9 inventos, patentes y modelos de OHMURA, TAKAO

  1. 1.-

    PROCEDIMIENTO PARA LA PURIFICACION DE ALBUMINA DE SUERO RECOMBINANTE.

    (07/2004)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Clasificación: C07K1/22, C07K1/36.

    LA INVENCION SUMINISTRA UN PROCESO PARA PURIFICAR ALBUMINA DEL SUERO HUMANO RECOMBINANTE (RHSA) CALENTANDO UN MEDIO DE CULTIVO QUE CONTIENE RHSA Y LAS CELULAS ANFITRIONAS PRODUCTORAS DE RHSA, EL SUMINISTRO DE LA SOLUCION CALENTADA AL INTERIOR DE UN LECHO FLUIDIZADO EN EL CUAL LAS PARTICULAS ABSORBENTES SON SUSPENDIDAS PARA EFECTUAR CONTACTO CON LAS PARTICULAS ABSORBENTES Y LUEGO RECUPERAR LA FRACCION ABSORBIDA QUE CONTIENE EL RHSA, TAMBIEN SE PRESENTA UNA COMPOSICION QUE COMPRENDE RHSA QUE MUESTRA UNA PROPORCION A350/A280 POR DEBAJO DE 0.015, CUANDO SE FORMULA EN UNA SOLUCION DEL 25% DE DICHA ALBUMINA.

  2. 2.-

    PROMOTOR AOX2 MUTANTE.

    (05/2004)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Clasificación: C12N1/19, C12P21/00, C12N15/81.

    SE PRESENTA UN PROMOTOR DEL AOX2 MUTANTE EN EL QUE ENTRE 1 Y 3 OLIGONUCLEOTIDOS GATAGGCTATTTTTGTCGCATAAAT SE AÑADEN EN LA DIRECCION NORMAL, EN LA DIRECCION INVERSA O AMBAS DIRECCIONES NORMAL E INVERSA EN EL EXTREMO 5'DEL FRAGMENTO DE DNA PARCIAL DE UN PROMOTOR DEL AOX2 DE TIPO NATURAL, UN VECTOR QUE LLEVA DICHO PROMOTOR, UN TRANSFORMANTE EN EL CUAL SE HA INTRODUCIDO DICHO VECTOR Y UN METODO PARA PRODUCIR UNA PROTEINA HETEROLOGA, QUE COMPRENDE EL CULTIVO DE DICHO TRANSFORMANTE. EL PROMOTOR DEL AOX2 MUTANTE DE LA INVENCION TIENE UNA ACTIVIDAD PROMOTORA MARCADAMENTE REFORZADA COMPARADO CON LOS PROMOTORES AOX2 DE TIPO NATURAL. DE ESTA FORMA, EL PROMOTOR DE LA INVENCION ES ALTAMENTE UTILIZABLE COMO PROMOTOR PARA SER LLEVADO POR UN VECTOR CAPAZ DE EXPRESAR UNA PROTEINA HETEROLOGA. EL VECTOR DE LA INVENCION PUEDE EXPRESAR Y PRODUCIR EFICIENTEMENTE DIFERENTES PROTEINAS, UTILES, HETEROLOGAS EN ANFITRIONES.

  3. 3.-

    PROMOTOR AOX2 MUTANTE, VECTOR PORTADOR DEL MISMO, TRANSFORMANTE, Y PRODUCCION DE PROTEINA HETEROLOGA.

    (08/2002)

    LA APLICACION COMPRENDE UN PROMOTOR AOX2 MUTANTE OBTENIDO POR MUTACION DE UNA SECUENCIA DEL PROMOTOR AOX2 NATURAL DE MANERA A COMPRENDER AL MENOS UNO DE LOS TRES MODOS DE UNA REGION QUE SE EXTIENDE CORRIENTE ARRIBA DESDE EL NUCLEOTIDO 1187 INCLUSIVO Y QUE COMPRENDE AL MENOS NUCLEOTIDOS 845-960 SE SUPRIME (A) NUCLEOTIDO(S) SE SUSTITUYE(N) EN (A) REGION(ES) DE NUCLEOTIDOS 1274-1314 Y SE INSERTAN NUEVO(S) NUCLEOTIDA(S) EN (A) REGION(ES) DE NUCLEOTIDOS 1274-1314; VECTORES QUE LLEVAN DICHO PROMOTOR AOX2 MUTANTE; SE HAN INTRODUCIDO TRANSFORMANTES DENTRO DE DICHO VECTOR ; Y METODOS PARA PRODUCIR UNA PROTEINA HETEROLOGA QUE COMPRENDEN...

  4. 4.-

    PROCEDIMIENTO PARA LA PREPARACION DE ALBUMINA SERICA HUMANA RECOMBINANTE.

    (08/2002)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Clasificación: C12N15/14, C07K1/14.

    LA ALBUMINA DEL SUERO HUMANO OBTENIDA MEDIANTE TECNICAS DE MANIPULACION GENETICA SE PUEDE PURIFICAR MEDIANTE UNA COMBINACION DE PASOS ESPECIFICOS EN QUE UN CULTIVO FLOTANTE OBTENIDO DE UN HUESPED PRODUCTOR DE LA ALBUMINA DEL SUERO HUMANO SE SOMETE A UNA ULTRAFILTRACION, A UN TRATAMIENTO DE CALOR, A UN TRATAMIENTO ACIDO Y A OTRA ULTRAFILTRACION SEGUIDO DE TRATAMIENTOS SUBSIGUIENTES CON UN CAMBIADOR DE CATIONES, UN PORTADOR DE UNA CORMATOGRAFIA HIDROFOBICO Y UN CAMBIADOR DE IONES Y DE UNA DESALACION PARA ASI OBTENER UNA FORMA PURA DE ALBUMINA DEL SUERO HUMANO QUE NO CONTENGA SUSTANCIALMENTE CONTAMINANTES PROTEINICOS NI POLISACARIDOS, QUE SE FORMULA EN UNA PREPARACION FARMACEUTICA. ESTE PROCESO HACE QUE SEA POSIBLE PURIFICAR DE MANERA EFICIENTE LA ALBUMINA DEL SUERO HUMANO RECOMBINANTE Y OBTENER UNA ALBUMINA DEL SUERO HUMANO SUSTANCIALMENTE PURA QUE CON CONTIENE SUSTANCIAS RELACIONADAS CON LOS HUESPEDES PRODUCTORES NI OTROS CONTAMINANTES Y NO TIENE SUSTANCIALMENTE COLOR.

  5. 5.-

    METODO PARA SUPRIMIR LA COLORACION DE LA ALBUMINA SERICA HUMANA.

    (02/2001)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Clasificación: C07K14/765, C12P21/02, C12N15/14.

    UN METODO PARA SUPRIMIR LA COLORACION DE LA ALBUMINA DEL SUERO HUMANO EXPRESADO MEDIANTE TECNICA GENETICA, QUE COMPRENDE EL CULTIVO Y/O DEPURACION, EN PRESENCIA DE UN COMPUESTO DE AMINAS, SELECCIONADAS DEL GRUPO FORMADO POR ALQUILAMINAS, DIAMINAS, GUANIDINAS, BENZAMIDINAS, ACIDOS AMINOBASICOS Y ACIDOS AMINOFENILACETICOS. DE CONFORMIDAD CON LA PRESENTE INVENCION, LA COLORACION DE HSA EXPRESADA MEDIANTE TECNICA GENETICA PUEDE SUPRIMIRSE DESDE UN SEGUNDO A UNA DECIMA, SIN TRATAMIENTO PARA LA SUPRESION DE LA COLORACION. ADEMAS, HSA PUEDE RECUPERARSE EN GRANDES PRODUCCIONES, Y EL TRATAMIENTO DE LA INVENCION NO AFECTA A LAS PROPIEDADES INHERENTES DEL HSA.

  6. 6.-

    INHIBICION DE COLORACION DE LA ALBUMINA DEL SUERO HUMANO.

    (12/1998)
    Solicitante/s: THE GREEN CROSS CORPORATION. Clasificación: C07K14/765, C12P21/02.

    UN METODO DE INHIBICION DE LA COLORACION DE LA ALBUMINA DEL SUERO HUMANO EXPRESADO POR LA UTILIZACION DE LA TECNOLOGIA DE LA MANIPULACION DE GENES. DICHO METODO COMPRENDE LA SEPARACION DE LOS CONTAMINANTES COLOREADOS DE DICHA ALBUMINA DEL SUERO HUMANO ANTES QUE DICHOS CONTAMINANTES COLOREADOS CIEGUEN A LA ALBUMINA DEL SUERO HUMANO.

  7. 7.-

    METODO PARA PRODUCIR ALBUMINA DE SUERO HUMANO.

    (08/1997)
    Solicitante/s: THE GREEN CROSS CORPORATION. Clasificación: C12P21/02, C12N15/14, C12N1/16.

    UN METODO PARA PRODUCIR ALBUMINA DE SUERO HUMANO QUE COMPRENDE EL CULTIVO DE UN HUESPED QUE PRODUCE ALBUMINA DE SUERO HUMANO PREPARADO POR INGENIERIA GENETICA, EN UN MEDIO QUE CONTIENE UN ACIDO GRASO CON DE 10 A 26 ATOMOS DE CARBONO O SU SAL, Y UN METODO PARA EL CULTIVO DEL HUESPED. LA PRODUCCION DE ASH SE PUEDE INCREMENTAR ENORMEMENTE MEDIANTE LA PRESENTE INVENCION.

  8. 8.-

    METODO PARA PURIFICAR SERO ALBUMINA HUMANA

    (12/1994)
    Solicitante/s: THE GREEN CROSS CORPORATION. Clasificación: A61K37/02, C07K15/12.

    DICHO METODO COMPRENDE EL TRATAMIENTO POR CALOR DE LA SOLUCION QUE CONTIENE SERO ALBUMINA HUMANA A APROXIMADAMENTE 50 70 C, DURANTE 1 Y/O UN ACIDO CARBOXILICO DE UN ACIDO CARBOXILICO ORGANICO DE 6 - 12 ATOMO DE CARBONO O SAL DEL MISMO.

  9. 9.-

    METODO DE FABRICACION PARA COMPOSICIONES QUE CONTIENEN PROTEINAS.

    (10/1994)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Clasificación: A61L2/00.

    UN METODO PARA FABRICAR UNA COMPOSICION QUE CONTIENE PROTEINAS INACTIVADAS A LOS VIRUS A PARTIR DE UNA COMPOSICION QUE CONTIENE PROTEINAS QUE PUEDEN CONTAMINARSE CON VIRUS. EL METODO DE ACUERDO AL PRESENTE INVENTO PERMITE FABRICAR PREPARACIONES DE PROTEINAS INACTIVADAS A LOS VIRUS FARMACEUTICAMENTE MAS SEGURAS SIN ESTROPEAR LA ACTIVIDAD DE LA PROTEINA.