17 inventos, patentes y modelos de GOLD, LARRY

  1. 1.-

    Métodos de detección usando aptámeros

    (03/2015)

    Un método de detección de una molécula diana que puede estar presente en una muestra de ensayo, método que comprende: (a) poner en contacto una muestra de ensayo con un aptámero que comprende una modificación de pirimidina en la posición 5 y que tiene una afinidad específica por la molécula diana, formándose un complejo de afinidad de aptámero mediante la interacción de un aptámero con su molécula diana, si la molécula diana está presente en dicha muestra de ensayo, en donde un complejo de afinidad de aptámero es un complejo no covalente formado por la interacción de un aptámero con su molécula diana; (b) tras la formación del complejo de afinidad...

  2. 2.-

    Análisis multiplexado de muestras de ensayo

    (03/2015)

    Un método de detección de una molécula diana que puede estar presente en una muestra de ensayo, comprendiendo el método: (a) poner en contacto una muestra de ensayo con un aptámero que tiene una afinidad específica por la molécula diana, formándose un complejo de afinidad de aptámero mediante la interacción de un aptámero con su molécula diana, si dicha molécula diana está presente en dicha muestra de ensayo, en donde un complejo de afinidad de aptámero es un complejo no covalente formado por la interacción de un aptámero con su molécula...

  3. 3.-

    Método para generar aptámeros con tasas de disociación mejoradas

    (03/2015)

    Un método para identificar un aptámero que tiene una tasa de disociación (t1/2) lenta de su molécula diana, en donde el aptámero comprende al menos una pirimidina con una base modificada, comprendiendo el método: (a) poner en contacto una mezcla de candidatos con una molécula diana, en donde los ácidos nucleicos que tienen una mayor afinidad por la molécula diana con respecto a otros ácidos nucleicos de la mezcla de candidatos se unen a la molécula diana, formando complejos ácido nucleico-molécula diana y en donde la mezcla de candidatos comprende ácidos nucleicos modificados en los que una, varias o todas las pirimidinas en al menos uno, o cada uno, de los ácidos nucleicos de la mezcla...

  4. 4.-

    Aptámeros con uridinas 5-(N-naftil)-sustituidas

    (01/2015)

    Un aptámero oligonucleótido que comprende al menos un nucleótido de uridina de base modificada, teniendo el nucleótido de uridina de base modificada la siguiente estructura:**Fórmula** y Z ≥ R más grupo conector (CH2)n, donde n ≥ 1, 2 o 3, y**Fórmula**

  5. 5.-

    Complejos de ligandos de ácidos nucleicos de factor de crecimiento derivado de plaquetas (PDGF)

    (10/2013)

    Un complejo constituido por un compuesto de alto peso molecular no inmunogénico y un ligando deácido nucleico que se une específicamente a PDGF, en el que el ligando de ácido nucleico es monocatenario ycomprende la secuencia:**Fórmula** en la que A, C, G, T ≥ desoxi-A, C, G, T; A,G ≥ 2'OMe-A,G; y C,U ≥ 2'-F-C,U.

  6. 6.-

    LIGANDOS DE ÁCIDO NUCLEICO QUE SE UNEN A ADN POLIMERASAS Y LAS INHIBEN

    (05/2011)

    Ligando de ácido nucleico para una ADN polimerasa termoestable, en el que el ligando de ácido nucleico se une a dicha polimerasa e inhibe a la misma a temperaturas ambientes, aunque permite que la polimerasa se active a temperaturas elevadas

  7. 7.-

    LIGANDOS DE ÁCIDO NUCLEICO INHIBIDORES DE LAS ADN POLIMERASAS

    (12/2010)

    Un ácido nucleico, en el que la secuencia de nucleótidos del ácido nucleico: (i) es la secuencia de nucleótidos primaria de una de la SEC DE ID Nº: 89, SEC DE ID Nº: 90, SEC DE ID Nº: 91, SEC DE ID Nº: 92, SEC DE ID Nº: 93, SEC DE ID Nº: 94, SEC DE ID Nº: 95, SEC DE ID Nº: 107, SEC DE ID Nº: 108, SEC DE ID Nº: 110, SEC DE ID Nº: 111, SEC DE ID Nº: 113, SEC DE ID Nº: 114, SEC DE ID Nº: 116, SEC DE ID Nº: 117, SEC DE ID Nº: 118, o (ii) tiene una homología superior al 80% de la secuencia primaria con una de dichas SEC DE ID Nos de (i), o (iii) tiene la secuencia de nucleótidos complementaria correspondiente a una secuencia de (i) o (ii)

  8. 8.-

    LIGANDOS DE ACIDO NUCLEICO DE AFINIDAD ELEVADA DE LA PROTEINA C5 DEL SISTEMA DE COMPLEMENTO

    (09/2010)

    Ligando de ácido nucleico que se une específicamente y con afinidad elevada a la proteína C5 del Sistema de Complemento y que es un inhibidor de la división de la proteína C5 en C5a y c5b, en el que dicho ligando comprende la secuencia: CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG o una secuencia que tiene un grado de homología primaria de secuencia superior a un 80%

  9. 9.-

    COMPLEJOS DE LIGANDOS DE ACIDO NUCLEICO

    (04/2010)

    ESTA INVENCION DESCRIBE UN PROCEDIMIENTO PARA PREPARAR UN COMPLEJO TERAPEUTICO O DE DIAGNOSTICO FORMADO POR UN LIGANDO DE ACIDO NUCLEICO Y UN COMPUESTO LIPOFILO O UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO, MEDIANTE LA IDENTIFICACION DE UN LIGANDO DE ACIDO NUCLEICO POR LA METODOLOGIA SELEX Y LA ASOCIACION DEL LIGANDO DE ACIDO NUCLEICO CON UN COMPUESTO LIPOFILO O UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO. LA INVENCION ADEMAS DESCRIBE COMPLEJOS FORMADOS POR UNO O MAS LIGANDOS DE ACIDO NUCLEICO ASOCIADOS CON UN COMPUESTO LIPOFILO O CON UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO

  10. 10.-

    LIGANDOS DE ACIDO NUCLEICO QUE SE UNEN A LAS ADN POLIMERASAS Y LAS INHIBEN

    (06/2009)
    Ver ilustración. Solicitante/s: NEXSTAR PHARMACEUTICALS, INC.. Clasificación: C12Q1/68, C07H21/04, C12P19/34.

    ESTA INVENCION PRESENTA LIGANDOS DE OLIGONUCLEOTIDOS DE ALTA AFINIDAD POR LA POLIMERASA TAQ TERMOESTABLE Y LA POLIMERASA TTH. ESPECIFICAMENTE, ESTA INVENCION PRESENTA LIGANDOS DE ADN CON CAPACIDAD PARA UNIRSE A LAS POLIMERASAS TAQ Y TTH Y LOS METODOS PARA OBTENER DICHOS LIGANDOS. LOS LIGANDOS SON CAPACES DE INHIBIR LAS POLIMERASAS A TEMPERATURA AMBIENTAL.

  11. 11.-

    LIGANDOS DE ACIDO NUCLEICO DE LA TENASCINA-C

    (02/2009)
    Ver ilustración. Solicitante/s: GILEAD SCIENCES, INC.. Clasificación: C12Q1/68, C07H21/02, C07H21/04, C12P19/34.

    Complejo que comprende un ligando de ácido nucleico para tenascina-C, donde (a) dicho ligando se selecciona del grupo que consiste en las secuencias indicadas en las SEC ID Nº: 4-64; (b) dicho ligando tiene una homología mayor del 70% y tiene sustancialmente la misma capacidad de unirse a tenascina-C que un ligando según (a); o (c) dicho ligando tiene sustancialmente la misma estructura que la que se postula usando RMN o por alineación de secuencias usando el programa Zukerfold y tiene sustancialmente la misma capacidad de unirse a la tenascina-C que un ligando según (a); y un marcador.

  12. 12.-

    PROCEDIMIENTO PARA IDENTIFICAR LIGANDOS DE ACIDO NUCLEICO PARA DIANAS TISULARES

    (01/2009)

    Procedimiento para identificar ligandos de ácido nucleico y secuencias de ligandos de ácido nucleico para una diana que es una diana tisular seleccionada del grupo que consiste en un conjunto de tipos de células; un agregado heterogéneo de macromoléculas; y un agregado heterogéneo de células, comprendiendo dicho procedimiento: (a) preparar una mezcla de secuencias de ácidos nucleicos candidatos; (b) poner en contacto dicha mezcla de ácidos nucleicos candidatos con dicha diana, donde los ácidos nucleicos que tienen una mayor afinidad por la diana con respecto a la mezcla candidata se pueden separar del resto de la mezcla candidata; (c) separar los ácidos nucleicos de mayor afinidad del resto de la mezcla candidata; y (d) amplificar...

  13. 13.-

    LIGANDOS DE OLIGONUCLEOTIDOS DE ALTA AFINIDAD A PDGF.

    (06/2007)
    Solicitante/s: NEXSTAR PHARMACEUTICALS, INC.. Clasificación: C12Q1/68, C12P19/34.

    SE DESCRIBEN METODOS PARA LA IDENTIFICACION Y PREPARACION DE LIGANDOS DE ACIDO NUCLEICO DE ELEVADA AFINIDAD POR TGF BE}, PDGF Y HKGF. SE INCLUYEN EN LA INVENCION LIGANDOS DE RNA Y SSDNA ESPECIFICOS PARA TGF BE}1 Y PDGF IDENTIFICADOS MEDIANTE EL METODO SELEX. SE INCLUYEN ASIMISMO EN LA INVENCION LIGANDOS DE RNA ESPECIFICOS A HKGF IDENTIFICADOS MEDIANTE EL METODO SELEX. SE INCLUYEN ADICIONALMENTE LIGANDOS DE RNA QUE INHIBEN LA INTERACCION DE TGF BE}1 Y HKGF CON SUS RECEPTORES Y LIGANDOS DE DNA QUE INHIBEN LA INTERACCION DE PDGF CON SU RECEPTOR.

  14. 14.-

    PROCEDIMIENTOS DE USO DE LIGANDOS DE ACIDO NUCLEICO.

    (10/2006)
    Solicitante/s: NEXSTAR PHARMACEUTICALS, INC.. Clasificación: C07H21/00, C12Q1/68, C12P19/34.

    UN ACIDO NUCLEICO QUE OCURRE DE FORMA NO NATURAL QUE TIENE UNA AFINIDAD DE UNION ESPECIFICA O FUNCION CATALITICA PARA UNA MOLECULA DIANA, DICHA MOLECULA DIANA SIENDO DIFERENTE A UN POLINUCLEOTIDO QUE SE UNE A DICHO ACIDO NUCLEICO A TRAVES DE UN MECANISMO QUE DEPENDE PREDOMINANTEMENTE DE UN EMPAREJAMIENTO DE BASE DE WATSON/CRICK O UNION DE TRIPLE HELICE Y DICHO ACIDO NUCLEICO NO SIENDO UN ACIDO CONOCIDO DE UNION A UNA PROTEINA DIANA DE UNION A ACIDO NUCLEICO QUE OCURRE DE FORMA NATURAL.

  15. 15.-

    COMPLEJOS DE LIGANDO DE ACIDO NUCLEICO DE FACTOR DE CRECIMIENTO ENDOTELIAL VASCULAR (VEGF).

    (09/2006)
    Solicitante/s: NEXSTAR PHARMACEUTICALS, INC.. Clasificación: A61K31/70, C12Q1/68, A61K47/48, C07H21/02, C07H21/04, C12P19/34.

    ESTA INVENCION SE REFIERE A UN PROCEDIMIENTO PARA PREPARAR UN COMPLEJO QUE COMPRENDE UN LIGANDO DE ACIDO NUCLEICO DE VEGF Y UN COMPUESTO NO INMUNOGENO DE BASE MOLECULAR ALTA O UN COMPUESTO LIPOFILO, IDENTIFICANDO UN LIGANDO DE ACIDO NUCLEICO VEGF MEDIANTE LA METODOLOGIA DE SELEX Y ASOCIANDO EL LIGANDO DE ACIDO NUCLEICO VEGF CON UN COMPUESTO DE PESO MOLECULAR ELEVADO, NO INMUNOGENICO O UN COMPUESTO LIPOFILICO. ESTA INVENCION SE REFIERE ADEMAS A UNOS COMPLEJOS QUE COMPRENDEN UNO O MAS LIGANDOS DE ACIDO NUCLEICO VEGF EN ASOCIACION CON UN COMPUESTO DE PESO MOLECULAR ALTO, NO INMUNOGENICO O UN COMPUESTO LIPOFILICO. ESTA INVENCION INCLUYE TAMBIEN UN ELEMENTO LIPIDO QUE COMPRENDE UN COMPLEJO O LIGANDO DE ACIDO NUCLEICO VEGF Y PROCEDIMIENTOS PARA SU FABRICACION.

  16. 16.-

    CONJUGADOS CONSTITUIDOS POR COMPLEJOS METALICOS Y OLIGONUCLEOTIDOS.

    (12/2004)
    Solicitante/s: SCHERING AKTIENGESELLSCHAFT NEXSTAR PHARMACEUTICALS, INC. Clasificación: A61K41/00, A61K51/04.

    ESTA INVENCION SE REFIERE A CONJUGADOS DE OLIGONUCLEOTIDOS MODIFICADOS QUIMICAMENTE QUE CONTIENEN UN AGENTE DE COMPLEJO O UN COMPLEJO QUE SE UNE POR UN ELEMENTO DE CONEXION A LOS OLIGONUCLEOTIDOS. EN ESTE CASO, LOS OLIGONUCLEOTIDOS SE MODIFICAN EN UNA FORMA QUE EVITA O AL MENOS INHIBE DE FORMA SIGNIFICATIVA LA DEGRADACION POR LAS NUCLEASAS QUE SE PRODUCEN NATURALMENTE. EL RADICAL OLIGONUCLEOTIDO PUEDE UNIRSE ESPECIFICAMENTE Y CON ALTA AFINIDAD DE ENLACE A ESTRUCTURAS DE DESTINO Y POR TANTO PUEDE PRODUCIR UN EFECTO DIAGNOSTICO O TERAPEUTICO ESPECIFICO MEDIANTE EL AGENTE DE COMPLEJO DE UNION O COMPLEJO DE UNION.

  17. 17.-

    LIGANDOS DE ACIDOS NUCLEICOS.

    (02/1998)
    Solicitante/s: NEXSTAR PHARMACEUTICALS, INC.. Clasificación: C12Q1/68, G01N33/566, G01N33/48, C12P19/34, C07H15/12.

    UNA NUEVA CLASE DE COMPUESTOS DE ACIDO NUCLEICO, LLAMADOS ANTICUERPOS DE ACIDO NUCLEICO, HAN DEMOSTRADO EXISTIR Y TENER UNA AFINIDAD DE ENLACE ESPECIFICA A LOS BLANCOS MOLECULARES TRIDIMENSIONALES. EN UN ASPECTO PREFERENTE DE LA INVENCION, LOS COMPONENTES DE LIGANDOS DE LOS ANTICUERPOS DE ACIDO NUCLEICO SE HAN IDENTIFICADO MEDIANTE EL METODO DE LA INVENCION DENOMINADO EVOLUCION SISTEMATICA DE LIGANDOS MEDIANTE ENRIQUECIMIENTO DEL EXPONENCIAL (SELEX), EN DONDE UNA MEZCLA CANDIDATA DE ACIDOS NUCLEICOS SE HA ENRIQUECIDO ITERATIVAMENTE EN ACIDOS NUCLEICOS DE GRAN AFINIDAD Y AMPLIFICADO PARA UNA MAYOR SEPARACION.