2,647 Patentes de noviembre de 2004 (pag. 56)

  1. 1761.-

    PROCEDIMIENTO PARA LA OBTENCION DE AROMATOS PUROS A PARTIR DE BENCINA DE REFORMADO.

    (11/2004)
    Solicitante/s: KRUPP UHDE GMBH. Inventor/es: EMMRICH, GERD, GEHRKE, HELMUT, SCHNEIDER, HANS-CHRISTOPH, FIRNHABER, BERNARD, DR. Clasificación: C10G67/04, C10G69/08.

    PROCEDIMIENTO PARA LA RECUPERACION DE COMPUESTOS AROMATICOS PUROS A PARTIR DE GASOLINA REFORMADA. EN UNA PRIMERA ETAPA LA GASOLINA SE HIDROGENA SELECTIVAMENTE, Y SE AJUSTAN DE TAL MANERA LAS CONDICIONES DE HIDROGENACION, QUE ESENCIALMENTE SE HIDROGENAN COMPUESTOS NO AROMATICOS, EN PARTICULAR OLEFINAS, DIOLEFINAS Y TRIOLEFINAS. A CONTINUACION EN UNA SEGUNDA ETAPA DEL PROCEDIMIENTO SE SEPARAN EN COMPUESTOS AROMATICOS Y NO AROMATICOS LOS PRODUCTOS SELECTIVAMENTE HIDROGENADOS QUE CONTIENEN COMPUESTOS AROMATICOS PROCEDENTES DE LA PRIMERA ETAPA POR DESTILACION EXTRACTIVA Y/O EXTRACCION LIQUIDO-LIQUIDO.

  2. 1762.-

    PROCEDIMIENTO DE FABRICACION DE UNA PIEZA FORJADA DE ACERO.

    (11/2004)

    ACERO PARA LA FABRICACION DE PIEZAS FORJADAS CUYA COMPOSICION QUIMICA COMPRENDE, EN PESO 0,1% INFERIOR O IGUAL A C INFERIOR O IGUAL A 0,4%, 1% INFERIOR O IGUAL A MN INFERIOR O IGUAL A 1,8%; 0,15% INFERIOR O IGUAL A SI INFERIOR O IGUAL A 1,7%; 0% INFERIOR O IGUAL A NI INFERIOR O IGUAL A 1%, 0% INFERIOR O IGUAL A CR INFERIOR O IGUAL A 1,2%, 0% INFERIOR O IGUAL A MO INFERIOR O IGUAL 0,3%, 0% INFERIOR O IGUAL A V INFERIOR O IGUAL A 0,3%, CU INFERIOR O IGUAL A 0,35%, EVENTUALMENTE DE 0,005% A 0,06% DE ALUMINIO, EVENTUALMENTE BORO EN CONTENIDOS COMPRENDIDOS ENTRE 0,0005% Y 0,01%, EVENTUALMENTE ENTRE 0,005% Y 0,03% DE TITANIO, EVENTUALMENTE ENTRE 0,005% Y 0,06% DE NIOBIO, EVENTUALMENTE DE 0,005% A 0,1% DE AZUFRE,,, EVENTUALMENTE HASTA 0,007% DE CALCIO, EVENTUALMENTE...

  3. 1763.-

    PUERTA TORACICA.

    (11/2004)
    Solicitante/s: UNITED STATES SURGICAL CORPORATION. Inventor/es: ALLI, ALIM, S., GUY, THOMAS D. Clasificación: A61B17/02, A61B17/34.

    PUERTO QUE INCLUYE UN CUERPO QUE TIENE UNA PARTE HUECA QUE DEFINE UN HUECO AXIAL, UNA PESTAÑA COLOCADA CIRCUNFERENCIALMENTE ALREDEDOR DE UN EXTREMO PROXIMAL DE LA PARTE HUECA Y DOS EXTREMOS COLOCADOS APARTE QUE SE EXTIENDEN DISTALMENTE DESDE LA PARTE HUECA, TENIENDO CADA EXTREMO UNA PARTE EXTREMA DISTAL CON UNA PARTE ALADA QUE SE EXTIENDE LATERALMENTE DESDE LA MISMA. EL PUERTO TORACICO SE INSERTA DENTRO DEL ESPACIO INTERCOSTAL ENTRE DOS COSTILLAS Y SE VUELVE HACIA UNA POSICION DE CIERRE EN LA QUE LOS EXTREMOS PUEDEN POLARIZAR VENTAJOSAMENTE LAS COSTILLAS PARA CONSEGUIR UNA CONFIGURACION MAS DISTANCIADA DE ESTAS Y DE LAS ALAS SOBRE LA SUPERFICIE DISTAL DE LAS COSTILLAS Y EVITAR LA RETIRADA INADVERTIDA DEL PUERTO.

  4. 1764.-

    MEZCLAS COMPATIBILIZADAS DE POLIETERIMIDAS Y POLIESTERES LIQUIDOS CRISTALINOS.

    (11/2004)
    Solicitante/s: GENERAL ELECTRIC COMPANY. Inventor/es: GIAMMATTEI, MARK, HOWARD, SILVI, NORBERTI, BROWN, STERLINE BRUCE, HOWE, KING LAU. Clasificación: C08L79/08.

    SE PREPARAN COMPOSICIONES RESINOSAS NO DELAMINADORAS MEDIANTE LA MEZCLA DE AL MENOS UNA POLIETERIMIDA, AL MENOS UN POLIESTER CRISTALINO LIQUIDO EN UNA CANTIDAD PARA PROPORCIONAR VISCOSIDAD DE FUSION INFERIOR, Y UNA CANTIDAD DE COMPATIBILIZACION DE AL MENOS UN COMPUESTO POLIEPOXI. LAS COMPOSICIONES PUEDEN TAMBIEN CONTENER UNA PROPORCION MENOR DE AL MENOS UN POLIESTER CRISTALINO NO LIQUIDO COMO POLI(ETILENO TEREFTALATO) O POLI(ETILENO 2,6NAFTALENODICARBOXILATO).

  5. 1765.-

    RELE ELECTROMAGNETICO Y PROCEDIMIENTO PARA EL AJUSTE DE LA TENSION DE EXCITACION DEL RELE ELECTROMAGNETICO.

    (11/2004)
    Solicitante/s: HELLA KG HUECK & CO.. Inventor/es: KORNER, ANDRE, HOFFMANN, WOLFGANG, ZIMMER, MAIK. Clasificación: H01H49/00, H01H50/28.

    SE DESCRIBE UN RELE ELECTROMAGNETICO, QUE SE CONFIGURA COMO RELE DE INDUCIDO DE TRAMPILLA, DONDE EL INDUCIDO ESTA UNIDO CON UN RESORTE DE FORMA PLANA, ESTANDO CONFIGURADO TANTO COMO RESORTE DE CONTACTO COMO TAMBIEN RESORTE DE RECUPERACION Y SE UNE MECANICA Y ELECTRICAMENTE CON UNA SUJECION DE CONEXION DE CORRIENTE DE CARGA. LA SUJECION DE CONEXION DE CORRIENTE DE CARGA MUESTRA UNA ZONA DE FIJACION DE RESORTE Y UNA ZONA DE CONEXION, LA ZONA DE FIJACION DE RESORTE Y LA ZONA DE CONEXION DE LA SUJECION DE CONEXION DE CORRIENTE DE CARGA SE CONFIGURAN DE FORMA FLEXIBLE UNA CONTRA OTRA. EN UN RELE DE ESTE TIPO PUEDE SER AJUSTADA LA TENSION DE ARRANQUE DE UNA FORMA ESPECIALMENTE SENCILLA Y RAPIDA. SE DESCRIBE INCLUSO UN PROCEDIMIENTO DE AJUSTE APROPIADO.

  6. 1766.-

    APTAMEROS INHIBIDORES DE LA CATEPSINA G.

    (11/2004)
    Solicitante/s: CRINOS INDUSTRIA FARMACOBIOLOGICA S.P.A.. Inventor/es: BRACHT, SCHROR KARSTEN PROF.DR.MED. Clasificación: A61K31/70, C12N15/11, C07H21/04.

    APTAMEROS CAPACES DE INHIBIR LA CATEPSINA G, QUE COMPRENDEN OLIGONUCLEOTIDOS DEL GRUPO CONSISTENTE EN LAS SECUENCIAS CONSENSO: GGN{SUB,1-17}GGN{SUB ,8-14}GGN{SUB,1-6}GGN{SUB ,1-7}GGN{SUB,1-6}GG, GGN{SUB,10-13}GGN{SUB ,1-5}GGN{SUB,3-6}GGN{SUB ,2-7}GG Y LA SECUENCIA GGGTTGAGGGTGGATTACGCCACGT-GGAGCTCGGATCCACACATCCAGG , DONDE N REPRESENTA NUCLEOTIDOS, Y LAS CIFRAS REPRESENTAN EL NUMERO DE POSIBLES NUCLEOTIDOS EN ESE LUGAR. DICHOS APTAMEROS INHIBIDORES DE CATEPSINA, SE PROPONEN COMO MEDICAMENTO.

  7. 1767.-

    TRANSMISION DE SEÑALES DIGITALES MEDIANTE UN SOPORTE DE GRABACION.

    (11/2004)
    Solicitante/s: PHILIPS ELECTRONICS N.V.. Inventor/es: LOKHOFF, GERARDUS CORNELIS PETRUS, DEHERY, YVES FRANCOIS, STOLL, GERHARD. Clasificación: G11B20/00, G11B20/12, G11B20/10.

    LA INVENCION FACILITA LA TRANSMISION DE SEÑALES DIGITALES A TRAVES DE UNA PORTADORA DE GRABACION Y SU CONSECUENTE REPRODUCCION. LAS SEÑALES DIGITALES PUEDEN SER SEÑALES DE SUBBANDA LEIDAS DESDE LA PORTADORA DE GRABACION HASTA LA REPRODUCCION PARA LA RECONSTRUCCION CORRECTA EN EL APARATO DE REPRODUCCION.

  8. 1768.-

    APARATO PARA SU USO EN ENDOSCOPIA Y LAPAROSCOPIA.

    (11/2004)
    Solicitante/s: NYCOMED AUSTRIA GMBH. Inventor/es: SCHEYER, MATHIAS, DR. Clasificación: A61B17/00.

    LA INVENCION TRATA DE UN APARATO DE MATERIAL QUIRURGICO PARA UTILIZARLO EN ENDOSCOPIA Y LAPAROSCOPIA, COMPUESTO DE UN MANGO 1, UN VASTAGO 2 RODEADO DE UN TUBO MOVIBLE 3, EN CUYO EXTREMO VA PROVISTO UN CIERRE PARA COLOCAR UN DISPOSITIVO PARA SUJETAR EL MATERIAL QUE CURE O CIERRE LAS HERIDAS, O UN INSTRUMENTO QUIRURGICO, ESTANDO FORMADO ESTE CIERRE POR DOS HOMBROS 6 UNIDOS Y DE DIFERENTE LONGITUD CON FORMA DE U, HABIENDO EN EL HOMBRO MAS LARGO UNA MUESCA 7, Y HABIENDO EN EL DISPOSITIVO PARA SUJETAR EL MATERIAL QUE CURE O CIERRE LAS HERIDAS O SOBRE EL MATERIAL QUIRURGICO UNA ELEVACION 8, QUE SE PUEDE METER EXACTAMENTE EN LA MUESCA DEL HOMBRO MAS LARGO.

  9. 1769.-

    DISPOSITIVO DE ACCESO A DISTANCIA A UNA RED PRIVIDA VIRTUAL.

    (11/2004)
    Solicitante/s: KONINKLIJKE PTT NEDERLAND N.V.. Inventor/es: SPRUIJT, CYRILLUS PATRICK. Clasificación: H04Q3/00, H04M1/27, H04Q3/62.

    LA INVENCION SE REFIERE A UN DISPOSITIVO DE TELECOMUNICACIONES , TAL COMO UN TELEFONO O UN DISPOSITIVO DE FACSIMILE, QUE TIENE UNOS ELEMENTOS PARA LA SALIDA AUTOMATICA DE UN CODIGO DE ACCESO DE UNA RED PRIVADA VIRTUAL (VPN) EN RESPUESTA A, POR EJEMPLO, EL LEVANTAMIENTO DEL AURICULAR . COMO RESULTADO, CON DICHO DISPOSITIVO SE PUEDEN MARCAR NUMEROS ABREVIADOS DE LA RED PRIVADA VIRTUAL, Y LA RED PRIVADA VIRTUAL SE PUEDE EXTENDER A TRAVES DE MEDIOS SENCILLOS DE FORMA NO RESTRINGIDA. PARA SU APLICACION JUNTO CON LOS EQUIPOS TELEFONICOS O DE FACSIMILE EXISTENTES , LA INVENCION TIENE TAMBIEN UNA UNIDAD CONECTADA EN SERIE PARA LA SALIDA DE UN CODIGO DE ACCESO. LA INVENCION ES PARTICULARMENTE CONVENIENTE PARA PERSONAS QUE TRABAJAN EN EL EXTERIOR.

  10. 1770.-

    PASO FINAL TOLERANTE A ERRORES PARA UN SISTEMA DIGITAL DE COMUNICACION DE DATOS POR UN BUS DE DOS CONDUCTORES.

    (11/2004)

    LA INVENCION SE REFIERE A UNA ETAPA TERMINAL CON UN MODULO DE EMISION Y UNA ETAPA DE RECEPCION, QUE CONTIENE UN MODULO DE PROCESADO INTERMEDIO DE SEÑAL DE BUS Y UN MODULO DE RECEPCION CONECTADO A CONTINUACION, DE FORMA QUE LAS SEÑALES BUS QUE SE RECIBEN SON PROCESADAS EN UNA UNIDAD DE PROCESAMIENTO DE DATOS CONECTADA A CONTINUACION. SE PROPONE UNA ETAPA TERMINAL, EN DONDE SE HA PREVISTO EN LAS CONDUCCIONES (H,L) BUS UN MODULO DE RECONOCIMIENTO DE SITUACION CONECTADO PARA RECONOCIMIENTO DE UN ESTADO DE CORTOCIRCUITO DE LAS CONDUCCIONES BUS, UNA CON RESPECTO A OTRA, DONDE EL MODULO DE EMISION SE CONTROLA MEDIANTE EL MODULO DE RECONOCIMIENTO DE SITUACION, SIENDO CONMUTABLE ENTRE UN TIPO DE OPERACION DIFERENCIA Y UN TIPO DE OPERACION DE...

  11. 1771.-

    INSTRUMENTO DISPENSADOR PARA SENSORES DE ANALISIS DE FLUIDOS.

    (11/2004)

    UN INSTRUMENTO DISPENSADOR DE SENSORES ESTA ADAPTADO PARA RECIBIR UN PAQUETE DE SENSORES GENERALMENTE CIRCULAR QUE CONTIENE MULTITUD DE SENSORES DE GLUCOSA EN SANGRE. CADA UNO DE LOS SENSORES ESTAN DISPUESTOS EN LAS CAVIDADES DE LOS SENSORES, CADA UNO DE LOS CUALES ESTA EN COMUNICACION FLUIDA CON UNA CAVIDAD DESECANTE CORRESPONDIENTE Y TIENE UNA PARED SOPORTE QUE ASISTE DIRIGIENDO AL SENSOR COMO SI FUERA EYECTADO DESDE LA CAVIDAD. EL PAQUETE SENSOR ES CARGADO SOBRE UN DISCO INDEXANTE EN UN INSTRUMENTO TAL QUE CUANDO EL ACTUADOR DESLIZANTE SITUADO SOBRE EL INSTRUMENTO SE MUEVE HACIA UNA POSICION DE ENSAYO, UN MECANISMO DE ALIMENTACION ENCAJADO POR EL ACTUADOR DESLIZANTE SE MUEVE SOBRE UNA HOJA DE CUCHILLO HACIA UNA DE LAS CAVIDADES DEL SENSOR....

  12. 1772.-

    DISTRIBUIDOR PARA UN PRODUCTO DE CONSISTENCIA LIQUIDA A PASTOSA.

    (11/2004)
    Solicitante/s: L'OREAL. Inventor/es: GUERET, JEAN-LOUIS. Clasificación: A45D34/04, A45D40/04.

    LA INVENCION SE REFIERE A UNA CONTERA DE APLICACION PARA LA DISTRIBUCION Y LA APLICACION DE UN PRODUCTO (P) DE CONSISTENCIA LIQUIDA A PASTOSA, QUE COMPRENDE UNA SUPERFICIE DE APLICACION DOTADA AL MENOS DE UN ORIFICIO DE DISTRIBUCION . ESTA CONTERA ESTA DOTADA CON UNA CHAPALETA UNIDIRECCIONAL (62B) QUE PERMITE LA DISTRIBUCION DEL PRODUCTO Y QUE IMPIDE QUE EL AIRE AMBIENTE ENTRE EN CONTACTO CON EL PRODUCTO. LA INVENCION SE REFIERE, TAMBIEN A UN CONJUNTO DE DISTRIBUCION QUE COMPRENDE TAL CONTERA DE APLICACION , UN DEPOSITO PARA EL PRODUCTO (P), MEDIOS (M) APTOS PARA PROVOCAR LA EXPULSION DEL PRODUCTO (P) A TRAVES DEL ORIFICIO DE DISTRIBUCION DE LA CONTERA DE APLICACION.

  13. 1773.-

    ANTAGONISTAS DE RECEPTOR NK-1 PARA EL TRATAMIENTO DE LESIONES NEURONALES Y ACCIDENTES CEREBROVASCULARES.

    (11/2004)
    Solicitante/s: PFIZER INC.. Inventor/es: LOWE, JOHN A, III, NELSON, ROBERT B. Clasificación: A61K31/445, A61K31/435, A61K31/40, A61K31/135, A61K31/675, A61K31/55, A61P25/00.

    LA PRESENTE INVENCION SE REFIERE A UN METODO PARA EL TRATAMIENTO O PREVENCION DE UNA ENFERMEDAD SELECCIONADA ENTRE LOS ATAQUES, LA EPILEPSIA, LOS TRAUMATISMOS CRANEALES, LOS TRAUMATISMOS DE LA MEDULA ESPINAL, EL DAÑO NEURONAL ISQUEMICO COMO EL DAÑO ISQUEMICO CEREBRAL, PRODUCIDO POR UN ATAQUE U OCLUSION VASCULAR (P.EJ. DURANTE LA CIRUGIA A CORAZON ABIERTO), EL DAÑO NEURONAL EXCITOTOXICO (P.EJ. LOS ATAQUES O LA EPILEPSIA) Y LA ESCLEROSIS LATERAL AMIOTROFICA EN LOS MAMIFEROS, INCLUIDOS LOS HUMANOS, QUE EMPLEA UN ANTAGONISTA NK-1. TAMBIEN SE REFIERE A UN METODO PARA EL TRATAMIENTO O PREVENCION DE DICHAS ENFERMEDADES EN LOS MAMIFEROS, INCLUIDOS LOS HUMANOS, UTILIZANDO CIERTOS DERIVADOS DE LA QUINUCLIDINA, DERIVADOS DE PIPERIDINA, DERIVADOS DE PIRROLIDINA, DERIVADOS DE AZANORBORNANO, DERIVADOS DE LA ETILENDIAMINA Y LOS COMPUESTOS RELACIONADOS QUE SON ANTAGONISTAS DEL RECEPTOR DE LA SUBSTANCIA P.

  14. 1774.-

    SISTEMA DE DETECCION DE AVERIAS PARA UN SISTEMA TELEFONICO.

    (11/2004)
    Solicitante/s: HARRIS CORPORATION. Inventor/es: HORTON, MICHAEL D., SCHILLACI, ONOFRIO, RISCHPATER, RAYMOND WILLIAM. Clasificación: H04M1/24, H04M3/30.

    UN MECANISMO PARA LA ELIMINACION DE PROBLEMAS INCORPORADO A LA UNIDAD INFORMATICA PORTATIL DE UN TECNICO DEL SERVICIO TELEFONICO, PARA PERMITIR QUE ESTE RESPONDA A UN PROBLEMA DETERMINADO. ANALIZANDO LAS FUENTES MULTIPLES DE INFORMACION, INCLUYENDO LAS ENTRADAS DEL USUARIO DESDE EL TECNICO, DATOS PARAMETRICOS INSERTADOS EN LA TARJETA DEL PROBLEMA, SE OBTIENEN DATOS DE PRUEBA A TRAVES DE LA EJECUCIONDE PRUEBAS LOCALES Y DATOS DE PRUEBA REMOTOS, DERIVANDO ESTE MECANISMO Y SUGIRIENDO UNA ESTRATEGIA DE RESOLUCION DE PROBLEMAS QUE PARECE ACERTADA. LA ARQUITECTURA DEL SISTEMA INCLUYE UN MOTOR DE APLICACION DE ELMINACION DE PROBLEMAS Y UN CONJUNTO ASOCIADO DE BASES DE DATOS, UNA DE LAS CUALES ES UNA BASE DE DATOS DE CONOCIMIENTOS, Y LA OTRA ES UNA BASE DE DATOS DE PARAMETROS COMPARTIDA. LA PRIMERA CONTIENE REGLAS Y PARAMETROS ESTATICOS QUE DEFINEN LAS CARACTERISTICAS Y COMPORTAMIENTO DEL MOTOR DE APLICACION. ESTOS CONJUNTOS DE REGLAS E INFORMACION SON ESPECIFICOS DE ELIMINACION DE PROBLEMAS DE LINEA TELEFONICA.

  15. 1775.-

    PROCEDIMIENTO PARA PURIFICAR UN ANTIGENO SUPERFICIAL DEL VIRUS DE LA HEPATITIS B QUE CONTIENE UN PEPTIDO PRES2.

    (11/2004)
    Solicitante/s: LG CHEMICAL LIMITED. Inventor/es: PARK, SOON-JAE, LEE, YOUNG-MEE, YOON, KYUNG-HEE, LIM, KOOK-JIN, KWON, YOUNG-SUN. Clasificación: A61K39/29, C07K14/02.

    UN PROCESO PARA LA PURIFICACION DEL ANTIGENO DE LA SUPERFICIE VIRAL DE LA HEPATITIS B QUE CONTIENE EL PEPTIDO PRES2 DE LAS CELULAS DE UN ORGANISMO RECOMBINANTE, QUE SE CARACTERIZA PORQUE DICHAS CELULAS SE ALTERAN CON LA UTILIZACION DE UN TAMPON QUE CONTENGA UNA SAL CAOTROPICA.

  16. 1776.-

    TELEFONO MOVIL CON FUNCION DE BUZON.

    (11/2004)
    Solicitante/s: SIEMENS AG. Inventor/es: CHRISTAL, PHILIP. Clasificación: H04M1/725, H04M1/247.

    SE DESCRIBE UN MANEJO DE MENSAJES BAJO LA UTILIZACION DE UNA LLAVE SOFT Y UNA INDICACION DE DESPLIEGUE.

  17. 1777.-

    INSPECCION DE LA SUPERFICIE DE SELLADO DE UN ENVASE.

    (11/2004)
    Solicitante/s: OWENS-BROCKWAY GLASS CONTAINER INC.. Inventor/es: RINGLIEN, JAMES A.. Clasificación: G01N21/90.

    SE PRESENTA UN APARATO PARA INSPECCIONAR LAS SUPERFICIES DE SELLAMIENTO DE ENVASES QUE INCLUYE UNA FUENTE DE LUZ POSICIONADA PARA DIRIGIR UN RAYO ESTRECHO DE ENERGIA LUMINOSA EN UN ANGULO AGUDO SOBRE LA SUPERFICIE DE SELLAMIENTO DE UN ENVASE A MEDIDA QUE EL ENVASE ES HECHO GIRAR ALREDEDOR DE SU EJE CENTRAL. UN SENSOR DE LUZ ESTA DISPUESTO PARA RECIBIR EL RAYO ESTRECHO DE ENERGIA LUMINOSA REFLEJADO DESDE LA SUPERFICIE DE SELLAMIENTO, Y SUMINISTRA UNA SEÑAL DE SALIDA QUE VARIA COMO FUNCION DE LA POSICION DE INCIDENCIA DEL RAYO DE LUZ REFLEJADO SOBRE EL SENSOR. EL SENSOR ESTA ACOPLADO A DISPOSITIVOS ELECTRONICOS ASOCIADOS PARA SUMINISTRAR UNA INFORMACION INDICATIVA DE LA ALTURA DEL ENVASE, Y UNA SEÑAL PARA CONTROLAR LA SEPARACION DE UN ENVASE DEL SISTEMA DE TRANSPORTE CUANDO LA ALTURA DEL ENVASE, LA ENVUELTA O LA PROFUNDIDAD DE LA SUPERFICIE DE SELLAMIENTO DEL ENVASE, O LOS PRODUCTOS FINALES COCINADOS EN EL ENVASE EXCEDA DE LOS ESTANDARES PREDETERMINADOS.

  18. 1778.-

    DERIVADOS DE ACIDO VINIL-CARBOXILICO.

    (11/2004)

    COMPUESTOS DE LA FORMULA (I) EN DONDE R1 ES CICLOALQUILO C3 - 8, HALOCICLOALQUILO C3 - C8, ALQUILO C1 - C6 - CICLOALQUILO C3 - C8, HALOALQUIL C1 - C6 - CICLOALQUIL C3 - C8, - SI(R3)3, - S - R4, - SO2 - R6, O - CO - R9; R2 ES HALOGENO, ALQUILO C1 - C4 O CF3, SIENDO LOS SUBSTITUYENTES R2 IGUALES O DIFERENTES CUANDO N ES 2; CADA R3 INDEPENDIENTEMENTE DE LOS OTROS ES ALQUILO C1 - C6, HALOALQUIL C1 C6, ALCOXI C1 - C6 O FENIL; R4 ES ARILO O HETEROARILO CADA UNO DE LOS CUALES PUEDE ESTAR SUBSTITUIDO O INSUBSTITUIDO; R6 ES ALQUILO C1 C10, ALQUENILO C2 - C6, ALQUINILO C2 - C6, ALCOXI C1 - C20, ALQUENILOXI C2 - C6, ALQUINILOXI C2 - C6, ALQUILTIO C1 - C4, ARILO, ARILOXI O ARILTIO SUBSTITUIDOS O INSUBSTITUIDOS, O ES AMINO OPCIONALMENTE SUSBSTITUIDO;...

  19. 1779.-

    COMPONENTE RECICLABLE CON ALMACENAMIENTO DE DATOS PARA ALMACENAR INFORMACION PARA EXAMINAR EL COMPONENTE, Y PRODUCTO QUE INCLUYE UN COMPONENTE DE ESTE TIPO.

    (11/2004)
    Solicitante/s: SONY DEUTSCHLAND GMBH. Inventor/es: SCHEIDT, LUTZ-GUNTHER, DR., LAGADEC, ROGER, DR., ZONG, SHUGIANG, DR.-ING. Clasificación: G07C3/00.

    LA INVENCION HACE RELACION AL PROBLEMA DEL RECICLADO DE PRODUCTOS DE ESTRUCTURA COMPLICADA Y SE BASA EN LA IDEA DE PROPORCIONAR A CADA COMPONENTE (2 A 6) DEL PRODUCTO UNA MEMORIA (2A,2B ... 6B) EN LA QUE NO SOLO SE ALMACENE LA INFORMACION EN EL MOMENTO DE LA PRODUCCION COMO LA LOCALIZACION DEL MATERIAL A RECICLAR SINO TAMBIEN DATOS ADICIONALES TALES COMO, P.EJ., SOBRE REPARACIONES Y/O PRESIONES ESPECIFICAS A LAS QUE EL APARATO HA SIDO SOMETIDO DURANTE SU USO. DICHOS DATOS ADICIONALES PUEDEN SER RECOGIDOS MEDIANTE SENSORES ESPECIFICOS PROVISTOS EN CADA COMPONENTE O EN EL CUERPO DEL PRODUCTO PARA SER MEMORIZADOS EN LA MEMORIA DE CADA COMPONENTE. BASADA EN LA IDEA DE LA INVENCION, LA VIDA DE CADA COMPONENTE PUEDE SER COMPROBADA INDIVIDUALMENTE PARA DETERMINAR SI DICHO COMPONENTE PUEDE VOLVER A USARSE O QUEDAR DISPONIBLE PARA DESMONTAJE Y RECICLADO.

  20. 1780.-

    9-(AMIDO(GLICIL SUSITUIDO))-6-SUSTITUIDO-5-HIDROXI-6-DESOXITETRACICLINAS.

    (11/2004)
    Solicitante/s: AMERICAN CYANAMID COMPANY. Inventor/es: LEE, VING JICK, BUCKWALTER, BRIAN LEE, BARDEN, TIMOTHY CLAUDE. Clasificación: A61K31/65, C07C237/26.

    LA INVENCION SE REFIERE A COMPUESTOS DE LA FORMULA: EN LA QUE R, R1, R2 Y W SON COMO SE DEFINEN EN LA ESPECIFICACION. ESTOS COMPUESTOS SON UTILES COMO AGENTES ANTIBIOTICOS.

  21. 1781.-

    FACTOR MITOGENO, GEN DEL MISMO Y PROCEDIMIENTO PARA SU MICRODETECCION.

    (11/2004)
    Solicitante/s: SHIONOGI & CO., LTD.. Inventor/es: YUTSUDO, TAKASHI, OKUMURA, KOICHI, IWASAKI, MAKOTO, HARA, AYAKO, KISHISHITA, MASAMICHI, TAKEDA, YOSHIFUMI, IGARASHI, HISANAGA, HINUMA, YORIO. Clasificación: C07K14/00, C12N15/74, C12N15/31, C12Q1/68, C12P21/08, C12N1/21.

    UN FACTOR MITOGENICO Y UN GEN QUE CODIFICA EL FACTOR MITOGENICO COMPRENDE LAS SECUENCIAS MOSTRADAS EN SEQ ID NO:1 OLIGONUCLEOTIDA CAPAZ DE HIBRIDIZAR CON EL GEN PUEDE SER USADO PARA LOS PRIMEROS PCR. EL GEN DE FACTOR MITOGENICO PUEDE SER DETECTADO POR LOS PASOS DE AMPLIFICAR Y ACUMULAR UN FRAGMENTO DEL GEN DE FACTOR MITOGENICO REPITIENDO LOS CICLOS DE LOS PCR UTILIZANDO LOS OLIGONUCLEOTIDOAS ANTERIORES Y DETECTANDO LOS FRAGMENTO ASI AMPLIFICADOS Y ACUMULADOS. EL GRUPO ESTREPTOCOCOS A PUEDE SER DETECTADO POR LA PRESENCIA DEL GEN DE FACTOR MITOGENICO. LA PRESENTE INVENCION HACE POSIBLE LA DETECCION DEL GRUPO FUERTEMENTE PATOGENICO DE ESTREPTOCOCOS A EN UNA ETAPA TEMPRANA DE LA INFECCION, Y ASI PUEDE UTILIZARSE PARA UN DIAGNOSTICO PRECOZ DE LA ENFERMEDAD INFECCIOSA CON LA BACTERIA.

  22. 1782.-

    METODO PARA LA PRODUCCION DE PROTEINAS EN FLUIDOS DE PLANTAS.

    (11/2004)

    SE DESCRIBE UN METODO PARA PRODUCIR UNAS PLANTAS PRODUCTORAS DE FLUIDO GENETICAMENTE TRANSFORMADAS QUE COMPRENDE: I) INSERTAR DENTRO DEL TEJIDO DE LA PLANTA UN GEN O FRAGMENTO QUE CONTROLE LA EXTRESION DE UN PRODUCTO OBJETIVO, Y II) REGENERAR UNA PLANTA DESDE DICHO TEJIDO, LA PLANTA GENETICAMENTE TRANSFORMADA ES CAPAZ DE EXPRESAR EL PRODUCTO OBJETIVO EN EL FLUIDO QUE PRODUCE. TAMBIEN PROVISTOS CLONES DE PLANTAS PRODUCTORAS DE FLUIDO GENETICAMENTE TRANSFORMADAS QUE CONTIENEN EN SUS CELULAS UN CROMOSOMA INSERTO TAL QUE EL PRODUCTO OBJETIVO SE EXPRESA EN LOS FLUIDOS QUE PRODUCEN LAS PLANTAS. UN METODO PARA PRODUCIR LA PROTEINA U OTRO PRODUCTO OBJETIVO QUE COMPRENDE: I) COSECHAR EL FLUIDO DESDE UNA PLANTA O ARBOL PRODUCTOR DEL MISMO GENETICAMENTE...

  23. 1783.-

    METODO PARA LA REDUCCION DE MALOS OLORES EN PRODUCTOS ABSORBENTES Y PRODUCTOS FORMADOS POR EL MISMO.

    (11/2004)
    Solicitante/s: KIMBERLY-CLARK WORLDWIDE, INC.. Inventor/es: GROSS, JAMES, RICHARD. Clasificación: A61L15/46, A61L15/48.

    SE DA A CONOCER UN METODO PARA LA REDUCCION DEL MAL OLOR ASOCIADO CON PRODUCTOS ABSORBENTES DESECHABLES APROPIADOS PARA LA ABSORCION DE FLUIDOS DEL CUERPO HUMANO. EL METODO INCLUYE LA APLICACION AL PRODUCTO ABSORBENTE, ANTES DE SU USO, EN UNA CANTIDAD EFECTIVA DE UN AGENTE ACTIVO SUPERFICIAL DISPONIENDO DE UN BALANCE HIDROFILICO/LIPOFILICO DE MENOS DE APROXIMADAMENTE 12. EL AGENTE ACTIVO SUPERFICIAL ES EFECTIVO PARA REDUCIR EL OLOR DE ORINA. SE PONE A DISPOSICION TAMBIEN UN PRODUCTO ABSORBENTE DESECHABLE ADECUADO PARA LA ABSORCION DE FLUIDOS DEL CUERPO, CUYO PRODUCTO ABSORBENTE DESECHABLE INCLUYE UNA ESTRUCTURA ABSORBENTE INCLUYENDO UN MATERIAL GENERALMENTE INSOLUBLE EN AGUA, HINCHABLE CON AGUA, UN MATERIAL DE RECUBRIMIENTO Y UNA CANTIDAD EFECTIVA DE UN AGENTE ACTIVO SUPERFICIAL DISPONIENDO DE UN BALANCE HIDROFILICO/LIPOFILICO DE MENOS DE APROXIMADAMENTE 12. EL AGENTE ACTIVO SUPERFICIAL ES ADECUADO PARA LA REDUCCION DEL OLOR DE ORINA.

  24. 1784.-

    GRAPA PASTICA MALEABLE, BIOABSORBIBLE Y METODO Y APARATO PARA DEFORMAR UNA GRAPA DE ESTE TIPO.

    (11/2004)

    UNA GRAPA POLIMERICA BIOABSORBIBLE Y MALEABLE (10') INCLUYE UN TRAMO TRASERO (12') CON DOS PATAS (14') QUE PENDEN PERPENDICULARMENTE DEL ANTERIOR TRAMO Y QUE SE DEFORMAN INICIALMENTE UNA HACIA LA OTRA Y POSTERIORMENTE EN SENTIDO ASCENDENTE HACIA DICHO TRAMO TRASERO DE MODO QUE LAS PUNTAS EN LOS EXTREMOS DE AMBAS PATAS SE EXTIENDEN LATERALMENTE Y MAS ALLA DEL TRAMO. LA GRAPA POSEE UNA FORMA TRANSVERSAL NO CIRCULAR. UN YUNQUE DEFORMADOR DE GRAPA QUIRURGICA PARA DEFORMAR LAS GRAPAS POSEE UNA CARA RECEPTORA DE GRAPA FORMADA POR UN PAR DE DEPRESIONES EN FORMA DE BOLSA NO COLONIAL ALARGADAS CADA UNA CON UN EXTREMO DE ENTRADA SOBRE UN EJE LONGITUDINAL PARALELO AL TRAMO TRASERO DE LAS GRAPAS, Y UN EXTREMO DE SALIDA . LOS EXTREMOS...

  25. 1785.-

    UN DISPOSITIVO PARA LA CONEXION OPTICA DE UN ELEMENTO OPTICO, COMO POR EJEMPLO UNA FIBRA OPTICA, CON UNA LENTE.

    (11/2004)
    Solicitante/s: AB STRATOS LIMITED. Inventor/es: FOLDI,PETER. Clasificación: G02B6/42, G02B6/32.

    UN DISPOSITIVO PARA CONECTAR OPTICAMENTE UN ELEMENTO OPTICO, UNA PORCION FINAL DE UNA FIBRA OPTICA POR EJEMPLO, A UNA LENTE ESFERICA , QUE CONSTA DE UN RETENEDOR Y DE UN ELEMENTO CONECTOR . EL RETENEDOR FIJA EL ELEMENTO OPTICO EN UNA POSICION PREDETERMINADA EN RELACION A UNA SUPERFICIE DE REFERENCIA DEL RETENEDOR. EL ELEMENTO CONECTOR TIENE AL MENOS UNA SUPERFICIE PARA DETERMINAR LA POSICION DE LA LENTE ESFERICA Y A MENOS UNA SUPERFICIE PARA DETERMINAR LA POSICION DEL RETENEDOR EN RELACION CON LA LENTE ESFERICA Y PARA ASI DEFINIR LA POSICION RELATIVA ENTRE EL ELEMENTO OPTICO Y LA LENTE ESFERICA . LA SUPERFICIE PARA DETERMINAR LA POSICION DE LA LENTE ESFERICA ESTA FORMADA POR UNA SUPERFICIE CONICA QUE SE AHUSA EN DIRECCION AL ELEMENTO OPTICO.

  26. 1786.-

    DISPOSITIVO ADAPTADOR PARA LA CONEXION DE CARGAS ELECTRICAS A UN CIRCUITO DE CORRIENTE CONTROLADO.

    (11/2004)
    Solicitante/s: O.C.E.M. S.P.A. Inventor/es: BASILE, GIANLUIGI. Clasificación: H05B37/02, H05B37/03.

    La invención se refiere a un dispositivo adaptador para la inserción de una carga eléctrica en un circuito de corriente controlada, con esta carga conectada a un bucle de alimentación (49 a través del cual fluye una corriente de alimentación. Incluye un primer detector (5b), que emite una señal que es proporcional a la tensión de carga (VC) existente a través de la carga , y una unidad de control (c) que controla dicho dispositivo adaptador de manera a mantener constante dicha tensión de carga (VC). El dispositivo también incluye un grupo operativo conectado en paralelo a través de la bobina secundaria de un transformador (3ª) previsto para acoplarse con el bucle de alimentación. El grupo operativo es puesto en marcha por la unidad de control (c) a través de un terminal de control, de acuerdo con los ciclos operativos predeterminados.

  27. 1787.-

    DISPOSITIVO DE ARTICULACION PARA LA ACTIVACION DE UNA TRAMPILLA O SIMILAR.

    (11/2004)
    Solicitante/s: GRASL, ANDREAS. Inventor/es: GRASL, ANDREAS. Clasificación: F24F13/14, E05F15/04, A62C2/24.

    Se presenta un dispositivo de unión para una hoja abatible, con un elemento motriz lineal. Un extremo del elemento motriz lineal está unido de forma giratoria a una solapa , el otro extremo está unido de forma giratoria a una palanca de soporte en un primer eje de pivotado. La palanca gira sobre un segundo eje de pivotado dispuesto a distancia, y especialmente por debajo, del primer eje giratorio fijo de la solapa. Un primer extremo de una palanca de inversión extra sobre un tercer eje de pivotado en el elemento motriz. Un segundo extremo de la palanca de inversión se monta sobre un punto de pivotado fijo (P2). El primer eje de giro (P5) del elemento motriz lineal en la palanca de soporte y el tercer eje de giro (P4) sobre el cual la palanca de inversión en el elemento motriz lineal gira describen trayectorias circulares cuando se acciona el elemento motriz lineal. Las trayectorias circulares se intersectan de forma que hagan girar el elemento motriz lineal.

  28. 1788.-

    PROCEDIMIENTO DE NEGOCIACION DE SERVICIO Y VELOCIDAD EN UN SISTEMA DE COMUNICACION MOVIL.

    (11/2004)

    En un procedimiento para negociar la configuración de servicio en un sistema de comunicaciones que tiene al menos un canal dedicado que no está compartido por los dispositivos de comunicación del sistema de comunicaciones, se genera un mensaje de petición indicativo de una configuración de servicio propuesta en un negociador de servicio . El mensaje petición se multiplexa, en un multiplexor acoplado al negociador , con una señal de datos de información para producir una señal multiplexada. La señal multiplexada se codifica en un codificador interpuesto entre el multiplexor y un transmisor de acuerdo con una configuración de servicio seleccionada por el negociador de servicio . La señal multiplexada...

  29. 1789.-

    MASAS EPOXI ENDURECIBLES Y SU EMPLEO.

    (11/2004)
    Solicitante/s: HILTI AKTIENGESELLSCHAFT. Inventor/es: DIERKER, SASCHA, PFEIL, ARMIN. Clasificación: C08G59/40, C08G59/68, C08K3/10, C08K3/20.

    Se presenta una composición de epóxido polimerizable utilizada en la construcción, especialmente para la fijación de una varilla o tornillo de anclaje en un orificio. La composición de epóxido polimerizable contiene: a) poliepóxido; b) poliamina; c) poliacetoacetato y d) un compuesto de metal de un catión de metal y opcionalmente otros constituyentes, por ejemplo material de relleno, diluyente, catalizador de la polimerización, aditivo reológico u agente humectante, colorante, etc.

  30. 1790.-

    METODO PARA FABRICAR CEPILLOS Y MAQUINA PARA FABRICAR CEPILLOS QUE APLICA ESTE METODO.

    (11/2004)
    Solicitante/s: FIRMA G.B. BOUCHERIE, NAAMLOZE VENNOOTSCHAP. Inventor/es: BOUCHERIE, BART GERARD. Clasificación: A46D3/04.

    Procedimiento de fabricación de cepillos, caracterizado porque se aplica un dispositivo que consiste en al menos un portador con aberturas que están mutuamente dispuestas según un cierto patrón, con lo que los paquetes de fibras a acoplar en un cuerpo de cepillo pueden ponerse en este portador , y por consiguiente este procedimiento consiste también e la combinación de al menos 4 pasos 86, 8, 9,11), respectivamente, la separación lateral de los paquetes de fibras de al menos una cantidad de fibras sueltas ; la provisión, de manera mecánica, paso a paso, de los dichos paquetes de fibras en dicho portador ; la transferencia de los paquetes de fibras colocados en el portador mediante este portador hacia un dispositivo de sujeción ; y mediante este dispositivo de sujeción ,la fijación de los paquetes de fibras en el cuerpo de cepillo o al menos en una parte del cuerpo de cepillo.

  31. 1791.-

    NUEVO VIRUS RECOMBINANTE DE MIXOMA ATENUADO Y SU USO EN LA PREPARACION DE VACUNAS MIXTAS CONTRA LA MIXOMATOSIS Y LA ENFERMEDAD HEMORRAGICA DE LOS CONEJOS.

    (11/2004)
    Solicitante/s: FUNDACION PARA EL ESTUDIO Y DEFENSA DE LA NATURALEZA Y DE LA CAZA INSTITUTO NACIONAL DE INVESTIGACION Y TECNOLOGIA, AGRARIA Y ALIMENTARIA. Inventor/es: BLASCO LOZANO,RAFAEL, BARCENA DEL RIEGO, MORALES CAMARZANA, MONICA, PAGES MANTE, ALBERT, PARRA FERNANDEZ, FRANCISCO, SANCHEZ VIZCAINO, JOSE MANUEL, TORRES TRILLO, JUAN MARIA, VAZQUEZ RUIZ, BELEN. Clasificación: C12N15/86, A61K39/295, A61K39/275, C12N15/41, A61K39/125.

    La invención se refiere a un nuevo virus mixoma recombinante registrado en la CNCM con número de registro I-1990 que contiene dentro de su genoma una secuencia de nucleótidos capaz de expresar la proteína de antígeno VP60 del virus de la enfermedad hemorrágica del conejo, que está atenuado y muestra una capacidad controlada de transmisión, así como vacunas combinadas anti-RHDV y antimixomatosis - que se autopropagan de manera controlada, obtenidas a partir de dicho virus. La invención también se refiere a un procedimiento para la obtención de un virus de mixoma recombinante atenuado útil en la preparación de vacunas combinadas de autopropagación contra la mixomatosis y otras enfermedades infecciosas de los lepóridos.

  32. 1792.-

    MUELLE NEUMATICO.

    (11/2004)

    Si la altura de un vagón de tren se reduce mediante la reducción de la banda de rodadura de cada rueda y devolviendo el nivel original de cada rueda mediante el incremento de la altura de muelles de gas, la carrera de compresión de la altura de os muelles de gas cambia. Se propone una disposición para mantener constante la carrera de comprensión después de un ajuste de altura. Un tope tiene partes de restricción de movimiento (8b) dispuestas circunferencialmente a intervalos predeterminados para restringir el movimiento descendente del cilindro exterior . El tope está montado giratoriamente sobre el elemento interno . El cilindro exterior tiene superficies a soportar (6a), y segundas superficies (6b) a soportar...

<< · 28 · 42 · 49 · 52 · 54 · < · 56 · > · 59 · 62 · 69 · >>