma , pudiendo la corona de toma recibir hacia el exterior de la abrazadera un grifo de toma y pudiendo mantener hacia el interior...

  22. 1526.-

    Caldera

    (06/2012)

    Caldera que comprende una cámara de combustión asociada con un quemador ; un intercambiador de calor primario para transferir calor de los humos producidos en la cámara de combustión a un fluido de calentamiento; un ventilador para hacer circular dichos humos; y un intercambiador de calor de condensación secundario para recuperar el calor de condensación latente de dichos humos; comprendiendo dicho intercambiador de calor secundario una tubería enrollada para formar un conducto en espiral que se extiende a lo largo de un eje (A) y en el que circula dicho fluido de calentamiento; y una carcasa que tiene una cámara sustancialmente cilíndrica...

  23. 1527.-

    Sistema de control de revestimiento por pulverización de polvo y su combinación con un dispositivo de alimentación de polvo o con un dispositivo de revestimiento por pulverización de polvo

    (06/2012)

    Un sistema de control de revestimiento por pulverización de polvo que acciona unidades de revestimiento por pulverización de polvo y que contiene un controlador que acciona (por control o regulación) una unidad de revestimiento por pulverización de polvo , que contiene, a su vez, una bomba de polvo ; además, un elemento de ajuste del polvo (2º) para ajustar el valor teórico de la tasa de polvo que debe alimentarse desde la bomba de polvo por medio de aire comprimido de transporte hasta una herramienta de polvo , siendo calculada la tasa del aire comprimido de transporte por el controlador como una función del valor teórico...

  24. 1528.-

    Batiente trasero para vehículo automóvil que comprende un cuerpo hueco

    (06/2012)

    Batiente trasero para vehículo automóvil montado de manera móvil entre una posición cerrada en la que obtura al menos parcialmente un acceso al vehículo , y una posición abierta en la que libera al menos parcialmente el acceso al vehículo ; comprendiendo el batiente una piel exterior estética y un refuerzo interior de revestimiento , estando el refuerzo de revestimiento moldeado en un material de plástico; comprendiendo el refuerzo de revestimiento una superficie de estanqueidad destinada a actuar conjuntamente con un elemento de estanqueidad dispuesto en la carrocería del vehículo cuando el batiente está...

  25. 1529.-

    Una disposición de célula solar fotovoltaica

    (06/2012)

    1. Una disposición de célula solar fotovoltaica para la producción de energía a partir del sol que comprende: un sustrato de germanio que incluye una primera unión fotoactiva y la formación de una subcélula solar inferior ; una subcélula media de arseniuro de galio dispuesta sobre dicho sustrato ; una subcélula superior de fosfuro de galio indio dispuesta sobre dicha subcélula media y una rejilla superficial dispuesta sobre dicha subcélula superior que incluye una pluralidad de líneas de rejilla separadas entre sí , caracterizada...

  26. 1530.-

    SISTEMA DE PREMARCO DE PUERTA Y REVESTIMIENTO DEL MISMO CON AIREACION

    (06/2012)

    Sistema de premarco y revestimiento del mismo con aireación, consistente en un premarco adosable sobre el hueco del tabique en el que se va a instalar la puerta revestido por unos batientes galceados sobre los que se fijan sólidamente sendos tapajuntas generándose un espacio entre el conjunto formado por el premarco , el batiente y los tapajuntas , oculto para el usuario y que permite la libre circulación del aire entre ambas caras del premarco o con flujo regulado mediante la instalación en el mismo de un aireador que actúa además como atenuador acústico.

  27. 1531.-

    MUEBLE MODULAR CONVERTIBLE EN SILLÓN, SOFÁ Y CAMA

    (06/2012)

    La presente invención describe un mueble convertible en sillón, sofá y cama, el cual comprende: i) al menos, un asiento formado de una base rígida , de una tira de, al menos, dos cojines que se une al borde superior frontal de la base rígida , donde los cojines están unidos entre sí, a manera de acordeón; ii) un respaldo conformado por un par de piezas inferiores en forma de T horizontal, donde las partes horizontales (4a) se fijas en la parte inferior de la base rígida , y las partes verticales (4b) son tubulares abiertas en su parte superior; un primer par de tubos pasados se introducen en las partes verticales (4b), donde dichos tubos están unidos, entre sí por, al menos, una barra horizontal que tiene...

  28. 1532.-

    MÉTODO PARA EL DIAGNÓSTICO. PRONÓSTICO Y SEGUIMIENTO DE LA DEGENERACIÓN MUSCULAR

    (06/2012)
    Solicitante/s: UNIVERSIDAD DE ZARAGOZA.. Inventor/es: OSTA PINZOLAS,ROSARIO, ZARAGOZA FERNANDEZ,PILAR, CALVO ROYO,ANA CRISTINA, MUÑOZ GONZALVO,MARIA JESUS, MANZANO MARTÍNEZ,Raquel, GARCÍA REDONDO,Alberto, TORRE MERINO,Paz. Clasificación: C12Q1/68.

    La presente invención proporciona métodos basados en la cuantificación de un conjunto de biomarcadores, preferiblemente en muestras biológicas aisladas de músculo esquelético, para llevar a cabo el diagnóstico, pronóstico y/o seguimiento de la degeneración muscular, preferiblemente de la degeneración muscular provocada por enfermedades de motoneurona, más preferiblemente de la degeneración muscular provocada por esclerosis lateral amiotrófica (ELA); así como un kit para el diagnóstico, pronóstico y/o seguimiento de este tipo de enfermedades. El método de la invención para el pronóstico y/o seguimiento de la degeneración muscular permite determinar la velocidad de progresión de dicha degeneración (alta o baja velocidad de progresión en relación a la velocidad normal de progresión).

  29. 1533.-

    MOTOR DE COMBUSTIÓN INTERNA ROTATIVO DIRECTO CIRCULAR CON CÁMARA DE EXPANSIÓN TOROIDAL Y ROTOR SIN ELEMENTOS MÓVILES

    (06/2012)
    Ver ilustración. Solicitante/s: MOSER ROSSEL, Roberto Felipe. Inventor/es: MOSER ROSSEL,Roberto Felipe. Clasificación: F01C1/356.

    Motor de combustión interna rotativo directo circular, con cámara de expansión toroidal y rotor sin elementos móviles, que transforma directamente la expansión de la combustión en movimiento rotatorio de su eje, recibe el comburente comprimido a alta presión, no necesita de inercia para funcionar y la combustión se puede realizar en una cámara de combustión estática.

  30. 1534.-

    Antígenos BVH-A2 y BVH-3 de streptococcus del grupo B

    (06/2012)

    Un polinucleótido aislado que comprende un polinucleótido elegido de: (a) un polinucleótido que codifica un polipéptido que tiene al menos el 70% de identidad con un segundo polipéptido que comprende una secuencia elegida de SEC ID Nº: 7 y 8; (b) un polinucleótido que codifica un polipéptido que tiene al menos el 95% de identidad con un segundo polipéptido que comprende una secuencia elegida de: SEC ID Nº: 7 y 8; (c) un polinucleótido que codifica un polipéptido que comprende una secuencia elegida de: SEC ID Nº: 7 y 8; (d) un polinucleótido que codifica un polipéptido que puede producir anticuerpos que tienen especificidad...

  31. 1535.-

    Sistema de proyección láser basado en una pantalla luminiscente

    (06/2012)

    Sistema de proyección láser que consiste en al menos una primera fuente de luz láser, una pantalla de proyección y un modulador de luz espacial para proyectar un haz de láser de dicha primera fuente de luz láser para formar una imagen sobre dicha pantalla de proyección, comprendiendo dicha pantalla de proyección una capa luminiscente que tras la excitación por dicho haz de láser emite luz azul, caracterizado porque dicha capa luminiscente contiene al menos uno de BaMgAl11O17:Eu o MSi6-aAlaN8-aOx+a:Eu2+ (siendo M = Sr, Ba, Ca; 0 x : 1; 0 : a : 1) como material luminiscente.

  32. 1536.-

    Conjugado de anticuerpo - polímero de peine

    (06/2012)

    Un conjugado de anticuerpo - polímero de peine que tiene la fórmula (Ia) o (Ib) : en las que: y es 1, 2 o 3; m es 1, 2, 3, 4, 5, 6, 7, 8, 9 o 10; 1 B1 representa un halógeno; B2 representa H o un halógeno; A representa el residuo de un anticuerpo o uno de sus fragmentos; L representa un grupo enlazador; Y representa un grupo espaciador; y X representa un resto de polímero de peine que comprende w equivalentes de una o más moléculas efectoras y z equivalentes de uno o más restos solubilizantes en agua, en la que X comprende los componentes de fórmula (III) y (IV) en cualquier orden: en las que: w es al menos...

<< · 24 · 36 · 42 · 45 · 46 · < · 48 · > · 51 · 54 · 60 · 73 · >>