18 patentes, modelos y diseños de NEXSTAR PHARMACEUTICALS, INC.

  1. 1.-

    LIGANDOS DE ACIDO NUCLEICO DE AFINIDAD ELEVADA DE LA PROTEINA C5 DEL SISTEMA DE COMPLEMENTO

    (09/2010)

    Ligando de ácido nucleico que se une específicamente y con afinidad elevada a la proteína C5 del Sistema de Complemento y que es un inhibidor de la división de la proteína C5 en C5a y c5b, en el que dicho ligando comprende la secuencia: CGCCGCGGUCUCAGGCGCUGAGUCUGAGUUUACCUGCG o una secuencia que tiene un grado de homología primaria de secuencia superior a un 80%

  2. 2.-

    COMPLEJOS DE LIGANDOS DE ACIDO NUCLEICO

    (04/2010)

    ESTA INVENCION DESCRIBE UN PROCEDIMIENTO PARA PREPARAR UN COMPLEJO TERAPEUTICO O DE DIAGNOSTICO FORMADO POR UN LIGANDO DE ACIDO NUCLEICO Y UN COMPUESTO LIPOFILO O UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO, MEDIANTE LA IDENTIFICACION DE UN LIGANDO DE ACIDO NUCLEICO POR LA METODOLOGIA SELEX Y LA ASOCIACION DEL LIGANDO DE ACIDO NUCLEICO CON UN COMPUESTO LIPOFILO O UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO. LA INVENCION ADEMAS DESCRIBE COMPLEJOS FORMADOS POR UNO O MAS LIGANDOS DE ACIDO NUCLEICO ASOCIADOS CON UN COMPUESTO LIPOFILO O CON UN COMPUESTO DE ELEVADO PESO MOLECULAR NO INMUNOGENICO

  3. 3.-

    LIGANDOS DE ACIDO NUCLEICO QUE SE UNEN A LAS ADN POLIMERASAS Y LAS INHIBEN

    (06/2009)
    Ver ilustración. Inventor/es: GOLD, LARRY, JAYASENA,SUMEDHA. Clasificación: C12Q1/68, C07H21/04, C12P19/34.

    ESTA INVENCION PRESENTA LIGANDOS DE OLIGONUCLEOTIDOS DE ALTA AFINIDAD POR LA POLIMERASA TAQ TERMOESTABLE Y LA POLIMERASA TTH. ESPECIFICAMENTE, ESTA INVENCION PRESENTA LIGANDOS DE ADN CON CAPACIDAD PARA UNIRSE A LAS POLIMERASAS TAQ Y TTH Y LOS METODOS PARA OBTENER DICHOS LIGANDOS. LOS LIGANDOS SON CAPACES DE INHIBIR LAS POLIMERASAS A TEMPERATURA AMBIENTAL.

  4. 4.-

    LIGANDOS DE OLIGONUCLEOTIDOS DE ALTA AFINIDAD A PDGF.

    (06/2007)
    Inventor/es: TOOTHMAN, PENELOPE, J., GOLD, LARRY, JANJIC, NEBOJSA, RINGQUIST, STEVEN, PAGRATIS, NIKOS. Clasificación: C12Q1/68, C12P19/34.

    SE DESCRIBEN METODOS PARA LA IDENTIFICACION Y PREPARACION DE LIGANDOS DE ACIDO NUCLEICO DE ELEVADA AFINIDAD POR TGF BE}, PDGF Y HKGF. SE INCLUYEN EN LA INVENCION LIGANDOS DE RNA Y SSDNA ESPECIFICOS PARA TGF BE}1 Y PDGF IDENTIFICADOS MEDIANTE EL METODO SELEX. SE INCLUYEN ASIMISMO EN LA INVENCION LIGANDOS DE RNA ESPECIFICOS A HKGF IDENTIFICADOS MEDIANTE EL METODO SELEX. SE INCLUYEN ADICIONALMENTE LIGANDOS DE RNA QUE INHIBEN LA INTERACCION DE TGF BE}1 Y HKGF CON SUS RECEPTORES Y LIGANDOS DE DNA QUE INHIBEN LA INTERACCION DE PDGF CON SU RECEPTOR.

  5. 5.-

    PROCEDIMIENTOS DE USO DE LIGANDOS DE ACIDO NUCLEICO.

    (10/2006)
    Inventor/es: GOLD, LARRY, TUERK, CRAIG. Clasificación: C07H21/00, C12Q1/68, C12P19/34.

    UN ACIDO NUCLEICO QUE OCURRE DE FORMA NO NATURAL QUE TIENE UNA AFINIDAD DE UNION ESPECIFICA O FUNCION CATALITICA PARA UNA MOLECULA DIANA, DICHA MOLECULA DIANA SIENDO DIFERENTE A UN POLINUCLEOTIDO QUE SE UNE A DICHO ACIDO NUCLEICO A TRAVES DE UN MECANISMO QUE DEPENDE PREDOMINANTEMENTE DE UN EMPAREJAMIENTO DE BASE DE WATSON/CRICK O UNION DE TRIPLE HELICE Y DICHO ACIDO NUCLEICO NO SIENDO UN ACIDO CONOCIDO DE UNION A UNA PROTEINA DIANA DE UNION A ACIDO NUCLEICO QUE OCURRE DE FORMA NATURAL.

  6. 6.-

    COMPLEJOS DE LIGANDO DE ACIDO NUCLEICO DE FACTOR DE CRECIMIENTO ENDOTELIAL VASCULAR (VEGF).

    (09/2006)
    Inventor/es: GOLD, LARRY, JANJIC, NEBOJSA, SCHMIDT, PAUL, G., VARGEESE, CHANDRA, WILLIS, MICHAEL. Clasificación: A61K31/70, C12Q1/68, A61K47/48, C07H21/02, C07H21/04, C12P19/34.

    ESTA INVENCION SE REFIERE A UN PROCEDIMIENTO PARA PREPARAR UN COMPLEJO QUE COMPRENDE UN LIGANDO DE ACIDO NUCLEICO DE VEGF Y UN COMPUESTO NO INMUNOGENO DE BASE MOLECULAR ALTA O UN COMPUESTO LIPOFILO, IDENTIFICANDO UN LIGANDO DE ACIDO NUCLEICO VEGF MEDIANTE LA METODOLOGIA DE SELEX Y ASOCIANDO EL LIGANDO DE ACIDO NUCLEICO VEGF CON UN COMPUESTO DE PESO MOLECULAR ELEVADO, NO INMUNOGENICO O UN COMPUESTO LIPOFILICO. ESTA INVENCION SE REFIERE ADEMAS A UNOS COMPLEJOS QUE COMPRENDEN UNO O MAS LIGANDOS DE ACIDO NUCLEICO VEGF EN ASOCIACION CON UN COMPUESTO DE PESO MOLECULAR ALTO, NO INMUNOGENICO O UN COMPUESTO LIPOFILICO. ESTA INVENCION INCLUYE TAMBIEN UN ELEMENTO LIPIDO QUE COMPRENDE UN COMPLEJO O LIGANDO DE ACIDO NUCLEICO VEGF Y PROCEDIMIENTOS PARA SU FABRICACION.

  7. 7.-

    LIGANDOS DE ACIDO NUCLEICO Y PROCEDIMIENTO DE PRODUCCION.

    (08/2006)
    Inventor/es: JANJIC, NEBOJSA, TUERK, CRAIG, GOLD, LARRY M., TASSET, DIANE. Clasificación: C12Q1/68, C07H21/02, C07H21/04, C12P19/34.

    LA PRESENTE INVENCION INCLUYE METODOS PARA LA IDENTIFICACION Y PRODUCCION DE LIGANDOS DE ACIDO NUCLEICO MEJORADO BASADOS EN EL PROCESO SELEX. TAMBIEN SON INCLUIDOS LOS LIGANDOS DE ACIDO NUCLEICO AL HIV-RT, HIV-1 REV, HIV-1 TAT, TROMBINA, Y PROTEINAS DE FACTOR DE CRECIMIENTO DE FIBROBLASTOS BASICO.

  8. 8.-

    VESICULAS DE VINCA ALCALOIDES CON MEJOR EFICACIA Y PROPIEDADES DE DIRECCION A TUMORES.

    (01/2004)
    Inventor/es: FORSSEN, ERIC, COX, GERRY W., HAIR, DENNISS. Clasificación: A61K9/127, A61K31/475.

    SE PRESENTA UNA FORMULACION DE LIPOSOMAS QUE CONTIENE UN ALCALOIDE DE PERVINCA Y UN ANION EN UNA FASE ACUOSA DEL LIPOSOMA. EL LIPOSOMA TAMBIEN COMPRENDE COLEINA DE DISTEAROILFOSFATIDIL , COLESTEROL Y DISTEAROILFOSFATIDILGLICEROL. TAMBIEN SE PRESENTA UN METODO PARA MEJORAR LA EFICACIA Y LAS PROPIEDADES DE OBJETIVACION DE TUMORES DE FORMULACIONES DE ALCALOIDES DE PERVINCA LIPOSOMIALES QUE CONTIENEN VESICULAS UNILAMINARES.

  9. 9.-

    METODO DE CICLOTRIMERIZACION DE ALQUINOS EN DISOLUCIONES ACUOSAS

    (05/2003)
    Ver ilustración. Inventor/es: EATON, BRUCE, SIGMAN, MATTHEW, S. Clasificación: C07C33/26.

    LA INVENCION SE REFIERE A UN METODO MEJORADO PARA LA REACCION DE [2+2+2] CICLOTRIMERIZACION EN DISOLUCIONES ACUOSAS, UTILIZANDO UN CATALIZADOR DE UN METAL DE TRANSICION HIDROSOLUBLE.

  10. 10.-

    NUEVOS DERIVADOS DEL ACIDO FOSFONICO CON ACTIVIDAD ANTIVIRICA.

    (04/2002)
    Inventor/es: HOSTETLER, KARL, Y., KUMAR, RAJ. Clasificación: C07F9/40, A61K9/127.

    SE PRESENTAN PROFARMACOS CON CONTENIDO LIPIDICO QUE SE SUMINISTRAN PARA EL TRATAMIENTO DE INFECCIONES VIRALES PRODUCIDAS POR HERPES, GRIPE, HEPATITIS, B, VIRUS DE EPSTEIN-BARR, Y VIRUS VARICELAZOSTER, ASI COMO CITOMEGALOVIRUS Y DERIVADOS DE AGENTES ANTIVIRALES. LOS COMPUESTOS ESTAN FORMADOS POR FOSFONOACIDOS CON ACTIVIDAD ANTIVIRAL QUE ESTAN LIGADOS, O BIEN A TRAVES DEL GRUPO FOSFATO O EL GRUPO CARBOXIL DEL FOSFONOACIDO, A UNO DE UN GRUPO SELECCIONADO DE LIPIDOS. EL ACIDO FOSFONOACETICO Y EL ACIDO FOSFONOFORMICO ESTAN POR LO TANTO LIGADOS A LOS FOSFOLIPIDOS, GLICEROLIPIDOS, ESFINGOLIPIDOS, GLICOLIPIDOS, O ACIDOS GRASOS. EL COMPUESTO PERSISTE, TRAS HIDROLISIS INTRACELULAR, AL IGUAL QUE LOS FOSFONOACIDOS ANTIVIRALES. LOS PROMEDICAMENTOS CON LIPIDOS SON EFECTIVOS EN LA MEJORA DE LA EFICACIA ANTIVIRAL DE LOS FOSFONOACIDOS PROLONGANDO SU ACTIVIDAD ANTIVIRAL TRAS SU ADMINISTRACION.

  11. 11.-

    DERIVADOS LIPIDICOS DE NUCLEOSIDOS ANTIVIRALES, INCORPORACION LIPOSOMICA Y METODO DE USO.

    (01/2001)

    SE DESCRIBEN COMPUESTOS PARA TRATAR EL SIDA, HERPES Y OTRAS INFECCIONES VIRICAS POR MEDIO DE DERIVADOS LIPIDOS DE AGENTES ANTIVIRALES. LOS COMPUESTOS CONSTAN DE ANALOGOS DE NUCLEOSIDOS QUE TIENEN ACTIVIDAD ANTIVIRAL, QUE ESTAN LIGADOS, NORMALMENTE A TRAVES DE UN GRUPO FOSFATO EN LA POSICION 5 DEL RESIDUO DE PENTOSA, A UNO DEL OS GRUPOS DE LIPIDOS ELEGIDOS. LA NATURALEZA LIPOFILA DE ESTOS COMPUESTOS PROPORCIONA VENTAJAS SOBRE EL USO DE LOS ANALOGOS DE NUCLEOSIDOS SOLOS. TAMBIEN HACE POSIBLE INCORPORARLOS A LA ESTRUCTURA LAMINAR DE LIPOSOMAS, YA SOLOS O COMBINADOS CON MOLECULAS...

  12. 12.-

    FORMULACION DE ANTIBIOTICO Y USO PARA INFECCIONES RESISTENTES A FARMACOS.

    (10/1999)
    Inventor/es: HERSCH, EVAN M., PETERSEN, ESKILD A., PROFFITT, RICHARD T., BRACKEN, KEVIN R., CHIANG, SU-MING. Clasificación: A61K9/127, A61K31/71.

    UNA FORMULACION DE AMINOGLICOSIDO LIPOSOMAL QUE CONSTA DE UN LIPIDO NEUTRO, LIPIDOS CARGADOS NEGATIVAMENTE Y UN ESTEROL. LA FORMULACION CONTIENE VESICULAS UNILAMINARES QUE TIENEN UN TAMAÑO MEDIO POR DEBAJO DE 100 NM. SE DESCRIBE UN PROCESO DE FABRICACION DE LIPOSOMAS CONTENIENDO UN AMINOGLICOSIDO DONDE LA TEMPERATURA DE HIDRATACION ESTA SIGNIFICATIVAMENTE POR DEBAJO DE LA TEMPERATURA DE TRANSICION DE LA FORMULACION. UN METODO PARA EL TRATAMIENTO DE BACTERIAS SUSCEPTIBLES Y RESISTENTES AL FARMACO.

  13. 13.-

    LIGANDOS DE ACIDOS NUCLEICOS.

    (02/1998)
    Inventor/es: GOLD, LARRY, TUERK, CRAIG. Clasificación: C12Q1/68, G01N33/566, G01N33/48, C12P19/34, C07H15/12.

    UNA NUEVA CLASE DE COMPUESTOS DE ACIDO NUCLEICO, LLAMADOS ANTICUERPOS DE ACIDO NUCLEICO, HAN DEMOSTRADO EXISTIR Y TENER UNA AFINIDAD DE ENLACE ESPECIFICA A LOS BLANCOS MOLECULARES TRIDIMENSIONALES. EN UN ASPECTO PREFERENTE DE LA INVENCION, LOS COMPONENTES DE LIGANDOS DE LOS ANTICUERPOS DE ACIDO NUCLEICO SE HAN IDENTIFICADO MEDIANTE EL METODO DE LA INVENCION DENOMINADO EVOLUCION SISTEMATICA DE LIGANDOS MEDIANTE ENRIQUECIMIENTO DEL EXPONENCIAL (SELEX), EN DONDE UNA MEZCLA CANDIDATA DE ACIDOS NUCLEICOS SE HA ENRIQUECIDO ITERATIVAMENTE EN ACIDOS NUCLEICOS DE GRAN AFINIDAD Y AMPLIFICADO PARA UNA MAYOR SEPARACION.

  14. 14.-

    TECNICA DE CARGA PARA PREPARAR LIPOSOMAS QUE CONTIENEN FARMACOS.

    (12/1995)
    Inventor/es: FORSSEN, ERIC, A. Clasificación: A61K9/127.

    UN PROCESO PARA CARGA DE DROGAS CATIONICAS, ANIONICAS O IONIZABLES A TRAVES DE MEMBRANAS LIPIDAS BICAPA EN AUSENCIA DE GRADIENTE DE PH COMPRENDE LA FORMACION DE LIPOSOMAS EN UN MEDIO ACUOSO QUE CONTIENE UNA COMBINACION DE, BIEN LA SAL DE UN ANION CON MEMBRANA DE ALTA PERMEABILIDAD Y UN CATION CON MEMBRANA DE BAJA PERMEABILIDAD SI EL COMPUESTO A SER ATRAPADO ES UNA DROGA ANIONICA O TIENE UN POTENCIAL ANIONICO, O BIEN LA SAL DE UN CATION CON MEMBRANA DE ALTA PERMEABILIDAD Y UN ANION CON MEMBRANA DE BAJA PERMEABILIDAD SI EL COMPUESTO A SER ATRAPADO ES UNA DROGA CATIONICA O TIENE POTENCIAL CATIONICO.

  15. 15.-

    METODO PARA LA FORMACION DE VESICULAS.

    (10/1995)
    Inventor/es: BRACKEN, KEVIN R. Clasificación: A61K9/127, B01D1/22.

    SE PRESENTA UN METODO DE RECIPIENTE UNICO PARA PREPARAR LIPOSOMAS EN CANTIDADES COMERCIALES FORMANDO UNA PELICULA DE LIPIDOS HOMOGENEA Y UNIFORME EN UN EVAPORADOR DE PELICULA DELGADA MEDIANTE LA EVAPORACION DEL SOLVENTE ORGANICO, SEGUIDA DE LA HIDRATACION IN SITU DE LA PELICULA EN UNA FASE ACUOSA POR AGITACION CON EL ROTOR.

  16. 16.-

    INHIBICION DE LA REPLICACION VIRICA.

    (08/1995)
    Inventor/es: SCOLARO, MICHAEL, J., SULLIVAN, SEAN, M. Clasificación: A61K31/70, C12N15/11.

    EL SUMINISTRO INTRACELULAR DE UN OLIGONUCLEOTIDO DE ADN CON LA MISMA SECUENCIA QUE UNA CEPA DE ORIGEN VIRAL QUE CODIFICA AL ADN QUE CODIFICA LA PRODUCCION DE UNA PROTEINA REGULADORA VIRAL INHIBE LA REPRODUCCION, EN UNA CELULA, DE UN VIRUS CON UN GENOMA QUE SE INTEGRA EN EL ADN HUESPED DE LA CELULA.

  17. 17.-

    FOSFOLIPIDO ANALOGO A UNA VESICULA CON UNA MITAD SUCINIMIDILA.

    (06/1995)
    Inventor/es: SULLIVAN, SEAN, M. Clasificación: A61K9/127, A61K47/22.

    FORMULACIONES PARA EXCIPIENTE DE SUMINISTRO QUE COMPRENDEN AGENTES ACTIVOS ENCAPSULADOS DENTRO DE MICROPARTICULAS QUE INCLUYEN UNA MITAD SUCINIMIDILA QUE SE EXTIENDE EXTERNAMENTE A PARTIR DE UNA MOLECULA DE LIPIDO Y QUE SON CAPACES DE SUMINISTRAR CELULAS CITOPLASMICAS O NUCLEARES DE AGENTES ACTIVOS ENCAPSULADOS INTACTOS.

  18. 18.-

    VEHICULOS DE LIBERACION CON PRINCIPIO ACTIVO ASOCIADO A ANFIFILA.

    (10/1994)
    Inventor/es: ELEY, CRISPIN GEORGE STEWART, SCHMIDT, PAUL GARDNER, FUJII, GARY. Clasificación: A61K9/50.

    SE DESCRIBEN VEHICULOS DE LIBERACION QUE COMPRENDEN UNA CAPA ENCAPSULANTE BIOCOMPATIBLE, UNA CAPA ASOCIADA A UN PRINCIPIO ACTIVO ANFIFILICO INTERNA Y UN PRINCIPIO ACTIVO. LOS VEHICULOS DE LIBERACION SON BIOCOMPATIBLES Y CAPACES DE SOLUBILIZAR EL PRINCIPIO PARA LIBERACION EN VIVO A TEJIDOS Y OTROS SISTEMAS CORPOREOS. LOS USOS INCLUYEN FORMACION DE IMAGEN EN RMN Y COMO MEDICAMENTO TERAPEUTICO.