3,418 Patentes de marzo de 2007 (pag. 97)

  1. 3073.-

    COPOLIAMIDA BASADA EN TETRAMETILENO-TEREFTALAMIDA Y HEXAMETILENO-TEREFTALAMIDA.

    (03/2007)
    Solicitante/s: DSM N.V.. Inventor/es: RULKENS, RUDY, CROMBACH, ROBERT, CONRAD, BARBARA. Clasificación: C08G69/26.

    Copoliamida semi-aromática constituida por a. unidades tetrametileno-tereftalamida , b. unidades hexametileno-tereftalamida y opcional- mente c. unidades adicionales derivadas de al menos un ácido dicarboxílico distinto del ácido tereftálico, y/o derivadas de al menos una diamina distinta de tetrametileno-diamina o hexametileno-diamina , y/o derivadas de al menos un ácido aminocarboxílico o una amida cíclica distinta de tetrametileno-tereftalamida y hexametileno-tereftalamida caracterizada porque la copoliamida contiene como máximo 20% molar de unidades (c) adicionales.

  2. 3074.-

    DISPOSICION DE PANEL O SEÑAL LUMINOSA.

    (03/2007)
    Ver ilustración. Solicitante/s: SCANDISIGN AS. Inventor/es: JACOBSEN, JARLE, ROGN, GUNDERSEN, LARS. Clasificación: G09F13/00.

    Disposición de señal o panel luminosa, por ejemplo para información de tráfico, publicidad, otras informaciones, decoración, etc., caracterizada por - al menos una placa de distribución de luz clara de material plástico transparente, por ejemplo acrílico o vidrio, en la que una de las caras de la placa está provista de una pluralidad de ranuras sustancialmente paralelas , y en la que las ranuras se extienden total o parcialmente a lo largo de la longitud de la placa entre un primer y un segundo extremo de la misma; - al menos un dispositivo de fuente de luz alargado que se extiende transversalmente respecto a las ranuras paralelas; y - una placa difusora de luz o película de visualización ubicada adyacente a la otra cara de la placa de distribución de luz, y/o una placa o lámina reflectora de luz (23, 25’, 30) ubicada adyacente a la primera cara de la placa de distribución de luz.

  3. 3075.-

    METODOS RELACIONADOS CON INTERFERON INDUCIDO POR ACIDOS NUCLEICOS INMUOESTIMULADORES.

    (03/2007)

    Un ácido nucleico aislado que tiene una secuencia seleccionada del grupo consistente en: ggggtcgtcgttttgggggg ODN 2184 SEQ ID NO:3 tcgtcgttttgtcgttttgggggg ODN 2185 SEQ ID NO:4 ggggtcgacgtcgagggggg ODN 2192 SEQ ID NO:5 ggggtcatcgatgagggggg ODN 2204 SEQ ID NO:6 ggGGGACGATCGTCgggggG ODN 2216 SEQ ID NO:7 gggggtcgtacgacgggggg ODN 2217 SEQ ID NO:8 ggGGGACGATATCGTCgggggG ODN 2245 SEQ ID NO:9 ggGGGACGACGTCGTCgggggG ODN 2246 SEQ ID NO:10 ggGGGACGAGCTCGTCgggggG ODN 2247 SEQ ID NO:11 ggGGGACGTACGTCgggggG ODN 2248 SEQ ID NO:12 ggGGGACGATCGTTGggggG ODN 2252 SEQ ID NO:13 ggGGAACGATCGTCgggggG ODN 2253 SEQ ID NO:14 ggGGGGACGATCGTCgggggG ODN 2254 SEQ ID NO:15 ggGGGACGATCGTCGgggggG...

  4. 3076.-

    MEDIO DE CULTIVO CELULAR LIBRE DE PROTEINAS Y SUERO.

    (03/2007)
    Ver ilustración. Solicitante/s: BAXTER AKTIENGESELLSCHAFT. Inventor/es: REITER, MANFRED, MUNDT, WOLFGANG, DORNER, FRIEDRICH, GRILLBERGER, LEOPOLD, MITTERER, ARTUR. Clasificación: C12N5/06, C12N5/00.

    Medio libre de proteína y suero para el cultivo de células de mamíferos, que comprende hidrolizado de soja, caracterizado porque el 40% mínimo de dicho hidrolizado de soja tiene un peso molecular = 500 dalton.

  5. 3077.-

    AISLAMIENTO DEL CUBRETABLERO.

    (03/2007)
    Ver ilustración. Solicitante/s: CWW-GERKO AKUSTIK GMBH & CO. KG. Inventor/es: FREIST, CHRISTOPH, SIERING, HERMANN, JORDING, NORBERT, DOPHEIDE, RALF. Clasificación: B60R13/08.

    Procedimiento para hermetizar una determinada perforación para el paso de un conducto o un componente , en una pared de separación equipada con un aislamiento del cubretablero , entre el habitáculo de un vehículo y la zona del motor , caracterizado porque tras el paso de un conducto o de un componente se insertan una o varias piezas de ajuste de espuma expansiva en la perforación , y porque después se inicia su expansión.

  6. 3078.-

    UNIDAD PARA LA TRANSFERENCIA Y LA DISTRIBUCION DE UN LIQUIDO, UN DISTRIBUIDOR Y UN RECAMBIO.

    (03/2007)
    Ver ilustración. Solicitante/s: GIVAUDAN SA. Inventor/es: HART, GERALD, LESLIE, NAISH, GUY, EDWARD, GOHIL, KISHEN. Clasificación: A61L9/12.

    Unidad (1, 1’, 7, 13) para la transferencia y la distribución de un líquido que utilizan la acción capilar, con un vástago alargado (2, 2’, 8, 14) que incluye un primer medio capilar adecuado para aspirar el líquido desde un depósito y con una rejilla que incluye un segundo medio capilar adecuado para recibir el líquido del primer medio capilar y distribuirlo, por lo menos, sobre una parte de la rejilla para su evaporación, y en el que la rejilla tiene una o varias aberturas a través de las cuales puede insuflarse aire y en las que el primer medio capilar y el segundo medio capilar son una sola pieza.

  7. 3079.-

    COMPOSICIONES DE CATALIZADOR Y METODO DE POLIMERIZACION CON EL MISMO.

    (03/2007)
    Ver ilustración. Solicitante/s: UNIVATION TECHNOLOGIES LLC. Inventor/es: HOLTCAMP, MATTHEW, W., LUE, CHING-TAI. Clasificación: C08F10/00, C08F4/642, C08F2/34.

    Un proceso de fase gaseosa para la polimerización de olefina(s) en la presencia de un sistema catalizador que comprende un compuesto de un metal de transición representado por la siguiente fórmula: en donde Y es hidrógeno o un grupo hidrocarbilo, un halógeno o un heteroátomo, X y Z son independientemente un ligando voluminoso sustituido o no sustituido, con la condición sin embargo, que X y Z no sean un grupo ciclopentadienilo o fluorenilo, M es un metal del grupo 4, n es el estado de oxidación del metal, preferiblemente 3 o 4, preferiblemente 4, cada Q es, independientemente, un grupo aniónico marginal, en donde el compuesto de un metal de transición y/o el activador están sobre un soporte, preferiblemente el soporte es talco; un óxido de silica, cloruro de magnesio, alúmina, o silica-alúmina; polietileno, polipropileno, poliestireno, poliestireno ligado en cruz; o una mezcla de éstos.

  8. 3080.-

    PROCEDIMIENTO PARA LA PREPARACION DE INTERLEUCINA-8 Y MUTEINAS DE INTERLEUCINA-8 RECOMBINANTES Y SU USO PARA ENCONTRAR ANTAGONISTAS DE RECEPTORES DE IL-8.

    (03/2007)
    Solicitante/s: BAYER AKTIENGESELLSCHAFT. Inventor/es: APELER, HEINER, SCNEIDER, KARL-HEINZ, GOTTSCHALK, UWE, SCHRIDER, WERNER. Clasificación: C12N15/62, C12N1/19, C12N15/24, C07K14/54.

    Uso de IL-8 Y13H en preparaciones de detección sistemática para encontrar antagonistas de IL-8 de bajo y alto peso molecular de los receptores CXCR1 y CXCR2 de IL- 8.

  9. 3081.-

    SUAVIZADOR DE LA GANANCIA EN UN DESCODIFICADOR DE SEÑAL DE HABLA Y AUDIO DE BANDA ANCHA.

    (03/2007)

    Un método para producir un vector de código de ganancia suavizada durante la descodificación de una señal de banda ancha codificada, a partir de un conjunto de parámetros de codificación de señal, de tal modo que dicho método comprende: hallar un vector de código (ck) y una ganancia (g) en relación con al menos un primer (k) y al menos un segundo (g) parámetros de codificación de señal, pertenecientes a dicho conjunto; calcular un primer factor (rv, ) representativo de un grado de articulación en voz en la señal de banda ancha, en respuesta a al menos un tercer parámetro (b, vT) de codificación de señal, perteneciente a dicho conjunto; calcular un...

  10. 3082.-

    MAQUINA DE MOLDEO DE ELEMENTOS DE POLIESTIRENO CON VAPOR INTRODUCIDO EN LA PARTE INFERIOR DEL MOLDE Y UN SISTEMA DE DRENAJE DE CONDENSACION POR EL MISMO TUBO.

    (03/2007)
    Ver ilustración. Solicitante/s: POLIMATE - S.R.L. Inventor/es: GORI, GIANCARLO, PASCIUTI, ANDREA. Clasificación: B29C, B29C33/00, B29C44/58.

    Una máquina de moldeo de elementos de poliestireno, del tipo que comprende un molde constituido por un medio molde fijo y un medio molde móvil diseñados para la introducción de flujos de vapor a alta temperatura, que se introducen dentro de y se drenan del molde por medio de conductos (10a, 9a) respectivamente, insertados bajo el eje horizontal central del medio molde fijo y del medio molde móvil ; caracterizada porque los conductos (10a, 9a) usados para la introducción y el drenaje de vapor, se usan también para drenar condensación del interior del molde; y porque en la parte fija de la máquina está instalada una serie de válvulas para controlar el paso de los fluidos del proceso por el mismo conducto.

  11. 3083.-

    UNIDAD DE COMPRESOR MULTIETAPA Y PROCEDIMIENTO PARA REGULAR LA MISMA.

    (03/2007)
    Ver ilustración. Solicitante/s: ATLAS COPCO AIRPOWER N.V.. Inventor/es: VERHAEGEN, KEN, GUSTAAF, HELENA. Clasificación: F04C29/10, F04C23/00, F04C28/00.

    Una unidad de compresor multietapa que comprende, al menos, dos elementos compresores (1 y 2) diferentes y, al menos, dos motores eléctricos separados, con una velocidad ajustable, estando dichos elementos compresores accionados por dichos motores eléctricos , de tal manera que la salida de un elemento compresor de una etapa esté conectada a la entrada de un elemento compresor sucesivo, de una etapa sucesiva, caracterizada porque los motores eléctricos (3 y 4) son idénticos por cuanto tienen una, y la misma capacidad nominal, al mismo tiempo que está provisto un engranaje de transmisión entre cada motor y el elemento compresor , accionado de esta manera.

  12. 3084.-

    DISPOSITIVO DE LIMPIAPARABRISAS PARA CRISTALES DE AUTOMOVILES.

    (03/2007)
    Ver ilustración. Solicitante/s: ROBERT BOSCH GMBH. Inventor/es: KOTLARSKI, THOMAS, DE BLOCK, PETER, BREESCH, FRANS, GRAMMENS, JORIS. Clasificación: B60S1/32.

    Dispositivo de limpiaparabrisas, especialmente para cristales de automóviles, con un brazo de limpiaparabrisas extendido alargad, accionado, guiado en un extremo en el automóvil, en cuyo otro extremo se puede articular de forma pendular una hoja de limpiaparabrisas extendida alargada, que se puede aplicar sobre el cristal, y con una pieza de articulación conectada en una sola pieza con el extremo guiado en el automóvil del brazo del limpiaparabrisas , como parte de una articulación abatible , que está realizada en la sección transversal esencialmente en forma de U, presentando la sección transversal un desarrollo esencialmente en forma de S , caracterizado porque en la sección transversal esencialmente en forma de S se conecta un desarrollo en forma de arco con una curvatura de aproximadamente 90º.

  13. 3085.-

    GENEROS PARA AIRBAGS REALIZADOS CON HILOS DE ALTO DENIER POR FILAMENTO.

    (03/2007)
    Solicitante/s: E.I. DU PONT DE NEMOURS AND COMPANY. Inventor/es: BROWN, JEFFREY STEVEN, BARNES, JOHN ALAN. Clasificación: B60R21/16, D02G3/00, A63H3/31, A63H5/00, D03D15/00, D03D1/02.

    Un género tejido para ser usado en la fabricación de un airbag, donde el tejido está hecho con una pluralidad de hilos multifilamento de un polímero sintético que se extienden en direcciones sustancialmente perpendiculares de trama y urdimbre, caracterizado porque cada uno de dichos hilos multifilamento en sí comprende una pluralidad de filamentos individuales, en que cada filamento tiene una densidad lineal en el rango de aproximadamente 8 decitex a aproximadamente 11 decitex por filamento, dicho tejido tiene una rigidez de doblado circular en el rango de aproximadamente 4 newtons a aproximadamente 7 newtons, medida según el método ASTM D4032-94.

  14. 3086.-

    ACTIVIDAD SOMNIFERA DE BACTERIAS NO PATOGENAS DEL ACIDO LACTICO.

    (03/2007)
    Ver ilustración. Solicitante/s: COMPAGNIE GERVAIS-DANONE. Inventor/es: KRUEGER, JAMES, M., PABST, MICHAEL, J., CAYUELA, CHANTAL, DEGIVRY, MARIE-CHRISTINE, HARTLEY, DONNA. Clasificación: A61K35/74, A23C9/123, A61P25/20, C12R1/225, C12R1/46.

    Uso de bacterias no patógenas del ácido láctico cuyas paredes celulares son sensibles a la mutanolisina para la preparación de una composición para mejorar la calidad del sueño en un mamífero, aumentando la longitud de la fase del sueño de movimientos no rápidos de los ojos y disminuyendo la longitud de la fase de movimientos rápidos de los ojos.

  15. 3087.-

    SISTEMA DE CAPAS DE INTERFERENCIA REFLECTORAS DE UV.

    (03/2007)

    Elemento óptico compuesto por un sustrato transparente con un sistema de capas de interferencia reflectoras de UV para el tratamiento antirreflectante de banda ancha en el intervalo de longitudes de onda visible, en el que las capas consecutivas presentan diferentes índices de refracción y las capas individuales comprenden materiales inorgánicos estables a la temperatura y a UV, caracterizado porque el sistema de capas de interferencia está compuesto exactamente por cinco capas individuales sobre el sustrato con la siguiente construcción de capas: sustrato/M1/T1/M2/T2/S , en el que sustrato designa el sustrato transparente; M1, M2 una capa con índice de refracción...

  16. 3088.-

    PROCEDIMIENTO PARA LA PRODUCCION DE FENOL Y ACETONA POR DESCOMPOSICION DE HIDROPEROXIDO DE CUMENO.

    (03/2007)

    Un procedimiento mejorado para la producción de fenol y acetona a partir de hidroperóxido de cumeno por descomposición de hidroperóxido de cumeno en presencia de un catalzador ácido, en el que la mejora comprende la neutralización de dicho catalizador ácido tras una finalización substancial de dicha descomposición por adición de una amina seleccionada del grupo constituido por: (i) una amina secundaria o terciaria que tiene de 4 a 21 átomos de carbono y que no tiene sustituyentes hidrolíticamente inestables que experimentan reacciones sustanciales de hidrólisis y/o condensación a un pH en el intervalo de 3, 5 a 1, 5 y a una temperatura en el intervalo...

  17. 3089.-

    ESCOBILLA LIMPIABRISAS PARA VEHICULOS, EN PARTICULAR PARA VEHICULOS AUTOMOVILES.

    (03/2007)

    1. Escobilla de limpiaparabrisas para la limpieza de lunas de vehículos, en especial de vehículos de motor, con una varilla de limpiaparabrisas que se extiende longitudinalmente y se puede apoyar sobre la correspondiente luna, la cual está hecha de un material elástico como el caucho y se encuentra provista en sus dos costados de ranuras longitudinales opuestas entre sí, en cada una de las cuales encaja con una parte de su anchura un carril de soporte , preferentemente elástico, que se extiende en la dirección longitudinal (L) de la varilla de limpiaparabrisas , sobresaliendo cada carril de soporte con otra parte de su anchura sobre el correspondiente...

  18. 3090.-

    METODO Y APARATO PARA LOGRAR LA SINCRONIZACION CRIPTOGRAFICA EN UN SISTEMA DE COMUNICACION POR PAQUETES DE DATOS.

    (03/2007)
    Solicitante/s: QUALCOMM INCORPORATED. Inventor/es: MAURO, ANTHONY. Clasificación: H04L9/12.

    Un método para lograr la sincronización criptográfica en un sistema de comunicación por paquetes de datos, el sistema de comunicación por paquetes de datos que incluye un transmisor y un receptor, dicho transmisor y dicho receptor poseen cada uno capacidades de seguridad criptográfica, ejecutando en el transmisor los pasos de: generación de cuadros de datos en una tasa predeterminada en dicho transmisor; incremento de un vector de estado en dicha tasa predeterminada; envío de dicho vector de estado a un módulo de codificación; generación de un libro de códigos desde dicho módulo de codificación, empleando al menos dicho vector de estado, dicho libro de códigos para codificar al menos uno de dichos cuadros de datos; y desactivación de dicho vector de estado cuando se disminuyen uno o más de dichos cuadros de datos.

  19. 3091.-

    PROCEDIMIENTO PARA LA PROTECCION DE LA ARMADURA EN HORMIGON ARMADO.

    (03/2007)
    Ver ilustración. Solicitante/s: IMPERIAL COLLEGE OF SCIENCE, TECHNOLOGY AND MEDICINE. Inventor/es: GLASS, GARETH, KEVIN, REDDY, BARTI, BUENFELD, NICHOLAS, ROBERT, VILES, ROBERT, FRANKLYN. Clasificación: E04C5/01, C04B41/45, C23F13/02.

    Un hormigón armado en el que el contenido de burbujas en el hormigón en la superficie de la armadura de acero es inferior al 0, 8% por área del acero y en el que hay un depósito de álcali sólido alrededor de la superficie de acero.

  20. 3092.-

    MANGO PARA HERRAMIENTAS DE MANO Y DE JARDIN ASI COMO JUEGOS DE MANGOS Y DE HERRAMIENTAS COMBINADOS CON ESTOS MANGOS.

    (03/2007)

    Mango para herramientas de mano y de jardín que, durante el empleo, requieren una posición acoplada preferida de un grupo de manos asignado, que consiste esencialmente en una primera pieza con una parte distal destinada al agarre con el puente de la mano entre el pulgar y el índice, asociada a una cabeza de mango; una parte proximal destinada a la disposición en las muñecas, asociada a una base del mango; y una parte central dispuesta entre la parte distal y la proximal y/o , que presenta una longitud (L0.1), destinada a la disposición en la palma de la mano, que une continuamente la parte distal y la parte proximal , y de una segunda pieza...

  21. 3093.-

    DERIVADOS DE ISATINA CON ACTIVIDAD NEUROTROFICA.

    (03/2007)
    Ver ilustración. Solicitante/s: NEUROSEARCH A/S. Inventor/es: GRONBORG, METTE, PETERS, DAN, MOLLER, ARNE, ROMBACH, PIRMIN, HERNANN, OTTO. Clasificación: A61K31/435, A61K31/495, C07D487/04, A61K31/40, A61P25/00, C07D471/04, C07D209/40, C07D209/80, C07D241/36.

    Un derivado de isatina representado por la fórmula general (IV): o una sal farmacéuticamente aceptable del mismo, en la que R1 representa hidrógeno o un grupo alquilo (C1-18); R2 representa hidrógeno, un grupo alquil (C1-18)-, un grupo carboxi (-COOH), un grupo alquilcarbonilo (C1-18) o un grupo isoxazolilo, pudiendo estar el grupo isoxazolilo opcionalmente sustituido con uno o más sustituyentes seleccionados entre el grupo constituido por alquil (C1-18)- o alcoxi (C1-18)-; y R5 representa un grupo fenilo sustituido en la posición 4 con halógeno, CF3, NO2, amino, alquil (C1-18)- o alcoxi (C1-18)-.

  22. 3094.-

    METODO DE OPERAR UN SISTEMA DE AMARRE PARA ADAPTARSE A MOVIMIENTOS DE GRAN AMPLITUD.

    (03/2007)

    Un método de operar un sistema de amarre , incluyendo el sistema de amarre al menos un primer y un segundo robot de amarre (100a, 100b) fijados con relación a un primer cuerpo, incluyendo cada robot de amarre (100a, 100b) un brazo de robot con un elemento de unión para fijación soltable a una superficie de un segundo cuerpo móvil con relación a dicho primer cuerpo, teniendo el primer robot (100a) un primer elemento de unión y teniendo el segundo robot (100b) un segundo elemento de unión , siendo capaz cada robot de amarre de desplazar su respectivo elemento de unión entre respectivas posiciones de límite de movimiento primera y segunda,...

  23. 3095.-

    PROCESO DE FABRICACION DE LENTES INTRAOCULARES.

    (03/2007)

    Un método para moldear por vaciado un implante oftálmico que comprende una porción óptica y elementos hápticos a partir de dos o más materiales diferentes comprendiendo el método proporcionar una cavidad central para formar las porciones ópticas, al menos dos cavidades de elemento háptico para formar elementos hápticos y cavidades de unión de manera que cada cavidad de elemento háptico está en comunicación fluida con al menos una cavidad de unión y cada cavidad de unión está en comunicación fluida con la cavidad central caracterizado por el llenado de la cavidad central y llenado parcial de las cavidades de unión de un...

  24. 3096.-

    FORMULACIONES PASTOSAS QUE COMPRENDEN EL SILICIE.

    (03/2007)
    Ver ilustración. Solicitante/s: MERIAL LIMITED. Inventor/es: JUN, CHEN. Clasificación: A61K47/18, A61K47/10, A61K47/26, A61K47/02, A61K47/34, A61P19/02.

    Formulación de pasta farmacéutica o veterinaria que comprende: (a) una cantidad efectiva de un agente terapéutico que es 3-(ciclopropilmetoxi)-5 , 5-dimetil-4-(4-metilsulfonnil-5H-furan-2-ona o 3-(ciclopropiletoxi)-5 , 5-dimetil-4-(4-metilsulfonil)fenil)-5H-furan-2-ona o sales o hidratos farmacéuticamente aceptables de estos compuestos; (b) sílice pirógena; (c) un modificador de la viscosidad seleccionado entre PEG 200, PEG 300, PEG 400, PEG 600, monoetanolamina, trietanolamina, glicerol, propileno glicol, polioxileno sorbitán monoleato o poloxámeros; (d) un portador; (e) opcionalmente, un absorbente seleccionado entre carbonato de magnesio, carbonato de calcio, almidón, o celulosa y sus derivados; (f) opcionalmente, un estabilizador, sulfactante, preservativo, o un colorante seleccionado entre dióxido de titanio, tinte y laca.

  25. 3097.-

    CARGADOR DE MUNICION ROTATIVO.

    (03/2007)
    Ver ilustración. Solicitante/s: HAGGLUNDS VEHICLE AB. Inventor/es: ERIKSSON, BENGT. Clasificación: F41A9/74.

    Un cargador de munición rotatorio, en particular para proyectiles , que comprende una unidad portadora de munición que está montada en un bastidor de manera rotatoria alrededor de un eje central longitudinal y que comprende varios primeros elementos portadores de munición alargados que están distribuidos uniformemente unos respecto de los otros alrededor del eje central y diseñados y situados para que sean capaces de llevar al menos dos proyectiles (G1, G2) colocados esencialmente paralelos a, y a diferente distancia radial del eje central, caracterizado porque unos segundos elementos (14a, 14b, 16b, 18b) portadores de munición están diseñados y dispuestos para que sean capaces de llevar al menos un proyectil (G3) esencialmente paralelo al aje central y entre los primeros elementos portadores de munición a la misma distancias del eje central que los proyectiles (G1) radialmente exteriores de los primeros elementos portadores.

  26. 3098.-

    METODO Y APARATO PARA MONITORIZAR Y CONTROLAR LA TERAPIA DE DIALISIS PERITONEAL.

    (03/2007)
    Ver ilustración. Solicitante/s: BAXTER INTERNATIONAL INC.. Inventor/es: CHILDERS, ROBERT, EERLINGEN, VITAL, BALTEAU, PATRICK, BELONGIE, DUANE. Clasificación: A61M1/28.

    Sistema para proporcionar una diálisis peritoneal a un paciente, comprendiendo el sistema: un recipiente de dialisato para su conexión al paciente ; un primer sensor de presión que debe ser conectado en línea entre el recipiente de dialisato y el paciente; un depósito de drenaje para su conexión al paciente ; un segundo sensor de presión que debe ser conectado en línea entre el depósito de drenaje y el paciente, caracterizado porque dicho primer sensor de presión está adaptado para medir la presión intraperitoneal del paciente mientras el dialisato circula desde el paciente hacia el depósito de drenaje y porque dicho segundo sensor de presión está adaptado para medir la presión intraperitoneal del paciente mientras el dialisato circula desde el recipiente de dialisato hacia el paciente.

  27. 3099.-

    MEJORA DE LA GALACTOSILACION DE GLICOPROTEINAS RECOMBINANTES.

    (03/2007)
    Ver ilustración. Solicitante/s: GENENTECH, INC.. Inventor/es: RYLL, THOMAS. Clasificación: C12N15/00.

    Proceso para la producción celular de glicoproteínas con una mayor glicosilación, dicho proceso comprende: La expresión de la glicoproteína en las células con un aumento de la actividad CAD (complejo polipeptídico enzimático de carbamoilfosfato sintetasa II (CPSII)/aspartato transcarbamoilasa (AT- Case)/dihidroorotasa) comparada con las células huésped control; y en consecuencia la producción de glicoproteínas con una mayor glicosilación comparada con las células huésped control.

  28. 3100.-

    EXTRACTOR PARA EXTRAER O SEPARAR PIEZAS CORTADAS O PARCIALMENTE CORTADAS DE UNA LAMINA DE MATERIAL.

    (03/2007)

    Aparato de extracción para extraer o separar piezas o partes cortadas o parcialmente cortadas de una lámina cortada que comprende: rodillos prensadores de entrada dirigibles para sujetar y desplazar una lámina cortada o parcialmente cortada a través de los rodillos prensadores de entrada y para mantener coincidentes la lámina cortada y las partes con una línea tangente al punto de línea de contacto de los rodillos prensadores de entrada en una trayectoria a través de dicho aparato de extracción; y un rodillo de extracción colocado en un lado de salida de dichos rodillos prensadores de entrada dispuesto para desplazarse,...

  29. 3101.-

    ESTIMACION DE LA POSICION EN UN CUERPO ORIENTABLE USANDO UNA REPRESENTACION DE DATOS MEDIANTE CUATERNION MODIFICADO.

    (03/2007)

    Un método de estimación de la posición de un cuerpo orientable incluyendo dicho cuerpo medios detectores de orientación y medios de detección de velocidad angular comprendiendo el método las etapas de: producir información de velocidad angular a partir de dicho medio detector de velocidad angular , y producir información de orientación a partir de dicho medio detector de orientación , caracterizado porque la transformación e integración de dicha información de velocidad angular producida para producir la primera información de posición del cuaternión de manera que dicha primera información del cuaternión está obligada a...

  30. 3102.-

    PROCEDIMIENTO PARA LA PUESTA EN SERVICIO DE UN SISTEMA DE TELECOMUNICACIONES Y DISPOSICION DE TELECOMUNICACION.

    (03/2007)

    Procedimiento para la puesta en servicio de un sistema de telecomunicaciones, que incluye particularmente una red de telefonía móvil (PLMN), para la puesta a disposición de una prestación de servicio y obtener la información, comprendiendo lo siguiente: memorización de una multitud de números de llamada de terminales del sistema de telecomunicaciones en una primera base de datos de números de llamada (CNDB1), generación de un mensaje primario, que comprende al menos una parte de información, una demanda de respuesta normalizada por adaptación a un algoritmo de evaluación y un número de llamada de un terminal del servidor, y la memorización...

  31. 3103.-

    MATERIAL ACUOSO DE REVESTIMIENTO ENDURECIBLE FISICAMENTE, TERMICAMENTE O TERMICAMENTE Y CON RADIACION ACTINICA Y UTILIZACION DEL MISMO.

    (03/2007)
    Solicitante/s: BASF COATINGS AG. Inventor/es: WEGNER, EGON, SCHWARTE, STEPHAN, JANSING, FRANK. Clasificación: C09D5/00, C09D5/02.

    Material de revestimiento acuoso endurecible físicamente, térmicamente o térmicamente y con radiación actínica, que contiene A) como mínimo un poliuretano saturado, insaturado y/o injertado con compuestos olefínicamente insaturados, estabilizado de forma iónica y/o no iónica, como ligante; B) como mínimo un pigmento de coloración y/o de efecto decorativo; y C) como mínimo un polvo incoloro, transparente u opaco, esencialmente inerte frente al resto de componentes del material de revestimiento, con un tamaño de partícula medio de 1, 0 a 10, 0 m, cuyas partículas presentan una densidad de 0, 8 a 3, 6 gcm- 3.

  32. 3104.-

    ETAPA DE ENGRANAJE PLANETARIO.

    (03/2007)

    Una unidad de engranajes que comprende una etapa planetaria que tiene al menos una construcción de rodamiento, que sitúa una portasatélites en rotación respecto de una corona dentada , en el cual un primer anillo de rodamiento (A) de dicha construcción de rodamiento es sometido a deformaciones locales cuando el portasatélites gira respecto de la corona dentada , en el cual dicha construcción de rodamiento comprende un segundo anillo de rodamiento (B), que puede girar síncronamente con el portasatélites, caracterizada porque dicho segundo anillo de rodamiento (B) está precompensado con lo cual, en comparación con un segundo anillo de...

<< · 49 · 73 · 85 · 91 · 94 · 95 · < · 97 · > · 99 · 102 · >>