82 patentes, modelos y diseños de YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.

  1. 1.-

    COMPOSICIONES MEDICINALES QUE CONTIENEN 2-AMINO-2-(2-(4-OCTILFENIL)ETIL)PROPANO-1,3-DIOL.SP

    (07/2009)
    Ver ilustración. Inventor/es: SAKAI,ATSUSHI,YOSHITOMI PHARMA. INDUSTRIES LTD, MASUDA,RUMIKO,YOSHITOMI PHARMA. INDUSTRIES LTD, FUJII,TSUNEO,YOSHITOMI PHARMA. INDUSTRIES,LTD, MISHINA,TADASHI,YOSHITOMI PHARMA. IND. LTD, CHIBA,KENJI,YOSHITOMI PHARMA. INDUSTRIES,LTD. Clasificación: A61K31/135, A61K47/26, A61K9/08, A61K47/40.

    Una composición farmacéutica que comprende 2-amino-2-[2-(4-octilfenil)etil]propano-1,3-diol o una de sus sales de adición de ácido farmacéuticamente aceptable como ingrediente activo y ciclodextrina como estabilizante.

  2. 2.-

    PROCEDIMIENTO PARA PRODUCIR PROTEINAS FORANEAS.

    (06/2006)
    Inventor/es: OHDA, TOYOO YOSHITOMI PHARMACEUTICAL IND. LTD, OHYA, TOMOSHI YOSHITOMI PHARMACEUTICAL IND. LTD., KUWAE,SHINOBU YOSHITOMI PHARMACEUTICAL IND. LTD, OHYAMA, MASAO YOSHITOMI PHARMACEUTICAL IND. LTD, KOBAYASHI, KAORU YOSHITOMI PHARMACEUTICAL IND. LTD, UEMURA, YAHIRO YOSHITOMI PHARMACEUTICAL IND. LTD. Clasificación: C12P21/00.

    Un método de producción de HSA (albúmina sérica humana), que comprende cultivar una levadura preparada mediante manipulación genética, en un medio que contiene un ácido graso o una sal del mismo y un tensioactivo a una concentración de no más de 0, 5 g/l, y recoger la HSA del cultivo.

  3. 3.-

    COMPUESTOS DE PIPERAZINA Y SU USO MEDICINAL.

    (08/2005)

    Un compuesto de piperazina de fórmula en la que R1 y R2 son iguales o distintos y es cada uno hidrógeno, halógeno, alquilo C1-C4, alcoxi C1-C4, amino, amino mono- o disustituido con un grupo seleccionado del grupo consistente en alquilo C1-C4, alcanoilo C1-C4, (alcoxi C1-C4)carbonilo y alcanoilo C1-C4 sustituido con fenilo; nitro, hidroxi o ciano; R3, R4 y R5 son iguales o distintos y es cada uno hidrógeno, halógeno, alquilo C1-C4, alcoxi C1-C4, nitro, amino, hidroxi o amino mono- o disustituido con un grupo seleccionado del...

  4. 4.-

    COMPUESTOS DE 2-AMINOPROPANO-1,3-DIOL , SU USO MEDICO, E INTERMEDIOS PARA SINTETIZARLOS.

    (03/2005)
    Ver ilustración. Inventor/es: FUJITA, TETSURO, ADACHI, KUNITOMO YOSHITOMI PHARM. INDUSTRIES,, AOKI, YOSHIYUKI YOSHITOMI PHARM. INDUSTRIES, LTD., HANANO, TOKUSHI YOSHITOMI PHARM. INDUSTRIES, LTD., TESHIMA, KOJI YOSHITOMI PHARM. INDUSTRIES, LTD.,, HOSHINO, YUKIO YOSHITOMI PHARM. INDUSTRIES, LTD. Clasificación: A61K31/135, C07C225/16, C07C223/02, C07C215/34.

    La presente invención se refiere a un compuesto de fórmula general *fórmula * en la que R{sup,1}, R{sup,2}, R{sup,3} y R{sup,4} son, cada uno, un hidrógeno o un acilo, una de sus sales de adición ácida farmacéuticamente aceptables o uno de sus hidratos; un producto farmacéutico que comprende este compuesto; una composición farmacéutica que comprende este compuesto y un vehículo farmacéuticamente aceptable; y 2-amino-2-{(}2-{(}4-{(}1-hidroxi-5-fenilpentil{)}fenil{)}etil{)}propano-1 ,3-diol o 2-amino-2-{(}2-{(}4-formilfenil{)}etil{)}propano-1 ,3-diol, los derivados de los dos compuestos cuyo/s grupo amino y/o grupo hidroxi está/n protegidos o una de sus sales. El compuesto de la presente invención presenta una acción inmunosupresora mayor con una menor toxicidad y una mayor seguridad y se utiliza como medicamento para prevenir o suprimir el rechazo de órganos o médula ósea transplantados, o como medicamento para prevenir o tratar diversas enfermedades autoinmunitarias o alérgicas.

  5. 5.-

    PROCEDIMIENTO PARA LA PURIFICACION DE ALBUMINA DE SUERO RECOMBINANTE.

    (07/2004)
    Inventor/es: NODA, MUNEHIRO, SUMI, AKINORI, OHMURA, TAKAO, YOKOYAMA, KAZUMASA. Clasificación: C07K1/22, C07K1/36.

    LA INVENCION SUMINISTRA UN PROCESO PARA PURIFICAR ALBUMINA DEL SUERO HUMANO RECOMBINANTE (RHSA) CALENTANDO UN MEDIO DE CULTIVO QUE CONTIENE RHSA Y LAS CELULAS ANFITRIONAS PRODUCTORAS DE RHSA, EL SUMINISTRO DE LA SOLUCION CALENTADA AL INTERIOR DE UN LECHO FLUIDIZADO EN EL CUAL LAS PARTICULAS ABSORBENTES SON SUSPENDIDAS PARA EFECTUAR CONTACTO CON LAS PARTICULAS ABSORBENTES Y LUEGO RECUPERAR LA FRACCION ABSORBIDA QUE CONTIENE EL RHSA, TAMBIEN SE PRESENTA UNA COMPOSICION QUE COMPRENDE RHSA QUE MUESTRA UNA PROPORCION A350/A280 POR DEBAJO DE 0.015, CUANDO SE FORMULA EN UNA SOLUCION DEL 25% DE DICHA ALBUMINA.

  6. 6.-

    COMPUESTO DE INCLUSION DE UN COMPLEJO METALOPORFIRINICO EN ALBUMINA Y COMPOSICION PORTADORA DE OXIGENO QUE LO CONTIENE.

    (07/2004)
    Inventor/es: EISHUN, TSUCHIDA, HIROYUKI, NISHIDE, TERUYUKI, KOMATSU. Clasificación: A61K47/48, A61K9/14.

    SE PRESENTA UN COMPUESTO DE INCLUSION DE COMPLEJO DE METAL DE FORFIRINA-ALBUMINA EN EL QUE UN COMPLEJO DE METAL DE FORFIRINA QUE COMPRENDA, COMO METAL CENTRAL, COORDINADO, UN METAL TRANSICIONAL QUE PERTENECE AL PERIODO CUARTO O QUINTO DE LA TABLA PERIODICA, ESTA INCLUIDO EN LA ALBUMINA, TAMBIEN SE PRESENTA UNA COMPOSICION PORTADORA DE OXIGENO QUE COMPRENDE EL COMPUESTO DE INCLUSION COMO INGREDIENTE ACTIVO. EL COMPUESTO FUNCIONA COMO UN PORTADOR DEL OXIGENO QUE ES SUPERIOR EN BIOCOMPATIBILIDAD, CAPAZ DE LA ABSORCION Y DESABSORCION DEL OXIGENO BAJO CONDICIONES FISIOLOGICAS Y ES BASTANTE FACIL DE PRODUCIR A ESCALA INDUSTRIAL.

  7. 7.-

    FARMACOS PARA PROFILAXIS/TRATAMIENTO DE LAS COMPLICACIONES DE LA DIABETES.

    (07/2004)
    Inventor/es: HAYASHI, YOSHIHARU YOSHITOMI PHARM. IND., LTD., GOTO, NOBUHARU YOSHITOMI PHARMACEUTICAL IND., LTD. Clasificación: A61K31/415, C07D521/00, C07D233/60.

    LA INVENCION SE REFIERE A PREVENTIVOS/REMEDIOS PARA COMPLICACIONES DE LA DIABETES, QUE CONTIENEN COMO INGREDIENTE ACTIVO ACIDO 4 - [ AL - HIDROXI - 2 - METIL - 5 - (1 IMIDAZOLIL)BENCIL] - 3, 5 - DIMETILBENZOICO, ISOMEROS OPTICOS DEL MISMO O SUS SALES FARMACEUTICAMENTE ACEPTABLES; Y UN METODO PARA PREVENIR O TRATAR LAS COMPLICACIONES DE LA DIABETES MEDIANTE LA ADMINISTRACION DE LOS COMPUESTOS DESCRITOS EN DOSIS EFICACES. DICHOS MEDICAMENTOS SON UTILES PARA LA PREVENCION Y TRATAMIENTO DE COMPLICACIONES DE LA DIABETES, COMO NEUROPATIA DIABETICA, NEFROPATIA, ALTERACIONES OCULARES Y ESCLEROSIS ARTERIAL. ADEMAS, PUEDEN PRESENTAR EFECTOS DE LARGA DURACION, INCLUSO EN UNA DOSIS EXTREMADAMENTE PEQUEÑA, LO CUAL HACE POSIBLE TOMAR LOS MEDICAMENTOS SOLO UNA VEZ AL DIA.

  8. 8.-

    COMPUESTO DE BENZAMIDA Y SU USO MEDICINAL.

    (06/2004)

    COMPUESTOS DE BENZAMIDA DE LA FORMULA EN DONDE CADA SIMBOLO ESTA DEFINIDO EN LA ESPECIFICACION, ISOMEROS DE LOS MISMOS Y SALES DE ADICION ACIDA FARMACEUTICAMENTE ACEPTABLES DE LOS MISMOS. COMPOSICIONES FARMACEUTICAS COMPRENDEN UNA CANTIDAD EFECTICA TERAPEUTICAMENTE DE ESTE COMPUESTO Y UN ADITIVO FARMACEUTICAMENTE ACEPTABLE, Y AGENTES TERAPEUTICOS PARA LA HIPERTENSION, AGENTES TERAPEUTICOS PARA LA ANGINA DE PECHO, AGENTE TERAPEUTICO PARA EL ASMA, AGENTES TERAPEUTICOS PARA LA CIRCULACION RENAL Y PERIFERICA Y UN INHIBIDOR DEL VASOPASMO CEREBRAL QUE CONTIENE ESTE COMPUESTO.EL...

  9. 9.-

    PROCEDIMIENTO PARA PRODUCIR COMPUESTOS DE IMIDAZOL OPTICAMENTE ACTIVOS, INTERMEDIOS EN SU SINTESIS Y PROCEDIMIENTO DE PREPARACION.

    (06/2004)
    Inventor/es: KAWASAKI, KAZUYUKI;, YOSHITOMI PHARM. INDUS. LTD., KOBAYASHI, HARUHITO;, YOSHITOMI PHARM. INDUS. LTD, EHARA, SYUJI;, YOSHITOMI PHARMACEUTICAL IND. LTD, SATO, HIDEAKI;, YOSHITOMI PHARMACEUTICAL IND. LTD. Clasificación: C07D233/60.

    La presente invención proporciona un procedimiento para la producción de un ácido 4-[{al}-hidroxi-5-(1-imidazolil)-2-metilbencil]-3 ,5- dimetilbenzoico ópticamente activo o una de sus sales farmacéuticamente aceptables, que incluye someter un compuesto de fórmula (I) * fórmula * en la cual cada símbolo significa según se ha definido en la especificación, a resolución óptica mediante cristalización fracción para dar un compuesto ópticamente activo y se somete el compuesto a una reacción de hidrólisis. Según este procedimiento, puede obtenerse un procedimiento de resolución útil para producción industrial a gran escala del compuesto ácido 4-[{al}-hidroxi-5-(1-imidazolil)-2- metilbencil]-3,5-dimetilbenzoico ópticamente activo, que se utiliza como inhibidor de la tromboxano sintetasa y como agente para la profilaxis y tratamiento de complicaciones diabéticas.

  10. 10.-

    PROMOTOR AOX2 MUTANTE.

    (05/2004)
    Inventor/es: OHMURA, TAKAO, OHI, HIDEYUKI, MIURA, MASAMI, HIRAMATSU, RYUJI. Clasificación: C12N1/19, C12P21/00, C12N15/81.

    SE PRESENTA UN PROMOTOR DEL AOX2 MUTANTE EN EL QUE ENTRE 1 Y 3 OLIGONUCLEOTIDOS GATAGGCTATTTTTGTCGCATAAAT SE AÑADEN EN LA DIRECCION NORMAL, EN LA DIRECCION INVERSA O AMBAS DIRECCIONES NORMAL E INVERSA EN EL EXTREMO 5'DEL FRAGMENTO DE DNA PARCIAL DE UN PROMOTOR DEL AOX2 DE TIPO NATURAL, UN VECTOR QUE LLEVA DICHO PROMOTOR, UN TRANSFORMANTE EN EL CUAL SE HA INTRODUCIDO DICHO VECTOR Y UN METODO PARA PRODUCIR UNA PROTEINA HETEROLOGA, QUE COMPRENDE EL CULTIVO DE DICHO TRANSFORMANTE. EL PROMOTOR DEL AOX2 MUTANTE DE LA INVENCION TIENE UNA ACTIVIDAD PROMOTORA MARCADAMENTE REFORZADA COMPARADO CON LOS PROMOTORES AOX2 DE TIPO NATURAL. DE ESTA FORMA, EL PROMOTOR DE LA INVENCION ES ALTAMENTE UTILIZABLE COMO PROMOTOR PARA SER LLEVADO POR UN VECTOR CAPAZ DE EXPRESAR UNA PROTEINA HETEROLOGA. EL VECTOR DE LA INVENCION PUEDE EXPRESAR Y PRODUCIR EFICIENTEMENTE DIFERENTES PROTEINAS, UTILES, HETEROLOGAS EN ANFITRIONES.

  11. 11.-

    PROCEDIMIENTO PARA PRODUCIR PROTEINAS.

    (09/2003)
    Inventor/es: KOBAYASHI, KAORU THE GREEN CROSS CORPORATION, TOMOMITSU, KENJI THE GREEN CROSS CORPORATION, KUWAE, SHINOBU THE GREEN CROSS CORPORATION, OHYA, TOMOSHI THE GREEN CROSS CORPORATION, OHDA, TOYOO THE GREEN CROSS CORPORATION, OHMURA, TAKAO THE GREEN CROSS CORPORATION. Clasificación: C12N15/12, C12N1/19, C12P21/00.

    UN PROCESO PARA PRODUCIR UNA PROTEINA, CULTIVANDO CELULAS HUESPED CAPACES DE EXPRESAR LA PROTEINA DIANA MEDIANTE UN CULTIVO DE ALIMENTACION, EN EL QUE EL INDICE DE CRECIMIENTO ESPECIFICO DE LAS CELULAS HUESPED SE CAMBIA DEL VALOR INICIAL A UN VALOR DADO, VARIANDO CONTINUAMENTE EL INDICE DE ADICION DEL SUBSTRATO QUE CONTROLA EL CRECIMIENTO DE LAS CELULAS HUESPED EN EL MEDIO DE CULTIVO. EL MODO DE VARIACION DEL INDICE DE ADICION, DE ACUERDO CON LA INVENCION, PUEDE CONSEGUIR PAUTAS OPTIMAS DE INDICE DE CRECIMIENTO ESPECIFICO E INDICE DE PRODUCCION ESPECIFICO, DIRIGIDO A OPTIMIZAR EL SISTEMA DE CULTIVO DE ALIMENTACION. COMO RESULTADO, ES POSIBLE LLEVAR A CABO UN CULTIVO DE ALTA DENSIDAD DE CELULAS HUESPED MEDIANTE UN CULTIVO DE ALIMENTACION, Y PRODUCIR PROTEINAS DESEADAS EFICAZMENTE EN POCO TIEMPO.

  12. 12.-

    CELULAS HUESPED DE LEVADURAS TRANSFORMADAS DE FORMA ESTABLE Y SU UTILIZACION PARALA PRODUCCION DE ALBUMINA.

    (07/2003)

    SE PRESENTA UN PLASMIDO PARA UN ANFRITRION DE LEVADURA, COMPRENDIENDO EL MISMO, EN SECUENCIA: UN PROMOTOR DERIVADO DE UNA LEVADURA, UNA ZONA CODIFICANTE DE ALBUMINA SITUADA BAJO EL CONTROL DEL PROMOTOR DERIVADO DE LA LEVADURA, UN FINALIZADOR DE TRANSCRIPCION Y UNA SECUENCIA HOMOLOGA A UNA PARTE DE LA SECUENCIA CROMOSOMICA DEL ANFRITRION DE LEVADURA DE TAL FORMA QUE EL PLASMIDO SEA CAPAZ DE INTEGRARSE DENTRO DEL CROMOSOMA DE LA CELULA ANFRITRIONA DE LEVADURA Y EN LA CUAL EL PLASMIDO SEA CAPAZ DE DUPLICACION AUTONOMA EN CELULAS DE LEVADURA; TAMBIEN SE PRESENTA UN ANFRITRION...

  13. 13.-

    ENVASE DE INFUSION, PREPARACION DE INFUSION Y PREPARACION DE INFUSION ALTA EN CALORIAS CON VITAMINAS.

    (07/2003)
    Inventor/es: KIDO, TAKAE THE GREEN CROSS CORPORATION, KODAIRA, HIDETO THE GREEN CROSS CORPORATION, MUNECHIKA, KOJI THE GREEN CROSS CORPORATION, II, SHIGEO THE GREEN CROSS CORPORATION, ABE, SHUNICHI THE GREEN CROSS CORPORATION, YOKOYAMA, KAZUMASA THE GREEN CROSS CORPORATION. Clasificación: A61K9/00, A61K45/06, A61J1/00.

    UN CONTENEDOR DE TRANSFUSION UTIL PARA PREPARAR UNA TRANSFUSION QUE CONTIENE SACARIDOS, AMINOACIDOS, ELECTROLITOS, EMULSION GRASA Y VITAMINAS. EL CONTENEDOR ESTA COMPUESTO DE DOS COMPARTIMENTOS CON UN MECANISMO DE PARTICION PROVISTO EN LOS MISMOS, Y UN PRIMER COMPARTIMENTO CONTIENE UNA TRANSFUSION QUE CONTIENE UNA EMULSION GRASA, SACARIDOS Y VITAMINA ESPECIFICADA, MIENTRAS QUE UN SEGUNDO COMPARTIMENTO CONTIENE UNA TRANSFUSION QUE CONTIENE AMINOACIDOS, ELECTROLITOS Y OTRAS VITAMINAS ESPECIFICADAS. UNA PREPARACION DE TRANSFUSION QUE CONTIENE SACARIDOS, AMINOACIDOS, ELECTROLITOS, EMULSION GRASA Y VITAMINAS QUE PUEDE PREPARARSE FACIL Y ASEPTICAMENTE MEDIANTE LA EXTRACCION DEL MECANISMO DE PARTICION ANTES DE USAR Y MEZCLAR LAS TRANSFUSIONES CONTENIDAS EN LOS DOS COMPARTIMENTOS.

  14. 14.-

    RECIPIENTE RELLENO CON LIQUIDOS DE INFUSION.

    (07/2003)
    Inventor/es: YOKOYAMA, KAZUMASA, INOUE, TADAAKI, KODAIRA, HIDETO, NAWA, YOSHIHITO, MURASHIMA, RYOICHIRO, ABE, SHUNICHI. Clasificación: A61K9/00, A61J1/00, A61K33/30, A23L1/48.

    SE MUESTRA UNA PREPARACION EN INFUSION PARA SU USO EN EL SUMINISTRO DE NUTRIENTES. ESTA COMPOSICION INCLUYE UN AZUCAR, AMINOACIDOS, ELECTROLITOS Y UNA EMULSION GRASA. TIENE UNA GRAN CAPACIDAD DE DURACION SIN PRECIPITACION NI DESNATURALIZACION A PESAR DE LA PRESENCIA SIMULTANEA DE ESTOS COMPONENTES. TAMBIEN SE PRESENTA UN CONTENEDOR LLENO CON LOS LIQUIDOS DE INFUSION QUE CONSTA DE DOS COMPARTIMENTOS DIVIDIDOS POR UN MECANISMO DE SEPARACION. EL PRIMER COMPARTIMENTO CONTIENE UNA INFUSION LIQUIDA DE LA EMULSION GRASA Y UN AZUCAR Y EL SEGUNDO COMPARTIMENTO CONTIENE UNA INFUSION LIQUIDA QUE CONTIENE AMINOACIDOS Y ELECTROLITOS. SE MUESTRA TAMBIEN UNA PREPARACION DE LA INFUSION QUE CONSTA DE EMULSION GRASA Y UN AZUCAR Y DE OTRA INFUSION QUE CONTIENE AMINOACIDOS Y ELECTROLITOS. SE PUEDE OBTENER UNA PREPARACION DE LA INFUSION QUE CONTIENE UN AZUCAR, AMINOACIDOS, ELECTROLITOS Y UNA EMULSION GRASA DE FORMA FACIL Y ASEPTICA MOVIENDO SIMPLEMENTE EL DISPOSITIVO DE SEPARACION Y MEZCLANDO LOS DOS LIQUIDOS DE INFUSION.

  15. 15.-

    COMPUESTOS DE TIENOTRIAZOLODIAZEPINA Y USOS MEDICINALES DE LOS MISMOS.

    (03/2003)
    Inventor/es: SUEOKA, HIROYUKI, YOSHITOMI PHARM. IND. LTD., KOMATSU, HIROTSUGU, YOSHITOMI PHARM. IND. LTD., KOBAYASHI, HARUHITO, YOSHITOMI PHARM. IND. LTD., EHARA, SYUJI, YOSHITOMI PHARM. IND. LTD. Clasificación: A61K31/55, C07D495/14.

    Compuestos de tienotriazoldiazepina de fórmula (I) *fórmula * en la que cada símbolo es tal y como se define en la memoria, sus sales o hidratos farmacéuticamente aceptables y agentes farmacéuticos que los contienen, una sal o un hidrato farmacéuticamente aceptable de los mismos. Se utiliza un agente farmacéutico que contiene el compuesto de la invención como agente terapéutico, un medicamento preventivo o un medicamento preventivo de recurrencia para las enfermedades intestinales inflamatorias causadas por adhesión celular, como por ejemplo colitis y enfermedad de Crohn. Además, el compuesto de la invención se puede utilizar para prevenir y tratar la insuficiencia venosa y la úlcera venosa o remitir ambas. Además, como la máxima toxicidad del compuesto de la invención se ha establecido mediante experimentos utilizando animales, el compuesto se utiliza como producto farmacéutico que ofrece gran seguridad.

  16. 16.-

    PREPARACION DE INFUSION.

    (03/2003)

    SE PRESENTA UNA PREPARACION DE UNA INFUSION PARA UTILIZARLA COMO SUMINISTRO NUTRIENTE. CONTIENE UN AZUCAR, AMINOACIDOS, ELECTROLITOS Y UNA EMULSION GRASA. TIENE UNA DURACION DE CONSERVACION EXCELENTE SIN CAUSAR LA PRECIPITACION, DESNATURALIZACION Y SIMILARES A PESAR DE LA PRESENCIA SIMULTANEA DE ESTOS COMPUESTOS. TAMBIEN SE PRESENTA UN CONTENEDOR RELLENADO CON LOS LIQUIDOS DE LA INFUSION QUE CONTIENE UN PRIMER Y SEGUNDO COMPARTIMIENTOS SEPARADOS ENTRE SI MEDIANTE UNOS MEDIOS DE SEPARACION, EN DONDE UN LIQUIDO DE LA INFUSION QUE CONTIENE UNA EMULSION...

  17. 17.-

    PREPARACION DE INMUNOGLOBULINAS PARA INYECCION INTRAVENOSA APTA PARA SER ALMACENADA A TEMPERATURA AMBIENTE.

    (03/2003)
    Inventor/es: HIRAO, YUTAKA, YOSHITOMI PHARMACEUTICAL IND., HASHIMOTO, MOTONORI, YOSHITOMI PHARMACEUTICAL IND., KITAMURA, TAE, YOSHITOMI PHARMACEUTICAL IND., UEMURA,YAHIRO, YOSHITOMI PHARMACEUTICAL IND. Clasificación: A61K39/395, C07K16/06.

    LA INVENCION SE REFIERE A UN PROCEDIMIENTO PARA PRODUCIR UNA PREPARACION DE INMUNOGLOBULINA PARA INYECCION INTRAVENOSA, QUE COMPRENDE LOS SIGUIENTES PASOS: FRACCIONAR UNA SOLUCION QUE CONTIENE INMUNOGLOBULINA CON ENTRE UN 4 Y UN 10 % EN PESO DE GLICOL DE POLIETILENO QUE TIENE UN PESO MOLECULAR DE ENTRE 1,000 Y 10,000, CON UN VALOR DE PH DE ENTRE 4.5 Y 6.5, UNA FUERZA IONICA DE ENTRE 0.0001 Y 0.1 M Y UNA TEMPERATURA DE ENTRE 0 Y 4°C PARA RECUPERAR UNA FRACCION SOBRENADANTE CON UN PH DE ENTRE 3.5 Y 5.0.

  18. 18.-

    PROCEDIMIENTO PARA PRODUCIR SEROALBUMINA HUMANA.

    (02/2003)
    Inventor/es: KOBAYASHI, KAORU, TOMOMITSU, KENJI, KUWAE, SHINOBU, OHYA, TOMOSHI, OHDA, TOYOO. Clasificación: C12P21/02.

    UN PROCESO PARA PRODUCIR ALBUMINA RECOMBINANTE DE SUERO HUMANO (HSA) QUE COMPRENDE CULTIVAR UN ANFITRION QUE PRODUZCA HSA PREPARADO MEDIANTE TECNICAS DE MANIPULACION GENETICA A UNA TEMPERATURA DE DESDE 21 A 29 GRADOS C. CULTIVAR EL ANFITRION QUE PRODUCE HSA A TAL CONDICION ESPECIFICA DE TEMPERATURA HACE POSIBLE AUMENTAR LA PRODUCTIVIDAD DE LA PRODUCCION DE HSA, MEJORAR EL CRECIMIENTO ARROJADO DE UN ANFITRION QUE PRODUCE HSA Y REDUCIR EL GRADO DE COLORACION EN LA PREPARACION HSA.

  19. 19.-

    METODO PARA PURIFICAR EN GRAN MEDIDA SEROALBUMINA HUMANA.

    (12/2002)
    Inventor/es: FULUHATA, NAOTO, THE GREEN CROSS CO., SUMI, KINORI, THE GREEN CROSS CO., OHMURA, TAKAO, THE GREEN CROSS CO. Clasificación: C07K1/00.

    SE PREVE UN METODO PARA PURIFICAR ALTAMENTE ALBUMINA DE SUERO HUMANO (HSA) QUE CONSISTE EN LLEVAR UNA FRACCION QUE CONTIENE HSA PRODUCIDO POR MANIPULACION GENETICA EN CONTACTO CON UN VEHICULO DE CROMATOGRAFIA DE QUELATO QUE TIENE IONES DE COBRE COMBINADOS CON ESTE, Y ELUDIR EL HSA ABSORBIDO SOBRE EL VEHICULO USANDO UN TAMPON QUE TIENE UN PH DE 5 A 7 Y QUE CONTIENE CLORURO DE AMONIO COMO ANTAGONISTA. ESTE METODO PUEDE PREVER UN HSA ALTAMENTE PURO LIBRE DE COMPONENTE E ORIGEN DE LEVADURA QUE HAN SIDO DIFICILES DE ELIMINAR SATISFACTORIAMENTE POR EL METODO CONVENCIONAL DE PURIFICACION DE HSA PRODUCIDO POR MANIPULACION GENETICA.

  20. 20.-

    COMPUESTO DE BENCENO Y USO MEDICINAL DEL MISMO.

    (09/2002)

    UN COMPUESTO DE BENCENO DE LA FORMULA EN DONDE CADA SIMBOLO ES COMO SE DEFINIA EN LA ESPECIFICACION; UN ISOMERO OPTICAMENTE ACTIVO O SAL DEL MISMO, UNA COMPOSICION MEDICINAL QUE CONTIENE EL MISMO, Y UN INMUNOSUPRESOR QUE CONTIENE EL MISMO COMO EL INGREDIENTE ACTIVO. EL COMPUESTO, ISOMERO OPTICAMENTE ACTIVO O SAL TIENE UN EXCELENTE EFECTO INMUNOSUPRESOR Y ES UTIL COMO UN INHIBIDOR PARA LA REACCION DE RECHAZO QUE OCURRE EN TRASPLANTE DE ORGANOS O DE MEDULA OSEA, Y COMO UN PREVENTIVO O REMEDIO PARA REUMATISMO ARTICULAR, ECZEMA ATOPICO (DERMATITIS), ENFERMEDAD DE BEHET, ENFERMEDAD UVEAL, LUPUS ERITEMATOSO SISTEMICO, SINDROME DE SJOGREN, ESCLEROSIS MULTIPLE, MIASTENIA GRAVIS,...

  21. 21.-

    PROMOTOR AOX2 MUTANTE, VECTOR PORTADOR DEL MISMO, TRANSFORMANTE, Y PRODUCCION DE PROTEINA HETEROLOGA.

    (08/2002)

    LA APLICACION COMPRENDE UN PROMOTOR AOX2 MUTANTE OBTENIDO POR MUTACION DE UNA SECUENCIA DEL PROMOTOR AOX2 NATURAL DE MANERA A COMPRENDER AL MENOS UNO DE LOS TRES MODOS DE UNA REGION QUE SE EXTIENDE CORRIENTE ARRIBA DESDE EL NUCLEOTIDO 1187 INCLUSIVO Y QUE COMPRENDE AL MENOS NUCLEOTIDOS 845-960 SE SUPRIME (A) NUCLEOTIDO(S) SE SUSTITUYE(N) EN (A) REGION(ES) DE NUCLEOTIDOS 1274-1314 Y SE INSERTAN NUEVO(S) NUCLEOTIDA(S) EN (A) REGION(ES) DE NUCLEOTIDOS 1274-1314; VECTORES QUE LLEVAN DICHO PROMOTOR AOX2 MUTANTE; SE HAN INTRODUCIDO TRANSFORMANTES DENTRO DE DICHO VECTOR ; Y METODOS PARA PRODUCIR UNA PROTEINA HETEROLOGA QUE COMPRENDEN...

  22. 22.-

    PROCEDIMIENTO PARA LA PREPARACION DE ALBUMINA SERICA HUMANA RECOMBINANTE.

    (08/2002)
    Inventor/es: NODA, MUNEHIRO, SUMI, AKINORI, OHMURA, TAKAO, YOKOYAMA, KAZUMASA, OHTANI, WATARU, FULUHATA, NAOTO, TAKESHIMA, KAZUYA, KAMIDE, KAEKO, ISHIKAWA, SYOICHI, OOHARA, KAZUHIRO. Clasificación: C12N15/14, C07K1/14.

    LA ALBUMINA DEL SUERO HUMANO OBTENIDA MEDIANTE TECNICAS DE MANIPULACION GENETICA SE PUEDE PURIFICAR MEDIANTE UNA COMBINACION DE PASOS ESPECIFICOS EN QUE UN CULTIVO FLOTANTE OBTENIDO DE UN HUESPED PRODUCTOR DE LA ALBUMINA DEL SUERO HUMANO SE SOMETE A UNA ULTRAFILTRACION, A UN TRATAMIENTO DE CALOR, A UN TRATAMIENTO ACIDO Y A OTRA ULTRAFILTRACION SEGUIDO DE TRATAMIENTOS SUBSIGUIENTES CON UN CAMBIADOR DE CATIONES, UN PORTADOR DE UNA CORMATOGRAFIA HIDROFOBICO Y UN CAMBIADOR DE IONES Y DE UNA DESALACION PARA ASI OBTENER UNA FORMA PURA DE ALBUMINA DEL SUERO HUMANO QUE NO CONTENGA SUSTANCIALMENTE CONTAMINANTES PROTEINICOS NI POLISACARIDOS, QUE SE FORMULA EN UNA PREPARACION FARMACEUTICA. ESTE PROCESO HACE QUE SEA POSIBLE PURIFICAR DE MANERA EFICIENTE LA ALBUMINA DEL SUERO HUMANO RECOMBINANTE Y OBTENER UNA ALBUMINA DEL SUERO HUMANO SUSTANCIALMENTE PURA QUE CON CONTIENE SUSTANCIAS RELACIONADAS CON LOS HUESPEDES PRODUCTORES NI OTROS CONTAMINANTES Y NO TIENE SUSTANCIALMENTE COLOR.

  23. 23.-

    COMPUESTOS DE 1-FENILPIRAZOL Y APLICACIONES MEDICINALES DE LOS MISMOS.

    (05/2002)
    Ver ilustración. Inventor/es: ISHIBUCHI, SEIGO, YOSHITOMI PHAR. IND., LTD., MORIMOTO, HIROSHI, YOSHITOMI PHAR. IND. LTD., FUKUNARI, ATSUSHI, YOSHITOMI PHAR. IND., LTD., INOUE, HIROYOSHI, YOSHITOMI PHAR IND., LTD., NAKA, YOICHI, YOSHITOMI PHAR. IND., LTD. Clasificación: A61K31/415, C07D231/14.

    LA PRESENTE INVENCION SE REFIERE A COMPUESTOS DE 1 - FENILPIRAZOL REPRESENTADOS POR LA FORMULA : EJEMPLIFICADA POR EL ACIDO 5 - AMINO - 1 -(3 - CIANO - 4 ISOBUTOXIFENIL)PIRAZOL 4 - CARBOXILICO, A UN ISOMERO OPTICO DE DICHOS COMPUESTOS Y A UNA SAL FARMACEUTICAMENTE ACEPTABLE DE LOS MISMOS. DICHOS COMPUESTOS PRESENTAN ACTIVIDAD INHIBITORIA DE LA XANTINA OXIDASA Y SON UTILES COMO AGENTES TERAPEUTICOS PARA ENFERMEDADES, TALES COMO LA HIPERURICACIDEMIA Y LA GOTA.

  24. 24.-

    PREPARACION DE ALBUMINA Y CONSERVACION DE LA MISMA.

    (03/2001)
    Inventor/es: INOUE, MASAHIRO, THE GREEN CROSS COR. YODOGAWA, ITO, HIROKAZU, THE GREEN CROSS CORP. YODOGAWA, TOMIOKA, SHINJI, THE GREEN CROSS CORP. YODOGAWA, YABUSHITA, SADAO, THE GREEN CROSS CORPORATION, IKARIYA, KOEI, THE GREEN CROSS CORPORATION, FURUTA, KOICHI, THE GREEN CROSS CORP. YODOGAWA. Clasificación: A61K38/38, C07K14/76.

    UNA PREPARACION DE ALBUMINA MUY SEGURA QUE SE PUEDE CONSERVAR AL TIEMPO QUE SE EVITA QUE EL ALUMINIO SALGA DEL RECIPIENTE PARA ASI MANTENER EL CONTENIDO DE ALUMINIO A UN NIVEL MUY BAJO. ESTO SE CONSIGUE MANTENIENDO UNA SOLUCION DE ALBUMINA ACUOSA EN UN RECIPIENTE DE VIDRIO BLANDO DESALCALIZADO TRATADO CON, POR EJEMPLO, UN GAS DE DIOXIDO DE AZUFRE O UNA SOLUCION DE SULFATO DE AMONIO EN LUGAR DE UTILIZAR UN RECIPIENTE DE VIDRIO DURO CONVENCIONAL QUE LIBERA ALUMINIO, LO QUE SE PIENSA CREA DIFERENTES ENFERMEDADES TALES COMO LA DEMENCIA DE DIALISIS, ENFERMEDADES OSEAS, ANEMIA HIPOCROMICA O LA ENFERMEDAD DE ALZHEIMER.

  25. 25.-

    METODO PARA SUPRIMIR LA COLORACION DE LA ALBUMINA SERICA HUMANA.

    (02/2001)
    Inventor/es: SUMI, AKINORI, OHMURA, TAKAO, YOKOYAMA, KAZUMASA, OHTANI, WATARU, TAKESHIMA, KAZUYA, KAMIDE, KAEKO, FURUHATA, NAOTO. Clasificación: C07K14/765, C12P21/02, C12N15/14.

    UN METODO PARA SUPRIMIR LA COLORACION DE LA ALBUMINA DEL SUERO HUMANO EXPRESADO MEDIANTE TECNICA GENETICA, QUE COMPRENDE EL CULTIVO Y/O DEPURACION, EN PRESENCIA DE UN COMPUESTO DE AMINAS, SELECCIONADAS DEL GRUPO FORMADO POR ALQUILAMINAS, DIAMINAS, GUANIDINAS, BENZAMIDINAS, ACIDOS AMINOBASICOS Y ACIDOS AMINOFENILACETICOS. DE CONFORMIDAD CON LA PRESENTE INVENCION, LA COLORACION DE HSA EXPRESADA MEDIANTE TECNICA GENETICA PUEDE SUPRIMIRSE DESDE UN SEGUNDO A UNA DECIMA, SIN TRATAMIENTO PARA LA SUPRESION DE LA COLORACION. ADEMAS, HSA PUEDE RECUPERARSE EN GRANDES PRODUCCIONES, Y EL TRATAMIENTO DE LA INVENCION NO AFECTA A LAS PROPIEDADES INHERENTES DEL HSA.

  26. 26.-

    PROCEDIMIENTO PARA LA ESTERILIZACION DE UNA COMPOSICION FARMACEUTICA QUE CONTIENE ALBUMINA SERICA HUMANA RECOMBINANTE.

    (11/2000)
    Inventor/es: KOBAYASHI, KAORU THE GREEN CROSS CORPORATION, TOMOMITSU, KENJI THE GREEN CROSS CORPORATION, KUWAE, SHINOBU THE GREEN CROSS CORPORATION, OHYA, TOMOSHI THE GREEN CROSS CORPORATION, OHDA, TOYOO THE GREEN CROSS CORPORATION, OHMURA, TAKAO THE GREEN CROSS CORPORATION. Clasificación: A61L2/04.

    UNA PREPARACION FARMACEUTICA DE ALBUMINA DE SUERO HUMANO RECOMBINANTE (RHSA) ES ESTERILIZADA AL SOMETER UNA PREPARACION FARMACEUTICA O RHSA OBTENIDA POR TECNICAS DE MANIPULACION DE GENES EMPAQUETADOS EN UN CONTENEDOR CON UNA UNIDAD DE ADMINISTRACION PARA TRATAMIENTO DE CALOR ENTRE 50 Y 80 C DURANTE 30 MINUTOS O MAS. POR EL METODO DESCRITO, EL RHSA QUE TIENE ELEVADA SEGURIDAD PUEDE ESTAR PROVISTO DESDE QUE LOS MICROORGANISMOS CONTAMINADOS EN LAS PREPARACIONES FARMACEUTICAS RHSA SE EXTINGUEN COMO UN RESULTADO DEL METODO DE ESTERILIZACION DE LA PRESENTE INVENCION.

  27. 27.-

    COMPUESTO DE 4-AMINO(ALQUIL)CICLOHEXAN-1-CARBOXAMIDA Y USO DEL MISMO.

    (10/2000)
    Inventor/es: ARITA, M., YOSHITOMI PHARMACEUTICAL IND. LTD., SAITO, T., YOSHITOMI PHARMACEUTICAL IND. LTD., OKUDA, H., YOSHITOMI PHARMACEUTICAL IND. LTD., SATO, H., YOSHITOMI PHARMACEUTICAL IND. LTD., UEHATA, M., YOSHITOMI PHARMACEUTICAL IND. LTD. Clasificación: A61K31/505, A61K31/435, C07D213/75, C07D487/04, C07D231/38, C07D495/04, C07D471/04, A61K31/415, C07D239/48, C07D473/16.

    UN COMPUESTO 4 DA REPRESENTADO POR LA FORMULA GENERAL (I), UN ISOMERO CONSIGUIENTE Y UNA ACIDO MAS SAL ACEPTABLE FARMACEUTICAMENTE, DONDE CADA SIMBOLO ES COMO SE DEFINE EN LA ESPECIFICACION. ESTAS SUSTANCIAS CON UNA RESEÑABLE ACTIVIDAD ALTAMENTE PERSISTENTE Y DE BAJA TOXICIDAD PARA AUMENTAR EL FLUJO SANGUINEO EN ARTERIAS CORONARIAS, CEREBRALES, RENALES Y PERIFERICAS, Y SON UTILES COMO UN POTENTE Y PERSISTENTE HIPOTENSOR Y MEDICAMENTO PARA EVITAR Y TRATAR ENFERMEDADES DE UN SISTEMA CARDIOVASCULAR TAL COMO ARTERIAS CORONARIAS, CEREBRALES, RENALES Y PERIFERICAS. ADEMAS, SON UTILES COMO ANTIASMATICO DADO QUE TIENE ACTIVIDADES DE INHIBICION DEL ASMA DEL COCHINILLO DE INDIAS EXPERIMENTAL CAUSADA POR LA INHALACION DE HISTAMINA Y CONTRACCION INHIBIDORA DE UN ESPECIMEN DE TRAQUEA EXTIRPADA A UN COCHINILLO DE INDIAS OCASIONADA POR ACETILCOLINA.

  28. 28.-

    RECIPIENTE QUE CONTIENE UN LIQUIDO DE TRANSFUSION, Y LIQUIDO DE TRANSFUSION PREPARADO.

    (08/2000)

    UN PAQUETE DE LIQUIDO DE TRANSFUSION (ENVASE QUE CONTIENE LIQUIDO DE TRANSFUSION) UTIL PARA PREPARAR UN LIQUIDO DE TRANSFUSION COMPUESTO POR AZUCAR, AMINOACIDOS, ELECTROLITOS, EMULSION DE GRASAS Y VITAMINAS. LA PRESENTE INVENCION UTILIZA UN ENVASE DISEÑADO DE MANERA QUE SU INTERIOR ESTA DIVIDIDO EN DOS COMPARTIMIENTOS INDEPENDIENTES A TRAVES DE UN MEDIO DE SEPARACION. LA PRIMERA CAMARA CONTIENE EL LIQUIDO DE TRANSFUSION CON LA EMULSION DE GRASAS, AZUCAR, LAS VITAMINAS SOLUBLES EN GRASAS Y VITAMINAS ESPECIFICAS SOLUBLES EN AGUA. LA SEGUNDA CAMARA CONTIENE UN LIQUIDO DE TRANSFUSION QUE CONTIENE...

  29. 29.-

    MICROESFERA DE LIBERACION SOSTENIDA QUE CONTIENE UN ANTIPSICOTICO Y PROCEDIMIENTO DE PRODUCCION.

    (06/2000)
    Inventor/es: KINO, SHIGEMI, YOSHITOMI PHARMACEUTICAL IND. LTD., OSAJIMA, TOMONORI, YOSHITOMI PHARMAC. IND. LTD., MIZUTA, HIROAKI, YOSHITOMI PHARMACEUTICAL IND. LTD. Clasificación: A61K31/445, A61K9/16.

    UNA MICROESFERA DE LIBERACION SOSTENIDA PRODUCIDA ENCERRANDO UN ANTIPSICOTICO HIDROFOBICO TAL COMO BROMOPERIDOL O HALOPERIDOL EN UNA BASE QUE COMPRENDE UN POLIMERO BIOCOMPATIBLE TAL COMO ACIDO POLILACTICO O UN COPOLIMERO DE ACIDO LACTICO/ACIDO GLICOLICO. PUEDE EXHIBIR UN DESEADO EFECTO FARMACOLOGICO, DONDE ES NECESARIA UNA ADMINISTRACION DE LARGA DURACION, INYECTANDO DE 1 A 8 SEMANAS, UNA VEZ POR SEMANA, EN LUGAR DE CADA DIA. COMO UN RESULTADO, PUEDE SER ESPERADA UNA IMPORTANTE MEJORA EN LA TOLERANCIA DURANTE TERAPIA SOSTENIDA. ADICIONALMENTE, EL USO DEL POLIMERO BIOCOMPATIBLE SIRVE PARA DISTRIBUIR INTEGRAMENTE CON OPERACIONES QUIRURGICAS TALES COMO IMPLANTACION, FACILIDADES HIPODERMICAS E INYECCION INTRAMUSCULAR JUSTO COMO EL CASO DE INYECCION PROLONGADA, Y SE PUEDE DISPENSAR CON EXTRACCION DE LA MICROESFERA. ADEMAS, LA MICROESFERA PUEDE SER ADMINISTRADA CON POCA AVERSION Y DOLOR.

  30. 30.-

    FARMACO PARA TRATAR UNA ENFERMEDAD AUTOINMUNE.

    (06/2000)

    UN AGENTE INMUNOSUPRESOR, UN REMEDIO PARA UNA ENFERMEDAD AUTOINMUNE, UN POTENCIADOR DE INMUNOSUPRESION, Y UN INHIBIDOR DE ADHESION CELULAR QUE CONTIENE CADA UNO UN COMPUESTO DE TIENOTRIAZOLODIACEPINA CON UN ANILLO DE DIACEPINA ALQUILADA EN POSICION 2 COMO INGREDIENTE ACTIVO DE INMUNOSUPRESION, TRATAMIENTO DE ENFERMEDADES AUTOINMUNES, PREVENCION DE LA INMUNOSUPRESION EN INHIBICION DE LA ADHESION CELULAR COMPRENDIENDO CADA UNO LA ADMINISTRACION DEL COMPUESTO ANTERIOR; Y EL USO DE DICHO COMPUESTO PARA PRODUCIR LAS DROGAS ANTERIORES. 4-(2-CLOROFENIL)-6, 9-DIMETIL-6H-TIENO [3,2-F][1,2,4] TRIAZOLO-4,3-A] [1,4] DIACEPINA, MORFOLIDO DE 3-[4-(2-CLOROFENIL)-6 , ACIDO9-DIMETIL-6H-TIENO [3,2-F] [1,2,4]TRIAZOLO [4,3-A] [1,4]-DIAZEPIN-2-IL)...

  31. 31.-

    USO DE DERIVADOS DE DIHIDROPIRIDINA PARA LA PROFILAXIS O EL TRATAMIENTO DE TRASTORNOS DE LA CIRCULACION CEREBRAL.

    (05/2000)
    Inventor/es: UCHIDA, TAKESHI THE GREEN CROSS CORP., OHTAKI, YUTAKA THE GREEN CROSS CORP., WATANABE, MASAHIRO THE GREEN CROSS CORP., ASHIMORI, ATSUYUKI THE GREEN CROSS CORP., FUKAYA, CHIKARA THE GREEN CROSS CORP. Clasificación: A61K31/495.

    UNA COMPOSICION CEREBRAL HIPERQUINERICA QUE CONTIENE COMO INGREDIENTE EFECTIVO AL MENOS UN DERIVADO DE DIHIDROPIRIDINA DE LA FORMULA(I), DONDE R1, R2 Y R3 IGUALES O NO SON INDEPENDIENTMENTE UN ALQUILO, CICLOALQUILO O UN ALCOXIALQUILO, R4 Y R5 IGUALES O NO , SON INDEPENDIENTEMENTE UN H UN HALOGENO, NITRO UN ALQUILO HALOGENADO, UN ALQUILSULFONILO, UN ALCOXI HALOGENADO, UN ALQUILSULFINILO, CIANO; X ES VINILENO Y AR ES UN FENILO, QUE PUEDE SER SUSTITUIDO O UNA SAL DE ADICION ACIDA EN CANTIDAD EFECTIVA.

  32. 32.-

    COMPUESTO DE TIENODIAZEPINA Y SU USO.

    (03/2000)
    Inventor/es: NAKA, YOICHI, YOSHITOMI PHARMACEUTICAL IND. LTD., HAGA, KEIICHIRO, YOSHITOMI PHARMACEUTICAL IND. LTD, HOSOYA, MASAHIRO YOSHITOMI PHARMACEUTICAL IND. LTD. Clasificación: A61K31/55, C07D495/04, C07D495/14.

    UN COMPUESTO DE TIENODIAZEPINA REPRESENTADO POR LA FORMULA GENERAL (I), UNA SAL FARMACEUTICAMENTE ACEPTABLE DEL MISMO, Y COMPOSICION FARMACEUTICA QUE LO CONTIENE: EN DONDE CADA SIMBOLO ES COMO SE DEFINE EN EL TEXTO DE LA ESPECIFICACION. EL COMPUESTO EJERCE UNA EXCELENTE ACCION INHIBIDORA SOBRE LA COLECISTOQUININA Y LA GASTRINA Y TIENE UNA ACTIVIDAD POTENTE Y PERSISTENTE PARA INHIBIR LA SECRECION DE LA ENZIMA PANCREATICA Y DEL ACIDO CLORHIDRICO EN EL ESTOMAGO. POR LO TANTO ES MUY UTIL COMO MEDICINA QUE ACTUA SOBRE EL SISTEMA NERVIOSO CENTRAL Y PERIFERICO Y COMO MEDICINA PARA LA PREVENCION O TRATAMIENTO DE ALTERACIONES PANCREATICAS Y ULCERAS GASTROINTESTINALES. ADEMAS ES UTIL COMO FARMACO ANTIDEMENCIAL PORQUE SE SUPONE QUE DESARROLLA UNA ACCION ANTIDEMENCIAL BASADA EN LA ACCION INHIBIDORA DE LA COLECISTOQUININA.

1 · > · >>